JPWO2021041885A5 - - Google Patents

Description

The present disclosure includes the following embodiments.
Embodiment 1
A method of editing a polynucleotide to allow transcription, comprising contacting said polynucleotide with a base editor in complex with one or more guide polynucleotides, said base editor comprising: A method, comprising a nucleotide programmable DNA binding domain and a deaminase domain, wherein one or more of said guide polynucleotides target said base editor to effect alterations that introduce transcription-enabling mutations.
Embodiment 2
2. The method of embodiment 1, wherein said mutation that enables transcription is a mutation that alters a stop codon, introduces a splice acceptor or splice donor site, or corrects a splice acceptor or splice donor site. .
Embodiment 3
A method of editing an SBDS polynucleotide containing mutations associated with Schwackman-Diamond Syndrome (SDS) comprising contacting said SBDS polynucleotide with a base editor in complex with one or more guide polynucleotides. wherein said base editor comprises a polynucleotide programmable DNA binding domain and a deaminase domain, and wherein one or more of said guide polynucleotides target said base editor to Schwackman-Diamond syndrome (SDS) A method that results in an associated mutational change.
Embodiment 4
4. The method of any one of embodiments 1-3, wherein the deaminase is cytidine deaminase or adenosine deaminase.
Embodiment 5
5. The method of embodiment 4, wherein said deaminase is an adenosine deaminase.
Embodiment 6
6. The method of embodiment 5, wherein said adenosine deaminase is selected from ABE8 or ABE8 variants listed in Table 7A or Table 7B.
Embodiment 7
5. The method of embodiment 4, wherein said deaminase is cytidine deaminase.
Embodiment 8
The cytosine deaminase is BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1, AmAPOBEC1, SsAPOBEC2, RrA3F containing the H122A substitution; A variant of BE4 in which the sequence of AmAPOBEC1 is replaced, a variant of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 contains the H122A substitution. 8. The method of embodiment 7, wherein the method is selected from one or more of the variants of BE4 replaced with the sequence of PpAPOBEC1 that replaces the PpAPOBEC1 sequence.
Embodiment 9
one or more variants of PpAPOBEC1 containing the H122A substitution or BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution selected from R33A, W90F, K34A, R52A, H121A, or Y120F 9. The method of embodiment 8, further comprising amino acid mutations.
Embodiment 10
4. The method of any one of embodiments 1-3, wherein the two or more guide polynucleotides target the base editor to effect alteration of two or more mutations associated with Schwakman-Diamond Syndrome.
Embodiment 11
A method of editing an SBDS polynucleotide comprising mutations associated with Schwackman-Diamond Syndrome (SDS), comprising: editing the SBDS polynucleotide into an adenosine base editor (ABE) in complex with one or more guide polynucleotides. wherein the base editor comprises a polynucleotide programmable DNA binding domain and a deaminase domain, the one or more guide polynucleotides directing the base editor to the A of 183-184 TA>CT Rs113993991 • A method that results in a T to G·C change and generates a missense mutation.
Embodiment 12
5. The method of embodiment 4, wherein said guide polynucleotide targets one of the following sequences: TGTAAATGTTTCCTAAGGTC or AATGTTTCCTAAGGTCAGGT.
Embodiment 13
8. The method of embodiment 7, wherein said ABE has 5'-NGC-3' or 5'-NGG-3'PAM specificity.
Embodiment 14
A method of editing an SBDS polynucleotide containing mutations associated with Schwackman-Diamond Syndrome (SDS) comprising contacting said SBDS polynucleotide with a cytidine base editor in complex with one or more guide polynucleotides. wherein said cytidine base editor (CBE) comprises a polynucleotide programmable DNA binding domain and a cytidine deaminase domain, and wherein one or more of said guide polynucleotides target said base editor to rs113993993 258+2T> A method resulting in a change of C from C.G to T.A.
Embodiment 15
15. The method of embodiment 14, wherein said CBE has 5'-NGC-3'PAM specificity or specificity for a PAM containing 5'-NGC-3'.
Embodiment 16
The guide polynucleotide is GTAAGCAGGCGGGTAACAGCTGC, AGCAGGCGGGTAACAGCTGCAGC, GCGGGTAACAGCTGCAGCATAGC, GTAAGCAGGCGGGTAACAGC, AGCAGGCGGGTAACAGCTGC, GCGGGTAACAGCTGCAGCAT, GCAGGCGGGTAAC 16. The method of embodiment 14 or embodiment 15, wherein a polynucleotide target sequence selected from AGCTGC, CAGGCGGGTAACAGCTGC, AGGCGGGTAACAGCTGC, or AAGCAGGCGGGTAACAGCTGC is targeted. .
Embodiment 17
17. The method of any one of embodiments 1-16, wherein said contacting is within a cell, a eukaryotic cell, a mammalian cell, or a human cell.
Embodiment 18
18. The method of embodiment 17, wherein said cell is in vivo or ex vivo.
Embodiment 19
19. The method of any one of embodiments 3-18, wherein said mutation associated with Schwackman-Diamond Syndrome (SDS) results from gene conversion.
Embodiment 20
20. The method of any one of embodiments 3-19, wherein said mutation associated with Schwackman-Diamond Syndrome (SDS) induces a stop codon or alters splicing of said gene.
Embodiment 21
21. The method of any one of embodiments 3-20, wherein said mutation associated with Schwackman-Diamond Syndrome (SDS) encodes an SBDS polypeptide with a truncation.
Embodiment 22
of embodiments 1-21, wherein said base editor introduces missense mutations, inserts new splice acceptor or splice donor sites, and/or corrects splice acceptor or splice donor sites containing mutations. A method according to any one of paragraphs.
Embodiment 23
said polynucleotide programmable DNA binding domain is from Streptococcus pyrogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus 1Cas9 (St1Cas9), Streptococcus canis Cas9 (ScCas9), or variants thereof 23. The method of any one of embodiments 1-22, which is selected Cas9.
Embodiment 24
24. The method of embodiment 23, wherein said polynucleotide programmable DNA binding domain is wild-type or modified Streptococcus pyrogenes Cas9 (SpCas9), or a variant thereof.
Embodiment 25
25. The method of embodiment 24, wherein said polynucleotide programmable DNA binding domain is a modified SpCas9 or SpCas9 variant.
Embodiment 26
26. The method of embodiment 24 or 25, wherein said polynucleotide programmable DNA binding domain comprises a modified SpCas9 or SpCas9 variant with altered protospacer adjacent motif (PAM) specificity.
Embodiment 27
27. The method of embodiment 26, wherein said SpCas9 has specificity for 5'-NGC-3' or 5'-NGG-3' of PAM nucleic acid sequences.
Embodiment 28
28. The method of embodiment 27, wherein said SpCas9 is a modified SpCas9 or SpCas9 variant with specificity for a PAM nucleic acid sequence comprising the PAM nucleic acid sequence 5'-NGC-3' or 5'-NGC-3'.
Embodiment 29
29. The method of any one of embodiments 26-28, wherein said modified SpCas9 or SpCas9 variant comprises an amino acid sequence listed in Table 1.
Embodiment 30
30. The method of embodiment 29, wherein said modified SpCas9 is spCas9-MQKFRAER.
Embodiment 31
29. The method of any one of embodiments 26-28, wherein said modified SpCas9 or SpCas9 variant comprises a combination of amino acid substitutions set forth in FIGS. 3A-3C or FIG.
Embodiment 32
32. The method of embodiment 31, wherein said modified SpCas9 or SpCas9 variant comprises a combination of amino acid sequence substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E and T1337R (267 (NGC Rd2 SpCas9).
Embodiment 33
33. The method of any one of embodiments 1-32, wherein the polynucleotide programmable DNA binding domain is nuclease inactive or a nickase variant.
Embodiment 34
34. The method of embodiment 33, wherein said nickase variant comprises the amino acid substitution D10A or its corresponding amino acid substitution.
