JPWO2019002875A5 - - Google Patents

Description

The present invention relates to improvements in drug delivery.

More specifically, the use of Cell Penetrating Agents (CPA), more specifically, for example, i) Stapled CPP by stapling two amino acids (hereinafter referred to as "stapled CPP ), or ii) forming a stitched CPP (hereinafter also referred to as a "stitched CPP") ( StiP ) by stitching three or more amino acids. It relates to the use of Cell Penetrating Peptides (CPPs) that are stabilized by.

It is based on Applicant's earlier patent application PCT/GB2016/054028 (PCT/GB2016/054028) when using different chemistries for olefin metathesis to stabilize peptides. is synonymous with, hereinafter the same). These chemistries provide a cross-link or bridge between at least two amino acids of the peptide, and the cross-link or bridge provides cyclization between at least two amino acids. In these alternative chemistries, cyclization is
i. condensation of aldehydes or ketones with hydrazines or protected hydrazines;
ii. thiol-enemichael addition;
iii. disulfide formation;
iv. Huisgen 1,3 dipolar cycloaddition;
v. reactions between amines and carboxylic acids;
vi. singlet or triplet based carbene reactions; or vii. Accomplished by one or more of Suzuki or Sonogashira couplings.

These StaPs or StiPs may consist of single or multiple staples or stitches and may or may not be contiguous along the peptide sequence.

These stabilized CPPs (hereinafter also referred to as "stabilized CPPs") can be directly attached to drugs, i.e., biologically active compounds (BACs) or bifunctional linkers ( BFLs ). -Functional Linker ) by which the BAC can be transported across the cell membrane by the CPP. The resulting molecules are called Drug Carrying Cell Penetrating Molecules (DCCPM).

Preferred BACs delivered in this manner are oligonucleotides (ON), more preferably oligonucleotides with a low electrical charge (-3 to +3 charge at pH 7.5), most preferably electrically neutral Oligonucleotides (charge −1 to +1 at pH 7.5) such as, but not limited to, peptide nucleic acids (PNA), phosphorodiamidate morpholino oligonucleotides (PMO) or modified derivatives thereof.

Instead, stabilized CPPs, when complexed to ONs, covalently or non-covalently associate with BACs, either DNA, RNA or protein molecules, either directly or via BFL. , whereby the BAC can be transported across the cell membrane by the CPP complex ON. The resulting molecules are termed Drug Targeting Cell Penetrating Molecules (DTCPM).

Preferred BFLs may be PEGylated to contain polyethylene glycol (PEG) groups containing modifications such as amine groups, or incorporate spacers such as β-alanine. These modifications may improve solubilization or provide proper spacing between functional moieties.

The present invention provides a method for enhancing the cellular uptake of BACs, the use of DCCPM in the treatment of diseases requiring modification of endogenous or exogenous genes, a method for improving the bioavailability of a drug or a BAC, a drug or A method of introducing a BAC to a site where it is naturally resistant to the drug or BAC, a method of treating a subject comprising administering a DCCPM of the invention, and It also relates to pharmaceutical compositions comprising DCCPM, its pharmaceutical salts and one or more pharmaceutically acceptable excipients.

The present invention relates to methods for enhancing cellular uptake of BACs, either DNA, RNA or protein molecules, the use of DTCPMs in the treatment of diseases requiring modification of endogenous or exogenous genes, drugs or organisms of BACs. A method of improving bioavailability, introducing a drug or BAC to a site that is refractory to the drug or BAC in its native state, treating a subject, comprising: and pharmaceutical compositions comprising DTCPM and one or more pharmaceutically acceptable excipients.

Moreover, further aspects will become apparent from the detailed description.

In the treatment of all diseases, it is desirable to deliver drugs or BACs to the body, more preferably to cells at the target site, in a manner that ensures maximum efficacy with minimal toxicity. This can be a difficult task.

An example of a drug or BAC that is delivered in a targeted manner is the term oligonucleotide (ON), which includes ON analogues.

ONs can target essential DNA, RNA and protein sequences and induce steric blockade to inhibit (i) RNA splicing, (ii) protein translation, or (iii) other nucleic acid:nucleic acid or nucleic acid:protein interactions. Gene expression can be regulated in several ways, including

Specifically, hybridization of ONs to specific RNA sequence motifs prevents correct assembly of spliceosomes, thereby failing to recognize target exons in pre-mRNAs and thus in mature gene transcripts. These exons of are removed. Removal of in-frame exons can lead to gene products that are truncated and functional; A decrease in gene expression levels results. Similarly, ONs can alter cellular protein content through regulating RNA splicing to exclude specific exons of genes from the mature mRNA transcript. Collectively, this has resulted in translation programs and subsequent market approval for conditions such as Duchenne muscular dystrophy (exon exclusion) and spinal muscular atrophy (exon inclusion)1,2.

In addition, ONs can be designed to target the 5' translation initiation site of viral gene transcripts to prevent binding of the translational machinery. The use of antisense oligonucleotides (AO) to suppress viral translation is a well-established technique3 and is progressing into clinical trials against viral hemorrhagic fevers such as Marburg and Ebola4,5. However, AOs can be designed to target the 5' translation initiation site of endogenously expressed genes.

ONs can also be designed to target the 3' untranslated region of endogenous transcripts to modify nuclear export, translation and stability of the transcript. Such targets include, but are not limited to, transcript polyadenylation and/or cleavage sites.

ONs also form aptamers whose secondary and tertiary structures can bind proteins or other cellular targets, thereby affecting specific gene expression levels or other cellular processes (e.g., post-translational modifications). can be designed to

An advantage of steric block-based suppression over siRNA/RNAi-based induction of ribonuclease H of the RNA-induced silencing complex is the reduced potential for off-target side effects.

Modification of the ON to create a negatively charged backbone improves stability6-9, but these backbone chemistries, such as the 2'O-methylphosphothioate analogs, induce membrane toxicity problems and Efficacy is hampered by toxicity issues even when the dosing protocol becomes increasingly intermittent11, as it causes thrombocytopenia and injection site problems during clinical interpretation11.

Indeed, both WO2013/150338 and WO2014/053622 describe small (typically smaller than 1.5 KDa) negatively charged ONs with 15 or more amino acids and 15-27 by forming a complex with a positively charged linear or staple peptide of amino acids in the range of .

JACS, Vol 136, 2014, GJ Hilnski et al, describe staple and stitch peptides that can penetrate cells. The possibility is mentioned that these peptides could be used to deliver oligonucleotides, perhaps as disclosed in the above-disclosed international application, i.e. by conjugation. New entities much larger (greater than 1.5 KDa to 2.5 KDa, 5 KDa, 7.5 KDa, 10 KDa, 12.5 KDa or more) are covalently linked to the BAC with CPA, optionally via BFL. Indeed, prior methods require each component to have opposite charges to facilitate complex formation.

