KR100580266B1 - DNA Marker for the Clubroot Resistant Gene - Google Patents

Abstract

According to the present invention, there is provided a method for producing a DNA label for a wart disease resistant gene, the method including: selecting an AFLP label indicating a polymorphism between a resistant individual and a diseased individual; Converting the AFLP label to a SCAR label or a CAPS label; And assaying the usefulness of Marker-Assisted Selection of the DNA label identified in the step. Wherein the resistant and pathogenic individuals are homozygous genotypes of wart disease resistant genes, and the selection of clones having the AFLP label is performed using electrophoresis to clones having inserts of the same size as the corresponding AFLP label. Selection is characterized by using a sudden analysis method.

Wart disease, wart resistance gene, AFLP marker, SCAR marker, CAPS marker

Description

DNA marker for wart resistance genes {DNA Marker for the Clubroot Resistant Gene}             

1 is a correlation map of CRb genes based on co-occurrence and dominant AFLP label isolated from F ₂ population.

Figure 2a is the electrophoresis of the chain polymerization reaction of the parent and F ₁ and 16 F ₂ using the primer pair prepared based on the sequence of AFLP label P7.

Figure 2b is the electrophoresis of the chain polymerization reaction of the parent and F ₁ and 16 F ₂ using the primer pair prepared based on the sequence of AFLP label P9.

3 is a band pattern of F ₂ as seen by CAPS label TCR02.

4 is a band pattern of F ₂ shown by SCAR label TCR04.

5 is a band pattern of the F ₂ entity shown by SCAR label TCR08.

6 is a band pattern of the F ₂ entity shown by SCAR label TCR09.

FIG. 7 is a SCAR and CAPS map of the CRb gene based on co-dominant and dominant AFLP label isolated from F ₂ population.

8 shows the results of assaying Chinese cabbage F ₁ hybrids and other varieties with SCAR-labeled TCR01.

9A shows the results of assaying cabbage F ₁ hybrids and other varieties with SCAR-labeled TCR02.

9B shows the results of assaying cabbage F ₁ hybrids and other varieties with SCAR-labeled TCR04. The cabbage varieties 1 to 34 have the same names as in Fig. 9A.

9C shows the results of assaying cabbage F ₁ hybrids and other varieties with SCAR labeled TCR08. The cabbage varieties 1 to 34 have the same names as in Fig. 9A.

9D shows the results of assaying cabbage F ₁ hybrids and other varieties with SCAR-labeled TCR09. The cabbage varieties 1 to 34 have the same names as in Fig. 9A.

9E shows the results of assaying cabbage F ₁ hybrids and other varieties with SCAR labeled TCR09. The cabbage varieties 1 to 34 have the same names as in Fig. 9A.

Field of invention

The present invention relates to DNA labels for wart disease resistant genes. More specifically, the present invention relates to a method for preparing a DNA label associated with a wart-resistant gene and selecting a wart-resistant individual using the same.

Background of the Invention

Warty disease, also called root-knot disease or root disease, is caused by Plasmodiophora brassicae WORON, a type of fungi that are absolute parasites belonging to the root-knotty species of protozoa. Wart disease causes irregular shapes on the roots of cruciferous vegetables, including cabbage, cabbage, broccoli, cauliflower, kale, lampshade, turnips, rapeseed and radishes, weakening or losing the function of the roots, especially acidity below pH 6 Severe outbreaks in soil Plants infected with warts also wither, develop less, and turn yellow.

Warts cause serious loss of cruciferous vegetables as described above, but because the pathogen is dormant spores in the soil, it is difficult to control by chemical treatment. The use of calcium or boron, soil pH control (7.2 or more) and the like, the control effect is weak, the commonly used fungicides only have a local effect, soil steam disinfection has an efficient but expensive problem. Therefore, breeding of resistant varieties may be an effective alternative to wart disease control.

To cultivate wart-resistant varieties, it is necessary to quickly and easily select wart-resistant individuals. In addition, when breeding resistant varieties using selected resistant individuals, it should be possible to promptly check whether resistance genes have been introduced. However, the traditional method of inoculating dormant spores directly into the root or soil (seedling assay) takes a long time to isolate and identify spores, and is inferior in reproducibility due to the health and environment of the inoculated plants. There was a problem.

However, DNA markers, which are being developed rapidly recently, can identify resistant traits without using pathogens, and have the advantage of being able to select plants quickly without being affected by the environment. Widely done (see Kumar, LS, 1999, DNA markers in plant improvement: An overview, Biotechnology Adv. 17: 143-182.).

DNA markers for the selection of resistant individuals to disease represent DNA polymorphisms between resistant and pathogenic individuals and are constructed using loci closely related to the resistant genes. Methods for investigating DNA polymorphism include random amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), or amplified fragment length polymorphism (AFLP). Although RAPD or RFLP has a low polymorphism, it is difficult to identify markers associated with wart resistance genes (Kunfinulei et al. 1997), but AFLP can detect a large number of plant DNA polymorphisms. Suitable for identifying markers associated with wart-resistant genes.

However, AFLP markers (Vos et al.) Are largely available for direct use of Marker-Assisted Selection (MAS) or for map-based cloning due to their high cost and complex manipulations. There are limitations to the population, and attempts have been made to convert them to simple, reliable PCR-based labels such as SCAR labels or CAPS labels. An AFLP label associated with the wart-resistant gene has been identified, which has been converted to a covalent SCAR label (Piao et al. 2002), which is used in the present invention. In addition, AFLP markers associated with the resistance genes of many crops have been identified (Pauquest et al. 2001; Xu et al. 2001; Negi et al. Miftahudin et al. 2002; Li et al. 1998), but the converted markers detect polymorphism. Problems such as failure to do so or amplification of genomic DNA resulted in very few succeeding in converting to SCAR markers (Qu et al. 1998; Bradeen and Smon 1998; Shan et al. 1999).

On the other hand, many studies have been conducted on the wart resistance gene, but since the exact location of the resistance gene is unknown, a closely related marker was developed to detect the position. Recently, Suwabe et al. Reported the two clubroot-resistant (CR) genes Crr1 and Crr2 and their markers in Brassica rapa L. (Suwabe, K. et al., 2003, Theor Appl Genet 107). : 997-1002), Hirai et al. Reported the label for the wart- resistant gene Crr3 (Hirai, M. et al., 2003, Theor Appl Genet). However, no DNA labeling for the wart resistance gene CRb present in CR Shinki according to the present invention has been reported.

