KR100349815B1 - Gene expression system for mass production of antimicrobial peptides - Google Patents

Abstract

The present invention relates to genetic constructs capable of producing large quantities of peptide antibiotics from microorganisms, methods for efficiently producing large quantities of peptide antibiotics from microorganisms, and vectors useful therein. The genetic construct according to the invention consists of a first gene sequence encoding all or part of a purF gene or derivatives thereof and a second gene sequence encoding a peptide antibiotic. Preparing an expression vector comprising the gene construct according to the present invention; Transforming bacterial host cells with said vector; Culturing the transformed cells so that the gene construct is expressed; By recovering the peptide antibiotics can be mass-produced peptide antibiotics.

Description

Gene expression system for mass production of antimicrobial peptides

TECHNICAL FIELD The present invention relates to recombinant DNA technology, and to methods for producing large quantities of peptide antibiotics in microorganisms, gene constructs and vector systems useful therein.

Peptides with biological activity (hereinafter referred to as 'peptide antibiotics') exhibit an antimicrobial activity by a different mechanism of action than conventional antibiotics, which are problematic for microbial resistance, and thus have the advantage of being less likely to cause resistance. . Therefore, peptide antibiotics have a high possibility of industrial application in the pharmaceutical and food fields.

However, the biggest obstacle to the industrial use of the above described peptide antibiotics is that the methods up to now cannot provide these inexpensively and in large quantities. For example, the production of peptide antibiotics by chemical synthesis has a problem of low economical efficiency, and attempts to produce peptide antibiotics by genetic engineering techniques using microorganisms, but the expression rate of peptide antibiotics is very low. There was a problem.

U.S. Patent 5,205,154 reports a gene construct consisting of a gene of a polypeptide capable of inhibiting the antimicrobial activity of cecropin and a secroffin gene linked to the polypeptide, and has presented an araB gene as an example of the polypeptide.

U.S. Patent 5,593,866 suggests a method for producing positively charged antimicrobial peptides in the form of fusion proteins with negatively charged peptides that inhibit degradation of bacteria by protease.

The present invention provides a gene construct capable of expressing a large amount of peptide antibiotics in a microorganism.

The present invention provides a gene construct that can effectively produce and recover peptide antibiotics in microorganisms.

The present invention provides gene construct multimers and methods for preparing the same that are effective for isolation and purification while increasing the number of gene expressions of desired products.

The present invention provides an expression vector capable of mass expression of peptide antibiotics in a microorganism.

The present invention provides a method for mass production of peptide antibiotics from microorganisms.

1 is a nucleotide sequence of a peptide antibiotic gene used in the present invention.

2 is the nucleotide sequence of a fusion partner gene.

3 is a schematic diagram of a method for fusion of a fusion partner and MSI-344 gene while generating CNBr loci.

4 is a schematic of a method for fusion of a fusion partner with an MSI-344 gene while generating hydroxylamine sites.

5 is a schematic diagram of a method for preparing a fusion multimer in the transfer step.

6 is a schematic diagram of a method for preparing a vector pGNX2.

7 is a schematic diagram of a method for preparing a vector pT7K2.1.

8 is a schematic diagram of a method for producing a vector pGNX3.

9 is a vector pGNX4.

10 is a schematic diagram of a vector pGNX5 manufacturing method.

11 is an SDS-PAGE photograph of transformant lysates expressing MSI-344 using lactose and IPTG as inducers, respectively.

12 is a SDS-PAGE picture of MSI-344 expression according to vector type.

13A of FIG. 13 is an SDS-PAGE photograph of a transformant lysate expressing various peptide antibiotics using lactose as an inducer, and 13b is a transformation of various peptide antibiotics expressed using lactose as an inducer SDS-PAGE picture of sieve lysate.

14A, 14B, 14C and 14D are SDS-PAGE photographs of transformant fragments expressing various peptide antibiotics using lactose as an inducer.

15 is an SDS-PAGE photograph of a transformant lysate in which the fusion gene is transformed into monomer, dimer and tetramer forms.

The present invention relates to a gene construct capable of effectively expressing a large amount of peptide antibiotics in E. coli or prokaryotic cells.

An essential requirement for the mass expression and production of peptide antibiotics in microorganisms is to effectively neutralize the toxicity to the microorganisms of peptide antibiotics. To this end, in the present invention, purF (glutamine pyrophosphoribosyl pyrophosphate amidotransferase; Genbank No: X12423) (Tso et al., J. Biol. Chem., 257: 3525, 1982, Makaroff et al., J) as a fusion partner to the peptide antibiotic gene Biol. Chem., 258: 10586, 1983) genes, portions thereof or derivatives thereof (hereinafter referred to as purF gene derivatives) are provided.

The purF gene derivative used as a fusion partner in the gene construct according to the present invention allows the peptide antibiotic to be expressed in a large amount in the form of a fusion polypeptide with the purF derivative without killing the host cell in the transformant Escherichia coli. Therefore, even with a powerful expression system, the host cell does not die and can produce a large amount of the desired peptide antibiotic from the host microorganism.

When the peptide is expressed using the fusion partner according to the present invention, the peptide antibiotics can be cleaved and separated from the fusion protein using proteolytic enzymes or chemicals, for example, Factor Xa or enterokinase (enterokinase). DNA sequences encoding amino acid residues that are cleaved by proteolytic enzymes such as), chemicals such as bromine cyanide (CNBr) or hydroxylamine can be inserted between the fusion partner and the peptide antibiotic gene.