Embodiment 35
35. The method of any one of embodiments 1-34, wherein said deaminase domain is capable of deaminating adenosine or cytosine in deoxyribonucleic acid (DNA).
Embodiment 36
17. The method of embodiment 16, wherein said adenosine deaminase or cytidine deaminase is a non-naturally occurring modified adenosine deaminase or cytidine deaminase.
Embodiment 37
37. The method of embodiment 36, wherein said adenosine deaminase is TadA deaminase.
Embodiment 38
The TadA deaminase is TadA * 7.10, TadA * 8.1, TadA * 8.2, TadA * 8.3, TadA * 8.4, TadA * 8.5, TadA * 8.6, TadA * 8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or 38. The method of embodiment 37, wherein the TadA* is 8.24.
Embodiment 39
39. The method of embodiment 38, wherein said TadA*7.10 comprises one or more of the following modifications: Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R.
Embodiment 40
Y147R+Q154R+I76Y; Y147R+Q154R+T166R; Y147T+Q154R; Y147T+Q154S; V82S+Q154S; 40. The method of embodiment 39, comprising a combination of modifications selected from the group consisting of:
Embodiment 41
said one or more guide RNAs comprising a CRISPR RNA (crRNA) and a transcoding small RNA (tracrRNA), wherein said crRNA is a nucleic acid sequence complementary to an SBDS nucleic acid sequence comprising said modifications associated with SDS 41. The method of any one of embodiments 1-40, comprising
Embodiment 42
42. Any one of embodiments 1-41, wherein the base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to an SBDS nucleic acid sequence comprising an SDS-associated modification. The method described in .
Embodiment 43
13. The method of embodiment 12, wherein said sgRNA comprises one of the following sequences: UGUAAAUGUUUCCUAAGGUC or AAUGUUUCCUAAGGUCAGGU.
Embodiment 44
17. The method of embodiment 16, wherein said sgRNA comprises one of the following sequences:
GUAAGCAGGCGGGUAACAGC; AGCAGGCGGGUAACAGCUGC; GCGGGUAACAGCUGCAGCA; AGCUGC.
Embodiment 45
in cells or in their precursors,
in a cell a base editor comprising a polynucleotide programmable DNA binding domain and a deaminase domain, a polynucleotide encoding said base editor; and
one or more guide polynucleotides that target the base editor to effect aberrant splicing-related changes;
Cells produced by transduction.
Embodiment 46
46. The cell of embodiment 45, wherein said cell or precursor thereof is an embryonic stem cell, an induced pluripotent stem cell, or a hematopoietic stem cell.
Embodiment 47
47. The cell of embodiment 46, which expresses an SBDS protein.
Embodiment 48
48. The cell of any one of embodiments 45-47, which is derived from a subject with Schwackman-Diamond Syndrome (SDS).
Embodiment 49
49. The cell of any one of embodiments 45-48, which is a mammalian cell or a human cell.
Embodiment 50
50. The cell of any one of embodiments 45-49, wherein said mutation results from gene conversion involving stop codons and/or mutations caused by aberrant splicing.
Embodiment 51
51. The cell of embodiment 50, selected for gene conversion associated with SDS.
Embodiment 52
52. The cell of any one of embodiments 45-51, wherein said polynucleotide programmable DNA binding domain is wild-type or modified Streptococcus pyrogenes Cas9 (SpCas9), or a variant thereof.
Embodiment 53
53. The cell of any one of embodiments 45-52, wherein said polynucleotide programmable DNA binding domain comprises wild-type SpCas9 or a modified SpCas9 variant with altered protospacer adjacent motif (PAM) specificity.
Embodiment 54
54. The cell of embodiment 53, wherein said modified SpCas9 has specificity for a PAM nucleic acid sequence comprising the nucleic acid sequence 5'-NGC-3' or or 5'-NGC-3'.
Embodiment 55
54. The cell of embodiment 53, wherein said modified SpCas9 is a Cas9 listed in Table 1.
Embodiment 56
56. The cell of embodiment 55, wherein said modified SpCas9 is spCas9-MQKFRAER.
Embodiment 57
53. The cell of embodiment 52, wherein said modified SpCas9 is a SpCas9 variant comprising a combination of amino acid substitutions shown in FIGS. 3A-3C or FIG.
Embodiment 58
58. The cell of embodiment 57, wherein said SpCas9 variant comprises a combination of amino acid sequences/substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E and T1337R (267 (NGC Rd2 SpCas9).
Embodiment 59
59. The cell of any one of embodiments 45-58, wherein said programmable polynucleotide DNA binding domain is a nuclease inactive variant.
Embodiment 60
60. The cell of any one of embodiments 45-59, wherein said programmable polynucleotide DNA binding domain is a nickase variant.
Embodiment 61
61. The cell of embodiment 60, wherein said nickase variant comprises the amino acid substitution D10A or its corresponding amino acid substitution.
Embodiment 62
Embodiment 45, wherein said deaminase domain is a cytidine deaminase domain capable of deaminating cytidine in deoxyribonucleic acid (DNA) or an adenosine deaminase domain capable of deaminating adenosine in DNA. 61. The cell of any one of paragraphs 1-61.
Embodiment 63
63. The cell of embodiment 62, wherein said adenosine deaminase or cytidine deaminase is a non-naturally occurring modified adenosine deaminase or cytidine deaminase.
Embodiment 64
64. The cell of embodiment 63, wherein said adenosine deaminase is TadA deaminase.
Embodiment 65
The TadA deaminase is TadA * 7.10, TadA * 8.1, TadA * 8.2, TadA * 8.3, TadA * 8.4, TadA * 8.5, TadA * 8.6, TadA * 8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or 64. The cell of embodiment 63, which is TadA*8.24.
Embodiment 66
66. The cell of embodiment 65, wherein said TadA*7.10 comprises one or more of the following modifications: Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R.
Embodiment 67
The cell of embodiment 66, wherein said TadA*7.10 comprises a combination of alterations selected from the group consisting of Y147R+Q154R+Y123H; Y147R+Q154R+I76Y; Y147R+Q154R+T166R;
Embodiment 68
The cytosine deaminase is BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 A variant of BE4 in which the sequence of AmAPOBEC1 is replaced, a variant of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 contains the H122A substitution. 64. The cell of embodiment 63, wherein the cell is selected from one or more of the variants of BE4 replaced with sequences of PpAPOBEC1 that are
Embodiment 69
one or more variants of PpAPOBEC1 containing the H122A substitution or BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution selected from R33A, W90F, K34A, R52A, H121A, or Y120F 69. The cell of embodiment 68, further comprising an amino acid mutation.
Embodiment 70
The one or more guide RNAs comprise a CRISPR RNA (crRNA) and a transcoding small RNA (tracrRNA), wherein the crRNA comprises a nucleic acid sequence complementary to an SBDS nucleic acid sequence containing SDS-related modifications. 70. The cell of any one of embodiments 45-69, comprising:
Embodiment 71
71. The cell of any one of embodiments 45-70, wherein said base editor and one or more guide polynucleotides form a complex within the cell.
Embodiment 72
72. The cell of embodiment 71, wherein said base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to an SBDS nucleic acid sequence comprising said gene conversion associated with SDS.
Embodiment 73
A method of treating Schwackman-Diamond Syndrome (SDS) or a disease associated with aberrant splicing in a subject in need thereof, comprising administering to said subject a cell according to any one of embodiments 45-72. A method comprising administering.
Embodiment 74
74. The method of embodiment 73, wherein said cells are autologous, allogeneic or xenogeneic to said subject.
Embodiment 75
An isolated cell or population of cells grown or expanded from the cells of any one of embodiments 45-72.