In this regard, the present inventors prepared a DNA bulk consisting of a homozygous conjugate using TCR01, which was previously studied in the step of selecting an AFLP label associated with a new anti-wart gene to overcome the above problems; In the step of converting the AFLP label into SCAR (Sequence Characterized Amplified Region) label or CAPS (Cleaved Amplified Polymorphism Sequence) label, which is convenient for use in polymerase chain reaction, electrophoresis and sudden assay for selection of clones with AFLP label. Using; The usefulness of the SCAR label or CAPS label for label utilization selection is to develop a DNA label for the wart-resistant gene.

An object of the present invention is to prepare a DNA label for the wart disease resistant gene.

Another object of the present invention is to easily convert AFLP labels associated with wart disease resistance genes into SCAR labels or CAPS labels.

Another object of the present invention is to facilitate the selection of wart-resistant individuals using DNA labels.

Still another object of the present invention is to quickly determine whether resistance genes are introduced during breeding of wart-resistant varieties.

The above and other objects of the present invention can be achieved by the present invention described below.

Summary of the Invention

Method for producing a DNA label for the wart-resistant gene according to the present invention is (A) extract genomic DNA of resistant and diseased individuals as a template DNA for PCR, using a combination of AFLP primers to perform PCR Electrophoresis to select an AFLP marker indicative of polymorphism between resistant and pathogenic individuals; (B) After separating and cloning the AFLP label in an electrophoretic gel, a clone having an AFLP label was selected, the sequence of the AFLP label was analyzed, and PCR was performed using the primers prepared using the sequence. Performing polymorphism to identify polymorphism between the resistant and the pathogenic entity; (C) assaying the usefulness of Marker-Assisted Selection (MAS) of the DNA label identified in step (B); In the step (A), the resistant individual and the pathological individual are genotypes of the wart-resistant disease genotype, and in step (B), the selection of the clones having the AFLP label is performed by PCR and using electrophoresis. Clones having an insert of the same size as the corresponding AFLP marker are selected and identified by Southern Analysis.

In addition, the method for selecting a wart-resistant object of the present invention is to isolate and purify the DNA of the wart-resistant plant and the plant to be discriminated; Amplifying the plant DNA by polymerase chain reaction in a reaction solution containing Mg ²⁺ ions, Tag DNA polymerase, dNTP and a primer using the purified DNA as a template DNA; Electrophoresis of the amplified DNA, and then confirming SCAR labeling by comparing aspects of DNA bands; Step is made, the primer and SCAR label is characterized in that using the one obtained in the DNA labeling process.

Primers used in the method for selecting wart-resistant individuals according to the SCAR label according to the present invention is selected from a pair of primers consisting of SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, and SEQ ID NO: 9 and 10 It is characterized by. In addition, it is more preferable to overlap the primer pair selected from the group consisting of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, and SEQ ID NO: 9 and 10.

Hereinafter, a method for producing a DNA label for a wart disease resistant gene of the present invention, comprising: (A) identifying an AFLP label associated with a wart disease resistant gene; (B) converting the AFLP label to a SCAR or CAPS label; (C) specifically examines the step of assaying the usefulness of the use of the DNA label for label selection, and the selection method of the wart-resistant individuals according to the present invention is the same as the method used in step (C), (C ) Together. In addition, since the primer used in the method of selecting a wart disease-resistant individual by SCAR label according to the present invention is a result of the method of producing a DNA label for the wart-resistant gene, the above-described step (C) and the embodiment described together do.

Detailed Description of the Invention

(A) Identification of AFLP markers associated with wart-resistant genes

In the present invention, an AFLP technique using BSA (Bulked Segregant Analysis) is used to select an AFLP marker. Brief description of the AFLP technique using the BSA is as follows.

Two groups of hybrids (hereinafter referred to as F ₂ ) are divided into resistant and pathogenic, and then DNA is extracted from resistant and pathogenic individuals, respectively, to form resistant DNA bulk and pathogenic DNA bulk. The genomic DNA of the copy and parent, and the resistant and pathogenic DNA bulk are used as template DNAs, and a polymerase chain reaction (hereinafter, referred to as PCR) is performed by combining AFLP primers. The PCR product is electrophoresed and AFLP markers are selected by examining bands representing polymorphism between resistant and pathogenic individuals.

However, there is a disadvantage in that both homozygous and heterozygous are present in the resistant DNA bulk based on the phenotype without determining the genotype. Therefore, in the present invention, a DNA bulk composed of homozygotes may be prepared using a previously developed SCAR label (Piao et al. 2002), and a label distinguished as dominant or co-dominant may be manufactured by applying AFLP technique thereto.

An association map is prepared to know the relative position and distance of the wart disease resistant gene of the AFLP marker selected using the BLP-applied AFLP technique.

(B) converting AFLP markers to SCAR markers or CAPS markers

AFLP markers are widely used for tagging specific regions of the genome, and are particularly useful for screening DNA markers associated with specific loci, but due to their high cost and complex manipulations, they can be used to select markers or rely on guidance. There is a limit to applying to large groups for cloning and the like. Therefore, the AFLP label selected in step (A) is converted into a SCAR label or CAPS label that is convenient and reliable to use. In addition, a mapping group of the transformed SCAR marker, CAPS marker, and wart resistance gene CRb is prepared to confirm whether the sequence of the AFLP marker is consistent.

In order to convert the AFLP label to the SCAR label, the AFLP label was separated from the electrophoretic gel, cloned, and a clone having the AFLP label was selected. In the process of converting the AFLP label to the SCAR label in the present invention, selecting the exact clone having the sequence of the AFLP label is the most critical factor. To confirm that the clone has an insert of the same size as the AFLP label, plasmid DNA from multiple colonies is isolated and PCR is performed using the optional primer combination of step (A) above. The PCR products were electrophoresed and colonies with inserts of the same size as the corresponding AFLP label were selected using parental and resistant and pathogenic DNA bulk as controls.

Clones of the selected colonies are reconfirmed using Southern Analysis. Sudden assays include a sudden blotting step of electrophoresing the PCR product of the selective primer onto an agarose gel and transferring DNA to a nylon membrane; Placing the blots in the hybridization buffer and hybridizing with the probe; Washing the hybridized membrane with a buffer; And detecting the hybridization signal after exposing the blot to the self-radiating film.