For example, to assign a site that is cleaved by CNBr, a restriction enzyme site containing a Met codon (ATG) that fits the reading frame at the 3 'end of the fusion partner, for example Afl III, Bsm I, BspH I, BspLU11 I, Nco I, Nde I, Nsi I, Ppu10 I, Sph I, Sty I or their isoschizomer sites are inserted to cleave with restriction enzymes to produce ends compatible with this restriction enzyme The restriction enzyme site linked to the reading frame can be inserted into the 5 'end of the peptide antibiotic gene and cleaved with the enzyme, thereby connecting the fusion partner and the peptide antibiotic gene.

As another example, a DNA sequence capable of encoding Asn-Gly can be inserted between the fusion partner gene and the peptide antibiotic gene to confer sites cleaved by hydroxylamine. For example, in the case of fusion of two genes, a restriction enzyme site or an isoskizomer site containing an Asn codon having a reading frame at the 3 'end of the fusion partner is inserted, and then cleaved with this enzyme and compatible with the enzyme. A restriction enzyme site including a Gly codon to which the leading frame is linked while generating a terminal or blunt end is inserted into the 5 'end of the peptide antibiotic gene and cleaved with the restriction enzyme, and then the fusion partner and the peptide antibiotic gene are separated. The fusion partner genes and peptide antibiotics can be fused to each other.

Gene constructs according to the invention can be cloned into host cells by inserting into a vehicle capable of inserting or incorporating expression vectors, eg, plasmids, viruses or other structural genes commonly used in the art. have.

The present invention also relates to a multimer and a method for producing the same, which increase the number of gene expressions of a desired product and at the same time facilitate the separation and purification of the desired product.

The multimers according to the invention consist of the following units;

a) a first restriction enzyme site capable of generating an initiation codon Met b) a structural gene c) a ribosomal binding site (RBS) and d) a second restriction enzyme that can be linked to a first restriction site and make an initiation codon Seat. Here, the stop codon and the RBS of the structural gene may overlap each other up to about 2 bp, or may be located up to about 500 bp apart. The distance between second restriction enzyme sites capable of generating an initiation codon in RBS can be about 5-30 bp. The 3 'end and 5' end of the multimer may be in a form cleaved by the first restriction enzyme and the second restriction enzyme, respectively.

The multimers according to the present invention may be prepared by various methods using techniques well known in the art of genetic manipulation, and may be prepared according to the following methods as an example.

When the previously described structural unit is cleaved with the first restriction enzyme and the second restriction enzyme, and then the cleaved structural units are connected, the multimers are linked to each other in the same direction, and the multimers containing at least one unit connected in the reverse direction are mixed. To obtain a mixture. Multimers containing one or more reversely linked units regenerate the first restriction enzyme site or the second restriction enzyme site at the linking site, thus simultaneously cutting the multimeric mixture back into the first restriction enzyme and the second restriction enzyme, for example. For example, when separated by agarose gel electrophoresis, it is possible to separate only multimers in which each unit is connected in only one direction.

The multimers according to the invention are transcriptionally fused multimers, in which repeated structural genes are transcribed into a single mRNA, but each structural gene expression is not linked to each other, ie several single expressions. It means a multimer which is translated into water.

In the case of the conventionally presented translationally fused multimers, since the desired structural gene expression is linked and present in one polypeptide, a separate cleavage process is required to obtain the desired active expression from the polypeptide. In addition, when the expression is a fusion protein, even when using the same cleavage step as compared to the expression obtained from the fusion multimer in the transcription step, a larger amount of cleavage reagent is required and there is a problem that the cleavage efficiency is low. In contrast, the multimeric gene construct of the present invention does not require a separate cleavage process when the repeating structural gene is expressed, or even when a cleavage process is required, such as a fusion protein, a cleavage that requires fewer peptide bonds per mole of the fusion peptide. Not only can the amount of reagents be reduced, but the cutting efficiency is increased.

As such, the multimers of the present invention can increase the number of gene expressions in a host and are advantageous for the isolation and purification of the desired product, and are more effectively expressed in the host than the monomers.

Gene construct multimers and methods for producing the same according to the present invention are not limited to the preparation of peptides or fusion peptides, and are applied to expressing various structural genes such as enzymes, hormones, antibiotics, etc. in a microorganism in a single form or in a fused form. can do.

Therefore, the genetic construct according to the present invention is preferably prepared in the form of a fusion multimer of the transcription step according to the present invention. When the gene construct according to the present invention is prepared in the form of a multimer, as described above, it is not only advantageous for the separation and purification of the desired product, but also more effectively expressed in the host than the monomer.

In addition, the present invention relates to an expression vector in which the expression of a foreign gene can be effectively induced by cheap lactose instead of expensive IPTG.

The expression vector of the present invention consists of a high copy number replication origin, a strong transcriptional promoter and a structural gene and does not include the lacI ^q gene.

The origin of replication may use colE1 or p15A. Examples of potent transcriptional promoters may include tac, trc, trp, T7Φ10, P _L promoters, other microbial induction promoters or constitutive promoters. In addition, it may include a selection marker gene for determining whether to transform the vector, such selection marker gene may compensate for nutritional resistance of the antibiotic resistance gene or host such as ampicillin, kanamycin, tetracycline, chloramphenicol and the like Genes can be used.