Embodiment 76
A method of treating Schwackman-Diamond Syndrome (SDS) in a subject, comprising:
a base editor comprising a polynucleotide programmable DNA binding domain and a deaminase domain, or a polynucleotide encoding said base editor; and
one or more guide polynucleotides that target the base editor to effect SDS-related changes
A method comprising administering
Embodiment 77
A method of treating a genetic disorder associated with aberrant splicing in a subject in need thereof
a base editor comprising a polynucleotide programmable DNA binding domain and a deaminase domain, or a polynucleotide encoding said base editor; and
one or more guide polynucleotides that target the base editor to effect splicing altering pathogenic mutation alterations
A method comprising administering
Embodiment 78
78. The method of embodiment 76 or 77, wherein said subject is a mammal or human.
Embodiment 79
78. The method of embodiment 76 or 77, comprising delivering said base editor or a polynucleotide encoding said base editor and said one or more guide polynucleotides to said cell of said subject.
Embodiment 80
78. The method of embodiment 76 or 77, wherein said cell expresses a truncated polypeptide.
Embodiment 81
78. The method of embodiment 76 or 77, wherein said alteration converts a TAA stop to TGG in the SBDS polynucleotide.
Embodiment 82
82. The method of any one of embodiments 76-81, wherein said alteration alters K62X in said SBDS polypeptide associated with SDS.
Embodiment 83
83. The method of any one of embodiments 76-82, wherein said gene conversion associated with SDS results in expression of a truncated SBDS polypeptide.
Embodiment 84
59. The method of any one of embodiments 76-58, wherein said base editor modification replaces lysine (K) with tryptophan (W) at amino acid position 62.
Embodiment 85
85. The method of any one of embodiments 76-84, wherein said polynucleotide programmable DNA binding domain comprises a modified Streptococcus pyrogenes Cas9 (SpCas9), or variant thereof.
Embodiment 86
86. The method of any one of embodiments 76-85, wherein said polynucleotide programmable DNA binding domain comprises a modified SpCas9 with altered protospacer adjacent motif (PAM) specificity.
Embodiment 87
87. The method of embodiment 86, wherein said modified SpCas9 has specificity for a PAM nucleic acid sequence comprising the nucleic acid sequence 5'-NGC-3' or 5'-NGC-3'.
Embodiment 88
88. The method of embodiments 85-87, wherein said modified SpCas9 is a Cas9 listed in Table 1.
Embodiment 89
89. The method of embodiment 88, wherein said modified SpCas9 is spCas9-MQKFRAER.
Embodiment 90
88. The method of any one of embodiments 85-87, wherein said modified SpCas9 is a SpCas9 variant comprising a combination of amino acid substitutions set forth in FIGS. 3A-3C or FIG.
Embodiment 91
91. The method of embodiment 90, wherein said SpCas9 variant comprises a combination of amino acid sequence substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E and T1337R (267 (NGC Rd2 SpCas9).
Embodiment 92
92. The method of any one of embodiments 76-91, wherein the polynucleotide programmable DNA binding domain is a nuclease inactive variant.
Embodiment 93
The method of any one of embodiments 76-91, wherein the polynucleotide programmable DNA binding domain is a variant of nickase.
Embodiment 94
94. The method of embodiment 93, wherein said nickase variant comprises the amino acid substitution D10A or its corresponding amino acid substitution.
Embodiment 95
95. The method of any one of embodiments 76-94, wherein said deaminase domain is capable of deaminating adenosine or cytidine in deoxyribonucleic acid (DNA).
Embodiment 96
96. The method of embodiment 95, wherein said deaminase domain is a non-naturally occurring modified adenosine deaminase or cytidine deaminase.
Embodiment 97
97. The method of embodiment 96, wherein said adenosine deaminase is TadA deaminase.
Embodiment 98
The TadA deaminase is TadA * 7.10, TadA * 8.1, TadA * 8.2, TadA * 8.3, TadA * 8.4, TadA * 8.5, TadA * 8.6, TadA * 8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or 71. The method of embodiment 70, wherein the TadA* is 8.24.
Embodiment 99
wherein said TadA*7.10 includes one or more of the following modifications: Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R; or said TadA*7.10 is Y147R+Q154R+Y123H; 4R + T166R; Y147T+Q154S; V82S+Q154S; and Y123H+Y147R+Q154R+I76Y.
Embodiment 100
wherein the deaminase domain is BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 A variant of BE4 in which the sequence of AmAPOBEC1 is replaced, a variant of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 contains the H122A substitution. 97. The method of embodiment 96, wherein the cytidine deaminase is selected from one or more of the variants of BE4 replaced with the sequence of PpAPOBEC1 that replaces the PpAPOBEC1 sequence with
Embodiment 101
one or more variants of PpAPOBEC1 containing the H122A substitution or BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution selected from R33A, W90F, K34A, R52A, H121A, or Y120F 101. The method of embodiment 100, further comprising amino acid mutations.
Embodiment 102
102. The method of embodiment 100 or 101, wherein said base editor targets SNP rs113993993 258+2T>C in said SBDS polynucleotide sequence to restore correct splicing.
Embodiment 103
wherein said one or more guide polynucleotides comprise a CRISPR RNA (crRNA) and a transcoding small RNA (tracrRNA), wherein said crRNA comprises a nucleic acid sequence complementary to an SBDS nucleic acid sequence comprising gene conversion; 103. The method of any one of embodiments 76-102.
Embodiment 104
104. Any one of embodiments 76-103, wherein the base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the SBDS nucleic acid sequence comprising the gene conversion associated with the SDS The method described in section.
Embodiment 105
A method of producing a cell or precursor thereof, comprising:
(a) in an induced pluripotent stem cell containing a gene transformation associated with Schwackman-Diamond Syndrome (SDS),
a polynucleotide-programmable nucleotide-binding domain and a base editor or a polynucleotide encoding a base editor comprising a cytidine deaminase domain or an adenosine deaminase domain; and
One or more guide polynucleotides that target base editors to effect alterations in SDS-associated mutations
introducing; and
(b) differentiating said induced pluripotent stem cells or progenitors into a desired cell type;
method including.
Embodiment 106
106. The method of embodiment 105, wherein said mutation is a gene conversion associated with SDS.
Embodiment 107
107. The method of embodiment 105 or 106, wherein said cells or progenitors are obtained from a subject with SDS.
Embodiment 108
108. The method of any one of embodiments 105-107, wherein said cells or progenitors are mammalian or human cells.
Embodiment 109
109. The method of any one of embodiments 105-108, wherein said polynucleotide programmable DNA binding domain comprises Streptococcus pyrogenes Cas9 (SpCas9), modified Streptococcus pyrogenes Cas9 (SpCas9), or variants thereof.
Embodiment 110
110. The method of any one of embodiments 105-109, wherein said polynucleotide programmable DNA binding domain comprises a modified SpCas9 with altered protospacer adjacent motif (PAM) specificity.
Embodiment 111
The SpCas9 has specificity for the nucleic acid sequence 5'-NGG-3', and the modified SpCas9 is specific for the PAM nucleic acid sequence containing the nucleic acid sequence 5'-NGC-3' or 5'-NGC-3' 111. The method of any one of embodiments 105-110, wherein the method comprises
Embodiment 112
111. The method of embodiment 110, wherein said modified SpCas9 is a Cas9 variant listed in Table 1 or said modified SpCas9 is spCas9-MQKFRAER.
Embodiment 113
112. The method of any one of embodiments 109-111, wherein said modified SpCas9 is a SpCas9 variant comprising a combination of amino acid substitutions set forth in FIGS. 3A-3C or FIG.
Embodiment 114
114. The method of embodiment 113, wherein said SpCas9 variants comprise a combination of amino acid sequence substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E and T1337R (267 (NGC Rd2 SpCas9).
Embodiment 115
115. The method of any one of embodiments 105-114, wherein the polynucleotide programmable DNA binding domain is nuclease inactive or a nickase variant.
Embodiment 116
116. The method of embodiment 115, wherein said nickase variant comprises the amino acid substitution D10A or its corresponding amino acid substitution.
Embodiment 117
of embodiments 105-116, wherein said adenosine deaminase domain is capable of deaminating adenosine within deoxyribonucleic acid (DNA) and cytidine deaminase is capable of deaminating cytosine within deoxyribonucleic acid (DNA) A method according to any one of paragraphs.