Electrically low charged oligonucleotides (charge −3 to +3 at pH 7.5), most preferably electrically neutral, conjugated directly or indirectly (covalently) with BFL The use of oligonucleotides (charge −1 to +1 at pH 7.5) such as, but not limited to, peptide nucleic acids (PNA), phosphorodiamidate morpholino oligonucleotides (PMO) is obvious. It was not clear, however, that limiting the charge on the ON would favor smaller peptides (less than 15 amino acids long, 14, 13, 12, 11, 10, 9, 8, 7, 6 to as few as 5 or 4) further enables the use of

The use of uncharged ON backbones such as phosphorodiamidate morpholino oligonucleotides (PMOs) represents an interesting BAC as it has an uncompromising safety record in preclinical and clinical settings 2,4,12-14 .

However, their ability to penetrate cells and access their targets is compromised due to their uncharged nature 15 .

It is therefore desirable to overcome the problem of promoting entry of ONs into cells.

Other examples of drugs or BACs delivered in a targeted manner include DNA molecules (including linear and circularized molecules), RNA molecules and peptides.

Such methods, including protein enhancement and virus-mediated gene enhancement methods, have been cornerstones of many medical developments, but the challenges and efficiency of targeting cargo delivery can constitute many problems.

Again, it would also be desirable to overcome the challenges of facilitating entry of such DNA, RNA and peptide-based BACs into cells, including circularization of the viral genome in the absence of packaging into infectious virions.

Over the past two decades, much research has focused on developing CPAs that facilitate the delivery of drugs and BACs to the site of biological action.

The approach has generally been to use charged peptides as non-covalent conjugates to facilitate BAC cell entry. Combinations have also been attempted.

WO2014/064258 is an example of existing composite technology. Negatively charged ONs are coupled to targeting peptides via linkers. Targeting peptides are receptor targeting moieties, not staple or stitch peptides, attached to moieties that are negatively charged ON as to whether a DNA or RNA molecule can enter cells using the receptor targeting moiety. Then, of course, many questions arise since non-covalent interactions modify its conformation 16 .

WO 89/03849 discloses oligonucleotide-polyamide conjugates. There is no disclosure of the use of stitch or staple peptides. In the method described, oligonucleotides are essentially used as scaffolds for chain elongation of peptides and not as complexes for BAC delivery such as ONs.

WO2011/131693 describes nucleic acid constructs containing nucleic acids specific for a given target gene and selective inhibitors of neurotransmitter transporters. There is no disclosure of the use of stitch or staple peptides as delivery agents.

WO2017/011820 describes cross-linking groups used to stabilize peptides.

Peptides capable of effecting peptide-mediated cell delivery may also be referred to as cell delivery peptides (CDPs). Examples include polyarginine, penetratin (based on Antennapedia homeodomain) or PMO internalization peptide (PIP).

However, since their first description 17, and considering that many CPPs have multiple arginine, β-alanine and 6-aminohexanoic acid residues (e.g. poly-Arg12, TAT, penetratin, Pip6a) [http://crdd. osdd. A database maintained at net/raghava/cppsite/] 18, it is surprising that no CPP-delivering agents have progressed through all phases of clinical trials. In part, this is because the common arginine-rich core that activates most CPPs also causes membrane deformation,19 and in higher mammals this leads to prohibited toxic side effects, such as renal tubular degeneration. It can be for 20 to show up.

（式中、Ｖ＝孤立中性原子の価電子；Ｎ＝規定される原子上の非結合価電子の数；Ｂ＝結合で共有される電子の総数である）
に基づいて算出され得る。 At physiological pH, and based on the pKa of the amino acid R group, the formal charge (FC) is given by the formula:

(Where V = valence electrons of lone neutral atoms; N = number of non-bonded valence electrons on a given atom; B = total number of electrons shared in bonds)
can be calculated based on

Indeed, on this basis the CPPs typically used to date have a large number of positively charged residues. A correlation between this positive charge and membrane toxicity has been shown 21 . In PCT/GB Patent Application Publication No. 2016/054028, Applicants found that a reduction in the formal charge of an eight amino acid peptide from +3 to +2, +1 and 0 was associated with retention of cell entry properties due to reduced charge variants. provided evidence that it has interesting properties such as Applicants here present data that reducing the charge variant of a CPP that has been cyclized by ring-closing metathesis has improved toxicological properties compared to the parent CPP with a formal charge of +3. .

Therefore, CPPs with fewer positively charged residues within the amino acid sequence while retaining the ability to cross biological membranes are of greater clinical importance. The Applicant has overcome this problem as disclosed in PCT/GB2016/054028, and the present application is an extension of it, further chemistries providing alternative stabilizing peptides. is used.

Previously, Applicants have illustrated this by delivering ONs targeted to restore the gene that produces dystrophin. The use of ONs to target specific genes is of course known per se, as exemplified, for example, by WO2009/054725 and WO2010/123369. However, in these publications negatively charged scaffolds are used and cargo is delivered either directly or using complex formation.

PCT/GB2016/054028 describes staple and stitch peptides, i.e. two linked amino acids (staples) or three or more linked amino acids (stitches), amino acids such as olefins (alkenes) ) groups, which can be incorporated in defined relative positions during solid-phase peptide synthesis. For example, the peptide is then typically induced to adopt a stabilizing conformation, although the α-helix is not essential, one (a staple [denoted herein as StaP]) or On-resin ring-closing metathesis is used to close two or more (stitches [denoted herein as StiP]) all-hydrocarbon crosslinks. In StaP, depending on the stereochemical configuration, the non- It is preferred to use either one or both enantiomers of the natural amino acid. StiP employs additional non-natural olefin-containing α,α-disubstituted amino acids (B5 or B8). However, the cross-linking method is not limited to ring-closing metathesis of non-natural olefin-containing α,α-disubstituted amino acids. Other cross-linking chemistries, such as ring-closing metathesis between O-allyl serine analogues (S-OAS or R-OAS), can be used to stabilize peptides.

Additionally, ONs can be designed to hybridize to single- or double-stranded DNA or RNA molecules (or analogs thereof), such that the hybridized DNA or RNA molecules can be delivered to target cells. is assumed. These DNAs and RNAs can be either linear, branched, circularized, or in any stable conformation. These DNA and RNA may be synthetic, modified or natural molecules, such as circular DNA molecules produced during viral genome replication to produce episomes.

Peptide stabilization can be achieved by cross-linking during solid-phase synthesis amino acids incorporated at defined relative positions in the peptide sequence or by chemically modifying existing amino acids. Peptides of various lengths can be stabilized using cross-links of two specific amino acids (staples) or cross-links of three or more amino acids (stitching) 22,23 . Specifically incorporated amino acids usually have orthogonal functional groups that allow specific and efficient cross-linking reactions to occur on the resin or in solution after cleavage of the peptide. Examples of cross-linking reactions based on ring-closing metathesis resins of olefin-containing amino acids are disclosed in PCT/GB2016/054028.