The expression vector according to the present invention can effectively induce gene expression by adding lactose instead of IPTG, preferably IPTG and lactose can be used together.

As an example, the plasmid obtained by inserting the structural gene into the expression vector according to the present invention is transformed into a host, and the transformant is transformed at 30-37 ° C. for 5-18 hours in a medium containing 50-300 μg / ml of kanamycin. Pre-incubate, inoculate 1/100 (v / v) of the preculture in fresh medium and incubate at 30-37 ° C. To induce expression, 0.01 mM-10 mM IPTG is added when the cell density is between OD ₆₀₀ 0.2-2 for IPTG induction and 0.2-10% lactose when between OD ₆₀₀ 0.2-2 for lactose induction Or add 0.2-10% lactose concurrently with inoculation. IPTG and lactose can also be used together, which can significantly reduce the amount of IPTG used.

The expression vector according to the present invention preferably further comprises a transcription terminator.

In addition, the expression vector of the present invention allows the expression product to be obtained in an insoluble state in water, and thus is particularly useful for producing products that are lethal to the host, for example.

The vector into which the gene construct of the present invention is inserted can be transformed into a microorganism by a method used in the field to which the present invention belongs. For example, prokaryotic cells such as E. coli can be transformed by the CaCl ₂ method, or by physical methods such as electroporation or microinjection.

In the present invention, the host is not particularly limited, but for example, E. coli strains BL21 (DE3), BLR (DE3), B834 (DE3), AD494 (DE3), JM109 (DE3), HMS174 (DE3), UT400 (DE3), UT5600 (DE3) and the like can be used, the culture medium may use LB, M9, M9CA, R depending on the characteristics of each host or the transformants obtained, and add growth factors depending on the host.

LB medium (10 g / l bacto-tryptone, 5 g / l yeast extract, 10 g / l NaCl)

M9 medium (Na ₂ PO ₄ .7H ₂ O 12.8 g / l, KH2PO4 3.0 g / l, NaCl 0.5 g / l, NH4Cl 1 g / l, glucose 4 g / l, MgSO ₄ 2 mM, CaCl ₂ 0.1 mM)

M9CA medium (M9 medium + 0.2% casamino acid)

R medium (Reisenberg _{medium; KH 2 PO 4 13.3 g /} l, (NH 4) 2HPO 4 4.0 g / l, citric acid _{0.17 g / l, MgSO 4 .7H} 2 O 0.22 g / l, glucose 20 g / l, a very small amount Elemental solution 10 ml / l)

Trace element solution (ferric citrate 7.3 g / l, CoCl 2 .6H2O 0.5 g / l, MnCl 2 .4H 2 O 3.2 g / l, CuCl 2 .2H 2 O 0.3 g / l, H 3 BO 3 0.7 g / l _{, NaMoO 4 .2H 2 O 1.68 g} / l, thiamine HCl 0.5g / l, EDTA 1 g / l)

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only to specifically describe the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

Example 1 Gene Preparation of Peptide Antibiotics

In order to effectively express the MSI-344 gene in E. coli and to facilitate genetic manipulation, two kinds of MSI-344 genes were synthesized by PCR method (FIG. 1). As a template for PCR, pNH18a-MBP-MSI-78 described in Korean Patent Application 97-29426 was used. Using primers 1 and 2 of Table 1, the fusion peptide was digested with CNBr to synthesize sequence (a) designed to isolate MSI-344, and using hydroxyls 3 and 4 of Table 1, Sequence (b) designed to be cleaved with amines was synthesized.

Nde I (SEQ ID NO: a) and Sma I (SEQ ID NO: b) sites were inserted before the MSI-344 gene and sub-cloned after the MSI-344 gene for subcloning each MSI-344 gene into the expression vector according to the reading frame. Codons TAA and TGA were inserted. In addition, a ribosome binding site (RBS) and an Ase I site overlapping the stop codon and the 1 base were inserted to prepare a multimer in the transcription step. The two obtained MSI-344 genes were inserted into pCR2.1 vector (Invitogen, USA) to prepare a vector pCRMSI comprising the sequence (a) and a vector pCRMSI 'containing the sequence (b).

Chemically synthesized oligonucleotides (Table 1) were annealed or annealed followed by PCR to prepare peptide antibiotic genes as described in FIG. In the case of Apidaecin I, Indolicidin, and Tachyplesin I, DNA sequences were inferred from the amino acid sequence (Maloy and Kark, Peptide Science, 37: 105, 1995). Genes were chemically synthesized with codons to maximize expression rates in E. coli. In the case of Bombinin, CPF1, Drosocin, Melittin, HNP-I, PGQ, and XPF, the N-terminal and C-terminal designed to anneal a portion (8-10 bp) to each other Corresponding oligonucleotides were synthesized and a complete gene was prepared using annealing after PCR. The properties of each peptide antibiotic are listed in Table 2.