Embodiment 118
118. The method of embodiment 117, wherein said adenosine deaminase is a non-naturally occurring modified adenosine deaminase.
Embodiment 119
The adenosine deaminase is TadA * 7.10, TadA * 8.1, TadA * 8.2, TadA * 8.3, TadA * 8.4, TadA * 8.5, TadA * 8.6, TadA * 8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or 119. The method of embodiment 117 or 118, which is a TadA deaminase selected from TadA*8.24.
Embodiment 120
wherein the deaminase domain is BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 A variant of BE4 in which the sequence of AmAPOBEC1 is replaced, a variant of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 contains the H122A substitution. 118. The method of embodiment 117, wherein the cytidine deaminase is selected from one or more of the variants of BE4 replaced with the sequence of PpAPOBEC1 that replaces the PpAPOBEC1 sequence with
Embodiment 121
one or more variants of PpAPOBEC1 containing the H122A substitution or BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution selected from R33A, W90F, K34A, R52A, H121A, or Y120F 121. The method of embodiment 120, further comprising amino acid mutations.
Embodiment 122
said one or more guide polynucleotides comprising a CRISPR RNA (crRNA) and a transcoding small RNA (tracrRNA), wherein said crRNA is complementary to an SBDS nucleic acid sequence comprising said gene conversion associated with SDS; 122. The method of any one of embodiments 105-121, comprising a nucleic acid sequence.
Embodiment 123
123. The method of any one of embodiments 105-122, wherein said base editor and one or more guide polynucleotides form a complex within the cell.
Embodiment 124
124. The method of embodiment 123, wherein said base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to an SBDS nucleic acid sequence comprising said gene conversion associated with an SDS.
Embodiment 125
A guide RNA comprising a 5′ to 3′ nucleic acid sequence selected from one or more of the following, or a 1, 2, 3, 4, or 5 nucleotide 5′ truncated fragment thereof: GUAAGCAGGCGGGUAACAGC; AGCAGGCGGGUAACAGCUGC; GCGGGUAACAGCUGCAGCAU; AAUGUUUCCUAAGGUCAGGU, GCAGGCGGUAACAGCUGC, CAGGCGGGUAACAGCUGC, AGGCGGGUAACAGCUGC, and AAGCAGGCGGGUAACAGCUGC.
Embodiment 126
A base editor system for editing pathogenic variants within an SBDS gene, comprising:
(a)(i) a polynucleotide programmable DNA binding domain;
(ii) a deaminase domain capable of deaminating a polynucleotide or its complementary nucleobase present in said SBDS gene conversion;
a base editor containing; and
(b) a guide polynucleotide associated with the polynucleotide programmable DNA binding domain, the base editor being targeted to a target polynucleotide sequence at least partially located in the SBDS gene, the SBDS pseudogene, or the reverse complementary strand thereof; guide polynucleotide
includes;
A base editor system that allows transcription of the SBDS gene by deaminating the polynucleotide or its complementary nucleobase.
Embodiment 127
A base editor system for editing mutations in genes that result in aberrant splicing, comprising:
(a)(i) a polynucleotide programmable DNA binding domain;
(ii) a deaminase domain capable of deaminating a mutation that results in aberrant splicing or its complementary nucleobase;
a base editor containing; and
(b) a guide polynucleotide associated with a polynucleotide programmable DNA binding domain, the guide polynucleotide directing said base editor to target a target polynucleotide sequence at least partially located in said gene, or its reverse complementary strand;
includes;
A base editor system wherein transcription is enabled by deaminating said mutation or its complementary nucleobase.
Embodiment 128
A method for editing a pathogenic mutation in a gene that results in aberrant splicing, comprising:
a target nucleotide sequence at least partially located in the gene or its reverse complement,
(i) a polynucleotide programmable DNA binding domain associated with a guide polynucleotide that directs a base editor to target a target polynucleotide sequence at least a portion of which is located in said gene or its reverse complement;
(ii) a deaminase domain capable of deaminating a pathogenic mutation or its complementary nucleobase that results in aberrant splicing;
contacting a base editor containing; and
Editing a pathogenic mutation by targeting a base editor to a target nucleotide sequence and deaminating the pathogenic mutation or its complementary nucleobase
including
A method wherein deaminating the pathogenic mutation or its complementary nucleobase results in converting the pathogenic mutation to a sequence that permits splicing, thereby correcting the pathogenic mutation.
Embodiment 129
A method of editing a pathogenic mutation within an SBDS gene, comprising:
a target nucleotide sequence at least partially located in the gene or its reverse complement,
(i) a polynucleotide programmable DNA binding domain associated with a guide polynucleotide that directs a base editor to target a target polynucleotide sequence at least a portion of which is located in said gene or its reverse complement;
(ii) a deaminase domain capable of deaminating the pathogenic variant or its complementary nucleobase;
contacting a base editor containing; and
Editing the pathogenic mutation by targeting the base editor to a target nucleotide sequence to deaminate the pathogenic mutation or its complementary nucleobase.
including
A method, wherein deamination of the pathogenic variant or its complementary nucleobase enables splicing, thereby editing the pathogenic variant of the SBDS gene.
Embodiment 130
130. The method of embodiment 129, wherein said pathogenic mutation in SBDS results from gene conversion.
Embodiment 131
130. The method of embodiment 128 or 129, wherein said pathogenic mutation introduces a stop codon or alters splicing of said gene.
Embodiment 132
130. The method of embodiment 128 or 129, wherein said pathogenic mutation encodes a polypeptide with a truncation.
Embodiment 133
130. According to embodiment 128 or 129, wherein said base editor introduces missense mutations, inserts new splice acceptor or splice donor sites, or corrects splice acceptor or splice donor sites containing mutations. Method.
Embodiment 134
134. The method of embodiment 133, wherein said base editor corrects a splice donor SNP site comprising the rs113993993 C→T mutation in the SBDS gene.
Embodiment 135
1. A method of treating SDS in a subject by editing a pathogenic mutation within the SBDS gene, comprising:
Administering a base editor or a polynucleotide encoding a base editor to a subject in need thereof, wherein the base editor:
(i) a polynucleotide programmable DNA binding domain; and
(ii) a deaminase domain capable of deaminating a nucleobase within the pathogenic variant or its complementary nucleobase;
administering; and
administering a guide polynucleotide to a subject, said guide polynucleotide directing said base editor to target a target nucleotide sequence located at least in part in said gene or its reverse complementary strand; and
Editing the pathogenic mutation by deaminating the pathogenic mutation within the SBDS gene or its complementary nucleobase when the base editor is aimed at the target nucleotide sequence.
including
A method wherein transcription is enabled or the pathogenic mutation is corrected by deaminating said pathogenic mutation or its complementary nucleobase.
Embodiment 136
1. A method of producing a cell, tissue or organ for treating SDS in a subject in need thereof by correcting a pathogenic mutation within the SBDS gene of the cell, tissue or organ comprising:
said cell, tissue, or organ,
(i) a polynucleotide programmable DNA binding domain; and
(ii) a deaminase domain capable of deaminating the pathogenic variant or its complementary nucleobase;
contacting a base editor containing; and
contacting said cell, tissue, or organ with a guide polynucleotide, wherein said guide polynucleotide directs a base editor to target a target nucleotide sequence located at least in part in said gene or its reverse complementary strand. causing; and
Editing said mutation by deaminating the pathogenic mutation or its complementary nucleobase when a base editor is aimed at said target nucleotide sequence.
including
A method wherein deamination of said pathogenic mutation or its complementary nucleobase allows for splicing thereby producing said cell, tissue or organ for treating SDS.
Embodiment 137
137. The method of embodiment 136, wherein said mutation results from gene conversion.
Embodiment 138
137. The method of embodiment 136, wherein said mutation associated with Schwackman-Diamond Syndrome induces a stop codon or alters splicing of said gene.
Embodiment 139
137. The method of embodiment 136, wherein said mutation associated with Schwackman-Diamond Syndrome (SDS) encodes an SBDS polypeptide with a truncation.
