JPWO2020166708A1 - New lactic acid bacteria and compositions containing them - Google Patents

Abstract

The present invention relates to a Lactobacillus Chrispatus strain, wherein the nucleotide sequence of the 16s rRNA gene of the strain has at least 95% identity with the nucleotide sequence set forth in SEQ ID NO: 1.

Description

The present invention relates to a novel lactic acid bacterium and a composition containing the novel lactic acid bacterium.

Conventional technology

Conventionally, the intestinal flora has generally referred to bacteria present in feces and contents. However, in recent years, the physiological significance of bacteria adhering to the host mucosa and the existence of mucosal adhering bacterial flora formed in the mucosa have been clarified.

For example, it has been reported that patients with inflammatory bowel disease (IBD) and Crohn's disease form a mucosal-attached bacterial flora different from that of healthy subjects (Non-Patent Document 1). In addition, among the bacteria that can be contained in the intestinal flora, Lachnospiraceae bacteria, Asinetobacter spp., Bacteroides spp., And Prevotella spp. Are known to increase in the intestine during inflammation of the intestinal tract and the whole body (non-). Patent Documents 2-8).

On the other hand, it is known that breast milk contains various nutrients necessary for the development of infants. In recent years, it has been reported that breast milk also contains lactic acid bacteria and contributes to the formation of the intestinal flora of newborns (Non-Patent Document 9). Furthermore, the relationship between the bacterial flora of breast milk and the development of offspring has also been reported (Non-Patent Document 10).

However, it may be difficult to breastfeed depending on the constitution of the mother and the child-rearing environment. In addition, since there are individual differences in the bacterial flora of breast milk, if the bacterial flora of the mother is poor, the bacterial flora attached to the mucosa of the offspring and the bacterial flora of the intestine may also be affected.

The Japanese Society of Gastroenterology, Nishino et al. , DOI 10.1007 / s00535-017-1384-4, 2017 The Journal of Nutrition, Genomics, Proteomics, and Metabolomics, Prediss et al. , 940-948, First published online April 6, 2016 The ISME Journal 6, Berry et al. , 2091-2106, (2012) Neuroscience, Aldy et al. , 1-12, 03 August 2017 Gut Microbe, Volume 6, Issue 1, Tang et al. , 48-56, 2015 Setoyama et al. Microbe Infect. 2003 Feb; 5 (2): 115-22 Scher et al. eLife 2013; 2: e01202. DOI: 10.75454 / eLife. 01202 Arai et al. Japanese Society of Allergology, 67 (1), 24-27, 2018 SCIENTIFIC Reports, 7, 9940, DOI: 10.1038 / s41598-017-09278-y, Drell et al. , 30 August 2017 Frontiers in Microbiology, Volume 8, Article 2100, Tuscano et al. , October 2017

One embodiment of the present invention aims to provide a novel lactic acid bacterium capable of effectively regulating the bacterial composition balance in the indigenous bacterial flora.

The present inventors have found a novel lactic acid bacterium that can effectively regulate the bacterial composition balance of indigenous bacterial flora including mucosal adherent bacterial flora or intestinal bacterial flora. The present invention is based on such findings.

One embodiment of the present invention includes the following aspects.
[1] A Lactobacillus crispatus strain, wherein the nucleotide sequence of the 16s rRNA gene of the strain has at least 95% identity with the nucleotide sequence shown in SEQ ID NO: 1.
[2] The strain according to [1], wherein the identity is 98% or more.
[3] Lactobacillus crispatas deposited under the accession number NITE BP-02869 CFF No. The strain according to [1] or [2], which is 2031.
[4] A composition comprising the strain according to any one of [1] to [3].
[5] The composition according to [4] for use as a medicine, food or drink, cosmetics or feed.
[6] The composition according to [4] or [5] for infants or minors.
[7] The composition according to any one of [4] to [6] for adjusting the compositional balance of bacteria contained in the indigenous bacterial flora.
[8] The bacterium contained in the indigenous bacterial flora is at least one selected from the bacteria of the family Lacnospirae, the bacterium of the genus Acinetobacta, the bacterium of the genus Musispyriram, the bacterium of the genus Prevotella and the bacterium of the genus Bacteroides, according to [7]. Composition.
[9] The composition according to [7] or [8], wherein the indigenous bacterial flora is a mucosal adherent bacterial flora or an intestinal bacterial flora.
[10] The composition according to any one of [4] to [9] for suppressing a disease or symptom related to inflammation.
[11] The composition according to any one of [4] to [10] for protecting the digestive tract.
[12] The composition according to any one of [4] to [11] for suppressing weight loss.
[13] In the production of a composition for adjusting the bacterial composition balance contained in a resident bacterial flora, the Lactobacillus crispatus strain is used, and the nucleotide sequence of the 16s rRNA gene of the strain is the same as the nucleotide sequence shown in SEQ ID NO: 1. Use, with at least 95% identity.
[14] A method for adjusting the compositional balance of bacteria contained in a resident bacterial flora, which comprises administering an effective amount of a Lactobacillus crispatus strain to a subject in need thereof, and 16s rRNA of the strain. A method, wherein the nucleotide sequence of the gene has at least 95% identity with the nucleotide sequence set forth in SEQ ID NO: 1.

According to one embodiment of the present invention, the bacterial composition balance in the indigenous bacterial flora including the mucosal adherent bacterial flora or the intestinal bacterial flora can be effectively regulated. According to one embodiment of the present invention, the formation of a healthy aboriginal flora can be advantageously promoted. The lactic acid bacterium strain of the present invention can be advantageously used to improve a disease or condition caused by inflammation. Further, according to one embodiment of the present invention, the lactic acid bacterium strain can be advantageously used for ingesting a child such as a minor or an infant to prevent a disease after growth.

