JP3252916B2 - Synthetic gene encoding human parathyroid hormone - Google Patents

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a recombinant DNA technology for producing human parathyroid hormone (hereinafter abbreviated as hPTH), and more specifically to a synthetic gene corresponding to the amino acid sequence of hPTH and a DNA containing the same. And a transformant transformed with the DNA and a method for producing hPTH using the transformant.

[0002]

2. Description of the Related Art hPTH is secreted from the parathyroid gland.
Is a polypeptide hormone consisting of two amino acids and is one of the most important regulators of calcium metabolism. Therefore, clinical application of hPTH to various bone diseases such as hypoparathyroidism and osteoporosis is highly expected. However, the amount of naturally occurring hPTH is extremely small, and hPTH is a protein having a relatively small molecular weight, and it can be said that hSTH can be chemically totally synthesized, which involves highly skilled techniques and great difficulties. . Therefore, production by recombinant DNA technology has recently attracted attention. The DNA sequence of hPTH was first disclosed by GNHendy et al. [Processings of the National Academy of Sciences (Proc. Natl.
Acad. Sci) USA, 78 , 7365-7369 (1981)]. Since then
HPTH cDNA has been cloned by a few groups, incorporated into various expression vectors, and attempts have been made to synthesize hPTH by microorganisms. Alestrom et al. (Japanese Patent Application Laid-Open No. 2-501108) have attempted to secrete and express cDNA-derived genes in yeast, but have not yet isolated and identified hPTH. A. Hφgset et al. [Biochemical and Biophysical Research Communication (Bioc
hem. Biophys. Res. Commun.), 166 , 50-60 (1990)]
A gene containing a Met-Gly residue at the N-terminus of TH was converted to hPTH c
It was prepared from a DNA clone and expressed in Escherichia coli. The resulting protein was expressed in hP with Met-Gly added to the N-terminus.
TH and had no hPTH activity. E.Wingen
der et al. [Journal of Biological Chemistry (J. Biol. Chem.) 246 , 4367-4373 (1989)] expressed hPTH as a fusion protein with β-galactosidase in Escherichia coli, but removed unnecessary parts. The protein was N
It was a molecule with Pro added to the end. A. Hφgset et al. [Journal of Biological Chemistry
(J. Biol. Chem.) 265 , 7338-7344 (1990)] provides the cDNA of hPTH with Staphylococcus aureus-
It has succeeded in separating and identifying hPTH by connecting it to the downstream of the protein A promoter and signal peptide gene, secreting and expressing it outside the cells in Escherichia coli. However, the amount of production at this time is also about 1 mg / 1 liter culture solution,
If the loss in the purification process is taken into account, the expression level is insufficient from an industrial point of view. Furthermore, expression by a chemically synthesized gene has been performed [Journal of Biological Chemistry (J. Biol. Chem.), 263 , 1307].
(1988)], however, the expression level in this case is also insufficient at 200 μg / 1 liter.

When a gene of a protein of an organism is to be expressed in another host, the gene can be obtained by chemically synthesizing the gene in addition to using a gene derived from the organism. . In recent years when the technology for automatic synthesis of DNA oligomers has advanced, when the protein has a relatively low molecular weight and its amino acid sequence or DNA sequence is known, the synthetic gene is often more advantageous in the following points. . That is, 1) the target gene can be obtained relatively easily. 2) It is possible to freely incorporate a terminal sequence when a gene is incorporated into a plasmid and a recognition sequence of an appropriate restriction enzyme for modifying the gene. 3) A gene sequence can be designed so that a target gene product is highly expressed. WLSung et al. [Bio Chemistry and Cellular Biology (Biochem.Cell.Biol.) 64 .1
33-138 (1986)] synthesizes a structural gene for hPTH using the amino acid codon that is most tolerated in yeast, and synthesizes this gene using SARabbani et al.
Biological chemistry (J. Biol. Chem.), 263 , 13
07-1313 (1988)] was expressed in E. coli. However, their production is extremely low and not practical.

[0004]

SUMMARY OF THE INVENTION As described above, hPTH
Has been attempted to be expressed in various systems using cDNA-derived genes and synthetic genes, but the production amount of each of them has been low, and this was insufficient from an industrial viewpoint.

[0005]

Means for Solving the Problems The present inventors have conducted intensive studies in order to develop a method for efficiently producing hPTH, and as a result, the DN of hPTH suitable for solving the above-mentioned problems has been obtained.
The present inventors have completed the present invention by finding the A sequence, establishing a method for producing the gene, a recombinant DNA containing the gene, a transformant transformed with the DNA, and a method for producing hPTH using them. The sequence of the synthetic gene is designed to satisfy various conditions for enhancing the expression of the gene. One of the reasons is that it is better to use the codon most accepted in the cells of the expression system. Therefore, h of the present invention
In the case of the PTH gene, codons commonly used in Escherichia coli and yeast, which are often used for production of proteins by the gene recombination method, were employed. In addition, consideration was given to providing a convenient restriction enzyme recognition sequence at an appropriate position in order to modify a gene when selecting codons. Furthermore, in order to correctly construct the gene of interest, the presence of unnecessary and relatively long palindrome sequences on the DNA strand and the continuous repetitive sequences were excluded as much as possible. As another condition for enhancing gene expression, importance is placed on the stability and translation efficiency of mRNA corresponding to the structural gene. In this case, the higher-order structure determined by the base sequence of the mRNA is considered to have an important meaning. Therefore, in the hPTH gene of the present invention, a loop structure or the like was searched using a computer during the designing process, and the sequence was slightly modified so as to eliminate the remarkable one. Thus, FIG. 1 (SEQ ID NO:
A novel DNA sequence most suitable for the production of hPTH as shown in 1) was found. This gene sequence is
The DNA sequence differs from that of Sung et al. By 25.4%. FIG. 1 shows the amino acid sequence in addition to the DNA sequence.