Embodiment 140
137. The method of embodiment 136, wherein said base editor introduces missense mutations, inserts new splice acceptor or splice donor sites, or corrects splice acceptor or splice donor sites containing mutations.
Embodiment 141
137. The method of embodiment 136, further comprising administering said cell, tissue, or organ to said subject.
Embodiment 142
137. The method of embodiment 136, wherein said cell, tissue, or organ is autologous, allogeneic or xenogeneic to said subject.
Embodiment 143
137. The method of embodiment 136, wherein said deaminase domain is a cytidine deaminase domain or an adenosine deaminase domain.
Embodiment 144
144. The method of embodiment 143, wherein said adenosine deaminase domain is capable of deaminating adenine in deoxyribonucleic acid (DNA) and said cytidine deaminase is capable of deaminating cytosine in DNA.
Embodiment 145
145. The base editor system or method of any one of embodiments 126-144, wherein said guide polynucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).
Embodiment 146
a nucleic acid complementary to an SBDS nucleic acid sequence, wherein said guide polynucleotide comprises a CRISPR RNA (crRNA) sequence, a transactivating CRISPR RNA (tracrRNA) sequence, or a combination thereof, wherein said crRNA comprises said modification associated with SDS; 146. The base editor system or method of any one of embodiments 126-145, comprising a sequence.
Embodiment 147
147. The base editor system or method of any one of embodiments 126-146, further comprising a second guide polynucleotide.
Embodiment 148
148. The base editor system or method of any one of embodiments 126-147, wherein said second guide polynucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).
Embodiment 149
148. The base editor system of any one of embodiments 126-147, wherein said second guide polynucleotide comprises a CRISPR RNA (crRNA) sequence, a transactivating CRISPR RNA (tracrRNA) sequence, or a combination thereof; or Method.
Embodiment 150
149. The base editor system or method of any one of embodiments 126-149, wherein said polynucleotide programmable DNA binding domain has no nuclease activity or is a nickase.
Embodiment 151
151. The base editor system or method of any one of embodiments 126-150, wherein said polynucleotide programmable DNA binding domain comprises a Cas9 domain.
Embodiment 152
152. The base editor system or method of any one of embodiments 126-151, wherein said Cas9 domain is Cas9 without nuclease activity (dCas9), Cas9 nickase (nCas9), or Cas9 with nuclease activity.
Embodiment 153
153. The base editor system or method of embodiment 152, wherein said Cas9 domain comprises a Cas9 nickase.
Embodiment 154
154. The base editor system or method of any one of embodiments 126-153, wherein said polynucleotide programmable DNA binding domain is an engineered or modified polynucleotide programmable DNA binding domain.
Embodiment 155
Said compilation results in less than 20% indel formation, less than 15% indel formation, less than 10% indel formation, less than 5% indel formation, less than 4% indel formation, less than 3% indel formation, 2% The base editor system of any one of embodiments 126-154, which results in less than 1% indel formation, less than 1% indel formation, less than 0.5% indel formation, or less than 0.1% indel formation, or Method.
Embodiment 156
156. The base editor system or method of any one of embodiments 126-155, wherein said editing does not result in a rearrangement.
Embodiment 157
156. The base editor or method of any one of embodiments 126-155, wherein said base editor corrects a splice donor SNP site comprising the rs113993993 C→T mutation in the SBDS gene.
Embodiment 158
A method of treating Schwackman-Diamond Syndrome (SDS) in a subject in need thereof, comprising administering a cell according to any one of embodiments 45-72 to said subject.
Embodiment 159
The method of any one of embodiments 1-44 or 76-124, or any one of embodiments 45-72, wherein said base editor and/or components thereof are encoded by mRNA. A cell, or the base editor system or method of any one of embodiments 126-157.
Embodiment 160
125. The method of any one of embodiments 1-44 or 76-124, wherein the base editor is in complex with a single guide RNA (sgRNA) comprising a nucleic acid sequence complementary to the SBDS nucleic acid sequence. , or the base editor system or method of any one of embodiments 126-157.
Embodiment 161
161. The method or base editor system of embodiment 160, wherein said sgRNA comprises a nucleic acid sequence comprising at least 10 contiguous nucleotides complementary to said SBDS nucleic acid sequence.
Embodiment 162
15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, wherein said sgRNA is complementary to said SBDS nucleic acid sequence, 162. The method or base editor system of embodiment 161, comprising a nucleic acid sequence comprising 34, 35, 36, 37, 38, 39, or 40 contiguous nucleotides.
Embodiment 163
163. The method or base editor system of embodiment 162, wherein said sgRNA comprises a nucleic acid sequence comprising 18, 19, or 20 contiguous nucleotides complementary to said SBDS nucleic acid sequence.
Embodiment 164
A composition comprising a base editor attached to a guide RNA, wherein said guide RNA comprises a nucleic acid sequence complementary to the SBDS gene associated with Schwackman-Diamond Syndrome (SDS).
Embodiment 165
165. The composition of embodiment 164, wherein said base editor comprises adenosine deaminase or cytidine deaminase.
Embodiment 166
166. The composition of embodiment 165, wherein said adenosine deaminase is capable of deaminating adenine in deoxyribonucleic acid (DNA).
Embodiment 167
The adenosine deaminase is TadA * 7.10, TadA * 8.1, TadA * 8.2, TadA * 8.3, TadA * 8.4, TadA * 8.5, TadA * 8.6, TadA * 8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or 167. The composition of embodiment 166, which is a TadA deaminase selected from one or more of TadA*8.24.
Embodiment 168
166. The composition of embodiment 165, wherein said cytidine deaminase is capable of deaminating cytidine in deoxyribonucleic acid (DNA).
Embodiment 169
169. The composition of embodiment 168, wherein said cytidine deaminase is APOBEC, A3F, or a derivative thereof.
Embodiment 170
the base editor comprising:
(i) comprises a Cas9 nickase;
(ii) contains a nuclease-inactive Cas9;
(iii) SpCas9 variants comprising combinations of amino acid substitutions shown in FIGS. 3A-3C or FIG. 10;
(iv) SpCas9 variants comprising a combination of amino acid sequence substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E, and T1337R (267 (NGC Rd2 SpCas9);
(v) does not contain a UGI domain; and/or
(vi) BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 of AmAPOBEC1 A variant of BE4 in which APOBEC-1 is replaced by a sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by a sequence of PpAPOBEC1, or PpAPOBEC1 in which APOBEC-1 contains the H122A substitution. a cytidine deaminase selected from variants of BE4 replaced with the sequence of
The composition of any one of embodiments 164-169.
Embodiment 171
In (vi) the variant of PpAPOBEC1 containing the H122A substitution or BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution is selected from R33A, W90F, K34A, R52A, H121A, or Y120F 171. The composition of embodiment 170, further comprising one or more amino acid mutations.
Embodiment 172
The composition according to any one of embodiments 164-171, further comprising a pharmaceutically acceptable excipient, diluent, or carrier.
Embodiment 173
A pharmaceutical composition for the treatment of Schwackman-Diamond Syndrome (SDS) comprising the composition of embodiment 172.
Embodiment 174
174. The pharmaceutical composition of embodiment 173, wherein said gRNA and base editor are formulated together or separately.
Embodiment 175
Embodiment 173, wherein said gRNA comprises a 5' to 3' nucleic acid sequence or a 1, 2, 3, 4, or 5 nucleotide 5' truncated fragment thereof selected from one or more of: or the pharmaceutical composition according to 174: GCGGGUAACAGCUGCAGCAU; UGUAAAUGUUUCCUAAGGUC; AGCAGGCGGGUAACAGCUGC.
Embodiment 176
176. The pharmaceutical composition of any one of embodiments 173-175, further comprising a vector suitable for expression in a mammalian cell, said vector comprising a polynucleotide encoding said base editor.