In Example 1, the control group (Group C) and Lactobacillus crispatus CFF No. It is a graph (vertical axis parameter: Axis 2, horizontal axis Axis 1) which shows the result of having performed the main coordinate analysis by metagenomic analysis of the mucosal adherence bacterial flora of the cecum about the 2031 strain administration group (L group). In Example 1, the control group (Group C) and Lactobacillus crispatus CFF No. It is a graph which shows the result of having performed the main coordinate analysis by the metagenomic analysis of the mucosal adherence bacterial flora of the cecum about the 2031 strain administration group (L group) (vertical axis parameter: Axis 2, horizontal axis Axis 3). In Example 1, it is a graph which shows the result of having performed the bacterial flora structure analysis based on the metagenomic analysis of the mucosal adherent bacterial flora of the cecum. In Example 1, with respect to the mucosal adherent bacterial flora of the cecum, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of Unclassified f_Lachnospiraceae in the 2031 strain administration group (Group L), and the occupancy rate in the control group (Group C). In Example 1, with respect to the mucosal adherent bacterial flora of the cecum, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of the Musispirillum in the 2031 strain administration group (L group), and the occupancy rate in the control group (C group). In Example 1, it is a graph which shows the result of having performed the bacterial flora structure analysis based on the metagenomic analysis of the mucosal adherent bacterial flora of the colon. In Example 1, with respect to the mucosal adherent bacterial flora of the colon, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of Acinetobacter bacterium in the 2031 strain administration group (L group), and the occupancy rate in the control group (C group). In Example 1, it is a graph which shows the result of having performed the bacterial flora structure analysis based on the metagenomic analysis of the bacterial flora of the cecal content. In Example 1, with respect to the bacterial flora of the cecal contents, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of Bacteroides spp. In the 2031 strain administration group (L group), and the occupancy rate in the control group (C group). In Example 1, with respect to the bacterial flora of the cecal contents, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of the Prevotella bacterium ([Prevotella]) in the 2031 strain administration group (L group), and the occupancy rate in the control group (C group). In Example 1, with respect to the bacterial flora of the cecal contents, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of the Lachnospiraceae bacterium (Unclassified Lachnospiraceae) in the 2031 strain administration group (Group L), and the occupancy rate in the control group (Group C). In Example 1, it is a graph which shows the result of having performed the bacterial flora structure analysis based on the metagenomic analysis of the bacterial flora of the colon contents. In Example 1, with respect to the bacterial flora of the colon contents, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of Bacteroides spp. In the 2031 strain administration group (L group), and the occupancy rate in the control group (C group). In Example 1, with respect to the bacterial flora of the colon contents, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of the Prevotella bacterium (Prevotella) in the 2031 strain administration group (L group), and the occupancy rate in the control group (C group). In Example 1, with respect to the bacterial flora of the colon contents, Lactobacillus crispatus CFF No. It is a graph which shows the comparison result of the occupancy rate of the Prevotella bacterium ([Prevotella]) in the 2031 strain administration group (L group), and the occupancy rate in the control group (C group). It is a graph which shows the weight transition of the test mouse in Example 2. The body weight on the first day (d1) of DSS administration is 100.00%, and the body weight transition (%) up to the 11th day (d11) of DSS administration is shown. It is a graph which shows the transition of Disease Activity Index (DAI) of the test mouse in Example 2. FIG. The DAI score from the 1st day (d1) to the 11th day (d11) of the start of DSS administration is shown.

Hereinafter, the present invention will be described in detail.
According to one embodiment of the present invention, Lactobacillus crispatus CFF No. 1 is a novel strain of lactic acid bacteria belonging to Lactobacillus crispatus. The 2031 strain is provided.

Lactobacillus crispatus CFF No. The 2031 strain (hereinafter, also simply referred to as “CFF No. 2031 strain” or “deposited strain”) was isolated from human breast milk as an isolation source. The mycological properties of this strain will be shown in the examples described below. The strain was transferred to the National Institute of Technology and Evaluation Patent Microorganisms Depositary Center (Room 2-5-8 122, Kazusakamatari, Kisarazu City, Chiba Prefecture, 292-0818) on January 29, 2019, with the accession number NITE BP. Deposited under -02869.

The lactic acid bacterium strain of the present invention may be the above-mentioned deposited strain or a strain substantially equivalent thereto. The deposited strain or a strain substantially equivalent thereto is a strain belonging to Lactobacillus crispatus, and the nucleotide sequence of the 16S rRNA gene thereof is at least the nucleotide sequence of the 16S rRNA gene of the deposited strain shown in SEQ ID NO: 1. It has 95% identity. Further, the above-mentioned identity preferably has 98% or more, more preferably 99% or more, still more preferably 99.9% or more, still more preferably 100%.

In the present invention, "identity" identity between two nucleotide sequences means the percentage of the same nucleotide obtained after the best alignment between the two sequences being compared, which percentage is. It is merely statistical and the differences between the two sequences are randomly distributed over their full length. Sequence comparisons between two nucleotide sequences are usually made by comparing these sequences after alignment in an optimal manner, in which case the comparison is performed segment by segment or by "comparison window". You may be broken. Optimal alignment of sequences for comparison can be performed by computer software (BLAST P comparison software).

Further, the substantially equivalent strain is preferably functionally equivalent to the deposited strain. Whether or not the substantially equivalent strain is functionally equivalent to the above deposited strain is within the range where there is no significant difference by the statistical method after conducting the same tests as in Examples 1 and 2 described later. It can be determined by the above.

