KR100363725B1 - Novel grass species Benest 3 - Google Patents

Abstract

The present invention relates to a new breed of grass, Benest Three (Benest 3), and after mating Anyang middle ground with excellent disease resistance, cold resistance, and Dongrae Goryeo with excellent texture, whether or not the mating of dongnae Goryeo, a pollinated breeding breeding breeding system For analysis, the Dongnae Goryeo specific Operon Primer was selected and RAPD assay was used to select the Dongrae Goryeo specific DNA marker, analyzed its sequencing, and then developed an ATS and Dongrae Goryeo crosses with the developed STS marker. Testing of individual and turf varieties has the effect of providing new varieties of grass with very good properties.

Description

Grass new species Benest Three {Novel grass species Benest 3}

The present invention relates to a new breed of grass Benest 3 (Benest 3). More specifically, the present invention relates to an excellent new grass varieties Benest three obtained the advantages of each by crossing the Anyang middle ground with excellent disease resistance, cold resistance and Dongnae Goryeo excellent texture.

Korean grass is a perennial herbaceous plant belonging to the flower family, and it breeds with crawling and underground diameters and shows many variations in form and characteristics depending on the region. Studies so far deuljandi (Z. japonica), Jandi (Z. matrella) in Korea, velvet grass (Z. tenufolia), Conger grass species, such as 5-6 (Z. sinica), wangjandi (Z. macrostachya) Grass is reported to be distributed. Korean turf is a rugged grass that grows widely in Far East Asia, including Korea, and is used in almost every place such as gardens, parks, stadiums, golf courses, road slopes, reclaimed land, and airports. In particular, Korean grass is the most suitable grass in Korea's climate, and it is more environmentally compatible than other cold grass and other warm grass. In particular, it is known to be strong in dry resistance, pressure resistance, cold resistance, weather resistance and flame resistance. However, there is a disadvantage in that the composition of the grass is slow, the green period is short, and breeding for excellent varieties is required accordingly.

In Korea, grasses native to Korea were collected by Yoo Dal-young and Salinity of Seoul National University since 1965. Among them, 63 outstanding individuals were selected. Subsequently, Salin, Young-Kyu Jo, and Han Song-Song participated in the germplasm collection activity of the United States Departmenet of Agriculture (USDA) in 1982 and reported fast, salt-proof trilobite Z. koreana (Yeam et al., 1986). Kim, 1989). Later, from 1985 to 1994, the research on the breeding of Zoysia grass was almost stopped and no further progress was made. Since 1995, Konkuk University, Dankook University, and Anyang Turf Environmental Research Institute have been conducting research on the Korean turf owned by Seoul National University. However, although Korea is the origin of Korea's grass (zoysia grass), new breeding and utilization of Korean grass is far behind compared to the US and Japan due to the lack of government support and breeding research.

In 1992, with the Convention on Biological Diversity, countries around the world began to recognize the importance of genetic resources more seriously.In addition to excellent genetic resources, gene sources whose performance or characteristics are not known are increasingly difficult to export or sell outside the country. ought. Since the international agreement on biodiversity came into force in December, countries around the world have been busy gathering their seeds. This is because the Convention on Biological Diversity recognizes the ownership of endemic seeds in each country.

Among the grasses, most of the grass species used in golf courses, stadiums, and parks in Korea are grass turf, and some of the grass is used in the southern region, but the varieties that have been systematically selected and bred have not been developed. While developed countries such as the United States and Japan are rapidly collecting grasses that show excellent characteristics of Korea and Southeast Asia, they use them to carry out grass breeding and sell superior varieties to countries around the world. In most cases, most of the Korean turf currently in the market is randomly selected and multiplied, so the classification of varieties is not clear and the variety of grass is mixed indiscriminately, resulting in poor uniformity. In addition, recently, the grass imported from foreign countries is being distributed at a low price, deteriorating the competitiveness of the Korean grass market. Therefore, it is urgently required to collect grass of Korea having excellent genetic traits and growth characteristics and to cultivate grass having excellent characteristics using the same.

In grass breeding, selection breeding has been the main breeding method so far, and the present inventors performed a breeding breeding method in order to grow grass having a specific shape.