[0006] The gene can be expressed as a fusion peptide or directly as hPTH without using a fusion peptide. In the former case, a DNA encoding a protein other than hPTH starting from the start codon ATG is arranged at the 5 'end of the synthetic gene of hPTH, and the DNA is terminated with a stop codon (eg, TAA) or the start codon A
HP is added at the 3 'end of the hPTH synthesis gene starting from TG.
A DNA encoding a protein other than TH may be provided and terminated with a stop codon (eg, TAA). To use for the latter direct expression, as shown in FIG. 2 (SEQ ID NO: 2), hPT
In addition to the sequence encoding the H polypeptide, an initiation codon ATG and a stop codon (for example, TAA) are directly disposed at the 5 'end and the 3' end, respectively. The 5 'end and the 3' end are used for insertion into a vector. For example, NdeI and BamHI are used as cohesive ends, respectively. In synthesizing the hPTH gene of the present invention, for example, as shown in FIG. 2 (SEQ ID NOs: 2 and 3), the hPTH gene was finally divided into 14 fragments. To avoid
Care was taken so that no self-complementary sequence appeared at the 5 'or 3' end. FIG. 3 shows each DNA fragment. The method of dividing into fragments need not be limited to the above, as long as care is taken to avoid the self-association described above.
Various divisions are possible.

Each of the DNA fragments (# 1 to # 14) (SEQ ID NOs: 4 to 17) can be produced according to a known synthesis method. #
If necessary, each of the fragments except for 1 and # 14 is phosphorylated at the 5 'end with polynucleotide kinase, and all fragments are hybridized at a time and ligated with DNA ligase, or the phosphorylated fragment is first treated with 2 to 3 fragments. The DNA is divided into groups and hybridized.
Double-stranded DNA was obtained by ligase, and each group was again subjected to D
Complete double-stranded hP by ligation with NA ligase
The TH gene was obtained (see FIG. 4). This is the Nd of pUC19
Ligation with the digests by eI and BamHI yields the new plasmid pU.PTH.C19 and transforms E. coli JM109.
The nucleotide sequence of the isolated plasmid was determined by the Sanger method using a part of the DNA fragment as a primer, and the DNA obtained by digestion with NdeI / BamHI was more easily obtained.
The NA fragment is digested with AvrII, NcoI, HgiAI, AluI, etc., and the presence of the desired hPTH gene is confirmed by having the correct restriction site.

In expressing the synthetic gene of the present invention, it is preferable to use it as a recombinant DNA inserted into a vector such as a plasmid or bacteriophage. Examples of the plasmid include pBR322 derived from Escherichia coli.
[Gene, 2, 95 (1977)], pBR325 [Gene, 4, 12
1 (1978)], pUC12 [Gene, 19, 259 (1982)], pUC13
[Gene, 19, 259 (1982)], pUB110 derived from Bacillus subtilis [Biochemical and Biophysical Research Comm.
unication), 112, 678 (1983)], and any other substances can be used as long as they are replicated and propagated in the host. As a phage vector, for example, λgt11 [Young, R., and Davis, R.,
Proc. Natl. Acad. Sc of the National Academy of Sciences of the USA
i., USA), 80 , 1194 (1983)], etc., but any other one can be used as long as it can be propagated in the host. The plasmid thus obtained is introduced into an appropriate host, for example, a bacterium belonging to the genus Escherichia, a bacterium belonging to the genus Bacillus, yeast, or an animal cell.

Methods for transforming a host with a plasmid include, for example, T. Maniatis et al.
Molecular Cloning, Cold Spring Harbor Laboratory (Cold Spri
ng Harbor Laboratory), page 249 (1982), the calcium chloride method or the calcium chloride / rubidium chloride method. Phage
When a vector is used, it can be introduced into, for example, grown Escherichia coli using an in vitro packaging method.

The above-mentioned recombinant DNA has the above-mentioned initiation codon A.
It is preferable to have a promoter upstream of TG,
The promoter may be any promoter as long as it is appropriate for the host used for the production of the transformant. For example, Escherichia coli (eg, MM294, B
L21, BL21 / PLys, W3110, DH1, N4830 etc.) for the trp promoter, lac promoter, rec A promoter, λ
Bacillus subtilis (eg, MI114, etc.) such as PL promoter, lpp promoter, T7 promoter, etc.
Bacillus brevi (SPO1 promoter, SPO2 promoter, penP promoter, etc.)
In s), yeast (Sac)
PHO5 promoter, PGK promoter, GAP promoter, ADH promoter, etc. for charomyces cerevisiae; eg, AH22; ) Derived LT
R region promoter and the like. Especially when the host is E. coli, the promoter is T7 promoter, tr
The promoter is preferably the p promoter or the λPL promoter. When the host is an animal cell, it preferably has an enhancer in addition to the above promoter.

The obtained transformant is cultured in a medium known per se. As a medium for the transformant of Escherichia coli, for example, LB medium can be mentioned. The cultivation of the transformant of Escherichia coli is usually performed at 15 to 43 ° C, preferably 28 to 40 ° C for 2 to 24 hours, preferably 4 to 16 hours, and if necessary, aeration and stirring may be added. After the culture, the cells are collected by a known method. In the case of a transformant of Escherichia coli, the cells are suspended in a buffer or a buffer containing a protein denaturant such as urea or guanidine hydrochloride, and disrupted by sonication, lysozyme treatment, or mechanical disruption with glass beads, etc. An extract containing hPTH is obtained by centrifugation. hPTH
Can be separated and purified from the extract using known means. Examples of the separation and purification means include column filtration such as gel filtration, ion exchange chromatography using a cation exchange resin or an anion exchange resin, hydrophobic chromatography, and partition adsorption chromatography, and high performance liquid chromatography. Bacillus, yeast,
Culture of a transformant of an animal cell and separation and purification of hPTH from the culture may be performed by a method known per se. The obtained hPTH can be used as a therapeutic agent for various diseases having abnormalities in calcium metabolism, for example, osteoporosis and hypoparathyroidism, and a therapeutic agent for hypertension. The dose depends on the subject,
Considering illness, etc., it is decided as appropriate for each case,
An appropriate amount is administered within a range of 1 ng to 100 μg per day per kg of body weight. hPTH is usually mixed with a pharmacologically acceptable carrier, excipient, and diluent, and is mainly administered parenterally as an injection, nasal drug, rectal drug, vaginal drug, or transdermal drug. May optionally be administered orally.