The plasmid DNA sequences of the clones selected in this manner are analyzed and primers are prepared for both terminal sequences of the AFLP label using primer preparation software.

The genomic DNA of resistant and pathogenic individuals was used as a template, and electrophoresis was carried out by PCR with the primers prepared above. When the polymorphism was shown between the two individuals, the AFLP label was converted into a SCAR label.

If the result of the polymerase chain reaction does not show polymorphism between the two individuals, the result of the polymerase chain reaction is cleaved with restriction enzymes, and the fragment is electrophoresed to show polymorphism between the two individuals. It is.

Successfully converted SCAR markers or CAPS markers are assayed for F ₂ plants and used for isolation and mapping. In addition, to determine whether the DNA label and its primers can be used for the selection of wart-resistant individuals, the following assay (C).

(C) Usefulness assay for selection of marker utilization of SCAR marker or CAPS marker

In order to test whether the SCAR label or CAPS label obtained in step (B) can be used for selection of label utilization, the cabbage varieties on the market are tested for wart disease resistance with the SCAR label or CAPS label.

Investigate the presence of wart disease by inoculating a wart strain against cabbage varieties resistant to or infectious to wart disease, and performing PCR with the primer selected in step (B) to compare the detection result of SCAR or CAPS label. By evaluating the usefulness of the markers, the method is as follows.

① Isolation and Purification of DNA

The genome DNA of a plant of the CR Shinki DH strain having the wart resistance gene CRb of the present invention and an individual to determine whether or not the wart disease is separated and purified. The choice of wart resistant individuals is important because their success depends on obtaining high-purity DNA. Methods for isolating and purifying genomic DNA from plants are by conventional methods known in the art.

② DNA amplification by PCR

PCR includes a denaturation step of single-stranding the double strand of template DNA at high temperature; Annealing step of annealing the primer and template DNA at low temperature; And an extension step of synthesizing the complementary strand with respect to the template DNA at medium temperature, and making the double-stranded DNA again (extention step). The method of amplifying exponentially the number of specific DNA fragments.

PCR repeats the above three steps 25 to 35 cycles in a reaction solution consisting of essential elements such as template DNA, Mg ²⁺ ions, Taq polymerase, dNTP, primers (potential primer, inverted primer).

Initial denaturation in the denaturation step is about 5 minutes at 94 ~ 95 ℃, subsequent denaturation is performed in 20 ~ 30 seconds at 94 ~ 95 ℃, it may vary depending on the GC content of the template DNA.

The temperature of the linking step is determined by the Tm value of the primer. If the temperature is too high, the primer is not annealed to the template DNA and no PCR product is produced. If the temperature is too low, non-specific annealing occurs and the correct PCR product is not produced.

In the extension step, DNA polymerization is performed by Taq polymerase, which is performed at 72 ° C., and the extension time varies depending on the length of the template DNA. Therefore, since PCR conditions vary depending on the length and nature of the primers, PCR conditions for each primer of the present invention are shown in Table 9.

③ Detection of SCAR label or CAPS label after electrophoresis

The PCR product of the CR Shinki DH strain and the plant to be discriminated is mixed with a loading dye and then electrophoresed on an agarose gel or a polyacrylamide gel. Electrophoresis results are irradiated under ultraviolet light, or gels are stained and irradiated to check whether the markers of the CR Shinki DH strain appear as bands of the plant to be discriminated.

As a result of assaying various plants with the primers prepared in step (B) in the PCR process, primers determined to be used for selection of label utilization are shown in SEQ ID NOs: 3 to 10. In addition, primers for the existing SCAR label is shown in SEQ ID NO: 1 and 2.

In addition, the method for selecting a wart-resistant individual using a DNA label according to the present invention includes the steps of: ① separating and purifying DNA; ② amplification of DNA by PCR; ③ It is the same as the detection of SCAR label or CAPS label after electrophoresis.

Therefore, the primer is characterized in that selected from the primer pair consisting of SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, and SEQ ID NO: 9 and 10. In addition, the primers are warty disease resistant when using a primer pair selected from the group consisting of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, and SEQ ID NO: 9 and 10 in duplicate. It is more desirable because the individual can be selected very accurately.

The invention may be better understood by the following examples, which are intended for purposes of illustration of the invention and are not intended to limit the scope of protection defined by the appended claims.

Example

Example 1 Identification of AFLP Markers Associated with Wart-Resistant Genes

(a) the disclosure cabbage material

The non-wart disease 94 SK sub-system is used as a copy, and the non-wart disease-resistant system is a CR Shinki DH (doubled haploid, or 'drug-induced resistance') system that has been grown by weakly cultivating CR Shinki. Used. CR Shinki DH flowers grown in the house are removed during germination and cross-pollinate with 94 SK pollen to obtain one hybrid (hereinafter referred to as F ₁ ) seed, which is self-hybridized. Two (hereinafter referred to as F ₂ ) were obtained. In addition, the above F ₁ was backcrossed with a copy to obtain _one backcross (hereinafter referred to as BC ₁ ).

(b) Wart-resistant test

① Separation of dormant spores

In 1998 and 2000, root nodules containing spores of P. brassicae were collected in Pyeongchang, Gangwon-do, Korea. The collected roots were stored at -70 ° C until they were washed with water.

450 ml of distilled water was added per 50 g of frozen diseased tissue, and then ground for 5 minutes at 3,000 rpm with a homogenizer, filtered through three layers of gauze, and again filtered through six layers of gauze. The filtrate was centrifuged at 2,000 rpm for 3 minutes, and then the supernatant was removed and suspended again by adding distilled water to a viscous pale brown precipitate (sleep spore precipitate) and repeating the centrifugation process. The final precipitate obtained after the third centrifugation was suspended in 100 ml of distilled water, and the spore concentration was determined using a hemocytometer to determine the form and size of the bacteria, and stored frozen at -20 ° C. The wart strains isolated as above were named PC98-1, PC98-2 and PC-00, respectively.

