KR100459106B1 - Identification of an organism by use of the intron dna sequence of the clock gene as dna fingerprints - Google Patents

Abstract

The present invention is to provide a method for identifying a biological individual, population, or species using the same, based on the fact that the nucleotide sequence of the intron region of the time gene in the genome of the organism has a large difference between individuals, groups, and species. Preparing polymerase chain reaction primer pairs capable of amplifying introns using conserved region sequences before and after the time gene introns; Amplifying introns by polymerase chain reaction with the prepared primers; And, it characterized in that it comprises the step of determining the base sequence of the amplified intron DNA fragments, and identifying the organism by the base sequence information of the intron, each of the biological classification group of the prior art to use a different DNA fingerprint As it can be used in common with most organisms (animals) to compensate for the shortcomings, it can be used for various organisms (animals) that need to be identified as well as forensic use related to humans such as identification of the suspect and verification of intimacy. Can be applied.

Description

IDENTIFICATION OF AN ORGANISM BY USE OF THE INTRON DNA SEQUENCE OF THE CLOCK GENE AS DNA FINGERPRINTS}

An object of the present invention is to provide a method for identifying a biological individual, a population, or a species based on the fact that the nucleotide sequence of the intron region of a time gene present in the genome of the organism has a large difference between individuals, groups, and species.

Identifying individuals, groups, and species of living organisms, including humans, is a matter of social and economic importance. Traditionally, in forensic medicine, each person is identified by using fingerprints, hair features, tooth shapes, other morphological features, and blood types, which are biochemical methods.

Since the 1990s, the development of genomic analysis technology has made it easier to identify DNA sequences in the human genome. From this time on, forensic science called DNA fingerprinting, and the differences in genome sequences between individuals began to be used to identify individuals.

On the other hand, there is a need to identify individuals, groups and species in livestock, poultry and aquatic products. The identification of these plants and animals still depends mainly on morphological features, and some organisms use DNA fingerprints.

Specific analysis techniques for DNA fingerprints include restriction fragments length polymorphism (RFLP), differences in minisatellite sequences, differences in microsatellite sequences, and single nucleotide polymorphism (SNP). Etc. are used.

Restriction fragment fragment polymorphism in DNA fingerprinting is a method of comparing the difference in length of cut DNA fragments by cutting the entire genome of a comparative organism with restriction enzymes and analyzing them by electrophoresis. This method has the advantage of analyzing the entire genome, but because the length of the cut DNA fragments varies inconsistently depending on the analyzer and the experimental method (Shapiro, 1991; Nature vol. 353: 121-122). There is a drawback that the significance of the results is poor unless the comparison is made by. In addition, since the restriction enzyme fragment polymorphism itself does not clearly show the cause of the difference in DNA fragment length between the comparative organisms, there is a case that no clear evidence can be provided to clarify the root relationship between the comparative organisms.

In addition, minisatellite differences, microsatellite differences, and monobasic polymorphisms provide clear results by directly comparing differences in base sequences between comparative organisms. However, in these methods, not only the base sequences to be compared but also the front and back base sequences are known and used. The base sequences before and after these are different from each other in the biological group, and thus the base sequences used in one biological group are different. The disadvantage is that it does not apply to the group, i.e., a new DNA fingerprint must be found for each biological group.

The present invention is to solve the problems of the existing biometric identification method using a DNA fingerprint, by providing a DNA fingerprint using technology that can be commonly used in a variety of organisms, to provide a method for identifying a biological individual, population, species using the same I would like to.

1 is a diagram showing the comparison between species and amino acid sequence of the conserved region amino acid sequence of the time gene protein,

Figure 2 shows the intersubspecies variation of the eel time gene intron.

The organism identification method of the present invention for achieving the above object is characterized by using the base sequence of the time gene intron as a DNA fingerprint.