An example of the expression of the hPTH synthesis gene is described below (see FIG. 5). An NdeI-BamHI excised 267 base pair DNA fragment from pU • PTH • C19 was used for the Nde expression vector pET3C.
I and BamHI sites were integrated to obtain an expression vector pET / PTH / 3C under the control of the T7 promoter. Escherichia coli BL21 was transformed with pET.PTH.3C, and the growing colonies were selected by using the ampicillin sensitivity as an index to obtain a strain containing the target hPTH gene. After culturing these transformants, collecting the cells by centrifugation and treating the cells with 7M guanidine, the hPTH contained in the solution was subjected to SDS-polyacrylamide electrophoresis (SDS
HPTH was quantified by staining with Coomassie brilliant blue (CBB) after S-PAGE) or by immunoblotting with hPTH antibody after SDS-PAGE.
The production amount was not less than mg / l (see FIGS. 6 and 7). This expression level is a breakthrough for direct expression of hPTH in E. coli.

[0013]

In the present invention, mRNA is designed by adopting the codon most accepted in the cells of the expression system as the DNA sequence of the hPTH gene and designing the gene in consideration of the higher-order structure of the mRNA corresponding to the DNA sequence. HPTH can be produced efficiently with high stability and good translation efficiency. Further, in the present invention, by providing recognition sites for several types of restriction enzymes inside the structural gene, the success or failure of gene insertion and the direction of insertion can be easily confirmed,
The present invention can exhibit advantages and versatility in gene manipulation, such as facilitating genetic modification when synthesizing a TH analog protein, and being able to carry on several types of vectors.

[0014]

【Example】

Example 1 1. Synthesis of DNA Fragments The 14 kinds of DNA fragments (# 1 to # 14) (SEQ ID NOs: 4 to 17) shown in FIG. 3 were prepared from appropriately protected DNA β-cyanoethylphosphoramidite by Applied Biosystems, model It was synthesized using an automatic 380A DNA synthesizer. The protocol for the synthesis was specified by Applied Biosystems. The synthesized protected DNA oligomer / resin was heated at 60 ° C. for 6 hours in 2 ml of concentrated aqueous ammonia with respect to 0.2 μmole of the resin. The obtained product was purified by reversed-phase high-performance liquid chromatography (hereinafter abbreviated as HPLC) to obtain a DNA oligomer in which only the 5′-terminal hydroxyl group was protected with a dimethoxytrityl group. 80% acetic acid 2m
1, 20 minutes to remove the dimethoxytrityl group at the 5 'end, and the product was purified by reverse phase HPLC and ion exchange HPLC. The 14 DNA oligomers synthesized in this manner are as shown in FIG. 3 (SEQ ID NOs: 4 to 17).

[0015] 2. Twelve DNA oligomers (# 2 to # 2) excluding # 1 (SEQ ID NO: 4) and # 14 (SEQ ID NO: 17) to be phosphorylated 5 'end of DNA oligomer
13) (SEQ ID NOs: 5 to 16) 25 µl each of a phosphorylation reaction solution [DNA oligomer 10 µg, 50 mM Tris-HCl, pH 7.6, 10 mM
M MgCl ₂ , 1 mM spermidine, 10 mM dithiothreitol (hereinafter abbreviated as DTT), 0.1 mg / ml bovine serum albumin (hereinafter BS)
A), 1 mM ATP, 10 units T4 polynucleotide kinase (Takara Shuzo)] at 37 ° C. for 1 hour to phosphorylate the 5 ′ end. This reaction solution is treated at 65 ° C. for 10 minutes,
Then, after freezing and thawing, it was used for the next reaction.

[0016] 3. Ligation of DNA fragments (Fig. 4-
1. See FIG. 4-1. 3-1 A series of steps in the duplex configuration of the hPTH gene is as shown in FIG. 4-1 (a bar with a protrusion (─) at the left end in the figure indicates 5). 'Indicates that the terminal hydroxyl group is phosphorylated.] For example, block I was connected as follows.
5 types (DNA fragments # 2 to # 6 (SEQ ID NOs: 5 to 5)
The DNA fragment # 1 (SEQ ID NO: 4) corresponding to the 5 'end was treated with 2.5 μl of the phosphorylation reaction solution of the DNA fragment obtained by the above operation 2) corresponding to 9) and 2.5 μl each.
g and combined to 50 μl. This has 5 units of T4
After adding DNA ligase (New England Biolab) and incubating at 14 ° C. for 5 hours, the mixture was treated at 65 ° C. for 10 minutes to stop the reaction and obtain Block I. Blocks II and III were obtained in the same manner. Each of these blocks I to III
The mixture was mixed in an amount of 20 μl, and 5 units of T4 DNA ligase was added thereto, incubated at 14 ° C. for 20 hours, and treated at 65 ° C. for 10 minutes to stop the reaction. Using a 7.5% acrylamide gel, a buffer solution (pH 8.3) [100 mM Tris-HCl, 100 mM
In boric acid, 2 mM EDTA] at 160 V for 1.5 hours. After the electrophoresis, 0.6 mg / l of ethidium bromide (EtB
The gel was stained in r), the gel piece containing the 263 bp DNA fragment was sealed in a dialysis tube, submerged in an electrophoresis buffer, and DN
The fragment A was eluted electrically from the gel [Journal of
Molecular biology (J. Mol. Biol), 110 , 119 (197
7)]. Collect the solution in the dialysis tube and transfer it to 0.2M NaC
1, Elutip-d column (Schleicher & Schnel) pre-buffered with 20 mM Tris-HCl (pH 7.4), 10 mM EDTA solution
to make the DNA adsorb, then add 1.0M NaCl, 2
Elution was carried out with 0 mM Tris-HCl (pH 7.4), 1.0 mM EDTA buffer. After adding twice the amount of ethanol to the eluate and cooling to −20 ° C., the DNA was precipitated by centrifugation.