The present invention introduces additional CPPs based on alternative stapling or stitching techniques that introduce cross-links or bridges between at least two amino acids that provide cyclization. These include, but are not limited to:
a) Incorporation or derivatization of amino acids with functional groups in a Huisgen 1,3 dipolar cycloaddition, typically azidridine and propargyl functional groups, eg α-propargylalanine. Typically, these reactions are performed by cyclization using copper- or ruthenium-based catalysts to 5-membered ring heterocycles such as 1,2,3 with each preferred substitution of either 1,4 or 1,5. A triazole can be obtained. In addition to azide and propargyl functionalities, even other substrates such as electron-deficient nitriles and/or diazoalkanes can be used24; and b) careful selection of protecting groups, e.g. during solid-phase synthesis. 25 of proteogenic amino acids for lactam formation by cyclizing lysine with glutamic acid or aspartic acid residues within the peptide using .

For those skilled in the art, staple CPPs can be developed based on other cyclization techniques. Utilizing a single method or a combination of staple cyclization based on several different bridging cyclization methods, either non-contiguous or contiguous along the peptide, using either single or multiple staples. CPPs can be formed in a distributed manner. Additionally, one of ordinary skill in the art can similarly form StiPs composed of one or more cyclization techniques, including, but not limited to, modular peptide moieties with different orthogonal cyclization chemistries.

The cell entry kinetics of existing linear CPA and StiP and StaP are different. While conventional CPPs enter cells via direct energy-independent plasma membrane translocation or via energy-dependent clathrin- and caveolin-mediated endocytosis, StiP and StaP enters via a mechanism that is energy-dependent but clathrin- and caveolin-independent22,26. Assuming that StiP and StaP uptake is inhibited with reduced cell decoration of heparin sulfate,22 a macropinocytotic entry mechanism is speculated,27 and this altered entry mechanism may be associated with enhanced cell It is suggested to allow uptake and biodistribution.

Compared to their unmodified peptide precursors, StaP and StiP are generally capable of supporting robust cellular uptake, marked resistance to proteolytic degradation and half-lives in non-human primates of over 12 hours in vivo. 28 showing stability. Such enhancements in the drug class likely result from stabilized structures and burial of backbone amide bonds, eg, in the α-helical core. This structural rigidity also reduces the potential for immunogenicity of StiP and StaP, as the design of the major histocompatibility complex requires the peptide to adopt an extended conformation for presentation. Let

The importance of stabilizing CPPs with engineered conformation should not be overlooked as the engineered conformation is in part responsible for the increased propensity for cellular uptake. The potential reduction or lack of membrane toxicity and immunogenicity enhances the clinical interpretability of these compounds when conjugated to drugs and BACs such as ONs.

BACs and CPPs can be directly covalently conjugated or covalently conjugated via BFL. Multiple functional groups can be used in conjugation reactions.

ONs can be used to induce steric blockade to any gene in humans, animals and lower organisms, thus reducing natural diseases in humans and animals (including hereditary and age-related diseases). Or it can be applied to acquired diseases. Furthermore, ONs, particularly when complexed to StaP or StiP CPPs, can also be used with the intention of hybridizing to DNA or RNA molecules (or analogues), eg, episomes, and facilitating their delivery.

As an example, viral hemorrhagic fever (VHF) is a disease of animal origin in which a protracted inflammatory cytokine response leads to progressive destruction of veins and arteries. Causes of VHF include Ebola and Marburg viruses and some arenaviruses; these diseases are currently considered incurable. Viral hemorrhagic fever is characterized by high fever and bleeding disorders and can result in death from shock and organ failure. AOs can be designed to target the 5' translation initiation site of viral gene transcripts to prevent binding of the translational machinery. Suppression of viral translation using AOs is a well-established technique,3 and has progressed into clinical trials for viral hemorrhagic fevers such as Marburg and Ebola.4,5 One PMO, AVI-7537, , was evaluated for human use during the 2014-15 Ebola outbreak in West Africa.

The use of AO has been employed with the intention of other RNA steric blocking strategies. AO alters RNA splicing and either excludes exons from the final processed mRNA (here, Duchenne muscular dystrophy is the lead indicator) or includes exons from the final processed mRNA (here, spinal cord muscle 1) where atrophy is the lead indicator) can be done. While both AOs reached FDA approval in 2016, systemic delivery of each AO remains a major obstacle.

Some tissues, such as the heart, are particularly resistant to naked PMO gene transfer, which may reflect different vesicle-mediated PMO uptake mechanisms 26 . In fact, direct intracardiac injection of naked PMO does not result in efficient gene transfer29 and resistant tissues tend to require repeated dosing or high dose regimens30-32. However, although CPP conjugation improves PMO biodistribution and serum stability,33-35 toxicity associated with these linear arginine-rich peptides remains a major obstacle to pipeline development. .

WO2016/187425 discloses AOs conjugated to peptides undergoing single cysteine arylation to form crosslinks, but no other techniques are disclosed. The cysteine arylation cross-linking technique is not a cyclization technique. This is because it introduces a rigid aromatic ring as a bridging moiety and is therefore not envisioned to have a stabilized conformation provided thereon. Apart from that, the structure is not stable after systemic administration due to the reduction of thiol bonds that would liberate cross-links. Furthermore, WO2016/187425 discloses only arginine-rich peptides. Therefore, considerable membrane toxicity concerns remain with this technique.

Nitrogen arylation has been developed as a cyclization technique 36 . While it is possible to conjugate such peptides to BACs, these peptides are not expected to form stabilizing structures and, importantly, are less invasive to cells than conventional linear peptides. 36.

For a valid clinical interpretation of sterically blocking AOs, CPPs should effectively deliver BACs to the cytoplasm or nucleoplasm while limiting any toxicity associated with cell entry.

Therefore, it would be highly desirable to provide DCCPMs or DTCPMs that can deliver drugs or BACs to target sites more efficiently or with less toxicity and immunogenicity.

According to a first aspect of the invention,
i. a biologically active compound (BAC);
ii. cell permeabilization agent (CPA), wherein BAC and CPA are linked directly or via a bifunctional linker (BFL); ) and CPA is a stabilizing peptide (CPP) by stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP) , is a stabilized peptide (CPP) having a conformation provided thereon, the StiP or StaP comprises a cross-link or bridge between at least two amino acids of the peptide, and the cross-link or bridge is formed by olefin metathesis A drug delivery cell permeation molecule (DCCPM) is provided that provides cyclization between at least two amino acids that are not formed.

Cyclization is direct, as opposed to by the introduction of another "bridging molecule" such as an aryl group, such as an aromatic ring or a perfluoroaryl group, where the staple or stitch is between sterically adjacent amino acids. means to be formed. This direct cyclization is
i. condensation of aldehydes or ketones with hydrazines or protected hydrazines;
ii. thiol-enemichael addition;
iii. disulfide formation;
iv. Huisgen 1,3 dipolar cycloaddition;
v. reactions between amines and carboxylic acids;
vi. singlet or triplet based carbene reactions; or vii. It can be accomplished by one or more of Suzuki or Sonogashira couplings.

A particularly preferred cyclization results from the chemistry of iv) and v).

Using iv), a five-membered heterocycle is formed between an azide and an electron-deficient nitrile- or propynyl-containing amino acid.

Using v), a lactam is formed between a free amine-containing amino acid and a carboxylic acid-containing amino acid.