Specifically, the organism identification method of the present invention,

Preparing polymerase chain reaction primer pairs capable of amplifying introns using conserved region sequences before and after the time gene introns;

Amplifying introns by polymerase chain reaction with the prepared primers;

Determining the sequence of the amplified intron DNA fragment; And

And identifying the organism by the base sequence information of the intron.

In the present invention, there is a large variation between individuals and species in the intron sequence of a clock gene, and there are conservation regions (bHLH, PAS-A, PAS-B domain determination regions, etc.) before and after these introns. It is based on the genetic knowledge that the sequence of the conserved region can be reconstructed according to the genetic code based on the conserved amino acid sequence.

Clock genes are already found in humans, mice, fish and fruit flies and are accepted by the scientific community as present in most organisms. In temporal proteins, regions called bHLH, PAS-A, and PAS-B, and some of the surrounding regions, are known to be conserved regions with almost the same amino acids, regardless of species.

Figure 1 shows the comparison of species between the conserved region amino acid sequences of the time gene protein and the positions of introns (I5 to I13), and the box means the conserved regions (bHLH, PAS-A, PAS-B). Where ① is Sebastes schlegeli , ② is zebra fish, ③ is salmon, ④ is rat, and ⑤ is human.

The DNA fragment of the time gene that determines this region in such a conserved region can reconstruct its nucleotide sequence irrespective of the organism according to the genetic code, and if necessary, the fragment is subjected to a polymerase chain reaction (PCR). Can be amplified and its nucleotide sequence confirmed.

This DNA fragment of the time gene has an intron region that does not determine amino acids in the genetic structure, and the present invention is based on the discovery that the nucleotide sequence of the time gene intron is large between individuals and species.

Figure 2 shows the inter-individual variation of the eel time gene intron, with the box region representing intron 10.

In addition, Table 1 shows the difference in intron base length between the bio taxa, the unit is bp.

Intron number Rockfish rat eel salmon 9 586 2821 10 122 108 518 142 11 114 2035 374 168 12 1010 191 439 13 107 765

According to this finding, the nucleotide sequence of the time gene intron can be used as a DNA fingerprint for identifying different organisms, and the present invention has been made accordingly.

The DNA fingerprint using the time gene intron according to the present invention differs from the conventional DNA fingerprint in that it can be used in any organism (animal) regardless of the type of organism. That is, the time gene is present in most organisms, and since there is a conserved region, it is possible to reconstruct the front and rear nucleotide sequences of the intron, so that the intron can be amplified by a polymerase chain reaction to identify and compare the nucleotide sequences.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are only examples of the present invention, and the scope of the present invention is not limited thereto.

EXAMPLE

First, the sequences of the conserved regions before and after the time gene intron were reconstructed, and using this information, a polymerase chain reaction primer pair capable of amplifying the intron was prepared.

That is, in order to use the sequences of the time genes Intron 10 (I10 in FIG. 1) and Intron 11 (I11 in FIG. 1) for the purpose of identifying individuals or species in humans, eel and humans, the front of Intron 10 and Intron 11 The sequence was reconstructed as follows, taking into account the amino acid sequence of the conserved region as follows: the former conserved amino acid, EFCCHMLRGTIDPKE; Posterior conserved amino acids, MCTVEEPNEEF or GYDYYHVDDL> sequencing reconstruction, anterior GARTTYTGYTGYCAYATGYTNMGNGGNACNATNGAYCCNAARAGR; Rear ATGTGYACNGTNGARGARCCNAAY GARGARTTY or GGNTAYGAYTAYTAYCAYGTNGAYGAYYTN.

Polymerase chain reaction primers were prepared as follows to amplify introns from the reconstituted sequence:

Forward primer Clock F2: 5 'GAGTTYTGYTGYCAYATGYT 3' (SEQ ID NO: 5);

Reverse primer HCMS23: 5 'TTGGGCTCCTCCACTGTACACA 3' (SEQ ID NO: 7);

Reverse primer Clock R2, 5 'TCGACCTGRTARTARTCRTA 3' (SEQ ID NO: 3).

Table 2 below shows examples of polymerase chain primer pairs for amplifying introns of the eel time gene.