3-2 One of the Double-Strand Structure of hPTH Gene
The series of steps can also be achieved by the method shown in FIG. 4-2 (the bar with a protrusion (─) at the left end in the figure indicates that the 5 ′ terminal hydroxyl group is phosphorylated). Phosphorylation reaction solution of 12 DNA fragments (corresponding to DNA fragments # 2 to # 13 (SEQ ID NOS: 5 to 16), respectively) (5 μl each) and DNA fragments corresponding to the 5 ′ end # 1 (SEQ ID NO: 4) and # 14 (SEQ ID NO: 17) each 2
μg was mixed to make 70 μl. This has 5 units of T4D
NA ligase (Takara Shuzo) was added and incubated at 15 ° C. for 20 hours. Using an 8% acrylamide gel,
Buffer solution (pH 8.3) [100 mM Tris-HCl, 100 mM boric acid, 2 mM E
DTA] at 125 V for 2 hours. After electrophoresis, 0.
The gel was stained with 6 mg / l EtBr, a gel piece containing a 263 bp DNA fragment was sealed in a dialysis tube, submerged in an electrophoresis buffer, and the DNA fragment was eluted from the gel electrically. After the phenol treatment was performed twice on the solution in the dialysis tube, the aqueous layer (upper layer) was recovered, twice the amount of ethanol was added, the mixture was cooled to -70 ° C, and the DNA was precipitated by centrifugation.
About 1 μg of the DNA fragment was obtained in this manner, and after phosphorylation with T4 polynucleotide kinase (Takara Shuzo), it was subjected to the following experiment 4-2.

[0018]4. Cloning of hPTH gene (Figure
5) 4-1 Cloning vector contains E. coli plasmid
pUC19 derived from pBR322 [Messing. J., Gene,33 Ten
3-109 (1985)] was used. Add 20 μl of pUC19 DNA
Reaction solution (20 mM Tris-HCl, pH 7.6, 7 mM MgCl_Two, 150 mM NaCl,
10 mM 2-mercaptoetal, 20 units of NdeI (new
-England Biolabs), 15 units of BamHI
(Takara Shuzo)], at 37 ° C for 24 hours, diluted 5 times with water
The mixture was treated at 65 ° C. for 20 minutes to inactivate the enzyme. This anti
5 µl of the reaction solution and about 5 equivalents of the DNA fragment (3-
1) were mixed and 50 mM Tris-HCl (pH 7.5), 10 mM MgCl_Two, 10m
M DTT, 1 mM spermidine, 0.1 mg / ml BSA and 1
As a 20 µl reaction solution containing mM ATP, at 14 ° C for 15 hours
T4 DNA ligase (New England Biolab)
To make the hPTH gene a plasmid.
Combined. Using this reaction solution, the colon
Bacterial strain JM109 [Messing. J. Gene,33 103-119 (19
85)]. That is, store at -70 ° C
50 μl of competent cells [Hanahan, D., Journal
Le of Molecular Biology (J. Mol. Biol.),16
6, 557 (1983)] at 0 ° C for 15 minutes,
10 μl of the above reaction was added. At 0 ° C for 30 minutes
Incubate for 1.5 minutes at 42 ° C and 2 minutes at 0 ° C.
Incubated for minutes. Add 200 μl of LB to this reaction solution.
Double ground (10 g of bactotripton per liter, Bactoy
5 g of NaCl extract and 5 g of NaCl) at 37 ° C for 1 hour.
For a while. This E. coli is
LB containing picillin, 100 μg / ml X-Gal, 0.1 mM IPTG
The cells were spread on an agar medium and cultured at 37 ° C. overnight. The resulting ampi
Β-galactosidase deficient 14 in sylin resistant colonies
Strain and the plasmid DNA of this transformed strain
[Maniatis, T. et al., Molecular Cloning (Molecu
lar Cloning (Cold Spring Harbor), 368-369 (198
2)], and digested with NcoI and BamHI.
Were digested with NdeI and BamHI. 1.7% of these digests
From the electrophoresis pattern on the agarose gel, one strain
It turns out that it is a transformed strain into which the PTH gene has been inserted.
Was.

