JPWO2021050601A5

JPWO2021050601A5 -

Info

Publication number: JPWO2021050601A5
Application number: JP2022515493A
Authority: JP
Publication date: 2023-09-15

Claims

A CasX:gNA system comprising a CasX protein and a first guide nucleic acid (gNA), wherein the gNA encodes a first protein involved in antigen processing, antigen presentation, antigen recognition, and/or antigen response. 138, wherein said CasX protein is a CasX variant protein comprising at least 70% identity to SEQ ID NO: 138, and as compared to a reference CasX protein. A CasX:gNA system exhibiting at least one improved property .

The first protein is
(a) is an immune cell surface marker or immune checkpoint protein ;
(b) is an intracellular protein ; or
(c) beta-2-microglobulin (B2M), T cell receptor alpha chain constant region (TRAC), transactivator of class II major histocompatibility complex (CIITA), T cell receptor beta constant 1 (TRBC1); ), T cell receptor beta constant 2 (TRBC2), human leukocyte antigen A (HLA-A), human leukocyte antigen B (HLA-B), TGFβ receptor 2 (TGFβRII), programmed cell death 1 (PD-1) , cytokine-induced SH2 (CISH), lymphocyte activation 3 (LAG-3), T cell immunoreceptor with Ig and ITIM domains (TIGIT), adenosine A2a receptor (ADORA2A), killer cell lectin-like receptor C1 (NKG2A), cytotoxic T lymphocyte associated protein 4 (CTLA-4), T cell immunoglobulin and mucin domain 3 (TIM-3), and 2B4 (CD244). The CasX:gNA system described.

Beta-2-microglobulin (B2M), T cell receptor alpha chain constant region (TRAC), transactivator of class II major histocompatibility complex (CIITA), T cell receptor beta constant 1 (TRBC1), T Cell receptor beta constant 2 (TRBC2), human leukocyte antigen A (HLA-A), human leukocyte antigen B (HLA-B), TGFβRII, PD-1, CISH, LAG-3, TIGIT, ADORA2A, NKG2A, CTLA- 4, TIM-3, and CD244, further comprising a second gNA comprising a target sequence complementary to a target nucleic acid sequence of an immune cell gene encoding a second protein selected from the group consisting of The CasX:gNA system according to claim 1 or 2 , wherein: is different from the first protein.

CasX:gNA system according to any one of claims 1 to 3 , wherein the first gNA and/or the second gNA are guide RNAs (gRNAs).

1 . The first gNA and/or the second gNA comprises a scaffold stem-loop sequence of CCAGCGACUAUGUCGUAGUGG (SEQ ID NO: 32), or a sequence having at least 1, 2, 3, 4 or 5 mismatches thereto. CasX:gNA system according to any one of 4 to 4 .

CasX:gNA system according to any one of claims 1 to 5 , wherein the gNA has a scaffold comprising the sequence of SEQ ID NO: 2238 , or a sequence having at least about 70% sequence identity thereto.

CasX:gNA system according to any one of claims 1 to 6 , wherein the first gNA and/or the second gNA are chemically modified.

The CasX protein is
(a) is a chimeric CasX protein comprising multiple domains derived from two or more different CasX proteins; and
(b) a CasX:gNA system according to any one of claims 1 to 7 , comprising the sequence SEQ ID NO : 138 , or a sequence having at least about 70 % sequence identity thereto.

CasX:gNA system according to claim 8 , wherein the CasX variant protein comprises at least one modification compared to a reference CasX protein having a sequence selected from SEQ ID NO: 1-3.

said at least one modification comprises at least one amino acid substitution, deletion, or substitution in a domain of said CasX variant protein compared to said reference CasX protein having a sequence selected from the group consisting of SEQ ID NOs: 1-3. 10. The CasX:gNA system of claim 9 , comprising:

the domain is selected from the group consisting of a non-target strand binding (NTSB) domain, a labeled strand loading (TSL) domain, a helical I domain, a helical II domain, an oligonucleotide binding domain (OBD), and a RuvC DNA cleavage domain; CasX:gNA system according to claim 10 .

The CasX variant protein is
(a) Non-target strand binding (NTSB) domain;
(b) labeled strand loading (TSL) domain;
(c) Chimeric helical I domain;
(d) Helical II domain;
(e) an oligonucleotide binding domain (OBD); and
(f) RuvC DNA cleavage domain;
including,
Optionally, the chimeric helical I domain has a sequence having at least about 70% sequence identity with or about amino acids 59-102 of SEQ ID NO: 2, and at least about 70% sequence identity with or about amino acids 192-332 of SEQ ID NO: 1. 12. The CasX:gNA system of claim 11, comprising sequences with 70% sequence identity .

CasX:gNA system according to any one of claims 1 to 12 , wherein the CasX protein comprises one or more nuclear localization signals (NLS).

The CasX variant is capable of forming a ribonucleoprotein complex (RNP) with the variant gNA, and the RNP of the CasX variant protein and the gNA variant is of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3. According to any one of claims 1 to 13, the gNA RNP exhibits at least one or more improved properties compared to a reference CasX protein and a gNA RNP comprising a sequence of any one of SEQ ID NOs: 4 to 16. The CasX:gNA system described.