Gene name Primer Sequence Intron Amplified Clock Clock F1: 5 'ATACGRCARGAYTGGAARCC 3' (SEQ ID NO: 1) Clock R1: 5 'AGCATCTGRCARCARAAYTC 3' (SEQ ID NO: 2) I7, I8, I9 Clock Clock F1: 5 'ATACGRCARGAYTGGAARCC 3'Clock R2: 5' TCGACCTGRTARTARTCRTA 3 '(SEQ ID NO: 3) I7, I8, I9, I10, I11, I12 Clock Clock F1: 5 'ATACGRCARGAYTGGAARCC 3'Clock R3: 5' TGGARCCATATCCAYTGYTG 3 '(SEQ ID NO: 4) I7, I8, I9, I10, I11, I12, I13 Clock Clock F2: 5 'GAGTTYTGYTGYCAYATGYT 3' (SEQ ID NO: 5) Clock R2: 5 'TCGACCTGRTARTARTCRTA 3' I10, I11, I12 Clock Clock F2: 5 'GAGTTYTGYTGYCAYATGYT 3'Clock R3: 5' TGGARCCATATCCAYTGYTG 3 ' I10, I11, I12, I13 Clock Clock F2: 5 'GAGTTYTGYTGYCAYATGYT 3'HCMS1: 5' AGACCATTCCTCCCTGCATTGGG 3 '(SEQ ID NO: 6) I10 Clock Clock F2: 5 'GAGTTYTGYTGYCAYATGYT 3'HCMS23: 5' TTGGGCTCCTCCACTGTACACA 3 '(SEQ ID NO: 7) I10, I11

In the above table, F means forward, R means reverse primer, and HCMS indicates a reverse primer.

The intron is amplified by polymerase chain reaction with the prepared primers.

Specifically, 50 μl of the polymerase chain reaction solution was prepared as follows: about 500 to 1,000 ng of genomic DNA, 0.5 μM of each of the reverse primer (Clock F2) and the reverse primer (Clock R2), nucleotides (dATP, dTTP, dCTP, dGTP) 0.2 μM each, HotStarTaq DNA Synthetase (Quigen, Germany) 2.5 units, Tris pH 7.7, KCl, (NH ₄ ) ₂ SO ₄ , 1.5 mM MgCl ₂ , secondary distilled water.

Subsequently, the polymerase chain reaction was performed as shown in Table 3 below.

Genomic DNA Polymerase Chain Reaction Repetition Reaction step Reaction temperature (℃) Response time (minutes) One Initial activation 95 15 35 Denaturation 95 One Annealing 45-53 One Extension 72 1.5 One Final extension 72 10 Save 4 ∞

After the polymerase chain reaction, the resultant was subjected to electrophoresis (about 100 V, 1 hour) on 0.8% agarose gel to confirm that the DNA fragment of the planned size was amplified. Amplified DNA fragments were isolated and sequenced immediately or cloned and sequenced to determine nucleotide sequences. Sequence determination of DMA fragments was carried out using polymerase chain reaction using BigDye terminator (PE Applied Biosystems, USA), purification of reaction product DNA using ethanol, DNA sequencer (ABI prism 377 DNA Sequencer: PE Applied Biosystems, USA) electrophoresis of DNA.

The polymerase chain reaction solution for sequencing made a total of 10 μl as follows: about 100 ng of DNA fragment, 1.6 pmol of translocation primer (Clock F2) or sequencing primer (M13 translocation primer, TGTAAAACGACGGCCAGT), terminator ready reaction mix (Terminator ready reaction mix: PE Applied Biosystems, USA) 4 μl, secondary distilled water.

Next, as shown in Table 4, the polymerase chain reaction was performed.