② How to inoculate

The spores were inoculated in house in 1998, 2000 and 2001, with the parents F ₁ and F ₂ as PC98-1, PC98-2 and PC-00, BC ₁ as PC-00, Assay. Seeds were sown in a 16-cell multi pot, and the temperature was maintained at 20-25 ° C., 16 hours at day, and cool-white fluorescent (CWF) at night. Three days after germination, 10 ⁶ / ml bacteria were irrigated 10 ml per pot around the roots. About 4 weeks after inoculation, the soil humidity was maintained so that the soil surface of the pot did not dry out. After 40 days of sowing, roots were removed to remove soil, and the incidence of WART disease was examined according to Table 1. Hereinafter, as a result of assaying for the wart strain, individuals with a 0-1 rating were classified as resistant, and individuals with a 3-4 rating were classified as pathogenic.

Rating The incidence of wart disease 0 Not infected One 1-10% of root surface area 2 Root bumps 11-30% of root surface area 3 Root bumps 31-60% of root surface area 4 Root nodules exceed 60% of root surface area

③ Race discrimination

On the other hand, to determine the race of wart strains collected in Pyeongchang, the tested plants according to Williams' classification (Williams 1966) Jersey Queen, Badger Shipper, Laurentian and Whilhelmsburger showed the results as shown in Table 3, According to Williams' classification (Williams 1966), the pathologies of PC98-1, PC8-2 and PC-00 were identified as races 8, 4 and 2.

Standard host plants Wart Disease Race One 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Jersey queen + + + + - + + - - + - + - - - - Badger shipper - + - + - - + - - + + - + + + - Laurentian + + + + - - - + + - + - + - - - Whilhelmsburger + - - + - - - - + + + + - + - +

(+ Indicates pathogenic response to standard host plants,-indicates resistance to standard host plants.)

Standard host plants PC 98-1 PC 98-2 PC 00 NPT NPI NPT NPI NPT NPI Whilhelmsburger 25 0 16 12 14 0 Jersey queen 25 0 9 9 16 15 Badger shipper 21 0 18 14 16 16 Laurentian 20 10 18 18 16 15

(NPT: number of plants tested, NPI: number of infected plants)

Genetic analysis of the wart-resistant genes using the wart strains PC98-1, PC98-2 and PC00 showed that the separation rate of resistant and pathogenic individuals in F ₂ was 3: 1 at 5% significance level. _In group ₁ , resistance and pathogenicity were found to be 1: 1. Therefore, resistance to the warty strain strains 2, 4, and 8 can be seen to be controlled by a single dominant gene, which is named CRb.

race descendants HP IP EHP EIP Significance Ratio (0.5 < P <0.9) PC-00 2 F ₂ 113 37 112.5 37.50 NS 3: 1 BC ₁ 57 55 56 56 NS 1: 1 PC98-2 4 F ₂ 82 22 78 26 NS 3: 1 PC98-1 8 F ₂ 29 14 32.25 10.75 NS 3: 1

(HP: observed value of resistant subject, IP: observed value of diseased subject, EHP: expected value of resistant subject, EIP: expected value of infectious subject, NS: not significance)

(c) BSA method using conventional SCAR label TCR01

To screen for homozygous (homozygous) resistant and pathogenic F ₂ individuals, 40 F ₂ individuals were examined using the co-dominant SCAR-labeled TCR01 (Piao et al. 2002) developed in the previous study. Resistant bulk and pathogenic bulk were prepared by extracting the same concentrations of DNA from 10 resistant and 6 pathogenic individuals, each representing a band of homozygous for the TCR01 label. The parental DNA and the two bulks were used for AFLP analysis with the BSA of (d) below.

Genomic DNA of the parent and 40 F ₂ individuals was extracted with a slight modification of Pierre and Marechal-Drouard (1992). Specifically, 1 g of leaves were ground, prepared as a fine powder, mixed by adding 10 mL of extraction buffer (100 mM sodium acetate pH 4.8, 50 mM EDTA pH 8.0, 500 mM NaCl, soluble PVP 2%). Filtered with 4 layers of gauze and 1 layer of miracloth. The mixture was incubated at 65 ° C. for 30 minutes, centrifuged at 10,000 g for 10 minutes at 25 ° C., and then the supernatant was separated. 1/3 part of 5 M potassium acetate (pH 4.8) was added, mixed and incubated for 30 minutes on ice. After centrifugation at 10,000 g for 10 minutes at 4 ° C, the supernatant was filtered through a layer of miracloth, and 0.6 parts of isopropanol were added to precipitate DNA at -40 ° C for 30 minutes. The supernatant was removed by centrifugation at 10,000 g for 10 minutes. The pellet was washed with 100% ethanol for 1 hour, redissolved in 500 μl of distilled water, and then insoluble material was removed by centrifugation. 0.6 parts of isopropanol was added to precipitate the DNA and centrifuged for 10 minutes at 12,000 rpm. DNA pellet was washed with 70% ethanol, vacuum dried and re-dissolved in sterile water.

(d) AFLP analysis

AFLP analysis was performed using the modified Vos et al. (1995) method.

① cleavage of genomic DNA

0.5 ㎍ of genomic DNA was added to 25 ㎕ of total volume and 5 units of restriction enzymes EcoR I and Tru 9I and 5 units of Pst I and Tru 9I were reacted overnight at 37 ° C.

② Connection of adapter to DNA fragment

After disabling the restriction enzyme in 75 ℃ water it was connected to the DNA fragment cut by the restriction enzyme with each of Eco and Mse RⅠ Ⅰ adapter, Pst Ⅰ and Mse Ⅰ adapter. Mixture for connecting the adapter to the restriction fragments were a Eco RⅠ or Pst Ⅰ adapter 5 pM, Mse Ⅰ adapter 50 pM, 10 ㅧ ligation buffer 2.5 ㎕, and T4 DNA ligase total volume of 25 ㎕ including the kinase 1 unit. The sequence of the adapter is shown in Table 5, and the flanking sequence in the adapter is used as the primer binding site on the restriction fragment.

Restriction enzyme Base sequence of adapter Eco RⅠ 5'-ctcgtagactgcgtacc-3 ' 3'-ctgacgcatggttaa-5 ' Pst Ⅰ 5'-ctcgtagactgcgtacatgca-3 ' 3'-catctgacgcatgt-5 ' Mse I 5'-gacgatgagtcctgag-3 ' 3'-tactcaggactcat-5 '

③ preliminary amplification

The chain polymerization reaction consists of two stages: preamplification and selective amplification. Preliminary amplification is carried out complementary to the adapter sequence with additional selective nucleotides to amplify the DNA in sufficient amounts to be used as a template for selective amplification.