Anyang Jungji is a grass collected by Samsung Byung Chul Lee's president, and has been widely used for fairway, tee planting and Samsung Group's landscaping, including Anyang Benest Golf Club. It is a new breed patented 22500. Anyang middle ground is a middle class of Z. sinica, with 3 ~ 4mm leaf width , showing intermediate characteristics between Z. japonica and Z. matrella , and growth habitability is not creeping type. Rather, it is a high-growing type. It is a grass of Z. matrella type which constitutes the fairway of Dongnae Benest Golf Club which is considered to be Dongrae. It has a narrow leaf width of 2 ~ 3mm and has the disadvantage of being impossible to overwinter in the grass or the central region.

In order to cultivate new varieties of grasses with the advantages of Anyang middle ground with excellent disease resistance and cold resistance and Dongrae Goryeo with excellent texture, the present inventors have obtained crossbreeds that have acquired their respective advantages by crossing Anyang Middle ground and Dongnae Goryeo. Analysis of the nucleotide sequence of Dongrae Goryeo specific DNA fragments obtained using the selected Dongrae Goryeo Selective Operon Primer using the assay method, and the STS marker analysis prepared by converting the primers to perform grass analysis with excellent phenotype New varieties were prepared and screened. The new grass species of the present invention was found to be a very excellent variety with excellent utility value even as a golf course lawn and construction planting lawn.

Accordingly, it is an object of the present invention to provide a new varieties of grass varieties with excellent varietal characteristics produced as a result of crossing Anyang middle ground with excellent disease resistance, cold resistance, and Dongnae Goryeo with excellent texture.

The above object of the present invention is to pollinate the pollen of Dongrae Goryeo in the pistil of Anyang stop and then obtain the hybrid species to determine whether or not the mating of Goryeo Goryeo Goryeo Goryeo and Anyang DNA DNA of the Dongrae Goryeo and Anyang Stop OPD12 primer Reaction and RAPD analysis resulted in obtaining Korean-specific DNA fragments and analyzing the nucleotide sequences. Based on this nucleotide sequence, 12 bases were added to the OPD12 primer to prepare STS markers, and then used in the Dongnae Goryeo crossbreed grass varieties. It was achieved by producing a new varieties of Venest three grass.

Hereinafter, the configuration of the present invention will be described in detail.

1 is an electrophoresis result showing the identification results of specific RAPD markers for Donrae Koryogi. A, B and C show RAPD bands for operon primers C06, C16, D12, respectively.

Figure 2 shows the results of the hybridization test using OPD12 for the plants assumed to be F ₁ plants.

3 shows the results of electrophoresis of recombinant clone predictors digested with Eco RI.

Figure 4 shows the results of sequencing of Dongrae Goryeo specific DNA fragments amplified by the OPD12 primer. The underlined area in bold letters indicates the RAPD primer sequence.

Figure 5 shows the results of electrophoresis of STS (Sequence Tagged Site) marker for the selection of Dongnae Goryeo.

6 shows PCR results of hybrids using STS markers.

Figure 7 is a graph showing the comparison between the length of the present invention Anyang stop and Dongnae Goryeo crossbreeds Benest Three, Anyang Stop and other hybrid species.

Figure 8 is a graph showing the leaf width of the present invention Anyang stop and Dongnae Goryeo crossbreed species Benest Three, Anyang Stop, Dongnae Goryeo and other hybrid species.

Figure 9 is a graph showing the comparison of the length of the lap diameter of the present invention Anyangji and Dongnae Goryeo crossbreeds Benest Three and other hybrids.

Figure 10 is a photograph showing the morphological characteristics of the present invention grass new varieties Benest Three grown in pots.