Sequencing Polymerase Chain Reaction Repetition Reaction step Reaction temperature (℃) Reaction time One Initial activation 95 2 mins 25 Denaturation 96 10 sec Annealing 50 5 sec Extension 60 4 mins Save 4 ∞

The reaction product DNA was purified by ethanol as follows: after completion of the reaction, 40 μl of secondary distilled water was added to the reaction tube, mixed well, and then the whole solution was transferred to a new tube, where 3 M sodium acetate (NaOAc, pH 4.6) 5 125 μl and 125 μl of cold 100% ethanol were added and placed on ice for 10 minutes. The solution was centrifuged at 14,000 rpm for 20 minutes to precipitate DNA, and the DNA precipitate was washed with cold 70% ethanol, followed by centrifugation to precipitate DNA and discarded ethanol. Precipitated DNA was dried at room temperature, and the DNA was dissolved in a buffer in which a 25 mM EDTA (pH 8.0) solution containing formamide and blue dextran was mixed at a ratio of 5 to 1.

Nucleotide sequence determination is finally performed by electrophoresis using a DNA sequencer (ABI prism 377 DNA Sequencer: PE Applied Biosystems, USA). That is, the DNA dissolved in the above was heated for 2 minutes at 95 ℃ and put on the gel installed in the sequencer, and then the DNA was electrophoresed so that each fragment of the DNA was separated to obtain a base sequence.

Once the sequences between the Clock F2 primer and the Clock R2 primer of the time gene are obtained in several individuals, they are aligned with each other using a sequence alignment program (e.g., Clustal W) (Figure 2), and each individual in the aligned sequences Identify the bases with mutations in the liver and use this as the basis for identifying each individual.

In addition to the primers shown in Table 2 above, examples of primer sequences that can be used to amplify time gene introns are shown in Table 5 below.

Gene name Primer Sequence Clock Forward primersClock F3: 5 'GAYCARTTYAANGTNYT 3' (SEQ ID NO: 8) Clock F4: 5 'AARGARYTNGGNACNATG 3' (SEQ ID NO: 9) Clock F5: 5 'ACNMGNAARATGGAYAA 3' (SEQ ID NO: 10) Clock F6: 5 'AAYGARGARTTYACNCA 3' (SEQ ID NO: 11) Clock F7: 5 'GCNATNATGACNGAYGG 3' (SEQ ID NO: 12) Clock F8: 5 'GARTTYTGYTGYCAYATG 3' (SEQ ID NO: 13) Clock F9: 5 'ACNATNGAYCCNAARGA 3' (SEQ ID NO: 14) Clock F10: 5 'TAYGARTAYGTNAARTT 3' Clock F11: 5 'ATGTGYACNGTNGARGA 3' (SEQ ID NO: 16) Clock F12: 5 'CCNAAYGARGARTTYAC 3' (SEQ ID NO: 17) Clock Reverse primersClock R4: 5 'TGNGTRAAYTCYTCRTT 3' (SEQ ID NO: 19) Clock R5: 5 'CCRTCNGTCATNATNGC 3' (SEQ ID NO: 20) Clock R6: 5 'CATRTGRCARCARAAYTCCAT 3' (SEQ ID NO: 21) Clock R7: 5 'TCYTTNGGRTCNATNGT (SEQ ID NO: 22) Clock R8: 5 'AAYTTNACRTAYTCRTA 3' (SEQ ID NO: 23) Clock R9: 5 'TCYTCNACNGTRCACAT 3' (SEQ ID NO: 24) Clock R10: 5 'GTRAAYTCYTCRTTNCC 3' (SEQ ID NO: 25) Clock R11: 5 'AANARRAAYTTCCAYTC 3' Clock R12: 5 'ACRTGRTARTARTCRTA 3' (SEQ ID NO: 27) Clock R13: 5 'CCYTTNCCRTAYTGCAT 3' (SEQ ID NO: 28) Clock R14: 5 'AYRAANCKRTARTARCA 3' (SEQ ID NO: 29) Clock R15: 5 'AACCANATCCAYTGYTG 3' (SEQ ID NO: 30)

As described in the above examples, the sequences of the conserved regions before and after the time gene intron were reconstructed, and polymerase chain reaction primer pairs capable of amplifying the intron were prepared using this information, and then the amplified intron DNA fragments were directly produced. By sequencing or by cloning after sequencing to determine the intron nucleotide sequence, it can be used to determine the similarity and difference of the intron sequencing between the comparative organisms to determine the biological identification and the source relationship. The present invention relates to an oligonucleotide used in a method for identifying an organism comprising at least one selected from the group consisting of oligonucleotides of SEQ ID NOs: 1 to 30.