Embodiment 177
177. The pharmaceutical composition of embodiment 176, wherein said polynucleotide encoding said base editor is mRNA.
Embodiment 178
178. The pharmaceutical composition according to embodiment 176 or 177, wherein said vector is a viral vector.
Embodiment 179
179. The pharmaceutical composition of embodiment 178, wherein said viral vector is a retroviral vector, adenoviral vector, lentiviral vector, herpes viral vector, or adeno-associated viral vector (AAV).
Embodiment 180
The pharmaceutical composition of any one of embodiments 173-179, further comprising ribonuclear particles suitable for expression in mammalian cells.
Embodiment 181
A pharmaceutical composition comprising (i) a nucleic acid encoding a base editor and (ii) the guide RNA of embodiment 125.
Embodiment 182
182. The pharmaceutical composition according to any one of embodiments 173-181, further comprising a lipid.
Embodiment 183
A method of treating Schwackman-Diamond Syndrome (SDS) comprising administering the pharmaceutical composition of any one of embodiments 173-182 to a subject in need thereof.
Embodiment 184
Use of a pharmaceutical composition according to any one of embodiments 173-182 in the treatment of Schwackman-Diamond Syndrome (SDS) in a subject.
Embodiment 185
185. Use according to embodiment 184, wherein said subject is a human.

OTHER EMBODIMENTS From the foregoing description, it will be apparent that variations and modifications can be made to the invention described herein to adapt it to different uses and conditions. Such embodiments are also within the scope of the following claims.

Claims (51)

1. An in vitro or ex vivo method of editing a polynucleotide to allow transcription, comprising contacting the polynucleotide with a base editor in complex with one or more guide polynucleotides, The base editor comprises a polynucleotide programmable DNA binding domain and a deaminase domain, and one or more of the guide polynucleotides target the base editor to effect alterations that introduce transcription-enabling mutations. ,Method. 2. The method of claim 1, wherein said mutation that enables transcription is a mutation that alters a stop codon, introduces a splice acceptor or splice donor site, or modifies a splice acceptor or splice donor site. . An in vitro or ex vivo method of editing an SBDS polynucleotide comprising mutations associated with Schwackman-Diamond Syndrome (SDS), comprising: contacting a polynucleotide, wherein the base editor comprises a polynucleotide programmable DNA binding domain and a deaminase domain; A method of effecting mutational alterations associated with Diamond Syndrome (SDS). The method according to any one of claims 1 to 3, wherein the deaminase is cytidine deaminase or adenosine deaminase. 5. The method of claim 4, wherein said deaminase is an adenosine deaminase and said adenosine deaminase is selected from ABE8 or ABE8 variants listed in Table 7A or Table 7B . The deaminase is cytidine deaminase, and the cytidine deaminase is
BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1, AmAPOBEC1, SsAPOBEC2, RrA3F containing the H122A substitution; RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 is replaced by the sequence of AmAPOBEC1 variants of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, variants of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 by the sequence of PpAPOBEC1 containing the H122A substitution. selected from one or more of the replaced variants of BE4, or
PpAPOBEC1 cytidine deaminase containing the H122A substitution or a variant of BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution and one selected from R33A, W90F, K34A, R52A, H121A, or Y120F or further comprising multiple amino acid mutations,
5. The method of claim 4. The base editor is an adenosine base editor (ABE), and the one or more guide polynucleotides target the base editor to effect the A T to G C change of 183-184 TA>CT Rs113993991. , which generates a missense mutation. 5. The method of claim 4, wherein the guide polynucleotide targets one of the following sequences: TGTAAATGTTTCCTAAGGTC or AATGTTTCCTAAGGTCAGGT. 8. The method of claim 7, wherein said ABE has 5'-NGC-3' or 5'-NGG-3'PAM specificity. said base editor is a cytidine base editor (CBE) and said one or more said guide polynucleotides target said base editor to effect a C G to T A change of rs113993993 258+2T>C 4. The method of claim 3 . said CBE has 5′-NGC-3′ PAM specificity or specificity for PAM containing 5′-NGC-3′, and/or
The guide polynucleotide is GTAAGCAGGCGGGTAACAGCTGC, AGCAGGCGGGTAACAGCTGCAGC, GCGGGTAACAGCTGCAGCATAGC, GTAAGCAGGCGGGTAACAGC, AGCAGGCGGGTAACAGCTGC, GCGGGTAACAGCTGCAGCAT, GCAGGCGGGTAAC targeting a polynucleotide target sequence selected from AGCTGC, CAGGCGGGTAACAGCTGC, AGGCGGGTAACAGCTGC, or AAGCAGGCGGGTAACAGCTGC;
11. The method of claim 10 . said contacting is within a cell, a eukaryotic cell, a mammalian cell, or a human cell; and/or
wherein the cell is ex vivo;
A method according to any one of claims 1-11 . said mutation associated with Schwackman-Diamond Syndrome (SDS) results from gene conversion and induces a stop codon of said gene, or alters splicing, or encodes an SBDS polypeptide having a truncation; The method according to any one of claims 3-12 . said polynucleotide programmable DNA binding domain is from Streptococcus pyrogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Streptococcus thermophilus 1Cas9 (St1Cas9), Streptococcus canis Cas9 (ScCas9), or variants thereof is Cas9 selected , or
said polynucleotide programmable DNA binding domain is wild-type or modified Streptococcus pyrogenes Cas9 (SpCas9), or a variant thereof; or
said polynucleotide programmable DNA binding domain is a modified SpCas9 or SpCas9 variant with altered protospacer adjacent motif (PAM) specificity, or
Said polynucleotide programmable DNA binding domain is a modified SpCas9 or SpCas9 variant comprising a combination of amino acid sequence substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E, and T1337R (267 (NGC Rd2 SpCas9)
A method according to any one of claims 1-13 . the polynucleotide programmable DNA binding domain is a nuclease inactive or nickase variant , or
the polynucleotide programmable DNA binding domain is a nickase variant containing the amino acid substitution D10A or its corresponding amino acid substitution;
A method according to any one of claims 1-14 . in cells or in their precursors,
a base editor comprising a polynucleotide programmable DNA binding domain and a deaminase domain; a polynucleotide encoding said base editor; a guide polynucleotide of
Cells produced by transduction. said cells or precursors thereof are embryonic stem cells, induced pluripotent stem cells, or hematopoietic stem cells ;
said cell expresses an SBDS protein;
said cells are derived from a subject with Schwackman-Diamond Syndrome (SDS); and/or
said cells are mammalian cells or human cells;
17. A cell according to claim 16 . the polynucleotide programmable DNA binding domain is wild-type Streptococcus pyrogenes Cas9 (SpCas9), or a modified Streptococcus pyrogenes Cas9 (SpCas9), or a variant thereof ;
said polynucleotide programmable DNA binding domain is a modified SpCas9 variant with modified protospacer adjacent motif (PAM) specificity;
the polynucleotide programmable DNA binding domain is a modified SpCas9 with specificity for a PAM nucleic acid sequence comprising the nucleic acid sequence 5'-NGC-3' or 5'-NGC-3';
the polynucleotide programmable DNA binding domain is a modified SpCas9 or spCas9-MQKFRAER, which is a Cas9 listed in Table 1, or
Said polynucleotide programmable DNA binding domain is an SpCas9 variant comprising a combination of amino acid sequences/substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E, and T1337R (267 (NGC Rd2 SpCas9)
18. A cell according to claim 16 or 17 . 19. The programmable polynucleotide DNA binding domain of any one of claims 16-18 , wherein the programmable polynucleotide DNA binding domain is a nuclease inactive variant , a nickase variant, or a nickase variant comprising the amino acid substitution D10A or its corresponding amino acid substitution. cell. 16. The deaminase domain is a cytidine deaminase domain capable of deaminating cytidine in deoxyribonucleic acid (DNA) or an adenosine deaminase domain capable of deaminating adenosine in DNA. 20. The cell of any one of items 1-19 . the adenosine deaminase or cytidine deaminase is a non-naturally occurring modified adenosine deaminase or cytidine deaminase ;
the adenosine deaminase is TadA deaminase;
The adenosine deaminase is TadA * 7.10, TadA * 8.1, TadA * 8.2, TadA * 8.3, TadA * 8.4, TadA * 8.5, TadA * 8.6, TadA * 8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or is a TadA deaminase selected from TadA*8.24;
whether said adenosine deaminase is TadA*7.10 comprising one or more of the following modifications: Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R,
The Adenosin Deaeminase is Y147R + Q154R + Y123H; Y147R + Q154R + I76Y; Y147R + Q154R + T166R; Y147T + Q154R; Y147T + Q154S; V82S TADA * 7.10, including the combination of changes selected from the group consisting of + Q154S
The cytosine deaminase is BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 A variant of BE4 in which the sequence of AmAPOBEC1 is replaced, a variant of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 contains the H122A substitution. selected from one or more of the variants of BE4 replaced with a sequence of PpAPOBEC1 that
21. A cell according to claim 20 . A composition according to any one of claims 16 to 21 for use in a method of treating Schwackman-Diamond Syndrome (SDS) or a disease associated with aberrant splicing in a subject in need thereof. A composition comprising the described cells. A composition for use in a method of treating Schwackman-Diamond Syndrome (SDS) in a subject, comprising:
a base editor comprising a polynucleotide programmable DNA binding domain and a deaminase domain, or a polynucleotide encoding said base editor; and one or more guide polynucleotides that target said base editor to effect SDS-related modifications nucleotide
A composition comprising A composition for use in a method of treating a genetic disease associated with aberrant splicing, comprising:
a base editor comprising a polynucleotide programmable DNA binding domain and a deaminase domain, or a polynucleotide encoding said base editor; multiple guide polynucleotides
A composition comprising said cell expresses a truncated polypeptide ;
said alteration converts a TAA stop to a TGG in the SBDS polynucleotide;
said alteration alters K62X in said SBDS polypeptide associated with SDS;
said gene conversion associated with SDS results in expression of a truncated SBDS polypeptide; and/or
A modification of the base editor replaces lysine (K) with tryptophan (W) at amino acid position 62.
