KR100553336B1 - Detection method of ?. ???? in water samples using pcr - Google Patents

Abstract

The present invention is to produce a new primer for the flagella gene hdfR which is common to pathogenic and non-pathogenic Escherichia coli, and E. coli can be confirmed early in the drinking water by the polymerase chain reaction (PCR) technique using this primer It relates to a detection method. E. coli detection method according to the present invention, even if a small amount of E. coli in the sample can be detected quickly and accurately E. coli quickly and accurately with only a small amount of DNA without going through the enrichment step.

Escherichia coli, hdfR gene

Description

Method for detecting E. coli in water using polymerase chain reaction {DETECTION METHOD OF Ｅ. ｃｏｌｉ IN WATER SAMPLES USING PCR}

1 is a schematic diagram of a method for separating bacterial chromosomes (genomic DNA).

Figure 2 is a schematic diagram of the E. coli detection method using a polymerase chain reaction (PCR).

Figure 3 is an electrophoresis picture showing the results of the detection sensitivity of E. coli based on the concentration of the template DNA.

Figure 4 is an electrophoresis picture showing the results of the detection sensitivity of E. coli based on the number of viable cells.

The present invention relates to a method for detecting E. coli in water using a polymerase chain reaction (PCR). More specifically, a novel primer for the flagella formation gene hdf R which is commonly present in pathogenic and non-pathogenic E. coli is newly manufactured. In addition, the PCR method using the primers relates to a method for detecting E. coli that can quickly and accurately confirm whether E. coli is contaminated in drinking water.

The emergence of fecal coliforms in drinking water means contamination in the feces of humans or other warm-blooded animals, suggesting the possibility of pathogens. The US Environmental Protection Agency (EPA) has suggested that E. coli is a better fecal contamination indicator microorganism than the fecal coliform group in assessing water quality (US EPA, 1986).

As a method for detecting E. coli from feces of animals and humans, selective medium or biochemical experiments are performed. However, this method has a disadvantage in that it takes a long time to detect because the bacteria must be cultured.

Alternatively, E. coli can be detected using a substrate that reacts with the β-glucuronic acid enzyme produced by E. coli to cause fluorescence. However, this method also has a limit of detection because E. coli O157: H7 does not show β-glucuronic acid activity unlike ordinary E. coli.

As a method for overcoming these disadvantages, E. coli can be detected accurately and quickly using polymerase chain reaction. Specifically, β-glucuronic acid coding gene ( uid A) in Escherichia coli can be amplified, and in the case of Escherichia coli O157: H7, verotoxin I and II genes ( slt I and II) or barriers causing hemorrhagic colitis It can be distinguished from E. coli by amplifying the pathogen ( eae A).

In the case of pathogenic Escherichia coli, many attempts have been made to detect them because enterotoxins secreted by multiplying Escherichia coli are direct pathogenic factors. Enterotoxins can be largely divided into heat-labile enterotoxin (LT) and heat-stable enterotoxin (ST) depending on the heat resistance. In the case of dipyrotoxin, latex agglutination and ELISA methods have been developed and used to prepare antiserum for toxin and smear it onto latex to perform agglutination. However, the sensitivity and specificity of the above method depend on the titer and purity of the prepared antiserum, and above all, there are problems in safety. In addition, in the case of heat-resistant toxin, since the toxin itself is small in size and immunogenic, it is difficult to develop a diagnostic technique using antiserum.

Recently, it has been found that the expression of these toxins is made by the plasmid gene of Escherichia coli, and a method of identifying a gene that produces the toxin has been developed. There is a DNA hybridization method that detects genes by synthesizing probes specific to each toxin, and the US Food and Drug Administration (FDA) has developed a technique for simultaneously detecting non-pathogenic and pathogenic genes. However, it takes a day or more in the culturing stage, so early detection is difficult, and when the amount of DNA is small, there is a problem in sensitivity and selectivity.