The reaction conditions of the pre-amplification step is Pst Ⅰ (or Eco RⅠ) primer 30 ng, Mse Ⅰ primer 30 ng, 2.5 mM concentration of dNTPs 5 ㎕, 10 ㅧ PCR buffer 2.5 ㎕, Taq DNA polymerase 1 unit, and 10-fold For a total volume of 50 μl solution containing 5 μl of diluted limiting / linking mixture, the denaturation step is 30 times at 94 ° C., the annealing step is 1 minute at 56 ° C., and the extension step is 29 times at 1 minute at 72 ° C. Repeated. Table 6 below shows the sequences of the preliminary amplification primers, wherein the 3 'end of each primer is an optional nucleotide. That is, the selective nucleotides of the primers Eco RⅠ 'a', selective nucleotides at Ⅰ Mse primer is 'c', selective nucleotides at Pst Ⅰ primers is 'g'.

primer order Eco RⅠ 5'-gactgcgtaccaattca-3 ' Pst Ⅰ 5'-gactgcgtacatgcag-3 ' Mse I 5'-gatgagtcctgagtaac-3 '

④ selective amplification

The product of the pre-amplification was diluted 50 times as a template DNA in the selective amplification steps, and the amplification in combination of two AFLP primers (Pst Ⅰ Ⅰ and Mse primers, Eco and Mse RⅠ Ⅰ primer). Each primer optionally contains two nucleotides at the 3 'end of the preliminary amplification primers (Table 7). Therefore, it is respectively possible 256 combinations with Pst Ⅰ Ⅰ and Mse primers, Eco and Mse RⅠ Ⅰ primer. For a total of 512 primer combinations, half consisted of 16 PstI + GNN and 16 MseI + GNN primers, and the other half consisted of 16 EcoRI + ANN and 16 MseI + CNN primers, which were AFLPs associated with wart resistance genes. It was used to identify the marker.

Selective amplification was mixed in total 20 ㎕ containing Eco RⅠ or Pst Ⅰ primer 15 ng, Mse Ⅰ primer 30 ng, dNTPs 2.5 mM, 10 ㅧ PCR buffer 2 ㎕, Taq DNA polymerase 0.4 unit, and a template DNA 5 ㎕ solution For, the denaturation step is 30 seconds at 94 ℃; In the binding phase, the first cycle is 30 seconds at 65 ° C, the second cycle is 72 seconds at 60 ° C, and then the 13th cycle is 1 minute at a temperature lowered by 0.7 ° C every cycle, and the remaining 33 cycles are at 1 ° C 56 ° C. Kept constant for a minute; The extension step was kept constant for 1 minute at 72 ℃. All amplifications were performed at 9600 Perkin-Elmer.

primer order Eco RⅠ 5'-gactgcgtaccaattc + aNN-3 ' Pst Ⅰ 5'-gactgcgtacatgca + gNN-3 ' Mse I 5'-gatgagtcctgagtaa + cNN-3 '

(N can be any of a, t, g, and c)

⑤ Electrophoresis

The PCR product of selective amplification was mixed with the same amount of loading die (98% formamide, 10 mM EDTA, 0.001% each of xylene cyanol and bromophenol blue). The sample was denatured at 94 ° C. for 5 minutes and then cooled on ice. The mixture (2.4 μl) was loaded on Long Ranger gel (FMC) and electrophoresed at 1 × TBE at 85 W. After electrophoresis, the gel was stained with a silver staining kit (Bioneer Co. Korea).

⑥ Detection of AFLP marker

Each AFLP label showing polymorphism between the parents was detected. In general, AFLP markers are dominant so the markers may or may not appear in bands. Bands showing polymorphism between resistance and pathogenic bulk were detected as candidates for markers associated with wart resistance genes. Candidate markers generated from the Pst I and Mse I primer combinations were identified by separate PCR reactions using parent DNA and two DNA bulk as template DNA. The labeled isolated from Eco and Mse RⅠ Ⅰ primer combinations were used only F ₂ recombination analysis to identify more closely associated markers.

Excluding one or more recombinations from one of the CRb-associated AFLP candidate markers detected in the Pst I and Mse I primer combinations was excluded. As a result, 16 AFLP markers were searched as candidates except for the already obtained marker TCR01. Five of them were named P1, P2, P3, P4, and P5 as co-dominant markers, and four were named P6, P7, P8, and P9 as markers associated with in coupling. associated markers were identified as P10, P11, P12, P13, P14, P15, and P16. The 16 AFLP markers and the SCAR marker TCR01 converted at P0 were used to evaluate 138 F ₂ individuals in Example 2 below.

(e) Association of AFLP Labeling with CRb

In the 17 AFLP markers selected in step (d), the dominant markers were analyzed for 3: 1 separation, the co-dominant markers were examined for 1: 2: 1 separation, and 138 F ₂ were examined to examine the association. The mapping population was examined with the AFLP primer combination used for the AFLP labeling. As a result, all markers were associated with the CRb gene and showed general isolation as shown in Table 8. However, since the dominant markers associated with the reciprocal markers may cause an error in measuring the genetic distance, they were not used in the mapping. Instead, only four dominant markers and six co-dominant markers associated with the merchant were used for the mapping. Analysis of 138 F ₂ individuals with these markers resulted in some recombination. CRb had 8 recombinations with TCR01, 7 with P4, 3 with P8, and 2 with P9.

Association analysis of each AFLP label was performed with a minimum LOD score of 3 and a maximum recombination fraction of 0.4. In the range of LOD values 3 to 8, all labels were aligned on one association group. The labels all associate with CRb, and recombination also occurred. Correlation results are shown in FIG. 1 and the SCAR markers TCR01 and AFLP markers were located in the 8.14 cM range. As shown in FIG. 1, AFLP labels P1, P2, P4, P7, P8, and P9 closely related to the CRb gene were selected and converted to SCAR labels in Example 2 below.