25. A composition according to claim 23 or 24 . said polynucleotide programmable DNA binding domain comprises a modified Streptococcus pyrogenes Cas9 (SpCas9), or a variant thereof ;
the polynucleotide programmable DNA binding domain comprises a modified SpCas9 with altered protospacer adjacent motif (PAM) specificity;
said polynucleotide programmable DNA binding domain comprises a modified SpCas9 with specificity for a PAM nucleic acid sequence comprising the nucleic acid sequence 5'-NGC-3' or 5'-NGC-3';
The polynucleotide programmable DNA binding domain comprises a modified SpCas9 that is a Cas9 variant listed in Table 1, or a modified SpCas9 that is spCas9-MQKFRAER, or
Said polynucleotide programmable DNA binding domain comprises an SpCas9 variant comprising a combination of amino acid sequence substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E, and T1337R (267 (NGC Rd2 SpCas9)
A composition according to any one of claims 23-25 . 27. A polynucleotide programmable DNA binding domain according to any one of claims 23-26 , wherein the polynucleotide programmable DNA binding domain is a nuclease inactive variant , a nickase variant or a nickase variant comprising the amino acid substitution D10A or its corresponding amino acid substitution. composition . said deaminase domain is capable of deaminating adenosine or cytidine in deoxyribonucleic acid (DNA) ;
said deaminase domain is a non-naturally occurring modified adenosine deaminase or cytidine deaminase;
said deaminase domain is an adenosine deaminase that is a TadA deaminase;
The deaminase domain is TadA*7.10, TadA*8.1, TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, TadA*8.6, TadA*8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or is a TadA deaminase selected from TadA*8.24; and/or
said deaminase domain is TadA*7.10 comprising one or more of the following changes: Y147T, Y147R, Q154S, Y123H, V82S, T166R, Q154R, or said TadA*7.10 is Y147R+Q154R+Y123H; Y147R+Q154R+I76Y; Y147R+Q154R+T166R; Y147T+Q154R; Y147T+Q154S; V82S+Q154S;
A composition according to any one of claims 23-27 . wherein the deaminase domain is BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 Variants of BE4 in which the sequence of AmAPOBEC1 is replaced, variants of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, variants of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 contains the H122A substitution. a cytidine deaminase selected from one or more of the variants of BE4 replaced with a sequence of PpAPOBEC1 that replaces the sequence of PpAPOBEC1; and/or
one or more variants of PpAPOBEC1 containing the H122A substitution or BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution selected from R33A, W90F, K34A, R52A, H121A, or Y120F further comprising an amino acid mutation; and/or
wherein the base editor targets SNP rs113993993 258+2T>C in the SBDS polynucleotide sequence to restore correct splicing;
29. A composition according to claim 28 . An in vitro or ex vivo method of producing mammalian or human cells or precursors thereof, comprising:
(a) in an induced pluripotent stem cell containing a gene transformation associated with Schwackman-Diamond Syndrome (SDS),
a polynucleotide - a programmable nucleotide-binding domain and a cytidine deaminase domain or an adenosine deaminase domain, or a polynucleotide encoding a base editor; (b) differentiating said induced pluripotent stem cells or progenitors into a desired cell type. The polynucleotide programmable DNA binding domain is Streptococcus pyrogenes Cas9 (SpCas9), a modified Streptococcus pyrogenes Cas9 (SpCas9), or a variant thereof , or a modified SpCas9 with altered protospacer adjacent motif (PAM) specificity 31. The method of claim 30 , comprising The SpCas9 has specificity for the nucleic acid sequence 5'-NGG-3', and the modified SpCas9 is specific for the PAM nucleic acid sequence containing the nucleic acid sequence 5'-NGC-3' or 5'-NGC-3' or
Said modified SpCas9 is a Cas9 variant listed in Table 1, spCas9-MQKFRAER, SpCas9 variant comprising a combination of amino acid substitutions shown in Figures 3A to 3C or Figure 10, or a combination of amino acid sequence substitutions selected from the following is a SpCas9 variant containing:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); or
D1135G, S1136, S1216G, G1218, E1219, A1322R, D1332A, R1335E, and T1337R (267 (NGC Rd2 SpCas9)
33. A method according to claim 30 or 32 . 33. The method of any one of claims 30-32 , wherein the polynucleotide programmable DNA binding domain is a nuclease inactive variant, a nickase variant , or a nickase variant comprising the amino acid substitution D10A or its corresponding amino acid substitution . whether said adenosine deaminase domain can deaminate adenosine in deoxyribonucleic acid (DNA) and cytidine deaminase can deaminate cytosine in deoxyribonucleic acid (DNA);
the adenosine deaminase is a non-naturally occurring modified adenosine deaminase;
The adenosine deaminase is TadA * 7.10, TadA * 8.1, TadA * 8.2, TadA * 8.3, TadA * 8.4, TadA * 8.5, TadA * 8.6, TadA * 8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or is a TadA deaminase selected from TadA*8.24;
wherein the deaminase domain is BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, a variant of BE4 in which APOBEC-1 is replaced by the sequence of rAPOBEC1, APOBEC-1 A variant of BE4 in which the sequence of AmAPOBEC1 is replaced, a variant of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1, or APOBEC-1 contains the H122A substitution. a cytidine deaminase selected from one or more of the variants of BE4 replaced with the sequence of PpAPOBEC1 that
The cytidine deaminase is PpAPOBEC1 containing a H122A substitution, or a variant of BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing a H122A substitution, R33A, W90F, K34A, R52A, H121A, or Y120F further comprising one or more amino acid mutations selected from
A method according to any one of claims 30-33 . 1. An in vitro or ex vivo method for editing pathogenic mutations in genes that result in aberrant splicing, comprising:
a target nucleotide sequence at least partially located in the gene or its reverse complement,
(i) a polynucleotide programmable DNA binding domain associated with a guide polynucleotide that directs a base editor to target a target polynucleotide sequence at least a portion of which is located in said gene or its reverse complement;
(ii) contacting a base editor comprising a deaminase domain capable of deaminating a pathogenic mutation resulting in aberrant splicing or its complementary nucleobase; and
editing the pathogenic mutation by targeting a base editor to a target nucleotide sequence and deaminating the pathogenic mutation or its complementary nucleobase;
A method wherein deaminating the pathogenic mutation or its complementary nucleobase results in converting the pathogenic mutation to a sequence that permits splicing, thereby correcting the pathogenic mutation. said pathogenic mutation is within the SBDS gene;