The substantially equivalent strain has a function of regulating the bacterial composition balance contained in the indigenous bacterial flora, preferably in the same manner as the deposited strain. Further, according to a more preferable embodiment, the bacteria contained in the indigenous bacterial flora include Lacnospiraceae (including Lachnospiraceae, Unclassified Lachnospiraceae), Acinetobacter, Prevotella, Prevotella, and Prevotella. (Including Prevotella, [Prevotella]), or Bacteria. Here, the classification of the above strains shall be in accordance with the classification of software phyloseq (https://joyy711.github.io/phyloseq) and the Greengenes referenced by the software. Further, according to a more preferable embodiment, the substantially equivalent strain is the same as the deposited strain, and the reducing activity of Lachnospiraceae, Acinetobacter, Prevotella or Bacteroides in the indigenous flora. Has. Moreover, according to still another preferred embodiment, the substantially equivalent strain has the same increasing activity of the bacterium belonging to the genus Musispyrilam in the indigenous bacterial flora as the deposited strain. Further, according to another preferred embodiment, the substantially equivalent strain has the same activity as the deposited strain in suppressing weight loss due to diarrhea or the like during intestinal inflammation in the subject to which the strain is administered. Moreover, according to another more preferable embodiment, the substantially equivalent strain has the same inhibitory activity on the DAI score at the onset of enteritis in the subject to which the strain is administered. The indigenous bacterial flora is preferably a mucosal adherent bacterial flora or an intestinal bacterial flora.

The lactic acid strain of the present invention also includes strains bred from deposited strains or strains substantially equivalent thereto by mutation treatment, gene recombination, selection of spontaneous mutant strains, etc., as long as the effects of the present invention are not impaired. Will be done.

The lactic acid bacterium strain of the present invention can be easily grown, for example, by culturing the strain. The method of culturing is CFF No. The 2031 strain is not particularly limited as long as it can grow, and a method usually used for culturing lactic acid bacteria can be appropriately modified and used as necessary. For example, the culture temperature may be 25 to 50 ° C, preferably 35 to 42 ° C. Further, the culture may be carried out under either aerobic conditions or anaerobic conditions, but it is preferably carried out under anaerobic conditions, and for example, the culture can be carried out while aerating an anaerobic gas such as carbon dioxide gas. Further, the cells may be cultured under slightly aerobic conditions such as liquid static culture.

The medium for culturing the lactic acid bacterium strain of the present invention is not particularly limited, and a medium usually used for culturing lactic acid bacteria can be appropriately modified and used as necessary. That is, as the carbon source, for example, saccharides such as galactose, glucose, fructose, mannose, cellobiose, maltose, lactose, sucrose, trehalose, starch, starch hydrolysate, and waste sugar honey can be used depending on the assimilation property. As the nitrogen source, for example, ammonium salts such as ammonia, ammonium sulfate, ammonium chloride and ammonium nitrate and nitrates can be used. Further, as the inorganic salts, for example, sodium chloride, potassium chloride, potassium phosphate, magnesium sulfate, calcium chloride, calcium nitrate, manganese chloride, ferrous sulfate and the like can be used. Further, organic components such as peptone, soybean flour, defatted soybean meal, meat extract and yeast extract may be used. Further, as the prepared medium, for example, MRS medium can be preferably used.

As the lactic acid bacterium strain of the present invention, the culture obtained after culturing may be used as it is, diluted or concentrated, or cells recovered from the culture may be used. In addition, various additional operations such as heating and freeze-drying can be performed after culturing as long as the effects of the present invention are not impaired.

The lactic acid bacterium strain of the present invention is preferably a live bacterium, but may be a dead bacterium.

The lactic acid bacterium strain of the present invention may be used as it is, or may be used in the form of a composition together with natural or other additives, if desired.

The lactic acid bacterium strain of the present invention can be used as a regulator of the bacterial composition balance contained in the indigenous bacterial flora in the subject. Therefore, the composition containing the lactic acid bacterium strain of the present invention is preferably used as a composition for adjusting the bacterial composition balance contained in the indigenous bacterial flora in the subject. Also, according to a more preferred embodiment, the composition is used to reduce Lachnospiraceae, Acinetobacter, Prevotella, or Bacteroides bacteria in the indigenous flora. Also, according to another more preferred embodiment, the composition is used to increase the bacterium of the genus Musspyrilam in the indigenous flora. In addition, according to yet another preferred embodiment, the composition is used to suppress weight loss due to diarrhea at the onset of enteritis in the subject to which it is administered. In addition, according to yet another preferred embodiment, the composition is used to suppress and activate the DAI score at the onset of enteritis in the subject to which it is administered. Moreover, according to still another more preferable embodiment, the composition is used to suppress inflammation of the mucous membrane in the subject to which it is administered, and to suppress diarrhea or fecal bleeding.

In addition, the lactic acid bacterium strain of the present invention can be used to reduce the amount of bacteria involved in inflammation in the indigenous bacterial flora. Therefore, according to another embodiment, the compositions of the invention are used to control inflammation-related diseases or conditions.

The indigenous bacterial flora in the present invention is preferably a mucosal adherent bacterial flora or an intestinal bacterial flora.

The compositions of the present invention can preferably be used as pharmaceuticals, foods and drinks, cosmetics or feeds.

The medicine is not particularly limited as long as it contains the lactic acid bacterium strain of the present invention. As a pharmaceutical product, the lactic acid bacterium strain of the present invention may be formulated and used together with a pharmaceutically acceptable carrier.

The dosage form of the pharmaceutical of the present invention is not particularly limited, and specifically, tablets, pills, powders, liquids, suspensions, emulsions, granules, capsules, syrups, suppositories, injections, ointments. , Patches, eye drops, nasal drops and the like can be exemplified. In addition, when formulating, additives such as excipients, binders, disintegrants, lubricants, stabilizers, flavoring agents, diluents, surfactants or solvents for injections, which are usually used as pharmaceutical carriers. Can be used.

The content of lactic acid bacteria in the drug of the present invention is appropriately set depending on the dosage form, usage, age, sex, type of disease, degree of disease, other conditions, etc., but is usually 1 × 10 ⁶ to 1. It is preferably in the range of × 10 ¹² cfu / g or 1 × 10 ⁶ to 1 × 10 ^{12 cfu / ml, 1 × 10 7} to 1 × 10 ¹¹ cfu / g or 1 × 10 ⁷ to 1 × 10 ¹¹ It is more preferably in the range of cfu / ml. CFF No. If the 2031 strain is dead, cfu / g or cfu / ml can be replaced with individual cells / g or individual cells / ml.