The present inventors, no E. coli as good as, the presence of the enrichment of pathogenic to byeonhalji also detection of the unknown non-pathogenic E. coli also recognizes the importance while, genes involved in flagellum formation present in common to pathogenic and non-pathogenic E. coli hdf R By confirming the presence or absence of the present invention, E. coli can be detected regardless of pathogenicity or non-pathogenicity.

Accordingly, an object of the present invention is to provide a method for detecting E. coli, which can detect both pathogenic and non-pathogenic E. coli in drinking water by confirming the presence of hdf R, a flagella forming gene of E. coli, using PCR.

It is another object of the present invention to provide a method for detecting E. coli, which can detect E. coli directly and quickly in a field sample without increasing the culture step.

Another object of the present invention is to provide a novel primer for PCR for the flagella gene hdf R of E. coli.

The method for detecting Escherichia coli according to the present invention is characterized by using a primer for hdf R which is a flagella forming gene in detecting Escherichia coli by a polymerase chain reaction.

In addition, the primer used in the method for detecting E. coli according to the present invention is characterized by consisting of the following nucleotide sequences:

LysR-p1: with forward primer of AATCTAGTTGCTGTGCCAGT (SEQ ID NO: 1)

LysR-p2: consisting of reverse primers of TTGCTGGGATATTTCACTTT (SEQ ID NO: 2).

Hereinafter, the present invention will be described in detail.

In order to detect E. coli quickly and accurately, first, a specific primer should be prepared. As described above, in the present invention, a flagella formation present in both pathogenic E. coli and non-pathogenic E. coli is performed to detect all E. coli without distinguishing between E. coli and non-pathogenic E. coli. There is a need to construct specific primers for the gene ( hdf R).

To this end, RAPD (Random Amplified Polymorphic DNA) PCR is used to analyze the nucleotide sequences of genes of about 200 bp (base pair) size or less common to E. coli to produce novel primers for flagella gene ( hdf R). The specific method will be described below.

[Isolation of genomic DNA]

In order to analyze nucleotide sequences of genes of about 200 bp (base pair) size or less common to Escherichia coli, using RAPD (Random Amplified Polymorphic DNA) PCR, the present invention was carried out in four strains of E. coli isolated from feces, and the National Institute of Health. A total of nine strains were received, including three species of Escherichia coli (ATCC 23515, ATCC 23520, ATCC 43888), Salmonella typhimurium (KCTC 2514) and Salmonella choleraesuis (KCTC 2932). Used.

Each of the nine strains was inoculated in 5 ml of LB medium and incubated at 37 ° C. at 180 rpm for 18 hours. Genomic DNA of each strain was isolated using a Promega Wizard Plus gDNA Purification kit (Promega, Madison, USA).

[Production of Novel Primer of the Invention]

A uniprimer kit (Surin Bio, Seoul, Korea) was used to perform RAPD PCR with the composition and conditions described below.

Composition for RAPD PCR

================================================== =====================

PCR reagents volume Final concentration

1 μl template DNA 100 ng

Uniprimer (R) 1.5 μl 0.5 μg / μl

Uniprimer (F) 1.5 μl 0.5 μg / μl

Taq DNA polymerase 10 × buffer w / MgCl ₂ 3 μl 1 × buffer

Taq DNA polymerase 0.5 μl 5 u / μl

2.5 mM dNTP mixture 0.6 μl 0.05 mM

ddH ₂ O 21.9 μl

================================================== =====================

Conditions for RAPD PCR

================================================== ==

Temperature (℃) Time (minutes)