The present invention comprises the steps of pollinating the pollen of the pollinated Dongnae Goryeo to the pistil of Anyangji, the seed parent to produce a hybrid species; Seeding the deleted seeds after mating, sowing, germinating, cultivating in a greenhouse to obtain 46 plants estimated to be hybrids; Extracting the DNA of Anyang Middle and Dongnae Goryeo to select specific markers showing different polymorphism through RAPD analysis between Anyang Middle and Dongrae Goryeo grass, and performing RAPD analysis using a total of about 40 operon primers such as OPC06; Identifying the OPC06, OPC16, and OPD12 primers that amplify the Dongrae Gorge specific band among a total of about 40 primers, and reacting with the grasses of 46 putative hybrids to confirm that the OPD12 amplifies the Dongdae Gorge specific band D12-900 of 900bp; Reacting the OPD12 primer with 46 putative hybrids to obtain seven hybrids identified as being amplified by the dongryok specific band; Confirming whether the Koryo-specific band is specifically amplified only in Kori grass; After inserting the Koryo specific DNA fragment D12-900 into a vector and introducing it into E. coli DH10B to transform it, the plasmid DNA was isolated from the recombinant, and then digested with Eco RI to clone the Koryo specific DNA fragment cloned. Obtaining a clone and analyzing the nucleotide sequence; Preparing a STS marker (Sequence tagged site marker) by synthesizing a long primer in a forward and reverse direction by adding 12 bases to a random primer base sequence used for RAPD analysis after the base sequence analysis; Using the STS markers to perform RAPD analysis on the breeding species and Anyang Intermediate breeding to identify an analysis of breeding lines and mating individuals; The seven varieties with different characteristics were examined by examining the growth of leaf width, leaf length, lap diameter and other characteristics of the Anyang middle and east goryeo crossbreeds, and among them, the excellent varieties were vigorous and the total height was lower than that of Anyang middle ground. Naming the new grass varieties Benest Three (Benest 3) of the present invention; Planting or cultivating plants containing terrestrial crawling or underground diameters, and asexually breeding or dividing fertilized areas, node parts, immature plants, immature embryos, and tips of roots and harvesting them on MS medium, and then regenerating callus or multishoot By the step of confirming the asexual breeding of the new varieties of the present invention Benest three.

Hereinafter, the configuration of the present invention will be described in detail by way of examples, but the scope of the present invention is not limited thereto.

Example 1 Acquisition of New Varieties by Crossing Anyang Stop and Dongnae Goryeo

A new breed of grass was obtained by crossing the Anyang middle ground as a seed parent and Dongnae Goryeo as a potted parent.

First step. Preparation of mating grass

Anyang Intermediate and Dongnae Goryeo were collected with a hole cutter with a diameter of 11.5cm and planted in a pot (inner diameter of 16.5cm). Anyang Jungji was planted at the end of February, 1998, and was wintered in a greenhouse maintained at 5 ° C in November, 1997. In order to match the flowering times of the two grass varieties, Dongrae Goryeo, which is earlier than the Anyang middle ground, was placed in the greenhouse from March to April.

Second step. Crossing between Anyang Stop and Dongrae Goryeo

The seed parent was Anyang middle ground, and the pollen parent was Dongnae Goryeo. The mating was harvested from early morning to evening pollen from early morning to evening for one month from April 10 to May 10, 1998, and pollinated the pistils of Anyang Middle School. When the pistil turned yellow after a few minutes, the operation of Anyang Stop, the seed's parent, came up and removed it from time to time to prevent the magnetization of Anyang Stop.

In general, it is known that the dongnae Goryeo was selected as a faster time than that of Anyang Middle East, and some of the Dongrae Goryeo overwintered in the greenhouse were taken out of the greenhouse at the beginning of March and controlled in bloom. Dongnae Goryeo, which was moved into the greenhouse, began to be lauded on March 10. Dongrae Goryeo, which was taken out of the greenhouse, was admitted into the greenhouse twice on March 23 and March 30, and during the period outside the greenhouse, the cold wave came about a week later, and it was much slower than expected. It was. However, the flowering period of Dongnae Gorge growing in the greenhouse lasted for more than a month, and it was possible to receive flower pots from these plants for mating. Anyang Middle School started to be pulled around April 5, and it was possible to breed from April 10.

Third step. Mating seeding

Two months after mating, harvested seeds were harvested from June 4 to June 17.

802 seeds were collected from a total of 57 flower beds. Of the 802 seeds, 287 seeds were straight and only 515 seeds were identified as faithful seeds (Table 1).

Seed breeding of hybrid varieties by crossing between Anyang Stop and Dongnae Bridge Total number of flowers Average seed count per flower Total seed count Jagged Faithful seed 57 19 802 287 515

Fourth step. Seed treatment and sowing

The seeded seeds were wrapped with gauze and treated dropwise with Tween-20 in 25% KOH solution for 30 minutes. After KOH treatment, the seeds were immersed in running water, washed with water for 24 hours, seeded in a petri dish, germinated at 30 ° C. for 3 days, and then transplanted into soil to grow in a greenhouse.

The germination rate of these hybrids was about 60%. During the seedling period, hybrid plants were cultivated in the greenhouse, and during the cultivation of seedlings in the greenhouse, the rainy season continued, and many seedlings died of rust and leaf blight. Only 70 of them survived and were planted in the experimental packaging. The 70 surviving individuals were planted on the pavement, and the following DNA analysis was carried out using the 46 surviving individuals.