3 ') primer One TCCGGATCCATATGGGTATCGGCAAATTCCTG MSI-344 (a) Synthetic primer (32mer) 2 GCATTAATATATCTCCTTCATTACTTTTTCAGGATTTTAACG MSI-344 (a) Synthetic primer (42mer) 3 GGATCCCGGGATCGGCAAATTCCTGAAAAAGG MSI-344 (b) Synthetic primer (32mer) 4 GGATCCATTAATATATCTCCTTCATTAC MSI-344 (b) Synthetic primer (28mer) 5 GGTAACAACCGTCCGGTTTACATCCCGCAGCCGCGTCCGCCGCACCCGCGTACTTGA Primer for Apidaesin I Synthesis (57mer) 6 AATTCTCAAGTACGCGGGTGCGGCGGACGCGGCTGCGGGATGTAAACCGGACGGTTGTTACC Primer for Apidaesin I Synthesis (62mer) 7 GGTATCGGTGCGCTGTCTGCGAAAGGTGCGCTGAAAGGTCTGGCGAAA Bombinine Synthesis Primer (48mer) 8 CGAATTCTCAGTTCGCGAAGTGTTGCGCCAGACCTTTCGCCAGACCTTTCAGCGCACC Bombinine Synthesis Primer (58mer) 9 GGTTTCGCGTCTTTCCTGGGTAAAGCGCTGAAAGCGGCGCTGAAAATC Primer for CPF Synthesis (50mer) 10 CGAATTCTCACTGCTGCGGCGCACCACCCAGCGCGTTCGCACCGATTTTCAGCGCCGCTT Primer for CPF Synthesis (60mer) 11 GGTAAACCGCGTCCGTACTCTCCGCGTCCGACCTCTCAC Primer for drosocin synthesis (39mer) 12 CGAATTCTCAAACCGCGATCGGACGCGGGTGAGAGGTCGGACGCGGAGA Primer for drosocin synthesis (49mer) 13 GCATGCCATGGCGTGCTACTGCCGTATCCCGGCGTGCATCGCGGGTGAACGTCGTTACGG Primer for HNP-I Synthesis (60mer) 14 CGAATTCTCAGCAGCAGAACGCCCACAGACGACCCTGGTAGATGCAGGTACCGTAACGAC Primer for HNP-I Synthesis (60mer) 15 CATGATCCTGCCGTGGAAATGGCCGTGGTGGCCGTGGCGTCGTTGAG Primer for indolidine synthesis (47mer) 16 AATTCTCAACGACGCCACGGCCACCACGGCCATTTCCACGGCAGGAT Primer for indolidine synthesis (47mer) 17 GGTATCGGTGCGGTTCTGAAAGTTCTGACCACCGGTCTGCCGGCGCTG Melitin Synthesis Primer (48mer) 18 CGAATTCTCACTGCTGACGTTTACGTTTGATCCAAGAGATCAGCGCCGGCAGACCGGT Melitin Synthesis Primer (58mer) 19 GGTGTTCTGTCTAACGTTATCGGTTACCTGAAAAAACTGGGTACC PGQ Synthesis Primer (45mer) 20 CGAATTCTCACTGTTTCAGAACCGCGTTCAGCGCACCGGTACCCAGTTTTTTCAG PGQ Synthesis Primer (55mer) 21 CATGAAATGGTGCTTCCGTGTTTGCTACCGTGGTATCTGCTACCGTCGTTGCCGTTGAG Primer for Tachyplesin Synthesis (59mer) 22 AATTCTCAACGGCAACGACGGTAGCAGATACCCCGGTAGCAAACACGGAAGCACCATTT Primer for Tachyplesin Synthesis (59mer) 23 GGTTGGGCGTCTAAAATCGGTCAGACCCTGGGTAAAATCGCGAAAGTT Primer for XPF Synthesis (48mer) 24 CGAATTCTCATTTCGGCTGGATCAGTTCTTTCAGACCAACTTTCGCGATTTTACCCAG Primer for XPF Synthesis (58mer) 25 GGATCCATATGTGCGGTATTGTCGGTATCG Primer for F Synthesis (30mer)

3 ') primer 26 CATATGGCGAGCTTCAAATACATCG Primer for F Synthesis (25mer) 27 GGATCCATATGTGCGGTATTGTCGGTATCG Primer for F 'Synthesis (30mer) 28 GGATCCAATATTAGCTTCAAATACATCGCTC Primer for F 'Synthesis (31mer) 29 GGATCCATATGTGCGGTATTGTCGGTATCG Primer for F3 Synthesis (30mer) 30 GGATCCAATATTCGCATGCGCAGCTTCAAATACATCG Primer for F3 (HA) synthesis (37mer) 31 CGGGATCCACATGTGGCGAGCTTCAAATAC F3 (CB) Synthesis Primer (30mer) 32 GGATCCATATGTGCGGTATTGTCGGTATCG Primer for F4 Synthesis (30mer) 33 GCGGATCCACATGTCGGCTTCCAG Primer for F4 (CB) Synthesis (31mer) 34 AATATTGTCGGCTTCCAGCGGGTAG Primer for F4 (HA) synthesis (25mer) 35 CATATGCTTGCTGAAATCAAAGG Primer for BF Synthesis (23mer) 36 AATATTGCCAGCACCCTCCTGTCCTCGGTG Primer for BF Synthesis (30mer) 37 TTCGCTTGCGCGACCACT primers for purF G49A mutation (18mer) 38 TGCGAACGGGTGGAGCCGTTAGACTG primers for purF N102L mutation (26mer) 39 GCGGATCCAAGAGACAGGATGAGGATCGTTTCGC kan ^R gene primer (34mer) 40 CGGATATCAAGCTTGGAAATGTTGAATACTCATACTCTTC kan ^R gene primer (40mer)