StaPs can be formed, for example, by stapling together two conformationally adjacent amino acids, and StiPs can be formed, for example, by stitching at least three conformationally adjacent amino acids.

Stapling or stitching results in the formation of cross-links or bridges that provide cyclization between two conformationally adjacent amino acids of the peptide.

In PCT/GB2016/054028 a cross-link or cross-link comprises two components, a hydrocarbon cross-link and a terminal methyl group. Hydrocarbon bridges can consist of double hydrocarbon bonds or single hydrocarbon bonds.

The present invention is a cross-link or Crosslinking is disclosed.

The CPP preferably comprises at least two of the following: a non-natural amino acid, a proteinogenic amino acid or a modified proteinogenic amino acid with functional groups as exemplified in Table 1 below.

A preferred staple or stitch CPP incorporates one or more of the functional groups defined in Table 1 and the incorporated amino acid structure is as shown in FIG. In FIGS. 1, 2 and 3, X or X1 illustrates a functional group such as those in Table 1. R can be hydrogen or a moiety such as methyl or isobutyl designed to sterically constrain the geometry of the group from the α-carbon, or R can be X as defined in Table 1. or X1.

In PCT/GB Patent Application Publication No. 2016/054028, the CPP preferably comprises at least two unnatural amino acids (e.g. α-methyl, α-pentenylglycine) with all-hydrocarbon tethers, preferred staples or the stitch CPP is (S)-pentenylalanine (S5) or its enantiomer (R5), S-octenylalanine (S8) or its enantiomer (R8) or a combination thereof (e.g. R-octenyl Alanine/S-pentenylalanine (R8/S5) or S-octenylalanine/R-pentenylalanine (S8/R5)) are incorporated.

Alternative CPPs and methods of making them are disclosed in Chu et al, 2014 and the supplementary information associated therewith, incorporated by reference 22 .

The exemplified stabilizing peptides contain two or more orthogonal functional groups highlighted in Table 2 below, covalently attached by corresponding chemistries.

A stabilized conformation typically comprises at least one α-helix, an extended 3 _{10 -} helix or a poly (Pro) II helix. However, it may include, among other options, at least one turn (e.g., but not limited to α, β, γ, δ or π), several turns or α-helices to form β-sheets or hairpins, elongation It may contain a combination of one or more of ₃₁₀ helices or poly(Pro)II helices, turns, β-sheets or hairpins.

The formal charge of CPP is calculated at physiological pH (approximately 7.5) and is based on the pKa of the amino acid R group. These values (pKx) are presented in Table 3 below.

The CPPs typically used to date have a large number of positively charged residues. Reducing the amount of positively charged residues within an amino acid sequence while retaining the ability to cross biological membranes becomes more clinically important.

Therefore, it is possible to reduce the charge on the peptide sequence.

Preferred BACs are oligonucleotides (ON), even more preferably antisense oligonucleotides (AO). Various antisense oligonucleotide chemistries are exemplified in Table 4 below, where the use of low or neutral charge chemistries such as phosphorodiamidate morpholino oligonucleotides (PMOs) is preferred.

BACs can target and modify the expression of endogenous or exogenous genes. Endogenous gene targets include, but are not limited to, genes associated with neuromuscular disease, metabolic disease, cancer, age-related degenerative disease, and exogenous gene targets are those of acquired diseases such as viral infections. including.

While the BAC can be directly linked to the CPP (Fig. 4), Applicants have found that the use of the BFL is desirable. Exemplary, non-limiting BFL chemistries are illustrated in Table 5 below.

As a footnote to Table 5, the following should be noted.

Figures 5a and 5b and Figures 5c and 5d hereinafter highlight the general structure of DCCPM where the atoms or groups defined below are preferred, but are not limited thereto.

In the preferred embodiment illustrated in FIG. 5a, Y1=nitrogen, Y2=hydrogen, Y3=spacer such as (PEG)n (n=5) (not limited to those identified in Table 5), Z = sulfur-containing moieties, eg cysteine and L = BFL such as SMCC (Fig. 5b).

In other embodiments, variations of the structure shown in Figure 5b may be utilized. For example, if another embodiment does not require a thiol for conjugation of BFL to CPA as shown in Figure 5c, then Z = Y3 (where Y3 is a spacer in Table 5). For BFLs that do not require sulfur for conjugation of BAC and CPA (eg, but not limited to entries 9-11 in Table 5), Z=a (covalent bond between L and Y3).

In other embodiments, the use of a spacer, BFL, may not be required, in such cases a thiol group for the formation of DCCPM shown in FIG. 4 and then the following applies. For resins utilized in solid-phase synthesis of peptides, modification of rinkamide or rinkamide MBHA to 2-chlorotrityl resin yields peptides and free carboxylic acids are coupled via standard peptide coupling conditions. can receive a ring.

Orthogonal functional groups highlighted in Table 1 can also be used in bioconjugation reactions. These functional groups can be used to conjugate molecules to DCCPM in order to provide the DCCPM with desirable properties. These include, but are not limited to, acetyl, cholesterol, fatty acids, polyethylene glycols, polysaccharides, aminoglycans, glycolipids, phospholipids, polyphenols, nuclear localization signals, nuclear export signals, antibodies and targeting molecules. Become.

A preferred linker chemistry includes a cyclohexane spacer, namely 4-(N-maleimidomethyl)cyclohexane-1- An amine-sulfhydryl crosslinker with N-hydroxysuccinimide ester and maleimide reactive groups separated by succinimidyl carboxylate (SMCC) is used.

In a particularly preferred embodiment, the linker may incorporate polyethylene glycol in single or multiple units of (PEG)n, where n=1-10 PEG molecules.

In preferred embodiments of any of the above, a CPA, e.g. (Figure 7a), is optionally linked to the N-terminus of the peptide and terminated with a sulfur-containing molecule, e.g. medium, n=1-10) can be preferentially assembled and covalently linked to BFL (FIG. 7b). This allows further elongation of BFL with bifunctional reactive molecules such as (SMCC) (Fig. 7c). This is then covalently linked to a functional group on the BAC, in a preferred embodiment a primary amine, thus generating DCCPM (Fig. 7d).

Covalent attachment to the CPP may include, for example, but not limited to, β-alanine or any other suitable moiety that may include branched or dendrimer-like structures that allow conjugation of multiple BACs or CPPs for any skilled person. can be through

In any particular embodiment, the relative positions of the cross-linking amino acids are such that the C-terminus is the first amino acid designated position 1 and the subsequent amino acids are numbered in the N→C-terminal fashion. Referenced by their positioning within the array. Functionality descriptors are defined in Table 2. For example, the cross-link between a lysine residue (K) and a glutamic acid residue (E) within the conventional sequence RKF-[E-RLF-K] (SEQ ID NO: 7) is K1E5-8M (8M is 8mer amino acids) and the brackets within the sequence represent the cyclic portion of the peptide. Similarly, the sequence RKF-[S5-RLF-S5] (SEQ ID NO: 8) cross-linked between S5 monomers by ring-closing metathesis is referred to as RCM1,5-8M.