The food and drink is not particularly limited as long as it contains the lactic acid bacterium strain of the present invention, and the food and drink include beverages such as soft drinks, carbonated drinks, nutritional drinks, fruit juice drinks, and lactic acid bacteria drinks (concentrated stock solutions and preparations of these drinks). Confectionery such as ice cream, sherbet, shaved ice; confectionery such as candy, chewing gum, candy, gum, chocolate, tablet confectionery, snack confectionery, biscuits, jelly, jam, cream, and baked confectionery; processed milk, Dairy products such as dairy beverages, fermented milk, drink yogurt, and butter; bread; enteral nutritional foods, liquid foods, baby milk, sports beverages; and other functional foods are exemplified. In addition, the food and drink may be a supplement, for example, a tablet-shaped supplement. In the case of supplements, the daily dietary amount and calorie intake are not affected by other foods, and CFF No. You can ingest the 2031 strain.

The food or drink can be produced by adding the lactic acid bacterium strain of the present invention to the raw material of the food or drink, and can be produced in the same manner as a normal food or drink except that the lactic acid bacterium strain of the present invention is added. .. The addition of the lactic acid bacterium strain of the present invention may be carried out at any stage of the food and drink manufacturing process. In addition, food and drink may be produced through a fermentation step using the added lactic acid bacterium strain of the present invention. Examples of such foods and drinks include lactic acid bacteria beverages and fermented milk.

As a raw material for foods or beverages, raw materials used for ordinary beverages and foods can be used.

The food and drink of the present invention also includes raw materials for manufacturing food and drink, food additives, and the like that are added to food and drink during or after the manufacturing process of food and drink. For example, the lactic acid bacterium strain of the present invention can be used as a starter for producing fermented milk. In addition, the lactic acid bacterium strain of the present invention can be added to the produced fermented milk later.

The content of the lactic acid bacterium strain of the present invention in a food or drink is appropriately set depending on the mode of the food or drink, but is usually 1 × 10 ⁶ to 1 × 10 ¹² cfu / g or 1 × 10 ⁶ to 1 in the food or drink. It is preferably in the range of × 10 ¹² cfu / ml, more preferably in the range of 1 × 10 ⁷ to 1 × 10 ¹¹ cfu / g or 1 × 10 ⁷ to 1 × 10 ¹¹ cfu / ml.

The food and drink of the present invention is used for regulating the bacterial composition balance contained in the indigenous bacterial flora, for reducing the bacteriophylla, Acinetobacta, Bacteroides or Prebotera bacteria in the indigenous bacterial flora, the mucosal adherent bacterial flora or For increasing Musspyrilam bacteria in the intestinal flora, for suppressing weight loss, for suppressing DAI score, for suppressing diarrhea or fecal bleeding, for reducing strains involved in inflammation, for suppressing inflammation-related diseases or symptoms It can be sold as a food or drink with an indication of its intended use.

In addition, the food and drink of the present invention includes "for adjusting the compositional balance of bacteria contained in the resident bacterial flora", "reduction of Lacnospirae bacteria, Acinetobacter bacterium, Bacteroides bacterium or Prebotera bacterium in the resident bacterial flora". "For", "For increasing Musispyrilam bacteria in the indigenous flora", "For suppressing weight loss", "For suppressing DAI score", "For suppressing diarrhea or fecal bleeding", "For bacteria involved in inflammation" It is possible to display "for reduction", "for suppression of diseases or symptoms related to inflammation" and the like. In addition to this, it goes without saying that any wording that expresses a secondary effect caused by the use of the composition for the above-mentioned use can be used. Examples of such words include "adjusting the condition of the stomach" and "improving stomach or intestinal discomfort".

The "display" means all actions for informing the consumer of the above-mentioned use, and if the display can recall or infer the above-mentioned use, the purpose of the display, the content of the display, and the display are used. Regardless of the object, medium, etc., all fall under the "indication" of the present invention. However, it is preferable to display it in an expression that allows the consumer to directly recognize the above-mentioned use.

Specifically, the act of describing the above-mentioned use on the product or product packaging related to the food or drink of the present invention, or the product or product packaging on which the above-mentioned use is described is transferred and displayed for delivery, transfer or delivery. However, the act of importing, advertisements related to goods, price lists or transaction documents, the above-mentioned uses are described and displayed or distributed, or the above-mentioned uses are described in the information containing these, and the electromagnetic (Internet, etc.) method. The act of providing the product can be exemplified by the above method, and it is particularly preferable to display it on advertising materials such as packaging, containers, catalogs, pamphlets, POPs, and other documents at the sales site.

Further, as the display, it is preferable that the display is permitted by the government or the like (for example, a display obtained based on various systems established by the government and performed in a mode based on such approval). For example, labeling as health foods, functional foods, enteral nutritional foods, special-purpose foods, nutritional functional foods, non-medicinal products, etc. can be exemplified, and other labeling approved by the Ministry of Health, Labor and Welfare, for example, specific. Examples of foods for health use and labeling approved by a similar system can be given. Examples of the latter include labeling as a food for specified health use, labeling as a food for specified health use with conditions, labeling to the effect that it affects the structure and function of the body, labeling for reducing the risk of illness, and the like. More specifically, the labeling as a food for specified health use (especially the labeling for health use) stipulated in the Health Promotion Law Enforcement Regulations (April 30, 2003, Ministry of Health, Labor and Welfare Ordinance No. 86), and this A similar display or the like can be exemplified.

The cosmetic product of the present invention may be prepared according to the above-mentioned pharmaceuticals or foods and drinks and used as a cosmetological agent for internal use, but may also be used as a topical or systemic external skin preparation. Suitable examples of external skin preparations include basic cosmetics such as lotions, emulsions, creams, ointments, lotions, oils and packs, facial cleansers such as bar soaps, liquid soaps and hand wash, skin cleansers, and massage agents. , Cleansing agents, depilatory agents, depilatory agents, shaving agents, after-shave lotions, pre-show lotions, shaving creams, foundations, lipsticks, cheeks, eye shadows, eyeliners, make-up cosmetics such as mascara, perfumes, Examples thereof include a beautiful nail agent, a beautiful nail enamel, a beautiful nail enamel remover, a poultice, a plaster agent, a tape agent, a sheet agent, a patch, an aerosol agent and the like.