Amino acid residues Molecular weight (kDa) origin Apidaesin I 18 2.11 insect (A.mellifera) Bombinin 24 2.29 frog (B.variegata) Secropin A 36 3.89 moth (H.cecropia) CPF1 27 2.60 frog (X.laevis) Drossosocin 19 2.11 fly (D.melanogaster) HNP1 30 3.45 human (alpha-defensin) Indolidine 13 1.91 cow MSI-344 22 2.48 frog (X.laevis) Melittin 26 2.85 insect (H.cecropia) PGQ 24 2.33 frog (X.laevis) Tachyflesh 17 2.27 crab (T.tridentatus) XPF 25 2.64 frog (X.laevis)

Example 2. Preparation of Fusion Partner

For use as a fusion partner, purF derivatives as shown in Figure 2 were obtained from chromosomes of E. coli and Bacillus subtilis by PCR. Fusion partner F is for CNBr cleavage, F ', F5, BF are prepared for cleavage of hydroxylamine, F3 and F4 are for cleavage of CNBr (F3 (CB), F4a (CB)) and hydroxylamine cleavage ( F3 (HA), F4 (HA), F4a (HA)) was prepared in two. Fusion partners F, F ', F3 (HA), F3 (CB), F4 (HA), F4a (HA), F4a (CB), F5, BF are shown in SEQ ID NOs: 1-9, respectively.

1) purF derivative F

61 amino acids are encoded from the N-terminus of E. coli PurF protein (FIG. 2), and the Nde I site including the initiation codon Met is inserted at the 5 'end, and can be cleaved by CNBr at the 3' end. The Nde I site containing the Met codon was inserted.

2) purF derivative F '

To remove the internal hydroxylamine sites, the 49th glycine residue (GGG) was substituted with alanine (GCG, see underline 2) using primers 36 and site directed mutagensis of Table 1, and the hydroxylamine cleavage site was After the production of alanine 57 by PCR, Ssp I site containing AAT encoding asparagine was added to generate.

3) purF derivative F3

The 49th residue glycine was replaced with alanine as in F ′, and asparagine 58 was replaced with alanine using PCR, and alanine-asparagine was added after histidine 59 (F3 (HA)). In the case of F3 for CNBr (F3 (CB), 59 was encoded by histidine followed by Met, and a DNA sequence including the BspLU11 I site was added.

4) purF derivative F4

It consists of 159 amino acids from the N-terminus of PurF protein. The wild type PurF protein has two hydroxylamine sites in this region. To remove this, F4 (HA) was prepared by substituting asparagine codon (AAC) No. 102 with leucine codon (A and Z-lined CTC) with primers No. 37 and site directed mutagenesis in Table 1, and glycine no. 49 , 102 asparagine was substituted with leucine at the same time to prepare F4a (HA). In case of hydroxylamine cleavage (F4 (HA), F4a (HA)), Ssp I site including asparagine codon was given at the 3 'end, and in the case of CNBr cleavage (F4a (CB)), it contained Met codon BspLU11 I site was given.

5) purF derivative F5

A total of 89 amino acids from 60 methionine to 148 aspartic acid and C-terminal Asn of the PurF protein were added to the 3 'end.

6) purF derivative BF

BF is a purF derivative of B. subtilis, consisting of 43 amino acids from the N-terminus and an Ssp I site encoding Asn at the 3 'end.

Example 3 Preparation of Fusion Peptide Gene Constructs

Among the peptide genes prepared in Example 1, a gene whose first amino acid was glycine was coupled to fusion partners F3 (HA), F4 (HA), F4a (HA), F5, and BF for hydroxylamine cleavage, depending on the kind. Other peptides (HNP-I, indolisidine, tachypressin) were coupled to F, F3 (CB) and F4a (CB), fusion peptides for CNBr cleavage (Table 3).

Methods of fusing a fusion partner and a peptide antibiotic gene while generating CNBr cleavage site (Met) or hydroxylamine cleavage site (Asn-Gly) are shown in FIGS. 3 and 4. In the fusion with the fusion partner F for CNBr, the DNA construct FM (FIG. 3A) was prepared by fusion of the fusion partner and MSI-344 gene using the Nde I site. In case of fusion with F3 (CB) or F4 (CB), the BspLU11 I site at the 3 'end of F3 (CB) or F4 (CB) was fused with the Nco I site for HNP-I, and indolisidine In the case of, tachyflesin, the gene was chemically synthesized and fused to make the 5 'end compatible with the BspLU11 I site.

Fusion with a fusion partner for hydroxylamine (F ', F3 (HA), F4 (HA), F4a (HA), F5, BF) cleaves the fusion partner with Ssp I and MSI-344 with Sma I The two DNA fragments were joined and fused to produce Asn-Gly sites cleaved by hydroxylamine. Apidaesin, Bombinin, CPF I, Drosonin, Melitin, PGQ, XPF were cut to Ssp I without using a restriction enzyme because the 5 'end was made blunt when the gene was prepared. Could be fused with a fusion partner.