Example 2 Selection of Dongrae Kori-Specific RAPD Primer Labels

In order to determine whether or not pollen mating of 46 individuals estimated to be the Anyang stop and Dongrae Goryeo hybrid of Example 1 was selected Dongrae Goryeo specific RAPD primer.

Since it was used as a pollinate, it has a specific marker when it is crossed. Therefore, in order to determine whether the mating, you should select a marker that is specifically amplified in Dongnae Goryeo. RAPD analysis between Anyang Stop and Goryeoji Grass selected specific markers with different polymorphisms.

First step. Selection of Dongrae Goryeo specific label by DNA extraction, PCR amplification, electrophoresis and RAPD analysis

In order to select the Dongrae Goryeo specific label, a total of 40 Operon Primer (Operon Primer) including OPC06 was used for RAPD analysis.

In order to extract DNA of Anyang Stop and Dongrae Goryeo, 2g of the leaves of Anyang Stop and Dongrae Goryeo grass grown in the experimental packaging were pulverized with liquid nitrogen, and 150 µl of this was transferred to 1.5mL microtube. . DNA extraction buffer (extraction buffer; 0.35M sorbitol, 0.1M Tris-base, 5mM EDTA: pH 7.5): Nuclei lysis buffer; 0.2M Tris-base, 0.05M EDTA, 2M NaCl, 2% CTAB ): 5% sarkosyl was mixed with 5: 5: 2 respectively, and the solution was warmed to 60 ° C., 750 μl was added, mixed well, and heated at 60 ° C. for 30 minutes. After 30 minutes, 500 µl of chloroform was added and mixed well for 15 minutes. After centrifugation at 10,000 rpm for 10 minutes, the supernatant was taken, and the same amount of isopropyl alcohol was added to precipitate DNA. The precipitated DNA was collected by centrifugation at 10,000 rpm for 10 minutes, washed twice with 70% ethanol, blown off ethanol, and put TE buffer into the remaining DNA pellet. Melted. Final concentration of DNA was measured using a Fluorometer.

PCR was performed using Perkin Elmer 9600. PCR reaction was denaturated at 94 ° C. for 3 minutes, followed by 45 reactions of 94 ° C. for 1 minute, 35 ° C. for 1 minute, and 72 ° C. for 2 minutes. At this time, 20 μl of the reaction solution contained 20 ng of template, 100 μM of dNTP, and 0.2 μM of primer, and 10 X reaction buffer containing 1.5 mM of Mg ²⁺ was used.

The product was electrophoresed after the PCR reaction. After PCR reaction, electrophoresis was performed at 1.4% agarose gel in TBE buffer at 100V for 4 hours, stained with ethidium bromide (EtBr), and observed and photographed using an ultraviolet illuminator. The data was kept.

Among the total of 40 operon primers, OPC06, OPC16, and OPD12 were used to confirm that a distinctive Koryo specific band was amplified (FIG. 1). However, as a result of experiments to determine the mating test using 46 grasses of Example 1 overwintered in the experimental packaging after mating, OPC06, OPC16 in the mating species because these were not amplified because these bands Primers were excluded from the hybridoma assay. In the case of OPD12, approximately 900 bp of Goryeo specific bands were also confirmed in the hybrids (FIG. 2). The 900 bp DNA fragment label, which only appears specifically in Korea when OPD12 primers were used, was named D12-900.

RAPD analysis was performed by separating DNA from a total of 46 hybrids using the OPD12 primer, which amplifies the band distinguished from Dongrae Goryeo and Anyang middle ground, and the mating number 3, 15, 22, 31, 33, Since the singular band of Dongrae Goryeo was amplified in 7 individuals 36 and 42, it was confirmed that the breeding numbers 3, 15, 22, 31, 33, 36 and 42 were hybrids of Anyang Grass and Dongrae Goryeo.

Second step. Identification of Korean Grass Turf Specific Marks by RAPD Analysis

To develop DNA markers that can distinguish Korea grass from other grasses, S-94, General species, Meyer, Zenith, Korea's representative field grass, Yaji, and Anyang grass are used as experimental materials. It was. RAPD analysis was performed on the OPD12 primer by the above-described method to confirm that the D12-900 band was specifically amplified only in Dongnae Goryeo, and it was confirmed that it was specifically amplified only in Koji grass.