CFF NO. In the cosmetics of the present invention. The content of the 2031 strain is appropriately set depending on the mode of the cosmetic product and the administration target, but is in the range of 1 × 10 ⁶ to 1 × 10 ¹² cfu / g or 1 × 10 ⁶ to 1 × 10 ¹² cfu / ml. It is preferably in the range of 1 × 10 ⁷ to 1 × 10 ¹¹ cfu / g or 1 × 10 ⁷ to 1 × 10 ¹¹ cfu / ml.

In addition, cosmetics can be manufactured by arbitrarily selecting and using the additive components exemplified below, if necessary. The additive component is not particularly limited, but is not limited to fats and oils (cacao fat, chamomile oil, carrot oil, cucumber oil, beef fat fatty acid, kukui nut oil, safflower oil, shea butter, etc.), waxes (mitsurou, carnauba wax, whale wax, etc.). , Lanolin, liquid lanolin, reduced lanolin, hard lanolin, candelilla wax, monttan wax, serrac wax, rice wax, etc.), mineral oil (liquid paraffin, vaseline, paraffin, ozokelide, selecin, microchristan wax, etc.), fatty acids (lauric acid, myristin, etc.) Natural fatty acids such as acid, palmitic acid, stearic acid, bechenic acid, oleic acid, linoleic acid, linolenic acid, docosahexaenoic acid, eikosapentaenoic acid, 12-hydroxystearic acid, undecylenic acid, tall oil, lanolin fatty acid, isononanoic acid, capron Acids, 2-ethylbutanoic acid, isopentanoic acid, 2-methylpentanoic acid, 2-ethylhexanoic acid, synthetic fatty acids such as isopentanoic acid), alcohols (ethanol, isopropanol, lauryl alcohol, cetanol, stearyl alcohol, oleyl alcohol, lanolin alcohol) , Natural alcohols such as cholesterol, phytosterol, phenoxyethanol, synthetic alcohols such as 2-hexyldecanol, isostearyl alcohol, 2-octyldodecanol, etc.), various vitamins (vitamin A group: retinol, retinal (vitamin A1), dehydroretinal (vitamin A1) Vitamin A2), carotene, lycopene (provitamin A), vitamin B group: thiamine hydrochloride, thiamine sulfate (vitamin B1), riboflavin (vitamin B2), pyridoxin (vitamin B6), cyanocobalamine (vitamin B12), folic acids, Nicotinic acid, pantothenic acid, biotin, choline, inositol, vitamin C group: vitamin C acid or its derivative, vitamin D group: ergocalciferol (vitamin D2), etc.), high molecular compound (Arabic rubber, benzoin rubber, dammar rubber) , Guayak fat, chitosan, hyaluronic acid or its salt, chondroitin sulfate or its salt, ethyl cellulose, methyl cellulose, carboxymethyl cellulose, carboxyethyl cellulose, sodium carboxyethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, nitrocellulose, crystalline cellulose, polyvinyl alcohol, polyvinylmethyl Ether, polyvinylpyrrolid , Polyvinyl methacrylate, polyacrylate, polyalkylene oxide such as polyethylene oxide and polypropylene oxide or a crosslinked polymer thereof, carboxyvinyl polymer, polyethyleneimine, etc.) and the like.

Examples of the feed of the present invention include pet food, livestock feed, fish feed and the like. The feed of the present invention is used for general feeds such as cereals, lees, brans, fish meals, bone meals, oils and fats, skim milk powders, whey, mineral feeds, yeasts and the like, and CFF NO. It can be produced by mixing 2031 strains. Also, for example, like silage, the added CFF NO. The feed may be produced through a fermentation step with the 2031 strain. The produced feed can be orally administered to general mammals, livestock, fish farms, pet animals and the like.

CFF NO. In the feed of the present invention. The content of the 2031 strain is appropriately set depending on the mode of the feed and the administration target, but is in the range of 1 × 10 ⁶ to 1 × 10 ¹² cfu / g or 1 × 10 ⁶ to 1 × 10 ¹² cfu / ml. It is preferably in the range of 1 × 10 ⁷ to 1 × 10 ¹¹ cfu / g or 1 × 10 ⁷ to 1 × 10 ¹¹ cfu / ml.

Further, according to another aspect, it is a method for adjusting the compositional balance of bacteria contained in the indigenous bacterial flora, and includes administering an effective amount of the lactic acid bacterium strain of the present invention to a subject who needs it. Is provided. According to another preferred embodiment of the invention, the method is for reducing the bacteria involved in inflammation (eg, Lachnospiraceae, Acinetobacter, Bacteroides, Prevotella, etc. in the indigenous flora). The method. Further, according to another more preferable embodiment, the above method is a method for increasing the number of bacteria of the genus Musispyrilam in the indigenous bacterial flora. In addition, according to another still preferred embodiment, the method is a method for suppressing at least one symptom selected from weight loss, DAI score, diarrhea or fecal bleeding due to diarrhea onset of enteritis.

Further, according to another aspect, there is provided a method for suppressing a disease or symptom related to inflammation, which comprises administering an effective amount of the lactic acid bacterium strain of the present invention to a subject in need thereof. To. Here, "suppression" includes not only treating or ameliorating an established pathological condition, but also preventing a pathological condition that may be established in the future.

Examples of the disease or symptom related to inflammation include inflammatory bowel disease (IBD), specifically ulcerative colitis (UC) and Crohn's disease (CD).

Further, according to one aspect, the method of the present invention excludes medical practice. According to another aspect, the method of the invention is a non-therapeutic method.