4-2 Cloning of the hPTH gene was also performed by the following method. PUC1 for cloning vector
9 (Takara Shuzo) was used. 0.5 μg of pUC19 DNA to 10 μ
l of the reaction solution [50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 100 mM
MNaCl, 1 mM dithiothreitol, 20 U of NdeI (New England Biolabs), and 10 U of BamHI (Takara Shuzo)] at 37 ° C. for 5 hours, followed by treatment at 65 ° C. for 15 minutes to inactivate the enzyme. Was. 1 μl of this reaction solution and about 10 equivalents of the DNA fragment (3-2) were mixed,
The hPTH gene was ligated to the plasmid using a ligation kit (Takara Shuzo). Transformation into Escherichia coli JM109 was carried out in the same manner as in 4-1. Among the resulting ampicillin-resistant colonies, 17-galactosidase-deficient 17
A strain was selected, and the plasmid DNA of the transformed strain was roughly purified by an alkaline method, digested with NcoI and BamHI, and further digested with NdeI.
And BamHI digestion. From the migration pattern of these digests on a 1.5% agarose gel, it was found that three strains were correctly transformed strains into which the hPTH gene had been inserted. The cloning vector obtained in 4-1 and 4-2 above was
-Named PTH-C19. One platinum loop of the recombinant Escherichia coli JM109 harboring this plasmid pU.PTH.C19 was added to 50 μg / m
1 ml of LB medium containing 1 ml of ampicillin
With shaking overnight. From this culture, plasmid DN
A was roughly purified and TE buffer containing 20 μg / ml RNase (1
(0 mM Tris-HCl pH 8.0, 1 mM EDTA).

Example 2 Construction of hPTH Expression Plasmid and Transformant
Manufacturing (Figure 5) 1) pU · PTH · C to about 10μg obtained in item 4 of Example 1
19 to a reaction solution [150 mM NaCl, 20 mM Tris-HCl (pH 7.8), 7 mM
MgCl ₂ , 10 mM 2-mercaptoethanol, 40 units Nde
I, 20 units BamHI (Takara Shuzo)] at 37 ° C for 5 hours, followed by 263 bp by 1.7% agarose gel electrophoresis.
The DNA fragment was purified according to a conventional method. On the other hand, pET3C [Stadier, FW, et al., Methods in Enzymology, 195 60-89 (19)
90)]. pET3C DNA was converted to N
After digestion with deI and BamHI, the reaction solution was added with 4 volumes of water and heated at 65 ° C. for 20 minutes to inactivate the enzyme. The thus obtained 263 bp DNA and plasmid DNA were respectively
It has a single-stranded cohesive end generated by NdeI digestion and BamHI digestion at both ends. Mix these two and add 50 mM Tris-HC
l, pH 7.6, 10 mM MgCl ₂ , 10 mM DTT, 1 mM spermidine
14 ° C., 16 hours T in the presence of 1 mg / ml BSA and 1 mM ATP
The DNA was ligated by the action of 4DNA ligase (New England Biolab), and Escherichia coli JM109 was transformed in the same manner as described above. Next, this E. coli
The cells were spread on an LB agar medium containing 0 μg / ml of ampicillin and cultured at 37 ° C. for 1 day. The resulting ampicillin resistant colonies were selected. Further, the plasmid DNA of the transformed strain is
I-BamHI, Bgl II-BamHI, EcoRI-NdeI, AvrII-Bgl
After digestion with a combination of restriction enzymes such as II, a transformant containing the hPTH gene was correctly selected from the pattern of polyacrylamide electrophoresis. The expression plasmid thus obtained was named PE-PTH, and the transformant was named Escherichia coli JM109 / pE-PTH.

2) JM109 / PE-P obtained in 1) above
Plasmid DNA was isolated and roughly purified from TH, and Escherichia coli MM294 (DE3) having T7 RNA polymerase required for expression of the T7 promoter [European publication No. 41650]
No. 5]. First, E. coli MM294 (DE3)
One platinum loop was inoculated into 10 ml of LD medium, and the
Shaking culture was carried out until it was between 0 and 180. 50m of this culture
Then, 10% W / V polyethylene glycol, 5% v / v dimethyl sulfoxide and 50 mM MgCl ₂ (pH 6.5) were added to 1 liter, and an LB medium was added so that the reaction solution became 100 μl. After adding 10 ng of plasmid DNA thereto and incubating at 4 ° C. for 10 minutes, the cells were spread on an LB agar medium containing 50 μg / ml of ampicillin and cultured at 37 ° C. overnight. Plasmid DNA obtained from the resulting colonies in the same manner as described above was digested with restriction enzymes, a transformant containing the hPTH gene was selected from the electrophoresis pattern, and this was used to transform Escherichia coli MM294 (DE
3) It was named / pE-PTH. Escherichia coli MM
294 (DE3) / pE-PTH is a fermentation research institute (IF
O) was deposited on August 28, 1990 as IFO 15087, and 1 as FERM BP-3110 at the Institute of Microbial Industry and Technology (FRI) of the Ministry of International Trade and Industry.
Deposited on September 25, 990.

Example 3 Production of hPTH 1) Escherichia coli MM294 (DE3) / pE-PTH
The cells were cultured with shaking at 37 ° C. overnight in an LB medium containing 50 μg / ml ampicillin. 100 μl of this culture solution was added to 10 ml of the same medium dispensed into a 200 ml flask, and cultured at 37 ° C. until the Kret value reached about 170, followed by isopropyl-β-D-
Thiogalactopyranoside (IPTG) was added to reach 0.1 mM. After further culturing for 2 hours, 1 ml of the culture was centrifuged at 15000 rpm at 4 ° C. for 5 minutes, and the obtained cells were separated from 0.5 M Tris.HCl (pH 6.8), 10% glycerol,
% (W / V) sodium dodecyl sulfate (SDS), β-mercaptoetal 0.1% (W / V), 100 μl of an aqueous solution containing bromophenol blue [Laemmli, UK, Nature,
227 680 (1970)], boiled for 3 minutes and subjected to 16% SDS polyacrylamide electrophoresis (PAGE). After the electrophoresis, when the gel was stained with Coomassie brilliant blue, a dark band showing the same mobility as that of the standard hPTH was observed (see FIG. 6). Another gel was subjected to Western blotting using the hPTH antibody.
The same staining pattern as PTH was obtained (see FIG. 7). As a result of gel staining and quantitative comparison with a standard product in Western blotting, about 200 mg of hPTH was expressed in terms of 1 liter culture solution.