said pathogenic mutation is in the SBDS gene and results from gene conversion;
said pathogenic mutation is within the SBDS gene and introduces a stop codon or alters splicing of said gene;
said pathogenic mutation is within the SBDS gene and encodes a polypeptide having a truncation;
said base editor introduces missense mutations, inserts new splice acceptor or splice donor sites, or corrects splice acceptor or splice donor sites containing mutations; and/or
the base editor corrects the splice donor SNP site containing the rs113993993 C→T mutation in the SBDS gene;
36. The method of claim 35 . An in vitro or ex vivo method of producing a cell, tissue or organ for treating SDS in a subject in need thereof by correcting a pathogenic mutation within the SBDS gene of the cell, tissue or organ There is
said cell, tissue, or organ,
(i) a polynucleotide programmable DNA binding domain; and
(ii) contacting with a base editor comprising a deaminase domain capable of deaminating the pathogenic mutation or its complementary nucleobase; and
contacting said cell, tissue, or organ with a guide polynucleotide, wherein said guide polynucleotide directs a base editor to target a target nucleotide sequence located at least in part in said gene or its reverse complementary strand. and editing said mutation by deaminating the pathogenic mutation or its complementary nucleobase when aiming a base editor at said target nucleotide sequence,
A method wherein deamination of said pathogenic mutation or its complementary nucleobase allows for splicing thereby producing said cell, tissue or organ for treating SDS. whether the mutation is due to gene conversion;
said mutation associated with Schwackman-Diamond Syndrome induces a stop codon or alters splicing of said gene, or
said mutation associated with Schwackman-Diamond Syndrome (SDS) encodes an SBDS polypeptide with a truncation;
38. The method of claim 37 . 38. The method of claim 37 , wherein the base editor introduces missense mutations, inserts new splice acceptor or splice donor sites, or corrects splice acceptor or splice donor sites containing mutations. A composition comprising a base editor attached to a guide RNA, wherein said guide RNA comprises a nucleic acid sequence complementary to the SBDS gene associated with Schwackman-Diamond Syndrome (SDS). said base editor comprises adenosine deaminase or cytidine deaminase;
said base editor comprises an adenosine deaminase capable of deaminating adenine in deoxyribonucleic acid (DNA);
The base editor is TadA*7.10, TadA*8.1, TadA*8.2, TadA*8.3, TadA*8.4, TadA*8.5, TadA*8.6, TadA*8 .7, TadA*8.8, TadA*8.9, TadA*8.10, TadA*8.11, TadA*8.12, TadA*8.13, TadA*8.14, TadA*8.15 , TadA*8.16, TadA*8.17, TadA*8.18, TadA*8.19, TadA*8.20, TadA*8.21, TadA*8.22, TadA*8.23, or an adenosine deaminase that is a TadA deaminase selected from one or more of TadA*8.24;
said base editor comprises a cytidine deaminase capable of deaminating cytidines in deoxyribonucleic acid (DNA); and/or
wherein the base editor comprises APOBEC, A3F, or a derivative thereof, cytidine deaminase;
41. The composition of claim 40 . the base editor comprising:
(i) comprises a Cas9 nickase;
(ii) contains a nuclease-inactive Cas9;
(iii) SpCas9 variants comprising combinations of amino acid substitutions shown in FIGS. 3A-3C or FIG. 10;
(iv) SpCas9 variants comprising a combination of amino acid sequence substitutions selected from:
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332, R1335E and T1337R (224 SpCas9); D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E and T133 7R (225 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332K, R1335E, and T1337R (226 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335E, and T1337Q (227 Cas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335Q and T1337Q (230 SpCas9);
D1135M, S1136Q, G1218K, E1219F, A1322R, D1332A, R1335D and T1337Q (235 SpCas9); D1135Q, S1136, G1218T, E1219W, A1322R, D1332, R1335N and T1337 (237 SpCas9); D1135H, S1136, G1218S, E1219W, A1322R, D1332, R1335V, and T1337 (242 SpCas9); D1135C, S1136W, G1218N, E1219W, A1322R, D1332, R1335N, and T1337 (244 SpCas9); D113LM, S1136W, G12 18R, E1219S, A1322R, D1332, R1335E, and T1337 (245 SpCas9); D1135G, S1136W, G1218S, E1219M, A1322R, D1332, R1335Q, and T1337R (259 SpCas9); L111R, D1135V, S1136Q, G1218K, E1219F, A1322R, D1 332, R1335A, and T1337R (Nureki SpCas9); D1135M , S1136, S1216G, G1218, E1219, A1322, D1332A, R1335Q, and T1337 (NGCRd1 SpCas9); T1337R(267 (NGC Rd2 SpCas9);
(v) does not contain the UGI domain; and/or (vi) BE4, rAPOBEC1, PpAPOBEC1, PpAPOBEC1 containing the H122A substitution, AmAPOBEC1, SsAPOBEC2, RrA3F, RrA3F containing the F130L substitution, APOBEC-1 replaces the sequence of rAPOBEC1. a variant of BE4 in which APOBEC-1 is replaced by the sequence of AmAPOBEC1, a variant of BE4 in which APOBEC-1 is replaced by the sequence of SsAPOBEC2, a variant of BE4 in which APOBEC-1 is replaced by the sequence of PpAPOBEC1 or a cytidine deaminase selected from variants of BE4 in which APOBEC-1 is replaced with the sequence of PpAPOBEC1 containing the H122A substitution;
42. The composition of claim 40 or 41 . In (vi) the variant of PpAPOBEC1 containing the H122A substitution or BE4 in which APOBEC-1 is replaced with a sequence of PpAPOBEC1 containing the H122A substitution is selected from R33A, W90F, K34A, R52A, H121A, or Y120F 43. The composition of claim 42 , further comprising one or more amino acid mutations. 44. The composition of any one of claims 40-43 , further comprising a pharmaceutically acceptable excipient, diluent, or carrier. 45. A pharmaceutical composition for the treatment of Schwackman-Diamond Syndrome (SDS) comprising the composition of claim 44 . 46. The pharmaceutical composition of claim 45 , wherein said gRNA and base editor are formulated together or separately. 45. The gRNA comprises a 5' to 3' nucleic acid sequence or a 1, 2, 3, 4 or 5 nucleotide 5' truncated fragment thereof selected from one or more of: or the pharmaceutical composition of 46 : GCGGGUAACAGCUGCAGCAU; UGUAAAUGUUCCUAAGGUC; GCAGGCGGGUAACAGCUGC. further comprising vectors suitable for expression in mammalian cells,
said vector comprises a polynucleotide encoding said base editor;
said vector comprises an mRNA polynucleotide encoding said base editor;
said vector is a viral vector, or
the vector is a retroviral vector, an adenoviral vector, a lentiviral vector, a herpes viral vector, or an adeno-associated viral vector (AAV);
The pharmaceutical composition according to any one of claims 45-47 . 48. The pharmaceutical composition of any one of claims 44-47 , further comprising ribonuclear particles suitable for expression in mammalian cells. (i) a nucleic acid encoding a base editor and (ii) one of GUAAGCAGGCGGGUAACAGC; AGCAGGCGGGUAACAGCUGC; 5' to 3' nucleic acid sequence selected from or a guide RNA comprising a 1, 2, 3, 4, or 5 nucleotide 5' truncated fragment thereof . 51. A pharmaceutical composition according to claim 49 or 50 , further comprising a lipid.