In any particular embodiment, the RKF-E-RLF-K sequence (SEQ ID NO: 9) is cyclized between a lysine and a glutamic acid residue, conventionally referred to as K1E5-8M-NC. It becomes the sequence of K1E5-8M that does not exist.

In any particular embodiment, when the relative spacing between cross-linking amino acids is decreased, for example, the sequence RKFR-[E-LF-K] (SEQ ID NO: 10) is designated K1E4-8M; When the relative spacing between linking amino acids increases, such RK-[E-FRLF-K] (SEQ ID NO: 11) is designated K1E6-8M.

Henceforth, when CPP contains the pegylated sequence RKF-[E-RLF-K] and BFL is SMCC, the resulting compound is called K1E5-CP8M (FIG. 7c).

According to a second aspect of the present invention, the uptake of a biologically active compound (BAC) into cells is achieved by forming or stitching stabilizing peptides, stapled peptides (StaP) . A method facilitated by the conjugation of a biologically active compound to a cell permeabilizing agent (CPA), a stabilizing peptide having a conformation provided thereon by forming a stitched peptide (StiP), comprising: The StiP or StaP comprises a cross-link or cross-link between at least two amino acids of the peptide, and the cross-link or cross-link forms a drug-carrying cell-permeable molecule (DCCPM), and said DCCPM in a suitable medium. Methods are provided for providing cyclization between at least two amino acids not formed by olefin metathesis, either directly or via a bifunctional linker (BFL), for presentation to cells.

In another embodiment of any of the above CPA's, eg (Figure 8a), (PEG)n is linked to the N-terminus of the peptide and terminated with hydrazinylnicotinic acid ( HNA ) (Figure 8b). This allows conjugation of BFL to appropriately modified BAC, where the BAC is terminated with an aromatic aldehyde, preferentially 4-formylbenzoic acid (Fig. 8c). This is then covalently linked to a functional group on the BAC to form DCCPM (Fig. 8d).

When CPP contains the sequence RKF-[E-RLF-K] and BFL is PEGylated hydrazinylnicotinic acid (HNA), the resulting compound is designated K1E5 -HP8M (FIG. 8b).

If the CPP contains the sequence RKF-[E-RLF-K] and the BFL is SMCC without pegylation, the resulting compound is designated K1E5-C8M (FIG. 6d).

In any particular embodiment, CPPs resulting from lysine cyclization with glutamate or aspartate residues can be directly conjugated to BACs, such as AOs (FIG. 9).

In any particular embodiment, the method of forming a cross-link between two amino acids, modified amino acids or unnatural amino acids, can be, but is not limited to, any functional group defined in Table 1.

In another preferred embodiment, the orthogonal functional groups used to form cross-links are incorporated azide and alkyne residues.

Specifically, for cross-linking using azides and alkynes, the residues to be incorporated are (S)-N-Fmoc-2-(2'-propynyl)alanine with alkynes and (2S)-N- with azides. Fmoc-6-azido-hexanoic acid.

In the case of incompatible synthesis of modified amino acids or unfavorable cleavage conditions, some residues are converted in situ, for example by treatment of lysine with N-diazo-1,1,1-trifluoromethanesulfonamide (TfN3) to form an azide. Functional groups are provided or the use of diazide molecules such as 1,3-benzenedicarbonyldiazide or similar substituted diazides to bridge between two propargyl bearing amino acids.

In any particular embodiment, the relative positions of the cross-linking amino acids are referenced by their positioning within the sequence and functional descriptors are used and defined in Table 1. For example, (2S)-N-Fmoc-6-azido-hexanoic acid (abbreviated as K(N3)) and (S)-N-Fmoc in the sequence RKF-[K(N3)-RLF-B] -2-(2′-propynyl)alanine (abbreviated as B) will be referred to as B1K(N3)5-8M (brackets within the sequence indicate the cyclic portion of the peptide ).

In any particular embodiment, the sequence of RKF-K(N3)-RLF-B becomes the sequence of B1K(N3)5-8M that is not cyclized between the azidridine and propylgyl residues. , hereinafter will be referred to as B1K(N3)5-8M-NC.

In any particular embodiment, if the relative spacing between amino acids is altered, this is referred to as B1K(N3)4-8M when reduced (sequence RKFR-[K(N3)- LF-B], etc.) (SEQ ID NO: 12) or B1(KN3)6-8M when increased (RK-[K(N3)-FRLF-B], etc. (SEQ ID NO: 13)).

Hereafter, when CPP contains the sequence RKF-[K(N3)-RLF-B] (SEQ ID NO: 2) and BFL is PEGylated SMCC, the resulting compound is referred to as B1K(N3)5-CP8M. (Fig. 10c).

When CPP contains the sequence RKF-[K(N3) -RLF -B] and BFL is PEGylated hydrazinylnicotinic acid (HNA), the resulting compound is designated 1(KN3)5-HP8M. (Fig. 11b).

If the CPP contains the sequence RKF-[K(N3)-RLF-B] and the BFL is SMCC without pegylation, the resulting compound is called B1K(N3)5-C8M.

As highlighted in Figure 5d, StaP or StiP complexed ONs (either in the presence or absence of BFL) may constitute delivery vehicles for other BACs. ONs can hybridize to or associate with BACs containing DNA, RNA or protein molecules. The resulting molecule is termed a drug-targeted cell permeation molecule (DTCPM). Remarkably, DTCPM is a circular DNA or RNA that is naturally produced during viral genome replication, particularly when no viral packaging signal is provided and the viral genome is packaged to form mature infectious viral particles. It can hybridize to molecules (episomes) or linear DNA or RNA molecules.

According to a third aspect of the invention there is provided a DCCPM or DTCPM of the first aspect of the invention for use in the treatment of diseases requiring alteration of the expression of endogenous or exogenous genes.

DCCPM can be used, for example, in the treatment of neuromuscular diseases, metabolic diseases, cancer, age-related degenerative diseases or to treat acquired infections.

DTCPM can be used, for example, in the treatment of neuromuscular diseases, metabolic diseases, cancer, age-related degenerative diseases or to treat acquired infections.

In one embodiment, DCCPM is used in the treatment of muscular dystrophy, such as Duchenne muscular dystrophy (DMD), although those skilled in the art will readily appreciate that the present invention can be used to target a wide range of genes. deaf.

For DMD, the DCCPM may include AONs targeting exon 51 of the dystrophin gene.

According to a fourth aspect of the present invention, a method of improving the bioavailability of a drug or BAC, wherein the drug or BAC is treated with a stabilizing peptide, a stapled peptide (StaP) linking to a CPP, a stabilizing peptide having a conformation provided thereon, by forming or stitching a stitched peptide (StiP), wherein the StiP or StaP is A method is provided comprising a cross-link or bridge between at least two amino acids of the peptide, and wherein the cross-link or bridge provides cyclization between the at least two amino acids not formed by olefin metathesis.

Shapes imposed by stabilization may produce structures with free energy minimized conformations.