The effective amount of the lactic acid bacterium strain of the present invention is not particularly limited as long as it does not interfere with the effect of the present invention, and can be, for example, 1.0 × 10 ⁴ cfu / time to 1.0 × 10 ¹² cfu / time. According to one embodiment, CFF NO. The effective amount of the 2031 strain is the intake per serving.

The effective amount of the lactic acid bacterium strain of the present invention can be administered once a day or in multiple divided doses, or may be administered once every few days or weeks. In addition, it is possible to appropriately select the administration time according to the condition of the subject and the like.

The subject of the present invention is preferably a human, more preferably a minor under the age of 15, and even more preferably an infant. The application of the lactic acid bacterium strain of the present invention to infants is particularly advantageous in regulating the compositional balance of bacteria contained in the mucosal adherent bacterial flora or the intestinal bacterial flora as an alternative to breast milk.

In addition, the lactic acid bacterium strain of the present invention may be continuously administered not only at one time but also at one time during infancy. Administration of the lactic acid bacterium strain of the present invention in infancy is particularly advantageous in preventing post-growth diseases.

In addition, the subject may be a healthy person, a person having a disease or symptom related to inflammation in the gastrointestinal tract, or a person having a physical disorder due to the disease or symptom.

Moreover, the administration method in this invention is preferably oral. However, the present invention is not particularly limited as long as it does not interfere with the effect of the present invention, and the lactic acid bacterium strain of the present invention may be administered to a subject by other methods such as tube, enteral, transdermal (application, etc.). ..

Further, according to another aspect, the use of the lactic acid bacterium strain of the present invention in the production of the composition for adjusting the bacterial composition balance contained in the indigenous bacterial flora is provided. According to a preferred embodiment, the composition is a composition for reducing bacteria involved in inflammation (for example, Lachnospiraceae bacteria, Acinetobacter spp., Prevotella spp. Or Bacteroides spp. In the indigenous flora). Further, according to another preferred embodiment, the above composition is a composition for increasing a bacterium belonging to the genus Musispyrilam in the indigenous bacterial flora. Also according to another more preferred embodiment, the composition is a composition for suppressing at least one symptom selected from weight loss, DAI score, diarrhea or fecal bleeding due to diarrhea onset of enteritis. ..

Further, according to another preferred embodiment, the use of the lactic acid bacterium strain of the present invention in the production of a composition for suppressing an inflammation-related disease or symptom is provided.

Hereinafter, examples of the present invention will be described, but the present invention is not limited to these examples.

Example 1: Confirmation test of the effect of lactic acid bacteria administration on mucosal adherent bacterial flora and intestinal bacterial flora Two-week-old C57BL / 6N mice purchased from Japan SLC were weaned at three-week-old after 7-day institutional acclimatization. Next, control group (group C) and Lactobacillus crispatus CFF No. The animals were bred and managed in two groups (n = 6) of the 2031 strain administration group (L group). After weaning, the mice were allowed to freely ingest the laboratory MR stock for mice, rats and hamsters (Nosan Corporation) and also to freely ingest unsterilized water. The breeding room was lit at 8 o'clock and turned off at 20:00 with a 12-hour light-dark cycle, and the room temperature was set to 25 ± 2 ° C.

Oral administration of each test substance was started the day after the weaning day, and oral administration was performed for 14 days. PBS (-) was used for the C group, and Lactobacillus crispatus CFF No. was used for the L group. The 2031 strain was orally administered. The amount of liquid for oral administration was adjusted according to the body weight of the mouse, and was 100 μl if the body weight was less than 12.5 g, and 150 μl if the body weight was 12.5 or more and less than 17.5 g.

A 1 ml syringe (TERUMO) was used as an instrument for oral administration. At the time of oral administration, the 1 ml syringe was equipped with an autoclave-sterilized 23G needle (TERUMO) equipped with a Chuko Flow PTFE tube AWG-26 (Chuko Kasei Kogyo) that was cut to an appropriate length and the tip was baked and processed into a round shape. ) Was attached.

Lactobacillus crispatus CFF No. orally administered to mice. The 2031 strain-containing liquid was prepared as follows. L. stored at -80 ° C. crispatas CFF No. The 2031 strain was inoculated into 10 ml of MRS medium and cultured under anaerobic conditions at 37 ° C. for 24 hours to prepare a preculture solution. This preculture solution was stored in a refrigerator and used for daily preparation of a lactic acid bacterium strain-containing solution. As the strain-containing solution, 200 μl was taken out from the preculture solution on the day before oral administration, subcultured in a new 10 ml MRS medium, and cultured under the same conditions as the preculture. After the culture is completed, the cells are centrifuged at 10,000 × g at room temperature for 3 minutes, the cells are pelleted, washed with PBS (-), and 5 × 10 ⁹ cfu based on the turbidity (OD595). It was suspended in PBS (-) so as to be / ml, and used as a lactic acid bacterium strain-containing solution.

Seven days after the end of oral administration was set as the washout period (rest period) of the test substance, and the animals were bred without oral administration.

At the end of the washout period (after the mice reached 6 weeks of age), all mice were dissected and the cecal mucosa and cecal contents, and the colonic mucosa and colon contents were collected, respectively.

Bacterial DNA was extracted from the mucosa and contents of each collected tissue using QuickGene DNA tissue kit S (KURABO). Using the extracted bacterial genomic DNA as a template, the V3-V4 region of the 16S rRNA gene was amplified by a PCR reaction using KAPA HiFi HS Ready Mix (Nippon Genetics). For this reaction, forward primer 341F (SEQ ID NO: 5'-TCGTCGGCAGCGTCAGATGTGTACAGTACAGCACTACGGGGNGGCWGCAG-3') with a sequence for 2ndPCR and reverse primer 805R (SEQ ID NO: 3: 5'-GTGTCGTACGGACTAGACTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGAGTGACGCGTAG board. PCR was performed using a total amount of 25 μl of KAPA HIFI HS Ready Mix 12.5 μl, template DNA 2.5 μl, primer 0.05 μl each, and free water 9.9 μl as a reaction solution. After the initial denaturation at 95 ° C. for 3 minutes, 25 cycles of temperature cycles of 95 ° C. for 30 seconds, 55 ° C. for 30 seconds, 72 ° C. for 30 seconds, and finally an extension reaction at 72 ° C. for 5 minutes were performed. After completion of the PCR reaction, electrophoresis was performed using a 1% agarose gel (tris acetate EDTA: TAE), and it was confirmed that the gene of interest was amplified. The PCR product was then purified using NucleoFast 96 PCR Clean up plate (Takara Bio). Purified products were tagged by a second PCR reaction with primers loaded with Index and Illumina sequencing adapter.