94 4

94 1 ┐

55 1 │ 35 cycles

72 2 ┘

72 7

4 permanent

================================================== ==

The E. coli common band of about 200 bp or less was cut from uniprimer 3 and ligated to the pGEM-Teasy vector to transform DH5α. 2 x ligation buffer (Promega, Madison, USA), T4 DNA ligation (Promega, Madison, USA) 3 to insert DNA isolated from the gel into the plasmid pGEM-T Easy vector (Promega, Madison, USA) u / μl and DNA were added and reacted at 4 ° C. for 16 hours. After mixing the ligation mixture in E. coli DH5α (competent cell) and leaving for 30 minutes at 0 ° C., 2 minutes at 42 ° C. and 2 minutes at 0 ° C., LB (Luria-Bertani) liquid medium was After incubation at 37 ° C. for 1 hour, bacteria were spread on LB plate medium to which 50 μg / ml of ampicillin antibiotic (Sigma Co., USA) was added and incubated at 37 ° C. for 18 hours. Plasmids were isolated using DNA Purification System kit (Promega, Madison, USA), followed by purification of DNA using phenol and chloroform, followed by PCR for sequencing using M13 primer. It was. After analyzing the nucleotide sequence of the amplified portion, when the BLAST search in NCBI confirmed that it is a flagella gene ( hdf R) of E. coli, a new primer was produced by using a primer manufacturing program (Primer 3). Primer 3 is a program designed by the Whitehead Institude / MT Center for Genome Research to design primers for PCR from nucleotide sequences. The novel primers of the present invention prepared are shown in Table 1 below.

Table 1 Base sequences of primers for detecting E. coli

Primer name direction SEQ ID NO: 5'-3 ' Target PCR product (bp) LysR-p1 LysR-p2 Forward reverse AATCTAGTTGCTGTGCCAGT (SEQ ID NO: 1) TTGCTGGGATATTTCACTTT (SEQ ID NO: 2) hdf R 181

[Amplification of Gene by PCR]

After preliminary experiments were carried out at different temperatures and times to determine the conditions of denaturation, annealing and extension in PCR, nine species used in the above E. coli chromosome separation experiments using PCR general principles. 5 mM to 10 µl of chromosomal template DNA isolated from the strain of 2.5 mM dNTPS, 10 × buffer, 5 u / µl Taq DNA polymerase, 20 pmole primer (LysR-p1, LysR-p2), DW was added and treated for 4 minutes at 94 ° C to denature the template DNA, followed by PCR amplification. PCR cycles were amplified 30 times in a PCR apparatus under conditions of denaturation 94 ° C./1 min, binding 55 ° C./1 min, and elongation 72 ° C./2 min, and final elongation was performed at 72 ° C. for 7 minutes. . After the DNA amplification was completed, 5 μl of each amplification sample was subjected to electrophoresis at 50 V for 1 hour on a 2% agarose gel. See FIG. 4). Figure 2 shows the amplification process by the series of PCR.

[Example 1: Selectivity to E. coli using the primer of the present invention]

Using the novel primers (LysR-p1, LysR-p2) prepared in the present invention was carried out an experiment for confirming the selectivity for E. coli by the PCR technique.

Prior to the experiment, 12 species of livestock wastewater and 20 kinds of microorganisms were separated from the livestock wastewater using the livestock wastewater and the Han River as samples, and then selected based on the shape and color shown on the selected medium, and then using the 24E Easy Plus strain identification kit. and was following separation, check the microbiological eight species, such as: keulrep when Ella pneumoniae (Klebsiella pneumoniae), Enterobacter Chloe Aka (Enterobacter cloacae), par Sten Relais H. Morley Utica (Pastenrella haemolytica), Serratia Plymouth Mu Utica ( Serratia plymuthica ), Enterobacter agglomerans , Citrobacter freundii , Klebsiella ozaenae , Escherichia coli .

The eight isolated microorganisms were extracted from the gDNA using InstaGene Matrix solution (BioRad, CA, USA) by the method shown in FIG. 1, and then described in FIG. PCR was performed according to the method to amplify the genes, followed by electrophoresis on a 2% agarose gel.

As a result, E. coli showed an amplification product of 181 bp, the flagella forming gene hdf R, but other kinds of microorganisms did not show PCR amplification products, so that the selectivity was recognized.

Example 2: Susceptibility to Escherichia coli of the Primer of the Invention

In order to investigate the sensitivity of the present invention, the DNA isolated according to the method of FIG. 1 in Example 1 and the novel primers (LysR-p1, LysR-p2) prepared in the present invention were divided into two types of sensitivity experiments as follows. Was performed.