The at least one improved property comprises a non-target strand of a protospacer in which any one of the PAM sequences TTC, ATC, GTC, or CTC has identity with the target sequence of the gNA in a cellular assay system. The editing efficiency of an RNP comprising the reference CasX protein of SEQ ID NO: 2 and the gNA comprising any one of SEQ ID NOs: 4 to 16 in an equivalent assay system and 15. The CasX:gNA system of claim 14 , comprising higher editing efficiency and/or binding of target sequences in said target DNA compared to binding.

the RNP is at least 5%, at least 10%, at least 15% compared to the reference CasX of SEQ ID NOs: 1-3 and the gNA comprising a sequence of any one of SEQ ID NOs: 4-16; or at least a 20% higher percentage of cleavage-competent RNPs.

CasX according to any one of claims 1 to 14 , wherein the CasX protein is a catalytically inactive CasX (dCasX) protein, and the dCasX and the gNA retain the ability to bind to a target nucleic acid: gNA system.

CasX:gNA system according to any one of claims 1 to 16 , further comprising a donor template nucleic acid.

A polynucleotide comprising a sequence encoding CasX and/or gNA according to any one of claims 1 to 17 .

A vector comprising the polynucleotide of claim 19 .

The vector is a retrovirus vector, lentivirus vector, adenovirus vector, adeno-associated virus (AAV) vector, virus-like particle (VLP), herpes simplex virus (HSV) vector, plasmid, minicircle, nanoplasmid, DNA vector, and an RNA vector.

A method of modifying a target nucleic acid sequence of a gene in a population of cells, wherein said gene encodes a protein involved in antigen processing, antigen presentation, antigen recognition, and/or antigen response, and wherein said gene encodes a protein involved in antigen processing, antigen presentation, antigen recognition, and/or antigen response;
a. CasX:gNA system according to any one of claims 1 to 18 ,
b. The polynucleotide according to claim 19 ,
c. The vector according to claim 20 or 21 , or
d . Including introducing a combination of two or more of ( a) to ( c ),
The method, wherein the target nucleic acid sequence of the cell is modified by the CasX protein.

The CasX:gNA system is introduced into the cell as an RNP and/or the cell is infected with a polypeptide encoding a chimeric antigen receptor (CAR) with binding affinity for a disease antigen, optionally a tumor cell antigen. 23. The method according to claim 22 , wherein the method is modified by the introduction of nucleotides.

A cell population modified ex vivo by the method of claim 22 or 23 .

25. The cell population of claim 24 for use in providing anti-tumor immunity in a subject .

25. The cell population of claim 24 for use in the treatment of a subject .

27. A cell population for use according to claim 26 , wherein the subject has cancer or an autoimmune disease.

28. A cell population for use according to claim 27 , wherein said cancer expresses a tumor cell antigen and said CAR has specific binding affinity for said tumor cell antigen.

A method of preparing cells for immunotherapy in a subject, said method reducing or eliminating expression of one or more proteins involved in antigen processing, antigen presentation, antigen recognition, and/or antigen response. and contacting a target nucleic acid sequence of the immune cell with a CasX:gNA system comprising a CasX protein and one or more gNA , wherein the CasX protein has the sequence number: 138, and wherein each gNA encodes said one or more proteins involved in antigen processing, antigen presentation, antigen recognition, and/or antigen response. comprising a target sequence complementary to a target nucleic acid sequence of one or more genes.

The one or more proteins are B2M, TTRAC, CIITA, TRBC1, TRBC2, HLA-A, HLA-B, TGFβRII, PD-1, CISH, LAG-3, TIGIT, ADORA2A, NKG2A, CTLA-4, TIM- 30. The method of claim 29 , wherein the method is selected from the group consisting of: 3, and CD244.

The method includes:
(a) a chimeric antigen receptor (CAR) with specific binding affinity for tumor cell antigens , and/or
(b) an engineered T cell receptor (TCR) comprising a binding domain with binding affinity for a disease antigen , said disease antigen being a tumor cell antigen;
31. The method according to claim 29 or 30 , comprising introducing a polynucleic acid encoding the above into the immune cells .

The cell is
(a) is self to said subject receiving said cell; or
(b) is allogeneic to the subject receiving the cell;
A method according to any one of claims 29 to 31 .

33. The method of any one of claims 29-32 , wherein the subject has cancer or an autoimmune disease.

34. The method of claim 33 , wherein the cancer expresses a tumor cell antigen and the CAR has specific binding affinity for the tumor cell antigen.

Said administration of a therapeutically effective amount of said cells results in tumor regression as a complete response, partial response, or incomplete response; progression-free period, treatment success period, biomarker response; progression-free survival period; disease-free survival period; relapse-free period an improvement in a clinical parameter or clinical endpoint related to the disease in the subject selected from one or more of; metastasis-free time; overall survival; improvement in quality of life; and improvement in symptoms. The method according to any one of items 29 to 34 .

A guide nucleic acid (gNA) comprising a target sequence complementary to a target nucleic acid sequence in the target strand of a gene encoding a protein involved in antigen processing, antigen presentation, antigen recognition, and/or antigen response, wherein said The gNA has a scaffold comprising a sequence having at least about 70% identity to the sequence of SEQ ID NO: 2238, and is specific for a protospacer adjacent motif (PAM) sequence comprising a TC motif in the complementary non-target strand. 138, wherein said CRISPR protein comprises a sequence having at least 70% sequence identity to SEQ ID NO: 138, wherein said PAM sequence comprises a sequence in said target strand. a gNA located one nucleotide 5' of a sequence in the non-target strand that is complementary to the target nucleic acid sequence, and wherein the target sequence is located at the 3' end of the gNA .