Using the SexualPrepTM Normalization Plate Kit (Invitrogen), the product obtained by PCR was purified and its concentration was adjusted. Then, the concentration of the purified product was quantified by real-time PCR using KAPA SYBR Fast qPCR Kit (Nippon Genetics). Samples having a sufficient concentration were mixed in an amount of 10 μl per sample, and purified and concentrated using Agencoute AMPure XP (BECKMAN COOLTER).

The concentration of the obtained library was calculated according to the standard protocol of KAPA Library Quantification Kit (Japan Genetics). Then, based on the obtained concentration, the sample was diluted to 4 nM with 10 mM Tris Buffer. Subsequent operations were performed according to 16S Metagenomic Sequencing Library Preparation (Illumina). The prepared sample was applied to a reagent cartridge of Miseq Reagent Kit V3 (600PE), and sequenced by MiSeq (Illumina) was performed. The obtained sequence data was subjected to a secondary analysis using STAMP after the primary analysis by QIIME.

The results were as shown in FIGS. 1-4.
1A and 1B are the results of main coordinate analysis by metagenomic analysis of the mucosal adherent bacterial flora of the cecum. For the above analysis, phyloseq (see https: //joy711.github.io/phyloseq/) was used. Therefore, the classification of the fungi shown in FIGS. 2A, 3A, 4A-4H follows the classification of phyloseq and the Greengenes referenced by the software. As a result of the main coordinate analysis by metagenomic analysis, Lactobacillus crispatus CFF No. In the 2031 strain administration group (L group), a change in the composition of the mucosal adherent bacterial flora of the cecum was confirmed as compared with the control group (C group) (PERMANOVA p = 0.002).

The results of the bacterial flora structure analysis by metagenomic analysis of the mucosal adherent bacterial flora of the cecum were as shown in FIG. 2A. In addition, regarding the mucosal adherent bacterial flora of the cecum, Lactobacillus crispatus CFF No. The occupancy rate of Lachnospiraceae bacteria in the 2031 strain-administered group (Group L) was significantly lower than the occupancy rate (proportion of sexuences (%)) in the control group (FIG. 2B, Wilcoxon / Kruskal). -Wallis test (rank sum), p <0.05). On the other hand, Lactobacillus crispatus CFF No. The occupancy rate of Musipyryram spp. In the 2031 strain administration group (L group) was significantly higher than that in the control group (FIG. 2C, Wilcoxon / Kruskal-Wallis test (rank sum), p <0. 05).

The results of the bacterial flora structure analysis by metagenomic analysis of the mucosal adherent bacterial flora of the colon were as shown in FIG. 3A. Regarding the mucosal adherent bacterial flora of the colon, Lactobacillus crispatus CFF No. The occupancy rate of Acinetobacter bacteria in the 2031 strain administration group (L group) was significantly lower than that in the control group (C group) (FIG. 3B, Wilcoxon / Kruskal-Wallis test (rank sum)). , P <0.05).

Lachnospiraceae bacteria and Acinetobacter spp. Are known to increase during inflammation of the intestinal tract (Non-Patent Documents 2 to 5). Therefore, these bacteria are Lactobacillus crispatus CFF No. Lactobacillus crispatus CFF No. was found to decrease with the administration of 2031 strain. The 2031 strain is considered to have an effect of suppressing inflammation of the gastrointestinal tract. Mucispirillum is a bacterium that assimilate mucus. From the result that this bacterium increased, Lactobacillus crispatus CFF No. It is considered that the gastrointestinal mucosa was sufficiently filled with mucus by the administration of the 2031 strain.
From the above, Lactobacillus crispatus CFF No. The 2031 strain is considered to have an effect of enhancing the barrier function of the gastrointestinal mucosa.

The results of bacterial flora structure analysis by metagenomic analysis of the bacterial flora of the cecal contents were as shown in FIG. 4A. In addition, regarding the bacterial flora of the cecal contents, as shown in FIG. 4B, Lactobacillus crispatus CFF No. The occupancy rate of Bacteroides in the 2031 strain-administered group (Group L) was significantly lower than that in the control group (Student's t-test, p = 0.0484). In addition, as shown in FIG. 4C, the occupancy rate of Prevotella bacteria ([Prevotella]) in the L group was significantly lower than that in the control group (Student's t-test, p = 0.0430). In addition, as shown in FIG. 4D, the occupancy rate of Lachnospiraceae bacteria in the L group was significantly lower than that in the control group (Student's t-test, p <0.0001). Furthermore, the occupancy rate of Lactobacillus in the L group was significantly higher than that in the control group (Student's t-test, p = 0.0409).

The results of bacterial flora structure analysis by metagenomic analysis of the bacterial flora of the colon contents were as shown in FIG. 4E. Regarding the bacterial flora of the colon contents, as shown in FIG. 4F, the occupancy rate of Bacteroides in the L group was significantly lower than that in the control group (Student's t-test, p = 0.0004). ). In addition, as shown in FIG. 4G, the occupancy rate of Prevotella in the L group was significantly lower than that in the control group (Wilcoxon / Kruskal-Wallis test (rank sum), p = 0.0131. ). In addition, as shown in FIG. 4H, the occupancy rate of Prevotella bacteria ([Prevotella]) in the L group was significantly lower than that in the control group (Student's t-test, p = 0.0072).