Example 3 Determination of the Sequence of Singularly Considered Marker and Development of Sequence Tagged Site Label

The specificity of RAPD analysis is low due to annealing at low temperature by using short primers in PCR reaction, and the same template DNA is amplified by different products depending on the reaction conditions. Many can not. In order to compensate for this problem, by analyzing the nucleotide sequence of the RAPD label, a primer having a length longer than that of the first random primer is used for PCR reaction, thereby increasing specificity and analyzing only the corresponding label. It is called (STS marker). In the present invention, an STS marker was produced by the following method.

First step. Selection, Cloning and Sequence Determination of Dongrae Koryo-specific Markers

Dongrae Goryeo specific DNA fragment (Dragment) D12-900 obtained as a result of RAPD using the OPD12 primer was recovered from an agarose gel using a DNA elution kit of QIAGEN. The separated DNA fragments were electrophoresed on an agarose gel, and then single bands of DNA recovered from the gel and their amounts were determined. Specific amplified DNA fragments were cut out and then mixed with Promega's pGEM-T easy vector at a ratio of 3: 1 for ligation at 14 ° C for 24 hours. E. coli DH10B, a host strain of E. coli , was transformed by electroporation. The transformed E. coli was applied to a medium containing 50 μg / mL of ampicillin, X-gal, or IPTG, followed by incubation for 16 hours to select a recombinant derived from white colony. The plasmid DNA was isolated by alkaline lysis. The separated plasmid was digested with Eco RI for 2 hours at 37 ° C. and electrophoresed on 1.4% agarose gel to obtain eight recombinant clones in which DNA fragments corresponding to the desired label sizes were cloned. Sequencing was performed on two clones 2 and 7 out of 8 obtained. Sequencing was performed using Sanger's chain termination method.

As shown in FIG. 3, electrophoresis of the DNA digested with the restriction enzyme revealed that there was a DNA fragment corresponding to the size of the label. The arrow shows the size of the insert. As a result of analyzing the bidirectional sequences of clones 2 and 7 among the clones containing the inserts, both 2 and 7 had the same base sequence (FIG. 4).

Second step. Conversion of Dongrae Koryo-specific RAPD Markers to STS Markers

After sequencing, long bases were synthesized in the forward and reverse directions by adding 12 bases to the random primer base sequence used for RAPD analysis. Tm of the synthesized primers were calculated to determine the annealing temperature during the PCR reaction.

Based on the sequencing results, a 22-mer oligonucleotide having both terminal sequences of each label was prepared (including the first random primer sequence) (Table 2, FIG. 4). By calculating the Tm value of the synthetic primer to determine the annealing temperature during the PCR reaction, the PCR reaction was performed. PCR reactions were carried out on four types of turfgrass, Yaji and Anyang, which are currently commercially available. Conversion of D12-900 to STS yielded the same results as in RAPD. The reaction conditions were 50 ng of DNA template, 25 nM of dNTP, 25 pmol of primer, 100 mM Tris-HCl (pH8.3), 1.25 mM MgCl 2 and 50 mM KCl were added and denatured at 94 ° C. for 3 minutes, followed by 35 times at 94 ° C. for 1 minute, 66 ° C. for 1 minute, and 72 ° C. for 2 minutes. As a result of switching to the STS using the D12-900, it was confirmed that the amplification was not performed in the other six grasses, but specifically amplified only in the grass of Dongrae Goryeo (FIG. 5). The converted STS markers can be used for analysis of crossbreeding systems.

Sequence tagged site (STS) marker primer pairs derived from cloned RAPD markers RAPD markername Primer name ^z Sequence ^y Tm Value (℃) 4 (G + C) +2 (A + T) D12-900 D12F CACCGTATCCCCAGGAAAGTTG 68 D12R CACCGTATCCTGCATGATCAAC 66

Third step. Discrimination of Anyang Stop and Dongrae Goryeo Cross Species Using STS Marks

Using the STS markers obtained through the present invention was carried out PCR of Anyang stop and Dongnae Goryeo crossbreed species (Fig. 6). As a result, the amplification was carried out only in the DNA of the individual 3, 15, 22, 31, 33, 36, 46 as in the case of the Operon Primer (D12). As a result, it was confirmed that the 3, 15, 22, 31, 33, 36, 46 individuals are hybrids of Dongnae Goryeo and Anyang middle ground.