2) E. hPT accumulated in E. coli
H was purified as follows. Cells from 200 ml of the culture solution obtained in the same manner as above were subjected to 8 M urea and 50 mM Tri.
s · HCl (pH 7.5), 50 mM EDTA, 1 mM α
-Suspended in a buffer solution (5 ml) containing toluenesulfonyl fluoride, and vigorously stirred under ice-cooling (about 1 hour) to destroy cells. The mixture was centrifuged at 15,000 rpm at 4 ° C. for 20 minutes, the supernatant was collected, and the same extraction operation was performed twice on the precipitate with a buffer (3 ml each) having the same composition. Combine the supernatants and dilute them two-fold, containing 4M urea
A 50 mM ammonium acetate buffer solution containing 4 M urea containing 4 M urea (10 ml) was passed through a TSK-gel, CM-Toyopearl column (Tosoh) (10 ml) equilibrated with a 50 mM ammonium acetate buffer solution (pH 5). The column was washed with (pH 5) (required about 10 ml), and when the absorption at 280 nm disappeared, 50 mM ammonium acetate (pH 5) buffer 50 ml-0.5 M ammonium acetate (p
H6) The column was developed by a linear concentration gradient method using 50 ml of a buffer solution (flow rate: 10 ml / hour, 1 fraction 2 m)
l). Fractions 33-47 were collected and lyophilized. This was subjected to reverse phase high performance liquid chromatography under the following conditions. Column: YMC-Pack A-325 S-
5 120A ODS (1 × 30 cm) (manufactured by YMC); solvent: 25% to 5 containing 0.1% trifluoroacetic acid
Linear gradient with acetonitrile to 0% (30 min); flow rate: 3 ml / min. Target peak (retention time 1
7.0 minutes). The obtained eluate is Bio-Rad
The solution was passed through a column of AG1 × 8 (acetic acid type) (Bio-Rad laboratory), the washing solution was added, acetonitrile was distilled off, and then lyophilized. 4.2 mg of the desired hPTH was obtained as a white powder. Based on the results of the following analyses,
It was shown to be TH.

A) The reverse phase HPLC showed a sharp single peak (see FIG. 8). Column: YMC-Pack A-32
4 S-5 DDS 120A φ10 × 300 mm;
A (0.1% trifluoroacetic acid), B (acetonitrile containing 0.1% trifluoroacetic acid); concentration gradient: 0-3 minutes (0
%, B), 3-10 minutes (0-30%, B), 10-70 minutes (30-
45%, B) b) SDS-PAGE and Western blotting after electrophoresis also showed a single band having the same mobility as the standard product (the conditions were the same as in FIGS. 6 and 7; see FIGS. 9 and 10).

C) amino acid analysis (in the presence of thioglycolic acid, in a sealed tube under reduced pressure, 110 ° C., 24 hours, hydrolysis of 5.7 N hydrochloric acid,
The values in parentheses indicate theoretical values): Asp (10), 10.5; Th
r (1), 0.96; Ser (7), 6.04; Glu (11),
11.73; Pro (3), 2.88; Gly (4) 4.69; Al
a (7), 7.03; Val (8), 7.91; Met (2),
1.96; Ile (1), 1.06; Leu (10), 10.6; Ph
e (1), 1.10; Lys (9), 9.32; His (4),
4.04; Arg (5), 4.00; Trp (1), 0.97 (82.3% recovery) d) N-terminal amino acid sequence analysis using Applied Biosystems gas phase sequencer model 470A
It was shown that the sequence from Ser at position 1 to Leu at position 15 was correct. e) Fast atom bombardment mass spectrometry after decomposition of bromocyan in 0.1 N hydrochloric acid (JEOL, JMS-
HX110 was used. ), The following peaks were observed. (1st-7th) -homoserine (MH +) Actual: 858.5 Theoretical: 858.5 (1st-17th) -Homoserine (MH +) Actual: 1990.2 Theoretical: 1990.0 (9th-17th) -homoserine (MH +) Actual value: 1102.7 Theoretical value: 1102.7 No peak derived from formylhomoserine or homoserine was observed.

Further, in the analysis after digestion with asparagine-specific endopeptidase, the following peak was observed.

(1st-16th) (MH +) Observed: 1819.9 Theoretical: 1819.9 (17th-33th) (MH +) Observed: 2168.8 Theoretical: 2168.1 ( (58th-76th) (M + Na) Found: 2061.8 Theoretical: 2062.0 (77th-84th) (MH +) Observed: 874.4 Theoretical: 874.5 The obtained hPTH has M at the N-terminus.
It was determined that the protein had a structure starting from Ser at position 1 and ending at Gln at position 84 at C-terminal without containing et or formyl-Met.

Experimental Example The biological activity of hPTH obtained in Example 3 was determined by Shigeno et al., Journal of Biological Chemistry, No. 26.
3, 18369-18377, 1980 (Shigeno et al. The Journal
al of Bioiogical Chemistry, 263 : 18369-18377 (198
8) The method reported in [1] was revised and evaluated. Mouse skull-derived osteoblast-like cell line, MC3 cultured on a 96-well multiplate (Nunclon, Nunclon)
0.01, 0.1, 1, 10 or 100 nM in T3-EI cells
100 μl of a culture solution containing 20 mM N-2 hydroxyethylpiperazine-N′-2ethanesulfonic acid (HEPES), 0.1% bovine serum albumin (BSA) and 0.5 mM isobutylmethylxanthine. Ha
nk's solution] and reacted at room temperature for 30 minutes. After adding 100 μl of 0.2N hydrochloric acid, the plate was immersed in boiling water for 2 and a half minutes, and cyclic cyclic substances produced by the hPHT receptor were added.
Adenosine monophosphate (cAMP) was extracted from the cells. The total cAMP measurement in the culture solution and in the cells was measured using a commercially available radioimmunoassay kit [cyclic AMP [ ^125]
I] Kit “DuPont-Daiichi”, Daiichi Pure Chemicals]. An increase in the amount of cAMP production depending on the concentration of the human PTH partial peptide (1-34) added as a standard was always observed, and the hPTH obtained by the method of this example was confirmed.
Had almost the same activity as this (see FIG. 11).