Example 4. Preparation of Fusion Multimers in the Transfer Step

Units were prepared to produce multimers, consisting of the Nde I site encoding Met, the structural gene, RBS, and the Ase I site capable of regenerating Met. F4a (HA) -MSI344 fusion gene ('F4Ma') and F5-MSI344 fusion gene ('F5M') were used as structural genes, respectively. The prepared units were cut into Nde I and Ase I, and the cut units were connected again. The obtained DNA fragment was further cut into Nde I and Ase I and subjected to agarose gel electrophoresis to separate multimers. In this manner, monomers (F4Ma), dimers (F4MaX2), and tetramers (F4MaX4) of F4Ma were obtained, and monomers (F5M), dimers (F5MX2), and tetramers (F5MX4) of F5M were obtained (Fig. 5).

Example 5. Expression Vectors

To express a large amount of foreign genes in E. coli, two expression vectors pGNX2 and pT7K2.1 were prepared using the T7Φ10 promoter, high copy replication origin (pUC family colEI), and kanamycin resistance gene.

To make plasmid pGNX2, the bla gene (ampicillin resistance gene: Amp ^R ) of pUC19 was first substituted with kanamycin resistance gene (Kan ^R ). To this end, 1745 bp DNA fragments were isolated by cleaving pUC19 with Ssp I and Dra I, using the Tn5 of E. coli as a template, and PCR the Kan ^R gene using primers 39 and 40 (Table 1). Amplified by. This DNA was digested with BamH I and Hind III and filled-in with Klenow enzyme, and then linked with pUC19 digested with Ssp I and Dra I to prepare pUCK2. This vector was cleaved with Nde I, filled-in with Klenow enzyme, and reconnected to obtain pUCK2ΔNdeI, where pT7-7 (USB, USA) was replaced with Ase I and Hind I in place of Ase I and BamH I of this vector. The final plasmid pGNX2 was prepared by inserting the DNA fragment containing the TBS10 promoter and RBS generated by cleavage. pGNX2 is composed of the T7Φ10 promoter and kanamacin resistance gene (Kan ^R ) in the same direction (FIG. 6).

To make plasmid pT7K2.1, first, the bla gene of pT7-7 was cut with Ssp I and Bgl I to replace the Kan ^R gene, and the Bgl I site was blunt-ended with T4 DNA polymerase. Kan ^R gene was prepared in the same manner as pGNX2 and pT7K2 was prepared by linking two DNAs. The Ase I site was removed from this vector to produce the final plasmid p7K2.1 (FIG. 7). E. coli HMS174 (DE3) transformed with pGNX2 was deposited on May 29, 1998 with the Biotechnology Research Institute Genetic Bank (KCTC) in Eoeun-dong, Yuseong-gu, Daejeon, Korea, and received accession number KCTC0486BP.

To make plasmid pGNX3, pGNX2F4M was first cleaved with Bsp HI, and fragments cut from only one Bsp H I site were cut with Bam H I. To produce a fragment containing the T7 and the rrnBT1T2 terminator remove the 132 bp fragment was cleaved with Bam H I and Eco R V from pET11a, which was connected to it and the Hin c II and the 488 bp fragment was cut and separated into Bsp H I ptrc99a. The ligated fragments were cleaved with Bam H I and Bsp H I and linked to the previously made vector to prepare plasmid pGNX3F4M (FIG. 8).

To make plasmid pGNX4, pETACc was cleaved with Xba I and Alw N I to separate 3502 bp fragments, and pGNX3F4M was cleaved with Xba I and Alw NI to connect 2405 bp fragments isolated to prepare pGNX4F4M ( 9).

To make plasmid pGNX5, pGNX3F4M was partially cleaved with Ase I, cleaved with Xba I and blunt-ended vector and pCR-TrpPO were cleaved with Eco R I and Nde I and blunt with cleno fragments. PGNX5F4M was prepared by concatenating fragments made into terminals (FIG. 11).

Example 6 Production of Peptide Antibiotics

Cloning the DNA construct obtained by fusion of the peptide antibiotic MSI-344 to the fusion partners F3, F4, F4a, F5 and BF, respectively, on the Nde I and BamH I sites of pGNX2 and the Nde I and BamH I sites of pT7K2.1, respectively. It was. In the case of using F (purF whole) as a fusion partner, the cells were cloned into Nde I and Xho I sites of pET24a (Novagen, USA). Multimers were cloned into Nde I sites of pGNX2 and pT7K2.1. Apidaesine I, indolisidine, tachyflesin I, bombinine, CPF1, droscinine, melittin, HNP-I, PGQ, XPF genes are linked to the fusion partner F4 in place of NDE I and EcoR I of pGNX2 Cloned. When F3 was used, it was cloned using BamH I and EcoR I sites of pRSETc (see Table 3).

Plasmids 2, 3, 4, 5, 6, and 7 in Table 3 were transformed into E. coli HMS174 (DE3), respectively, by CaCl ₂ method. R medium with cassamino acid was used as the medium, and peptide expression was induced by adding 2% lactose and 2 mM IPTG, respectively, when the culture medium was between OD ₆₀₀ 0.2 and 0.4. The expression level was quantified by the percentage of the fusion peptide in the total cellular protein by scanning the results obtained through the SDS PAGE with a densitometer (Fig. 11). In Figure 11, M represents the molecular weight standard markers, lanes 1 to 6 are transformed with plasmids 2, 3, 4, 5, 6 and 7 of Table 3, respectively, and then induced with lactose, and lanes 7 to 12, respectively. It was transformed with plasmid 2, 3, 4, 5, 6, 7 of 3 and induced with IPTG. Lanes 13 and 14 were transformed with plasmid 43 (E. coli purF; EF) in Table 3 and induced with lactose and IPTG, respectively.