According to a fifth aspect of the present invention, a method of introducing a drug or BAC to a site that is refractory to the drug or BAC in its native state, wherein the drug or BAC is stabilized stapling to form a stapled peptide (StaP) or stitching to form a stitched peptide (StiP) to stabilize a peptide having a conformation thereon; A method is provided that includes linking to a CPP that is a peptide. A StiP or StaP contains a cross-link or bridge between at least two amino acids of the peptide, and the cross-link or bridge provides a cyclization not formed by olefin metathesis, which is administered to the subject.

The DCCPM of the present invention can be used to administer drugs or BACs to target tissues such as heart, brain or muscle.

According to a sixth aspect of the invention, there is provided a method of treating a subject to alter the expression of an endogenous or exogenous gene comprising administering to the subject the DCCPM or DTCPM of the invention. be.

According to a seventh aspect of the present invention, DCCPM or DTCPM of the present invention and one or more pharmaceutical agents that allow the composition to be administered orally, parenterally, intravenously or topically. A composition is provided comprising a pharmaceutically acceptable excipient.

Embodiments of the present invention are further described below with reference to the attached drawings.

Examples of uncyclized CPPs (left) and some of the resulting stabilized structures that can be formed therefrom (right) are illustrated. Examples of uncyclized CPPs (left) and some of the resulting stabilized structures that can be formed therefrom (right) are illustrated. Examples of uncyclized CPPs (left) and some of the resulting stabilized structures that can be formed therefrom (right) are illustrated. Illustrates an example of a stitched CPA: Figure 2a is formed by cyclizing two sets of orthogonal amino acids placed consecutively within a peptide sequence. Illustrating Examples of Stitched CPA: FIG. 2b illustrates a stitched CPA formed by cyclizing two different sets of orthogonal amino acids that are not arranged consecutively within the peptide sequence. Illustrates an example of a stitched CPA: Figure 2c illustrates a stitched CPA where the two sets of amino acids to be cross-linked are derived from one amino acid. Illustrates an example of a stitched CPA: Figure 2d illustrates two alternative amino acid sets derived from one amino acid that can be cross-linked to form a continuous stitched CPA. 1 illustrates structures of amino acids that can be incorporated into CPPs with different functional groups as defined in Table 1. FIG. The functional groups represented by X and X1 are cross-linkable to form a CPA and can be used in bioconjugation. FIG. 4 illustrates direct conjugation of stabilized CPP to BAC without the use of BFL. The connectivity of BFL and the overall structure of DCCPM and DTCPM are illustrated. Schematic diagram of DCCPM illustrating binding of BFL in non-limiting examples from Table 5 when BAC is antisense oligonucleotide (AO) or oligonucleotide (ON). The connectivity of BFL and the overall structure of DCCPM and DTCPM are illustrated. BFL in non-limiting examples from Table 5 when BAC is AO or ON and CPA is stabilized by either 1,4- or 1,5-substituted 1,2,3 triazoles Schematic of a DCCPM illustrating connectivity. The connectivity of BFL and the overall structure of DCCPM and DTCPM are illustrated. BFL in non-limiting examples from Table 5 when BAC is AO or ON and CPA is stabilized by either 1,4- or 1,5-substituted 1,2,3 triazoles Schematic of a DCCPM illustrating connectivity. The connectivity of BFL and the overall structure of DCCPM and DTCPM are illustrated. Schematic representation of DTCPM illustrating the binding of BFL in non-limiting examples from Table 5 when oligonucleotides form part of the delivery molecule; as a non-limiting list of BACs delivered by this technique. , DNA, RNA or protein molecules (in effect, the ON is part of the BFL and connects to the BAC). Figure 3 illustrates some preferred embodiments of DCCPMs incorporating different BFLs; 1 is a general schematic of a DCCPM illustrating, but not limited to, connectivity of BFLs as defined in Table 5. FIG. Figure 3 illustrates some preferred embodiments of DCCPMs incorporating different BFLs; Incorporated PEG5 terminated with a thiol-containing molecule (cysteine) and conjugated to BAC using the heterobifunctional protein crosslinker succinimidyl-4-[N-maleimidomethyl]cyclohexane-1-carboxylic acid (SMCC) 1 is a schematic diagram illustrating a preferred embodiment of a DCCPM having a lactam-stabilized CPP with . Figure 3 illustrates some preferred embodiments of DCCPMs incorporating different BFLs; FIG. 4 illustrates a preferred embodiment of DCCPM having a lactam-stabilized CPP with incorporated PEG5 conjugated to a BAC terminated with hydrazinylnicotinic acid (HNA) and then modified with 4-formylbenzoic acid. 1 is a schematic diagram; FIG. Figure 3 illustrates some preferred embodiments of DCCPMs incorporating different BFLs; Lactam-stabilized CPP terminated with a thiol-containing molecule (cysteine) and conjugated to a BAC using the heterobifunctional protein crosslinker succinimidyl-4-[N-maleimidomethyl]cyclohexane-1-carboxylic acid (SMCC) 1 is a schematic diagram illustrating a preferred embodiment of a DCCPM with Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. Schematic representation of a CPP stabilized by cyclization between two proteinogenic amino acids to form a lactam. Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. Incorporation of PEG5 at the N-terminus of CPA and its termination with a thiol-containing molecule (cysteine) is illustrated. Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. Illustrates the incorporation of the heterobifunctional linker SMCC into DCCPM. Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. Incorporated, terminated with a thiol-containing molecule (cysteine) and then conjugated to the BAC using the heterobifunctional protein crosslinker succinimidyl-4-[N-maleimidomethyl]cyclohexane-1-carboxylic acid (SMCC) FIG. 4 is a schematic diagram illustrating a preferred embodiment of DCCPM with KE stabilized CPP with PEG5. Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. Schematic representation of a CPP stabilized by cyclization between two proteinogenic amino acids to form a lactam. Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. FIG. 4 is a schematic diagram illustrating a preferred embodiment of a DCCPM having a lactam-stabilized CPP with incorporated PEG5 terminated with hydrazinylnicotinic acid (HNA) and then conjugated to a 4-formylbenzoic acid-modified BAC. Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. Schematic representation of 4-formylbenzoic acid modified BACs. Some preferred embodiments of DCCPMs incorporating stabilized CPPs by cross-linking lysine and glutamic acid residues to form a lactam are illustrated. FIG. 4 illustrates a preferred embodiment of DCCPM having a lactam-stabilized CPP with incorporated PEG5 conjugated to a BAC terminated with hydrazinylnicotinic acid (HNA) and then modified with 4-formylbenzoic acid. 1 is a schematic diagram; FIG. 1 is a schematic diagram illustrating a preferred embodiment of a lactam-containing CPP directly conjugated to a BAC. FIG. FIG. 4 is a schematic diagram illustrating the conjugation of 1,4-substituted triazole-stabilized CPPs to BACs to form preferred embodiments of DCCPM. Schematic representation of CPPs stabilized with 1,4-substituted triazoles. FIG. 4 is a schematic diagram illustrating the conjugation of 1,4-substituted triazole-stabilized CPPs to BACs to form preferred embodiments of DCCPM. Schematic representation of a 1,4-substituted triazole-stabilized CPP with incorporated PEG5 and terminated with a thiol-containing molecule (cysteine). FIG. 4 is a schematic diagram illustrating the conjugation of 1,4-substituted triazole-stabilized CPPs to BACs to form preferred embodiments of DCCPM. Schematic representation of 1,4-substituted triazole-stabilized CPPs, illustrating the incorporation of the heterobifunctional protein crosslinker succinimidyl-4-[N-maleimidomethyl]cyclohexane-1-carboxylic acid (SMCC). FIG. 4 is a schematic diagram illustrating the conjugation of 1,4-substituted triazole-stabilized CPPs to BACs to form preferred embodiments of DCCPM. 