[0029]

According to the present invention, the hPTH gene provided by the present invention has a novel DNA sequence and exhibits a high expression rate of hPTH. According to the present invention, for the first time, a large amount (100 to 200 mg) of hPTH is obtained in a system using E. coli as a host. / Liter) directly. Further, the recombinant DNA technology using the synthetic gene corresponding to hPTH of the present invention provides hPTH.
TH can be produced more efficiently, which is useful for the production of hPTH as a therapeutic agent and for studying the physiological role of hPTH in vivo.

[0030]

[0031]

[Sequence list] SEQ ID NO: 1 Sequence length: 252 Sequence type: Number of nucleic acid strands: Double strand Topology: Linear Sequence type: Other nucleic acid, Synthetic DNA Sequence characteristics Characteristic symbol: Mat peptide Location: 1 ... 252 Method used to determine characteristics: E Symbol representing feature: mutation Location: 7, 8, 9, 12, 15, 19, 21, 33, 36, 43, 51,
58, 60, 82, 109, 111, 114, 117, 120, 121, 123, 12
9,130,132,147,150,153,156,177,196,197,19
8, 201, 204, 216, 219 Method for determining features: S

SEQ ID NO: 2 Sequence length: 263 Sequence type: number of nucleic acid strands: double-stranded Topology: linear Sequence type: other nucleic acids, characteristics of synthetic DNA sequence Characteristic symbol: CDS presence Position: 2 ... 262 Method for determining characteristics: E Symbol indicating characteristic: Mat peptide Location: 5 ... 256 Method for determining characteristics: E Symbol for characteristic: mutation Location: 11, 12, 13 , 16,19,23,25,37,40,47,5
5, 62, 64, 86, 113, 115, 118, 121, 124, 125, 127,
133,134,136,151,154,157,160,181,200,201,
202, 205, 207, 220, 223, 259, 261, 263 Method for determining features: S

SEQ ID NO: 3 Sequence length: 265 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Antisense: yes

SEQ ID NO: 4 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acids, characteristics of synthetic DNA sequence Characteristic symbol: CDS presence Position: 2 ... 30 Characterized method: E Sequence: TATGTCTGTG TCCGAGATTC AGTTAATGCA 30.

SEQ ID NO: 5 Sequence length: 34 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Antisense: Yes Sequence type: Other nucleic acid, Characteristics of synthetic DNA sequence Characteristic Symbol: CDS Location: 1 ... 34 Method for determining characteristics: E Sequence: AGGTTATGCA TTAACTGAAT CTCGGACACA GACA 34.

SEQ ID NO: 6 Sequence length: 45 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Type of sequence: Other nucleic acid, characteristics of synthetic DNA Sequence characteristic symbol: CDS present Position: 1 ... 45 Method for determining characteristics: E Sequence: TAACCTTGGC AAACATTTGA ACTCCATGGA GCGTGTAGAA TGGCT 45.

SEQ ID NO: 7 Sequence length: 45 Sequence type: number of nucleic acid strands: single strand Topology: linear Sequence type: other nucleic acid, characteristic of synthetic DNA sequence Characteristic symbol: CDS presence Position: 1 ... 45 Method of Characterization: E Sequence: TTACGCAGCC ATTCTACACG CTCCATGGAG TTCAAATGTT TGCCA 45.

SEQ ID NO: 8 Sequence length: 30 Sequence type: number of nucleic acid strands: single strand Topology: linear Sequence type: other nucleic acid, characteristic of synthetic DNA sequence Characteristic symbol: CDS presence Position: 1 ... 30 Method for determining characteristics: E Sequence: GCGTAAGAAG TTGCAGGATG TGCACAATTT 30.

SEQ ID NO: 9 Sequence length: 30 Sequence type: Number of nucleic acid strands: 1 strand Topology: Linear Antisense: Yes Sequence type: Other nucleic acids, characteristics of synthetic DNA sequence Characteristic Symbol: CDS Location: 1 ... 30 Method for determining characteristics: E Sequence: GCAACAAAAT TGTGCACATC CTGCAACTTC 30.

SEQ ID NO: 10 Sequence length: 46 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid, characteristics of synthetic DNA sequence Characteristic symbol: CDS present Position: 1 ... 46 Characteristic method: E Sequence: TGTTGCCTTA GGTGCCCCAT TGGCTCCTCG TGATGCTGGT TCCCAA 46.

SEQ ID NO: 11 Sequence length: 46 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Antisense: Yes Sequence type: Other nucleic acids, Characteristics of synthetic DNA sequence Symbol: CDS Location: 1 ... 46 Method for determining characteristics: E Sequence: TGGTCTTTGG GAACCAGCAT CACGAGGAGC CAATGGGGCA CCTAAG 46.

SEQ ID NO: 12 Sequence length: 41 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Type of sequence: Other nucleic acid, Features of synthetic DNA Sequence Characteristic symbol: CDS present Position: 1 ... 41 Method for determining characteristics: E Sequence: AGACCACGTA AAAAGGAAGA CAATGTCTTA GTTGAGAGCC A41.

SEQ ID NO: 13 Sequence length: 41 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Antisense: Yes Sequence type: Other nucleic acid, Characteristics of synthetic DNA sequence Characteristic Symbol: CDS Location: 1 ... 41 Method for determining characteristics: E Sequence: TTTTCATGGC TCTCAACTAA GACATTGTCT TCCTTTTTAC G41.