Example 4 Growth of the Hybrids

A growth survey was conducted to register the seven hybrids of Anyang Middle and Dongnae Goryeo as new varieties of grass. As a result, most of the hybrid species were intermediate characteristics between Anyang and Dongrae Goryeo, that is, leaf width was narrower than Anyang middle ground, leaf color was similar to or slightly thicker than Anyang middle ground, and total length was less than Anyang middle ground and longer than Dongrae Goryeo Goryeo. Showed.

Anyang middle and dongnae Goryeo cross-breed length comparison is shown in Figure 7. The overall length of the plant is intermediate between Anyang and Dongnae Goryeo in the case of hybrid species. Anyang stop> # 42> # 22> Dongnae Goryeo Gorge> # 31> # 3> # 36> # 15> # 33 The total length of plants is shorter than that of S-94 and S-generals of Seoul seedlings, which are sold as existing grass varieties, and Meyer, which is widely used in the US. In addition, it is considered that the ball type is excellent in the golf course because the super-type shows the upright type in most cases.

The leaf length comparison results of the Anyang middle ground and Dongrae Goryeo crossbreeds are shown in FIG. 8. The crossover of Anyang Stop and Dongrae Goryeo showed intermediate characteristics between Anyang Stop and Dongrae Goryeo in leaf width. Leaf width was Anyang middle ground> # 3> # 31> # 22> # 42> # 15. # 33, # 36> appeared to be Dongrae Goryeo. In the case of hybrid species, no leaf width was narrower than that of Dongnae Goryeo, but in all cases, the leaf width was narrower than that of Anyang. The leaf widths of the hybrids were expected to have a good texture because the leaf widths were thinner than the conventional grass species.

A comparison of the lengths of the creep diameters of the Anyang Middle and Dongnae Goryeo hybridomas is shown in FIG. The length of the creep is closely related to the composition of the lawn. The longer the number and length of the creep diameters, the faster it is to cover the same area of land. In hybrid species of Anyang Middle and Dongnae Goryeo, the length of creep diameter was more than 40cm, and the length was in order of # 33> # 36> # 42> # 31> # 15> # 22> # 3. Especially in case of # 33, not only the length of creep is long, but the average number of creep per individual is 3.2 ± 1.3. The longest lap diameter ranged from 200 in length to # 42. Grasses with a length of 100 cm or more are considered to be very suitable as grasses to be planted in areas that require construction and fast covering.

Growth Characteristics of Anyang Intermediate and Dongnae Goryeo Crossbreeds Hybrid Growth characteristics Characteristic Leaf width (mm) Leaf length (cm) Creep diameter (cm) AM03 2.9 ± 0.1 7.4 ± 1.8 44.8 ± 3.3 Dark green, high density, smooth texture AM15 2.0 ± 0.1 6.7 ± 0.6 68.7 ± 15 Low gross, triple, stiff texture AM22 2.3 ± 0.2 9.1 ± 1.0 50.5 ± 13.3 Strong growth, low total height compared to Anyang Stop AM31 2.4 ± 0.1 7.7 ± 1.3 75.7 ± 20.6 Fast coverage, vigorous growth AM33 2.0 ± 0.0 5.2 ± 1.5 144.0 ± 13.0 Fast coverage, vigorous growth AM36 2.0 ± 0.1 7.1 ± 1.5 140.7 ± 41.3 Fast covering speed, very long length of creep AM42 2.2 ± 0.3 10.6 ± 2.4 126.8 ± 36.7 Fast covering speed

Among the seven breeding varieties, the grass width 2.3 ± 0.2㎜, leaf length 9.1 ± 1.0㎝, creeping length 50.5 ± 13.3㎝ and growth is high and the total height is lower than Anyang middle ground. It was named Three (Benest 3). 10 shows the morphological characteristics of the new varieties of grass grown in pots.

Example 5: Asexual breeding method of the new varieties of the present invention Benest three

Zoysia grass is characterized by very strong creepiness and is propagated laterally by ground crawling and underground diameters. Rhizomes are horizontal stems that extend horizontally, with each eye producing one eye, which is a shoot, a new shoot, and eventually the stem of the ground that produces the branches. Becomes At the same time, roots emerge from each node of the underground diameter. Stolons are horizontal stems on the ground that also have pedicles and roots at each node. New varieties of grassy grasses, a kind of Korean grass, have the ability to spread by underground or ground crawling and form a dense cushion-like form.