1 is a schematic diagram illustrating a CPP stabilized with a 1,4-substituted triazole as part of a DCCPM. FIG. It should be noted that the 1,2,3 triazoles may have other isomers, eg 1,5 substituted triazoles. Illustrates the binding properties of CPPs containing 1,4-substituted triazoles. Schematic diagram illustrating a preferred embodiment of a DCCPM having a triazole-stabilized CPP with incorporated PEG5 terminated with hydrazinylnicotinic acid (HNA) and then conjugated to a 4-formylbenzoic acid-modified BAC. be. Schematic representation of 4-formylbenzoic acid modified BACs. DCCPM with 1,4-substituted triazole-stabilized CPP with incorporated PEG5 conjugated to BAC terminated with hydrazinylnicotinic acid (HNA) and then modified with 4-formylbenzoic acid 1 is a schematic diagram illustrating a preferred embodiment of the FIG. Circular dichroism spectra of FITC-K1E4-CP8M, FITC-K1E5-CP8M and FITC-K1E6-CP8M blanked in D2O and collected in triplicate at room temperature. FITC-K1E4-CP8M and FITC-K1E5-CP8M exhibit random coils and FITC-K1E6-CP8M exhibit alpha helicity. Circular dichroism spectra of K1E4-CP8M, K1E5-CP8M and K1E6-CP8M blanked in D2O and collected in triplicate at room temperature. K1E5 exhibits a random coil, while K1E4 and K1E6 exhibit an elongated Pi helix. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. Comparison of HeLa pLuc 705 cells incubated with FL1+ cells K1E4-P8M-FITC or K1E4-P8M-FITC-NC for 4 hours. n=4, error bars indicate standard deviation, two-way ANOVA was performed and no interaction effects were shown. The data illustrate that there was no significant difference in the number of FL1 positive cells when K1E4-P8M-FITC was cyclized. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. Comparison of HeLa pLuc 705 cells incubated with FL1+ cells K1E5-P8M-FITC or K1E5-P8M-FITC-NC for 4 hours. n=4, error bars indicate standard deviation, two-way ANOVA was performed and no interaction effects were shown. The data illustrate that there was no significant difference in the number of FL1 positive cells when K1E5-P8M-FITC was cyclized. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. Comparison of HeLa pLuc 705 cells incubated with FL1+ cells K1E6-P8M-FITC or K1E6-P8M-FITC-NC for 4 hours. n=4, error bars indicate standard deviation, two-way ANOVA was performed. * represents p<0.05 and ** represents p<0.001. The data illustrate that there is a significant increase in the number of FL1 positive cells at a given concentration when K1E6-P8M-FITC is cyclized. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. Comparison of MFI of HeLa pLuc 705 cells incubated with K1E4-P8M-FITC or K1E4-P8M-FITC-NC for 4 hours. n=4, error bars indicate standard deviation. A two-way ANOVA was performed and no interaction effect was shown. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. Comparison of MFI of HeLa pLuc 705 cells incubated with K1E5-P8M-FITC or K1E5-P8M-FITC-NC for 4 hours. n=4, error bars indicate standard deviation. A two-way ANOVA was performed and no interaction effect was shown. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. Comparison of MFI of HeLa pLuc 705 cells incubated with K1E6-P8M-FITC or K1E6-P8M-FITC-NC for 4 hours. n=4, error bars indicate standard deviation. A two-way analysis of variance was performed. * represents p<0.05. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. (i) K1E4-P8M-FITC vs. K1E4-P8M-FITC-NC, (ii) K1E5-P8M-FITC vs. K1E5-P8M-FITC-NC, and (iii) K1E6-P8M-FITC vs. K1E4-P8M-FITC- Percent viable cell comparison as judged by gated cells compared to negative control of HeLa pLuc 705 cells incubated with NC for 4 hours. n=4, error bars indicate standard deviation. Data show no significant difference in % cells recovered when normalized to untreated controls. Photomicrographs of PC3-705 cells treated with PMO conjugated to either K1E4, K1E5 or K1E6 CP8M. Cells were treated without transfection reagent for 4 hours and then images were acquired. Images were acquired using either a brightfield objective or an epifluorescence microscope to show FITC-labeled PMOs. Images were then merged to show cellular localization. It is evident that the intracellular PMO signal is significant in PC3-705 cells treated with PMO conjugated to either K1E4, K1E5 or K1E6 CP8M alone. Uncomplexed PMOs do not generate intracellular signals. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. FL1+ cells HeLa incubated with RCM1,5-P8M-FITC-3+, RCM1,5-P8M-FITC-2+, RCM1,5-P8M-FITC-1+, RCM1,5-P8M-FITC-0+ for 4 hours Comparison with pLuc 705 cells. n=5, error bars indicate standard deviation, * represents p<0.05, ** represents p<0.001. *a represents interactions between RCM1,5-P8M-FITC-1+ and all other groups, *b between RCM1,5-P8M-FITC-0+ and all other groups represents the interaction of The data show that RCM1,5-P8M-FITC-1+ has a significant reduction in FL1+ cells over various concentrations compared to other treatments. RCM1,5-P8M-FITC-0+ shows an increase in the number of FL1+ cells across various concentrations compared to other treatments. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. of HeLa pLuc 705 cells incubated for 4 hours with RCM1,5-P8M-FITC-3+, RCM1,5-P8M-FITC-2+, RCM1,5-P8M-FITC-1+, RCM1,5-P8M-FITC-0+ It is a comparison of MFI. n=5, error bars indicate standard deviation. * represents p<0.05 and ** represents p<0.001. There is no significant difference in MFI between given concentrations of RCM,1,5-P8M-FITC-0+, 1+ and 2+. However, RCM1,5-P8M-FITC-3+ shows an increase in MFI at higher concentrations >1 μM. Flow cytometry data in HeLa pLuc 705 cells incubated in the presence of FITC-labeled CPA. RCM1,5-P8M-FITC-3+[RKF(S5RLFS5)], RCM1,5-P8M-FITC-2+[RIF(S5RLFS5)], RCM1,5-P8M-FITC-1+[IIF(S5RLFS5)], RCM1, Percent live cell comparison as judged by gating cells compared to negative control of HeLa pLuc 705 cells incubated with 5-P8M-FITC-0+[IIF(S5ILFS5)] for 4 hours. n=3, error bars indicate standard deviation. * represents p<0.05. *a represents the difference between RCM1,5-P8M-FITC-3+ and RCM1,5-P8M-FITC-2+ *b represents RCM1,5-P8M-FITC-2+ and RCM1,5-P8M -FITC-0+, *c represents the difference between RCM1,5-P8M-FITC-0+ and RCM1,5-P8M-FITC-3+. The data show a significant decrease in the number of viable cells recovered when comparing RCM1,5-CP8M-FITC-3+ to RCM1,5-CP8M-FITC-2+ and RCM1,5-CP8M- Shown is the increase in the number of cells when comparing FITC-2+ to RCM1,5-CP8M-FITC-0+. Similarly, at 33 μM, comparing RCM1,5-CP8M-FITC-3+ with RCM1,5-CP8M-FITC-2+ and RCM1,5-CP8M-FITC-0+ showed a decrease in % viable cells. At all other concentrations, no other significant effects were observed other than 0.05 μM. RCM1,5-CP8M-FITC-0+ at 0.05 μM showed an increase in viable cells over RCM1,5-CP8M-FITC-3+ and RCM1,5-CP8M-FITC-2. FIG. 11 illustrates % cell viability of HeLa pLuc 705 cells compared to treatment with RCM1,5-P8M-3+-FITC to K1E5-P8M-FITC for 4 hours. n=3-4, error bars indicate standard deviation. * represents p<0.001. An increase in viability was observed at all concentrations when comparing K1E5-P8M-FITC to RCM1,5-P8M-FITC-3+.