SEQ ID NO: 14 Sequence length: 42 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Type of sequence: Other nucleic acid, Synthetic DNA Sequence characteristics Characteristic symbol: CDS Position: 1 ... 42 Method for determining characteristics: E Sequence: TGAAAAATCC CTAGGCGAGG CAGACAAGGC CGATGTGAAT GT42.

SEQ ID NO: 15 Sequence length: 42 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Antisense: Yes Sequence type: Other nucleic acids, characteristics of synthetic DNA sequence Characteristic Symbol: CDS Location: 1 ... 42 Method for determining characteristics: E Sequence: GTTAATACAT TCACATCGGC CTTGTCTGCC TCGCCTAGGG AT42.

SEQ ID NO: 16 Sequence length: 29 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acids, characteristics of synthetic DNA sequence Characteristic symbol: CDS presence Position: 1 ... 28 Characterized method: E Sequence: ATTAACTAAA GCTAAATCCC AGTAATGAG 29.

SEQ ID NO: 17 Sequence length: 27 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Antisense: Yes Sequence type: Other nucleic acids, characteristics of synthetic DNA sequence Characteristic Symbol: CDS Location: 6 ... 27 Method for determining characteristics: E Sequence: GATCCTCATT ACTGGGATTT AGCTTTA 27.

[Brief description of the drawings]

FIG. 1. DN of the synthetic gene of the present invention corresponding to hPTH
It is a figure showing A sequence and amino acid sequence.

FIG. 2 is a diagram showing an example of the division of a DNA fragment during hPTH gene synthesis of the present invention.

FIG. 3 shows a DNA for producing a synthetic gene corresponding to hPTH of the present invention.
It is a figure showing an example of a fragment.

[FIG. 4-1] The DNA fragments of FIG.
It is a schematic diagram which manufactures a PTH synthesis gene.

FIG. 4-2 shows the ligation of each DNA fragment of FIG.
It is a schematic diagram which manufactures a PTH synthesis gene.

FIG. 5 is a construction diagram of an expression plasmid incorporating the hPTH-corresponding synthetic gene of the present invention.

FIG. 6 shows hPT in a transformant of the present invention.
FIG. 2 is an electrophoretogram showing the production of H and a diagram of its Western blotting. In the figure, lane 1 is a molecular weight marker,
Lane 2 is a standard hPTH, Lane 3 is an extract of a transformant induced by IPTG (corresponding to 10 μl of culture solution), and Lane 4 is an extract of a transformant not induced by IPTG (corresponding to 10 μl of culture solution). ).

FIG. 7 shows hPT in a transformant of the gene of the present invention.
FIG. 2 is an electrophoretogram showing the production of H and a diagram of its Western blotting. In the figure, lane 1 is a prestained molecular weight marker, lane 2 is an extract of a transformant not induced (corresponding to 10 μl of culture solution), and lane 3 is IPTG
Extract of the transformant cultured with induction in
Lane 4 is a standard product PTH.

FIG. 8 shows an elution pattern of purified hPTH by reverse phase HPLC.

FIG. 9 is a diagram showing an electrophoretogram of a hPTH sample and a Western blotting thereof. In the figure, lane 1 is a prestained molecular weight marker, and lane 2 is purified h obtained by the present invention.
PTH, lane 3 is a standard product hPTH.

FIG. 10 shows an electrophoretogram of an hPTH sample and its Western blotting. In the figure, lane 1 is a prestained molecular weight marker, lane 2 is purified hPTH obtained by the present invention, and lane 3 is a standard hPTH.

FIG. 11 is a view showing the biological activity of the hPTH fragment, wherein-*-indicates a synthetic hPTH (1-34) fragment, and-●-indicates a purified hPTH obtained by the present invention.

────────────────────────────────────────────────── ─── Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI (C12P 21/02 C12R 1:19) C12R 1:19) C12N 15/00 ZNAA (56) References Special Table 2-501108 ( JP, A) Biol. Chem. , Vol. 13, p. 7338-7344 (May 5, 1990)

Claims (8)

(57) [Claims] 1. DNA sequence: TCTGTG TCCGAG
ATTC AGTTAATGCATAACCTTGGGC
AAACATTTTGA ACTCCATGGAGGC
TGTAGAA TGGCTGCGTA AGAAGT
TGCAGGATGTGCAC AATTTTGTTGG
CCTTAGGTGCCCCATTGGGCT CCT
CGTGATG CTGGTTCCCAAAGAACCA
CGT AAAAAAGGAAG ACAATGTCTT
AGTTGAGAGC CATGAAAAT CCC
TAGGCGAGGCAGACAAG GCCGATG
TGA ATGTATTAACTAAAGCTAAAA
DNA containing a synthetic gene encoding human parathyroid hormone represented by TCCCAG. 2. The method for producing DNA according to claim 1, wherein a plurality of oligodeoxynucleotides are enzymatically linked and inserted into a vector if desired. 3. The vector containing the DNA according to claim 1, wherein the synthetic gene is inserted into a control region of an E. coli T7 promoter. 4. Escherichia coli MM294 (DE
3) The vector according to claim 3, which is a plasmid pE-PTH obtainable from / pE-PTH [FERM BP-3110]. [5] A transformant transformed with the DNA according to [1]. 6. An Escherichia coli transformant transformed by the DNA according to claim 1, 3 or 4. 7. Escherichia coli MM294 (DE
3) The transformant according to claim 6, which is / pE-PTH [FERM BP-3110]. 8. A method for producing human parathyroid hormone, which comprises culturing the transformant according to claim 5, 6 or 7, producing and accumulating human parathyroid hormone in the culture, and collecting the human parathyroid hormone. .