In the same manner, plasmids 44, 45, and 46 in Table 3 were transformed into E. coli HMS174 (DE3), respectively, and induced with lactose to express MSI-344 (FIG. 12). It can be seen that the expression efficiency is higher in the plasmid having the transcription terminator.

9 hours after inducing the expression of the fusion peptide with lactose in HMS174 (DE3) transformed with plasmid No. 4 in Table 3, the cells were disrupted in the culture state and centrifuged to collect the precipitate. The precipitate was dissolved in 9 M urea, 20 mM potassium phosphate (pH 8.5), 5 mM EDTA solution at room temperature for 2 hours, dissolved, loaded onto an SP Sepharose FF (Pharmacia, Sweden) column, and then with 0.3-1 M NaCl. Elution was used to purify F4Ma. Purified F4Ma was reacted with 0.5-2 M hydroxylamine, 0.4 M potassium carbonate (pH 7.5-9.5) at 45-55 ° C. to cleave MSI-344 from the fusion partner. The reaction solution was desalted and loaded again onto an SP Sepharose FF (Pharmacia, Sweden) column and MSI-344 was eluted using 0.4-1 M NaCl. Purified MSI-344 was confirmed by MSI, MALDI, amino acid sequence analysis to MSI-344.

Example 7

Other plasmids listed in Table 3 were transformed into E. coli HMS174 (DE3) according to the CaCl ₂ method. R medium with casamino acid was used as a medium, and peptide expression was induced by adding 2% lactose when the culture medium was between OD ₆₀₀ 0.4 and 0.6. The expression level was quantified by the percentage of fusion peptide in the total cellular protein by scanning the result obtained through SDS PAGE with a densitometer. The result of expressing each peptide antibiotic is shown in FIG. 13A, FIG. 13B, and Table 3. FIG. In Fig. 13A, lanes 1 to 6 represent plasmids 10, 12, 15, 20, 21, and 23 of Table 3, respectively, and in Fig. 13B, lanes 1 to 9 respectively represent plasmids 11, 13, 14, 16, 22, and 17, 18, 24, and 19 are shown.

14A to 14D show the results of expression of plasmids 25 to 42 in Table 3. Buporin IIbx2 and Buporin IIx4 are dimers and tetramers of Buporin IIb, respectively, and were prepared by the method described in Example 4. Corresponding plasmids and systems of Table 3 and expression results are shown in parentheses.

Fig. 14A: 1 (25)

14B: 1 (26), 2 (31), 3 (36)

14C: 1 (27), 2 (32), 3 (37), 4 (28), 5 (33), 6 (38), 7 (29), 8 (34), 9 (39), 10 ( 30), 11 (35), 12 (40)

14D: 1 (41), 2 (42), 3 (43)

number Peptide Convergence Partner Cutting method Cloning Vector Plasmid Strain Expression degree (%) One MSI-344 F CNBr pET24a pETFM BL21 (DE3) BLR (DE3) 9 2 MSI-344 F3 HA pGNX2 pGNX2F3M BL21 (DE3) HMS174 (DE3) 10 3 MSI-344 F4a (HA) HA pGNX2 pGNX2F4M BL21 (DE3) HMS174 (DE3) JM109 (DE3) UT400 (DE3) UT5600 (DE3) 30 4 MSI-344 F4 (HA) HA pGNX2 pGNX2F4Ma BL21 (DE3) HMS174 (DE3) JM109 (DE3) UT400 (DE3) UT5600 (DE3) 30 5 MSI-344 F4 (HA) HA pT7K2.1 pT7KF4M BL21 (DE3) HMS174 (DE3) JM109 (DE3) UT400 (DE3) UT5600 (DE3) 30 6 MSI-344 F4a (HA) HA pT7K2.1 pT7KF4Ma BL21 (DE3) HMS174 (DE3) JM109 (DE3) UT400 (DE3) UT5600 (DE3) 30 7 MSI-344 F5 HA pGNX2 pGNX2F5M BL21 (DE3) HMS174 (DE3) 20 8 MSI-344 F5 HA pT7K2.1 pT7KF5M BL21 (DE3) HMS174 (DE3) 20 9 MSI-344 BF HA pGNX2 pGNX2BFM BL21 (DE3) HMS174 (DE3) 12

number Peptide Convergence Partner Cutting method Cloning Vector Plasmid Strain Expression degree (%) 10 Apidaesin I F3 HA pRSETc pRF3Ap BL21 (DE3) pLysS 25 11 Apidaesin I F4 (HA) HA pGNX2 pGNX2F4Ap BL21 (DE3) pLysS 8.7 12 Bombinin F3 HA pRSETc pRF3Bp BL21 (DE3) pLysS 23 13 Bombinin F4 (HA) HA pGNX2 pGNX2F4Bb BL21 (DE3) pLysS 33.6 14 CPF F4 (HA) HA pGNX2 pGNX2F4Cpf BL21 (DE3) pLysS 9.0 15 Drossosocin F3 HA pRSETc pRF3Dp BL21 (DE3) pLysS 14 16 Drossosocin F4 (HA) HA pGNX2 pGNX2F4Dp BL21 (DE3) pLysS 25 17 Melittin F4 (HA) HA pGNX2 pGNX2F4Mel BL21 (DE3) pLysS 26