Gene map of the label associated with CRb was used JoinMap 3, which was created based on LOD score 4.2 and maximum recombinant fragment 0.4. The map distance was calculated using the Kosambi mapping function (Kosambi 1944). As a result, it was found that both the CRb and the AFLP label were on the same association group (LG 1).

sign Association Group χ ² sign Association Group χ ² CRb One 0.3 P8 One 0.1 TCR01 One 0.1 P9 One 0.2 P1 One 1.0 P10 One 0.8 P2 One 0.6 P11 One 0.1 P3 One 4.3 P12 One 0.5 P4 One 0.1 P13 One 0.02 P5 One 0.8 P14 One 0.02 P6 One 1.2 P15 One 0.02 P7 One 0.5 P16 One 0.1

(χ ² = (HP-EHP) ² / EHP + (IP-EIP) ² / EIP; HP: Observation for resistant populations; IP: Observation for pathogenic populations; EHP: Expectation for resistant populations; EIP: Expected value for the pathogenic population

Example 2 Conversion of AFLP Labels to SCAR Labels or CAPS Labels

(a) Cloning of AFLP Labels

① Purification of AFLP label

Of the 16 AFLP markers identified in Example 1, six AFLP markers (P1, P2, P4, P7, P8 and P9) closely associated with the wart disease resistance gene CRb were isolated from the PAGE gel and incubated overnight at 25 ° C. Then boiled in 100 μl of sterile water for 5 minutes. After centrifugation at 12,000 rpm for 5 minutes, the supernatant was transferred to a clean tube. 5 μl of the supernatant containing the AFLP fragment was amplified under the conditions of selective amplification described in Example 1 using the corresponding selective primers. Amplified PCR products were separated on long Langer gels (FMC) and parental and two DNA bulks were used as controls. The PCR product was the same size as the AFLP label and was separated on a 1.0% agarose gel and then eluted from the gel by using a gel extraction kit (Qiagen USA).

② transforming competent cells using AFLP labeling

E. coli DH 10B was used as a competent cell (Gibco-BRL) for transformation of the PCR product, and cloned using pGEM-T Easy Vector (Promega USA) as a vector. The connection between the purified DNA fragment and the vector was allowed to react overnight at 4 ° C., and the ratio of the vector and the insert was 1: 3. The gel mixture (100 mM glucose in 1% agarose gel) was desalted for 1 hour on ice, and 1 μl of the ligation and 20 μl of competent cells were mixed well before the Micropulser (Bio-Rad) was added. Electroporation was applied at 16 kV / cm. Transformed cells were transferred to 1 mL of SOC medium and incubated at 37 ° C. After 50 minutes the cells were spread over LB solid medium (ampicillin 50 mg / mL, X-Gal and IPTG) and incubated overnight at 37 ° C. Recombinant clones were identified by blue / white selection. Positive (white) clones were selected for isolation of plasmid DNA and cultured in LB liquid medium.

(b) Selection of clones with inserted AFLP sequences

In the process of converting the AFLP label to the SCAR label, it is important to select the exact clone having the sequence of the AFLP label, so the following two processes are used.

① Selection by electrophoresis on PAGE gel

Plasmid DNA was isolated from 10 or more colonies. PCR reactions were performed with the corresponding selective primer combinations and electrophoresed on long Langer gels to confirm the presence of inserts and AFLP labels of the same size in positive clones. PCR conditions were repeated for 30 seconds at 94 ℃, 60 seconds at 56 ℃, 60 seconds at 72 ℃, 30 cycles. In addition, the selective PCR products of the parent and two DNA bulks were also loaded as a control. As a result, colonies having the same size as the corresponding AFLP label were selected.

② Selection by Southern Analysis

Colonies selected by the above were confirmed by the following ECL direct nucleic acid labeling and detection system (Amersham Pharmacia USA). V) Southern blot: The selective PCR products of the parent and two DNA bulks were electrophoresed on a 1.5% agarose gel. The gel is cut to size and treated with depurinization solution (0.25 M HCl), denaturation solution (1.5 M NaCl and 0.5 M NaOH) and neutralization solution (0.5 M Tris HCl, 1.5 M NaCl pH7.5). It was. Ii) Hybridization: Blots were placed in hybridization buffer and prehybridized at 42 ° C. for 1-2 hours. After prehybridization, a labeled probe was added to the prehybridization buffer. Incubation was performed overnight at 42 ° C. with slow shaking. Probes were prepared from PCR products of selected colonies using a gel extraction kit (Qiagen USA). Probes denatured in boiling water were labeled with a DNA labeling reagent and a glutaaldehyde solution supplied by the kit. Iii) Washing: The membrane was washed twice with altered washing buffer (6 M Urea, 0.4% SDS and 0.5 × SSC). V) Signal detection: A blot on one Saran Wrap was covered with a mixture of detection reagents 1 and 2 in the same amount. Two magnetic spinning films were placed on the blots, exposed for 5 minutes and then removed. Only hybridization signals could be detected in resistant parents and bulk, and the corresponding colonies were selected for sequencing.

As a result, P4, P7, P8 and P9 were able to identify exact clones with the label, but P1 and P2 could not detect the difference between the two DNA bulks due to the low separation of the agarose gel. Therefore, two clones having an insert of the same size as the AFLP label were selected and sequenced at both ends were analyzed to prepare primers when the sequences were identical.

(d) Sequencing of AFLP Labels

Plasmid DNA was prepared using a Plasmid mini preparation Kit (Bioneer Co. Korea) from selected clones that were expected to contain AFLP markers. DNA analysis of plasmid inserts was performed at both ends using an ABI PRISM ^™ 377 auto sequencer (Perkin Elmer Applied Biosystem USA). PCR reactions based on the dideoxy method of Sanger et al., 1982 were performed at 10 μl of total volume including 1.6 μM of T7 or SP6, 1 μl of Big Dye Terminator (Perkin Elmer Applied Biosystem USA), 3 μl of 2.5 × buffer. Was performed. The denaturation step under PCR reaction conditions was 25 cycles for 12 seconds at 94 ° C. on the first cycle and then at 96 ° C .; The connecting step was carried out at 50 ° C. for 6 seconds; The extension step was carried out at 60 ° C. for 4 minutes. PCR products were concentrated by ethanol method. The sequence of the AFLP label was searched for nucleotide (NT) and non-redundant (NR) using the BLAST algorithm of the National Center for Biotechnology Information (NCBI).

(e) converting AFLP markers to SCAR markers or CAPS markers

Primer pairs for SCAR labeling were based on both nucleic acid sequence ends of each AFLP label analyzed in (d) and were prepared using PRIMER3 software (K. Ellinger, Erlangen, Germany).

In order to examine whether the primer pairs prepared as described above can be used for the selection of wart-resistant individuals, a sequence was obtained by using preparative amplification products of the parent and two DNA bulks, and genomic DNA of the individuals constituting the two bulks as template DNA. The polymerization reaction was carried out.