Asexual breeding of the new grass varieties Benest Three of the present invention was carried out as in the following experimental example.

Experimental Example 1. Propagation Method by Sprigging

Sprigs are parts of grassy plants that contain terrestrial or underground diameters. Sprigs of the new varieties of Venetian turf were cut to include nodes and planted 2 to 3 inches deep at intervals of 6 to 12 inches (inches). After planting, water was supplied and managed sufficiently, and grass and roots came out from each node.

Experimental Example 2. How to multiply by stolonizing

New varieties of grass were cut to cover the ground or underground diameters of the Benest Three, so that they were scattered in areas where grass forge was formed. In order to prevent drying after midwife, watering was performed after surface covering. This method requires a larger amount of grass than the Sprigging.

Experimental Example 3. How to multiply by Sodding

When planting wide and flat square grass turf with a length of 2 to 6 feet and a width of 1 to 1.5 feet at regular intervals, the empty space between the turf is filled by ground crawling and underground. lost.

Experimental Example 4. How to multiply by plugging

A plug is a small piece of cymbal, cylindrical or block shaped. When the grass plugs were planted at regular intervals, the space between the plugs was filled by the ground crawling and underground views, thereby creating a lawn.

Experimental Example 5. How to multiply using multishoot

After disintegrating tissues with strong divisions such as ground crawling or underground section, and fertilization, MS containing BA (6-benzyladenin) 0.1 ~ 1.0mg / L and NAA (1-naphthaleneacetic acid) 0.05 ~ 0.1mg / L (Murashige Skoog) was wounded in a medium to abandon the multishoot. The separated multishoots were separated into individual individuals and transferred to 1/2 concentration of medium containing no hormone (Table 4). The rooted plants were purified and grown in greenhouses.

Composition of MS medium Constituent Concentration (mg / L) Macronutrients KNO ₃ 1900 NH ₄ NO ₃ 1650 MgSO _{4 7} H ₂ O 370 KH ₂ PO ₄ 170 CaCl ₂ · 2H ₂ O 440 Micronutrients H ₂ BO ₃ 6.2 MnSO ₄ 4H ₂ O 22.3 ZnSO ₄ · 7H ₂ O 8.6 NaMoO ₄ 2H ₂ O 0.25 CuSO ₄ · 5H ₂ O 0.025 CoCl ₂ · 6H ₂ O 0.025 KI 0.83 FeSO ₄ 7H ₂ O 27.8 Disodium EDTA 37.3 Glycine 2 Sucrose 30 × 103 Vitamins Thiamine hydrochloride 0.5 Pyridoxine hydrochloride 0.5 Nicotinic acid 0.5 myo-inositol 100 pH 5.7

Experimental Example 6. How to multiply and replant plants from callus

2,4-D (2,4-dichlorophenoxyacetic acid) after harvesting and disinfecting tissues with strong divisions such as nodules, immature plants, immature embryos, spermatozoa, tip of roots, etc. The callus was organic on the MS medium (Murashige Skoog) (Table 4) of Experimental Example 5 containing 1 to 5 mg / L and 0.5 to 1.0 mg / L of kinetin. The released callus was transferred to a 1/2 medium medium containing no hormones to regenerate the plants. The regenerated plants were purified and grown in greenhouses.

As is apparent from the above examples, the present invention crosses Anyang middle ground with excellent disease resistance and cold resistance, and Dongrae Goryeo with excellent texture, and then PCR using a Dongrae Goryeo specific STS marker produced using Dongrae Goryeo specific DNA label. As a result, we have obtained excellent new grass varieties Benest 3 (Benest 3), which has obtained the advantages of each, and these new grass varieties have short blade lengths and shorter lawn cuttings, and the leaves are upright. It is a very useful invention in the grass breeding industry and the grass breeding industry because the length of the crawling cloth is excellent as a grass for planting, the texture is excellent, and the breeding effect is excellent.

Claims (1)

Anyang Middle and Dongrae Goryeo were produced by mating by sexual reproduction method, with leaf width 2.3 ± 0.2㎜, leaf length 9.1 ± 1.0㎝, creep length 50.5 ± 13.3㎝, lower than that of Anyang Medial, and growing more vigorously. Grass new varieties Benest Three (Benest 3), characterized by planting or cultivating grass vegetation contained in this grass.