18 PGQ F4 (HA) HA pGNX2 pGNX2F4Pg BL21 (DE3) pLysS 20.2 19 XPF F4 (HA) HA pGNX2 pGNX2F4Xp BL21 (DE3) pLysS 26.5 20 HNP-I F3 CNBr pRSETc pRF3Hp BL21 (DE3) pLysS 26.3 21 Indolidine F3 CNBr pRSETc pRF3Id BL21 (DE3) pLysS 29 22 Indolidine F4 (CB) CNBr pGNX2 pGNX2F4Id BL21 (DE3) pLysS 20.7 23 Tequipressin I F3 CNBr pRSETc pRF3Tp BL21 (DE3) pLysS 30 24 Tequipressin I F4 (CB) CNBr pGNX2 pGNX2F4Tp BL21 (DE3) pLysS 21.8 25 Buporin I F4 (HA) HA pGNX3 pGNX3F4BI HMS174 (DE3) 25 26 Buporin II F4 (HA) HA pGNX3 pGNX3F4BII HMS174 (DE3) 30 27 Buporin II F5 (HA) HA pGNX3 pGNX3F5BII HMS174 (DE3) 20 28 Buporin II F5 (HA) HA pGNX4 pGNX4F5BII HMS174 (DE3) 18 29 Buporin II BF (HA) HA pGNX3 pGNX3BFBII HMS174 (DE3) 4 30 Buporin II BF (HA) HA pGNX4 pGNX4BFBII HMS174 (DE3) 4 31 Buporin IIa F4 (HA) HA pGNX3 pGNX3F4BIIa HMS174 (DE3) 28 32 Buporin IIa F5 (HA) HA pGNX3 pGNX3F5BIIa HMS174 (DE3) 20 33 Buporin IIa F5 (HA) HA pGNX4 pGNX4F5BIIa HMS174 (DE3) 18 34 Buporin IIa BF (HA) HA pGNX3 pGNX3BFBIIa HMS174 (DE3) 4 35 Buporin IIa BF (HA) HA pGNX4 pGNX4BFBIIa HMS174 (DE3) 4 36 Buporin IIb F4 (HA) HA pGNX3 pGNX3F4BIIb HMS174 (DE3) 25 37 Buporin IIb F5 (HA) HA pGNX3 pGNX3F5BIIb HMS174 (DE3) 20 38 Buporin IIb F5 (HA) HA pGNX4 pGNX4F5BIIb HMS174 (DE3) 18 39 Buporin IIb BF (HA) HA pGNX3 pGNX3BFBIIb HMS174 (DE3) 20

number Peptide Convergence Partner Cutting method Cloning Vector Plasmid Strain Expression degree (%) 40 Buporin IIb BF (HA) HA pGNX4 pGNX4BFBIIb HMS174 (DE3) 15 41 Buporin IIbx2 BF (HA) HA pGNX4 pGNX4BFBIIbx2 HMS174 (DE3) 20 42 Buporin IIbx4 BF (HA) HA pGNX4 pGNX4BFBIIbx4 HMS174 (DE3) 20 43 MSI-344 EF HA pGNX2 pGNX2EFM HMS174 (DE3) 30 44 MSI-344 F4 (HA) HA pGNX3 pGNX3F4M HMS174 (DE3) 35 45 MSI-344 F4 (HA) HA pGNX4 pGNX4F4M HMS174 (DE3) 35 46 MSI-344 F4 (HA) HA pGNX5 pGNX5F4M HMS174 (DE3) 15

Example 8

Gene construct prepared in Example 4, monomer of F4Ma (F4Ma), dimer (F4MaX2), tetramer (F4MaX4), monomer of F5M (F5M), dimer (F5MX2), tetramer (F5MX4) respectively Nde I of pGNX2 E. coli HMS174 (DE3) was transformed after cloning into Nde I site of site and pT7K2.1. According to the method of Example 6, the fusion protein was expressed, and the expression level was quantified by the percentage of the fusion peptide in the total cellular protein by scanning with a densitometer the results obtained through SDS PAGE. In FIG. 15, lane 1 of pT7K2.1 is F4Ma, lane 2 is F4MaX2, lane 3 is F4MaX4, lane 4 is F5M, lane 5 is F5MX2, lane 6 is F5MX4, lane 1 of pGNX2 is F4Ma, lane 2 represents F4MaX2, lane 3 represents F5M, and lane 4 represents F5MX2. As can be seen in Figure 15, in the case of F4M expression when the tetramer expression was increased from 30% to 40%, F5M tetramer expression was increased from 20% to 25% compared to the monomer.

By the present invention, it is possible to mass-produce peptide antibiotics in microorganisms at a lower cost effectively and to facilitate separation and purification.

Claims (3)

(delete) (delete) (correction) A vector in which the expression of a foreign gene is induced by lactose selected from the group consisting of pGNX2, pGNX3, pGNX4, and pGNX5.