As described above, the technique of identifying organisms using the time gene intron sequence as the DNA fingerprint according to the present invention complements the shortcomings of the prior art in which different DNA fingerprints should be used for each biological taxon. Since it can be used in common with animals, it can be applied to various organisms (animals) requiring identification such as various agricultural and marine products and imported animals, as well as forensic use related to humans such as identification of the suspect and confirmation of intimacy.

In addition, the identification process of the organism requires more judgment data in order to increase its accuracy. When using the method of the present invention together with the prior art, the reliability of the confirmation judgment is provided by providing another independent judgment data in the organism identification process. This will bring about an effect.

<110> KOREA OCEAN RESEARCH AND DEVELOPMENT INSTITUTE <120> IDENTIFICATION OF AN ORGANISM BY USE OF THE INTRON DNA SEQUENCE OF THE CLOCK GENE AS DNA FINGERPRINTS <130> PPC30134 <160> 30 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 1 atacgrcarg aytggaarcc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 2 agcatctgrc arcaraaytc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 3 tcgacctgrt artartcrta 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 4 tg garccata tccaytgytg 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 5 gagttytgyt gycayatgyt 20 <210> 6 <211> 23 <212 > DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 6 agaccattcc tccctgcatt ggg 23 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223 > primer for amplifying intron of clock gene <400> 7 ttgggctcct ccactgtaca ca 22 <210> 8 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 8 gaycarttya angtnyt 17 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> p rimer for amplifying intron of clock gene <400> 9 aargarytng gnacnatg 18 <210> 10 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 10 acnmgnaara tggayaa 17 <210> 11 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 11 aaygargart tyacnca 17 <210> 12 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 12 gcnatnatga cngaygg 17 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 13 garttytgyt gycayatg 18 <210> 14 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 14 acnatngayc cnaarga 17 <210> 15 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 15 taygartayg tnaartt 17 <210> 16 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 16 atgtgyacng tngarga 17 <210> 17 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 17 ccnaaygarg arttyac 17 <210> 18 <211> 17 < 212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 18 gartggaart tyytntt 17 <210> 19 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 19 tgngtraayt cytcrtt 17 <210> 20 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 20 ccrtcngtca tnatngc 17 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 21 catrtgrcar caraaytcca t 21 <210> 22 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 22 tcyttnggrt cnatngt 17 <210> 23 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifyin g intron of clock gene <400> 23 aayttnacrt aytcrta 17 <210> 24 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 24 tcytcnacng trcacat 17 < 210> 25 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 25 gtraaytcyt crttncc 17 <210> 26 <211> 17 <212> DNA <213 > Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 26 aanarraayt tccaytc 17 <210> 27 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 27 acrtgrtart artcrta 17 <210> 28 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 28 ccyttnccrt aytgcat 17 <210> 29 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 29 ayraanckrt artarca 17 <210> 30 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> primer for amplifying intron of clock gene <400> 30 aaccanatcc aytgytg 17

Claims (3)

An organism identification method comprising using a nucleotide sequence of a time gene intron as a DNA fingerprint. The method of claim 1, Preparing polymerase chain reaction primer pairs capable of amplifying introns using conserved region sequences before and after the time gene introns; Amplify the intron by polymerase chain reaction with the prepared primer, Determining the sequence of the amplified intron DNA fragment; And And identifying the organism by the base sequence information of the intron. Oligonucleotides for use in organism identification methods comprising at least one selected from the group consisting of oligonucleotides of SEQ ID NOs: 1-30.