Experiment to determine minimum concentration of template DNA

PCR amplification products using the newly prepared primers were tested to determine the minimum concentration of template DNA that can be visually identified on electrophoresis.

First, the E. coli template DNA was separated with InstaGene Matrix solution (BioRad, CA, USA), and then purified by phenol: chloroform: isoamyl alcohol (25: 24: 1), and then UV 260 nm and 280 using a spectrophotometer. Absorbance was measured at nm to calculate DNA concentration. Each DNA was diluted 10-fold, 1 μl was dispensed, and PCR was performed as shown in FIG. 2, followed by electrophoresis. The results are shown in FIG. 3. Since the PCR amplification products of LysR-p1 and LysR-p2, which are hdf R primers according to the present invention, can be confirmed at 1.91 pg / μl, it can be seen that they bind to template DNA 100 times more sensitive than the known uid A primers. .

Experiment to check the viable count of Escherichia coli

When E. coli DNA was isolated from the sample and PCR was performed using the newly prepared primer, an experiment was performed to confirm the viable cell count of E. coli, which can visually identify the PCR amplification product on electrophoresis.

First, E. coli (ATCC 23515), which was cultured in 50 mL LB liquid medium for 18 hours, was plated on an LB plate medium every hour to measure the viable cell count, and the growth curve was determined by measuring the OD value. , OD values continued to increase but colony count remained unchanged at 10 ⁹ cfu / mL after 4 h of incubation. Escherichia coli (ATCC 23515), incubated in 50 mL LB liquid medium for 18 hours, was re-inoculated with 5% LB liquid medium by 0.2%, and then diluted 10 times each to 1 cfu / mL, and the DNA was diluted according to the method shown in FIG. PCR was carried out as shown in FIG. 2, and electrophoresis was performed. The results are shown in FIG. 4. LysR-p1 and LysR-p2, which are hdf R primers according to the present invention, can identify PCR products up to 10 cfu / mL, whereas existing known uid A primers could not be identified at 10,000 cfu / ml.

The present invention performs a RAPD PCR using a uniprimer to produce a new primer that can selectively detect only E. coli to find the hdf R gene involved in the formation of E. coli flagella, a new primer LysR- p1 and LysR-p2 were produced. The newly prepared hdf R primers LysR-p1 and LysR-p2 according to the present invention can detect DNA concentrations up to 1.91 pg / μl, and are at least 100 times more sensitive than the known uid A primers based on template DNA concentrations. Based on the number of E. coli bacteria, up to 10 cfu / mL can be detected. Due to the excellent sensitivity of the newly prepared primer, even if a small amount of E. coli is detected in the sample, it can be detected immediately without going through the enrichment step, and the detection time can be shortened within a day.

Due to the preparation of a novel primer for the flagella forming gene hdf R which is common to the pathogenic and non-pathogenic Escherichia coli according to the present invention, even if a small amount of E. coli is present in the sample, it is fast and has only a small amount of DNA without undergoing the enrichment culture step. E. coli can be detected accurately, which is superior in both selectivity and sensitivity compared to the primer of the gene uid A, which was previously used to detect E. coli.

<110> Korea Institute of Science and Technology <120> Detection method of E. coli in water samples using PCR <130> K-3100 <160> 2 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for hdfR gene <400> 1 aatctagttg ctgtgccagt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for hdfR gene <400> 2 ttgctgggat atttcacttt 20

Claims (2)

delete In a method for detecting E. coli by a polymerase chain reaction, characterized in that a primer for hdf R, a flagella forming gene, is used, wherein the primer is composed of the following nucleotide sequences: LysR-p1: with forward primer of AATCTAGTTGCTGTGCCAGT (SEQ ID NO: 1) LysR-p2: consisting of reverse primers of TTGCTGGGATATTTCACTTT (SEQ ID NO: 2).

Images