The conditions of the PCR reaction were optimized for the preliminary amplification products of the parent and the two DNA bulks used as templates, followed by amplification of the genomic DNA of the 16 F ₂ individuals that make up the two DNA bulks. PCR products of dominant labels of P7, P8 and P9 were isolated on 1.5% agarose gel, PCR products of P1 were cleaved with restriction enzymes ( Hae III, Hpa II, Taq I and Xho I) and 2% agarose gel Phases were separated. P2 and P4 were also separated on polyacrylamide gels. If AFLP analysis of the PCR product shows polymorphism between resistant and pathogenic individuals, it indicates conversion to SCAR markers. Table 9 shows primer sequences and PCR reaction conditions based on AFLP labeling.

As a result, the AFLP labeling of P1, P4, P7, P8 and P9 was modified to the SCAR label and the CAPS label, but the AFLP label of P2 was not modified. As can be seen in Figures 2a, 2b and 5, the SCAR markers modified with the dominant AFLP markers P7, P8 and P9 were present in resistant individuals but not observed in pathological individuals, and these labels were identified as TCR07, TCR08 and TCR09, respectively. Named it. The co-dominant marker P4 was modified with TCR04, a co-dominant SCAR marker, and FIG. 4 is a pattern of the F ₂ entity shown by TCR04. The 279 bp fragment indicated by the up arrow was found in the resistant but not the pathogenic.

In the case of P1, no polymorphism was found between the resistant and pathogenic individuals. As a result, the resistant individuals were cleaved by the restriction enzyme Hpa Ⅱ as shown in FIG. (Top arrow points), polymorphism between resistance and pathogenic individuals. Thus P1 was modified with a CAPS label and named TCR02.

AFLP marker Primers for SCAR Markers or CAPS Markers designation Sequence (5 '>>>>> 3') size PCR conditions Annealing Extension P0 TCR01 F GGCACGTGAGAAAAACGTAT 200 bp 62 ℃ 60s 72 ℃ 90s R GAGACGAGTTGACGAAGTAA P1 TCR02 F GCTCCATTCAGTTACGGTGA 447bp 62 ℃ 60s 72 ℃ 90s R GCAGAGAATTTTGGAAGAGGA P4 TCR04 F AGAATCATGACCGGGGAAAT 279 bp 62 ℃ 60s 72 ℃ 90s R GCAGCTAAGTCATCGACCAA P7 TCR07 F GCAGAATTATAACCTGAGCGTGT 131bp 62 ℃ 60s 72 ℃ 60s R ATTACCGGAGTATGCGATCC P8 TCR08 F GCAGCAACCGATAATATAAGGA 101 bp 53 ℃ 60s 72 ℃ 60s R AACCAGAAGAAGAAAAACAAAAA P9 TCR09 F AACTCTTGAAGAAAGCAAAGAAGC 170 bp 58 ℃ 60s 72 ℃ 60s R GCAGGAATAAGAAGGAACACCA

(The PCR product of TCR02 was cleaved with Hpa II restriction enzyme; F is translocation primer, R is inversion primer; common conditions for all of the above primers, the first cycle in denaturation step at 94 ° C. for 5 minutes and subsequent cycles. Is carried out for 30 seconds at 94 ℃ and repeated 35 cycles)

(f) Association of SCAR and CAPS Labels

F ₂ individuals were examined using the SCAR label and CAPS label obtained as described above. SCAR markers showing separation are shown in FIGS. 3, 4, 5 and 6, and these labels showed normal separation in the mapping population as in Table 10. As can be seen in Figure 3, 16 recombinations were detected using TCR02, including three recombinations in homozygotes, eight in heterozygotes, and five in recessive homozygotes. As can be seen in FIGS. 5 and 6 (stars in FIGS. 4-6 indicate recombination), five recombinations were detected between TCR08 and TCR09, and one resistant and two pathogenic recombination between TCR08 and CRb was detected. Two pathogenic recombinations were detected between TCR09 and CRb. In addition, as shown in FIG. 4, TCR07 detected recombination with CRb in three pathogenic lines. TCR04 showed 7 resistant recombinations with CRb and 1 recombination with TCR01.

sign test results Expected rate χ ² P (probability) RR Rr rr CRb 32 75 36 1: 2: 1 0.57 > 0.750 TCR01 36 71 36 1: 2: 1 0.01 > 0.995 TCR02 38 74 31 1: 2: 1 0.86 > 0.500 TCR04 35 72 36 1: 2: 1 0.02 > 0.990 TCR07 110 33 3: 1 0.28 > 0.500 TCR08 108 35 3: 1 0.02 > 0.750 TCR09 109 34 3: 1 0.12 > 0.500

(χ ² = (HP-EHP) ² / EHP + (IP-EIP) ² / EIP; HP: Observation for resistant populations; IP: Observation for pathogenic populations; EHP: Expectation for resistant populations; EIP: Expected value for the pathogenic population; if the P value is greater than the significance level of 0.05, it is considered an expected rate

The separated data was used to create the association map of FIG. 7 using JoinMap3 (van Ooijen and Voorrips 2001) based on minimum LOD score 3. In the correlation map, the CRb has the closest TCR08 (CR8 and 0.78 cM) and TCR04 (CRb and 1.92 cM) on both sides. The remaining markers are located on the side of TCR04 at a distance of 0.39 cM to 4.05 cM.

Example 3 Usefulness Assay for Label Utilization Selection of SCAR Label or CAPS Label

In order to evaluate the usefulness of the selection of the SCAR label or CAPS label obtained in Example 2, 27 F ₁ cabbage varieties and European Clubroot Differential (ECD) set 01-05 (Buczacki, IR et al. 1975) After inoculation with PC98-2, the assay was performed with the SCAR label or CAPS label obtained in Example 2. Some resistant varieties used were sold by seed companies in Korea and Japan, and 27 Chinese cabbage varieties were F ₁ hybrid and wart disease, derived from the cross between the CR Shinki DH strain and four inbred lines. Ten hybrids resistant to disease and 13 hybrids resistant to wart disease were used. The 27 Chinese cabbage varieties and ECD 01-05 are shown in Table 11.

The 27 species of Chinese cabbage varieties and ECD 01-05 were inoculated with PC 98-2 identified as race 4 to check the onset, and the inoculation of the strain was carried out in house as described in Example 1 above. As a result, all pathogenic varieties of 27 F ₁ cabbage varieties were pathogenic, but some of the resistant varieties including CR Saerona, Mas and Hwang Gokoro were also pathogenic. This indicates that there is another cause of resistance.