Prevotella and Bacteroides bacteria are known to increase during inflammation of the intestinal tract and systemic body (Non-Patent Documents 6-8). Therefore, these bacteria are Lactobacillus crispatus CFF No. Lactobacillus crispatus CFF No. was found to decrease with the administration of 2031 strain. The 2031 strain is considered to have an effect of suppressing inflammation of the gastrointestinal tract. From the above, Lactobacillus crispatus CFF No. The 2031 strain is considered to have an effect of suppressing inflammation of the gastrointestinal mucosa.

Example 2: Gastrointestinal barrier function enhancement test by administration of lactic acid bacteria Two 2-week-old C57BL / 6N mice (6 each belly) purchased together with mother mice from Charles River Laboratories Japan were introduced into the breeding room of our laboratory. The facility was acclimatized for 7 days. The pups were weaned at 3 weeks of age, and the control group (Group C), Lactobacillus crispatus CFF No. The animals were bred and managed in two groups (N = 6) of the 2031 strain administration group (L group). As in Example 1, from the day after the weaning day, PBS (-) was used for the DC group, and Lactobacillus crispatus CFF No. was used for the DL group. Oral administration of 2031 strain was started, and oral administration was performed for 14 days. The wash-out period of the administered bacteria was set to 7 days after the end of oral administration, and the animals were bred without oral administration. At the end of the wash out period and when the mice reached 6 weeks of age, in Example 2, 1.5% DSS (Dextran Sulfate Sodium (DSS) salt, Collitis grade (MP Biomedicals MW 36-50 kDa) in distilled water 15). (Dissolved at g / l) was replaced with tap water and allowed to be freely ingested as drinking water. All mice were dissected on day 11 of DSS administration.

During the period after weaning, unless otherwise specified, the laboratory MR stock for mice, rats and hamsters (Nosan Corporation) was freely ingested, and unsterilized tap water was freely ingested. The breeding room had a 12-hour light-dark cycle of turning on at 8 o'clock and turning off at 20:00, and the room temperature was set to 25 ± 2 ° C. and the humidity was set to 40 to 70%.

Mice were weighed and scored for fecal properties (hardness and bleeding) daily from the DSS administration start date (d22) to the day before the final day (d31). However, on the final day (d32), the mice were weighed and the fecal properties were scored immediately before the dissection. From the weight loss rate and fecal symptoms, DAI, which is an index indicating the severity of enteritis, was calculated and the symptoms of enteritis were evaluated. In addition, this evaluation method is described in Mengen et al. (2009) (Table 2-1) was followed.

In addition, as shown in FIG. 5A, on the 11th day (d11) of DSS administration, Lactobacillus crispatus CFF No. was compared with the control group (C group: 86.87%). A weight loss inhibitory effect was observed in the 2031 strain administration group (L group: 92.26%) (t-test, p = 0.05). In addition, as shown in FIG. 5B, on the 11th day (d11) of DSS administration, Lactobacillus crispatus CFF No. was compared with the control group (Group C: DAI score 9.07). In the 2031 strain administration group (L group :: DAI score 7.00), the deterioration of the DAI score was also suppressed (t-test, p = 0.07).

When the administration time and age of the mice used in this study are converted to humans (when the lifespan of mice is converted to 2 years and the lifespan of humans is converted to 60 to 80 years), 1 and a half to 2 and a half years in this study. As a result of administering lactic acid bacteria to some children for one to one and a half years, it means that they have prevented inflammatory diseases that may occur around the age of four to five years. From this result, it is considered that administration of the lactic acid bacterium strain of the present invention in infancy can be utilized for prevention of post-growth diseases.

INDUSTRIAL APPLICABILITY According to the present invention, there is provided a novel lactic acid bacterium capable of effectively regulating the bacterial composition balance in a resident bacterial flora including a mucosal adherent bacterial flora or an intestinal bacterial flora.

Claims (14)

Lactobacillus crispatus strain, wherein the nucleotide sequence of the 16s rRNA gene of the strain has at least 95% identity with the nucleotide sequence shown in SEQ ID NO: 1. The strain according to claim 1, wherein the identity is 98% or more. Lactobacillus crispatus CFF No. deposited under accession number NITE BP-02869. The strain according to claim 1 or 2, which is 2031. A composition comprising the strain according to any one of claims 1 to 3. The composition according to claim 4, for use as a medicine, food or drink, cosmetics or feed. The composition according to claim 4 or 5, for infants or minors. The composition according to any one of claims 4 to 6, for adjusting the bacterial composition balance contained in the indigenous bacterial flora. The composition according to claim 7, wherein the bacterium contained in the resident bacterial flora is at least one selected from a bacterium belonging to the genus Lacnospirae, a bacterium belonging to the genus Acinetobacta, a bacterium belonging to the genus Musispyriram, a bacterium belonging to the genus Prevotella, and a bacterium belonging to the genus Bacteroides. The composition according to claim 7 or 8, wherein the indigenous bacterial flora is a mucosal adherent bacterial flora or an intestinal bacterial flora. The composition according to any one of claims 4 to 9, for suppressing an inflammation-related disease or symptom. The composition according to any one of claims 4 to 10, for protecting the digestive tract. The composition according to any one of claims 4 to 11, for suppressing weight loss. The use of a Lactobacillus crispatus strain in the production of a composition for controlling bacterial composition contained in a resident bacterial flora, wherein the nucleotide sequence of the 16s rRNA gene of the strain is at least 95% of the nucleotide sequence shown in SEQ ID NO: 1. Have the same, use. A method of adjusting the compositional balance of bacteria contained in a resident bacterial flora, which comprises administering an effective amount of a Lactobacillus crispatus strain to a subject in need thereof, the nucleotide of the 16s rRNA gene of the strain. A method, wherein the sequence has at least 95% identity with the nucleotide sequence set forth in SEQ ID NO: 1.

Images