The 32 plant genomic DNAs were extracted using DNeasy Plant Mini preparation Kit (Qiagen USA). The CR Shinki DH strain was used as positive control, 94 SK as negative control, and genomic DNA of each plant in Table 11 was used as template DNA, and the SCAR or CAPS label shown in Table 9 was used. PCR reactions were performed under the conditions of the primers for TCR01, TCR02, TCR04, TCR07, TCR08, and TCR09.

kind Onset TCR01 TCR02 TCR04 TCR07 TCR08 TCR09 CR Hwangun 65 R - + - + - + CR Hwangun 75 R - + - + - + Hwangruck 65 R - + - + + + CR Kaioh R - + - + - + CR Saerona S - + - - - - CR Sanchon R - + - + + + CR power R - + - + - + Hwang gokoro S - + - + + + Mas S - + - - - - Yellow spring S - + - - - - Chilsung S - + - - - - Hanyoerum S - + - - - - H. Kumkarack S - + - - + + Kaenari S - - - - + + Black pearl S - + - - + - Shinchun # 1 S - + - - - - Chillihan S - + - - - - Sanchon S - - - - + + Kumchon S - - - - + + AB11 R + + + + + + CB6 R + + + + + + CB13 R + + + + + + RB19 R + + + + + + CR Green R + + + + + + T-651 R - + - + - + Anshin R + + + + + + Yuki R - + - + - + ECD01 R + + - + + + ECD02 R - + + + - + ECD03 R - - + + + + ECD04 R - + - + + + ECD05 S - - - - - -

(R: resistant, S: pathogenic, +: CR Shinki DH line specific band present,-: CR Shinki DH line specific band not present)

As a result of the TCR01 assay, as shown in FIG. 8, the pathogenic varieties (lane 12-21) and the partially resistant varieties (lane 3-11, 27, 29) showed the same pattern as the 94 pathogenic 94 SK (lane 2). Four hybrids (lanes 22-25), CR Green (lane 26) and Anshin (lane 28) derived from CR Shinki DH showed the same pattern as CR Shinki. TCR04 showed the same results as TCR01 as shown in FIG. 9B. However, TCR02 is the CR Shinki DH strain in all resistant and pathogenic strains except Kaenari (lane 20), Sanchon (lane 24), Kumchon (lane 25), ECD03 (lane 32), and ECD05 (lane 34), as shown in Figure 9a. It is evaluated that it is difficult to use for MAS because it shows the same aspect as

As shown in FIG. 9C, TCR08 showed the same pattern as the CR Shinki DH strain among Hwangruck 65, CR Sanchon, Hwang Gokoro 85, CR Green, Anshim, AB11, CB6, CB13 and RB19 among 17 resistant varieties. H. Kumkarack, Kaenari, Black Pearl, Sanchon and Kumchon also showed the same pattern as the CR Shinki DH strain. As shown in FIG. 9D, TCR09 did not show the CR Shinki DH strain in Saerona (lane 7) and Mas (lane 9) among the resistant varieties, but showed the same pattern as the CR Shinki DH strain in other resistant varieties. Dog breeds (Kumkarack, Kaenari, Sanchon and Kumchon) showed signs of CR Shinki DH. As shown in FIG. 9E, TCR07 did not show the CR Shinki DH strain in Saerona (lane 7) and Mas (lane 9) among the resistant varieties, but showed the same pattern as the CR Shinki DH strain in other resistant varieties. The label of CR Shinki DH was not shown in.

Taken together, TCR01, TCR04, TCR07, TCR08 and TCR09 can be used as PCR primers for the selection of wart-resistant individuals, and in particular, TCR01 and TCR04 can be used as PCR primers for the selection of wart-resistant individuals. It can be seen that it is very suitable.

The present invention easily and quickly selects warty-resistant individuals by converting an AFLP label associated with a wart-resistant gene into a SCAR label or a CAPS label and using it in a polymerase chain reaction method, and resists breeding of resistant varieties. There is an effect that can confirm whether the introduction of the gene.

Simple modifications or changes of the present invention can be easily carried out by those skilled in the art, and all such modifications or changes can be seen to be included in the scope of the present invention.

Attach sequence list electronic file  

Claims (12)

delete delete delete Separating and purifying DNA of the wart-resistant plant and the plant to be discriminated; Amplifying the plant DNA by polymerase chain reaction in a reaction solution containing Mg ²⁺ ions, Tag DNA polymerase, dNTP and a primer using the purified DNA as a template DNA; Electrophoresis of the amplified DNA, and then confirming SCAR labeling by comparing aspects of DNA bands; Consists of steps, Said primer is SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, and SEQ ID NO: 9 and 10 characterized in that the selection method of the wart disease-resistant individual, characterized in that. The method of claim 4, wherein the primers are two or more primer pairs selected from the group consisting of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, SEQ ID NO: 7 and 8, and SEQ ID NO: 9 and 10. Selection method of wart-resistant individuals, characterized in that the use of overlapping. The method of claim 4, wherein the wart-resistant plant is a drug-resistant lineage of CR Shinki. The plant of claim 4, wherein the plant to be discriminated is Chinese cabbage ( Brassica campestris L. ssp.pekinensis or Brassica rapa L. ssp.pekinensis ), cabbage ( Brassica oleracea L.), broccoli (Broccoli), cauliflower (cauliflower) ), Kale, mustard, turnip or brassica rapa , rapeseed, radish and their tissues or seeds. 5. The method of claim 4, wherein the wart disease is infected by selecting from the group consisting of Race 2, Race 4 and Race 8 according to the Wart Race Discrimination Criteria of Williams (1966). A primer pair having the sequence of SEQ ID NO: 3 and SEQ ID NO: 4 used in the method for selecting wart-resistant individuals by SCAR label. A primer pair having the sequence of SEQ ID NO: 5 and SEQ ID NO: 6 used in the method for selecting wart-resistant individuals by SCAR label. A primer pair having the sequence of SEQ ID NO: 7 and SEQ ID NO: 8 used in the method for selecting wart-resistant individuals by SCAR label. A primer pair having the sequence of SEQ ID NO: 9 and SEQ ID NO: 10 used in the method for selecting wart-resistant individuals by SCAR label.

Images