The present invention uses different staples (as opposed to those disclosed in Applicant's earlier application PCT/GB2016/054028) to create drug-carrying cell-permeable molecules (DCCPMs). We show that ring and stitching chemistries can be used and that these stabilizing peptides can confer different and potentially beneficial effects, such as lower toxicity.

To demonstrate cellular uptake, an exemplary drug-carrying cell-permeable molecule (DCCPM) was made with FITC labeling.

An exemplary DCCPM is
i) a biologically active compound (BAC);
ii) a cell penetrating agent (CPA) which is a stabilizing peptide;
iii) a bifunctional linker (BFL).

The three components forming the DCCPM are more specifically described below, and a particularly preferred embodiment is illustrated by referring to Figures 7a-d and 8a-d.

1. Biologically Active Compounds A biologically active compound is any compound that can exert a biological effect in living cells. Preferably, but not essentially, the BAC affects expression of one or more endogenous or exogenous genes. Examples include nucleic acids, DNAzymes, ribozymes, aptamers and pharmaceuticals. Preferred bioactive compounds for use in the present invention are electrically neutral oligonucleotides (physiological pH is about 7.5 and contains a charge of -1 to +1).

ii) protein translation; or iii) other nucleic acid:nucleic acid or nucleic acid:protein interactions that alter gene expression of endogenous or exogenous (pathogen-derived) genes. It can be used as a steric blocking compound to enhance.

Hybridization of ONs to specific RNA sequence motifs prevents correct assembly of spliceosomes, thereby failing to recognize target exons in pre-mRNAs and thus inhibiting these exons in mature gene transcripts. is removed. Removal of in-frame exons can lead to gene products that are truncated and functional; A decrease in gene expression levels results.

In addition, ONs can be designed to target the 5' translation initiation site of endogenous or viral gene transcripts to prevent binding of the translational machinery. The use of AOs to suppress viral translation is a well-established technique, progressing into clinical trials against viral hemorrhagic fevers such as Marburg and Ebola.

ONs can also be designed to target the 3' untranslated region of endogenous transcripts to alter nuclear export, translation and stability of the transcript. Such targets include, but are not limited to, transcript polyadenylation and/or cleavage sites.

ONs can also be designed to form aptamers whose secondary and tertiary structures can bind proteins or other cellular targets, thereby affecting specific gene expression levels.

Non-limiting examples of ON chemistries are illustrated in Table 4.

In an illustrative non-limiting example, the target is exon 51 of the dystrophin gene and has the sequence:
SEQ ID NO: 1: 5'CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3'
including.

2. Cell-permeabilizing agents (CPAs), which are stabilizing peptides
The cell-penetrating agents of the invention are stabilizing peptides.

The peptide is stabilized by cross-linking two amino acids, such as modified or unnatural amino acids, to form a staple peptide (StaP) or by cross-linking three or more residues to form a stitch peptide (StiP). can be

Cross-linking by stapling and stitching may have certain properties such as solvating conformations such as, but not limited to, alpha helices, extended ₃₁₀ helices or poly(Pro)II helices, turns (e.g., limited to but not α, β, γ, δ or π), several turns or α-helices to form β-sheets or hairpins, extended 3 ₁₀ -helices or poly(Pro)II helices, turns or β-sheets Combinations of one or more may impart an energy-dependent conformational bias to the solvating environment, such as interaction with the plasma membrane, cell permeability, and biological activity.

Non-limiting examples of alternative chemistries to those described in PCT/GB Patent Application Publication No. 2016/054028 for making StaP and StiP are illustrated in Table 6, illustrated by X, and the limitations are not defined, but are under determination for the functional groups defined in Table 1, peptide sequences with nominal positions for cross-linking by amino acids, such as modified amino acids or unnatural amino acids.

Peptide stabilization, such as stitching or stapling, can be accomplished by various means depending on the functional groups incorporated into the peptide. Non-limiting examples of functional groups are shown in Table 2. Some reactions require a catalyst or have preferential reagents for stabilization and are exemplified in Table 6 below.

All peptide components (amino acids, unnatural amino acids, non-staple/non-stitch, partial staple/stitch and staple/stitch peptides) may exist in particular geometric or stereoisomeric forms. All compounds include cis and trans isomers, (R)- and (S)-enantiomers, diastereoisomers and racemic mixtures thereof.

Preferred isomers/enantiomers will be enriched to give a higher proportion of one specific isomer or enantiomer. The embodiments may consist of greater than 90%, 95%, 98% or 99% of the preferred isomer/enantiomer by weight.

Non-limiting examples of unnatural amino acids used to stabilize peptide structure are illustrated in Table 1.

In PCT/GB Patent Application Publication No. 2016/054028 Applicants used α,α-disubstituted unnatural amino acids with all-hydrocarbon tethers (e.g. α-methyl, α-pentenylglycine) .

In the present invention, Applicants alternatively utilize the chemistry disclosed in Table 6.

In one preferred embodiment, the cross-link is formed by coupling two naturally occurring amino acids (eg, lysine and glutamic acid) in the sequence RKF-[E-RLF-K] (SEQ ID NO:4). Alternatively, these naturally occurring amino acids can be lysine and aspartic acid.

In yet another embodiment, Applicants have used a modified natural amino acid (N6-diazolysine) and an unnatural amino acid (S)-2-amino-2-methyl-4-pentynoic acid, such as the sequence RKF-[K(N3). -RLF-B] (SEQ ID NO: 2), where B represents (S)-2-amino-2-methyl-4-pentynoic acid and K(N3) represents N6-diazolysine. Use cross-links between

In one embodiment, the cell penetrating agent has a staple or stitch peptide comprising the sequence RFK-X-RLF-X (SEQ ID NO:3), where X represents a cross-linkable amino acid.

In another embodiment, the sequence RFK-[X-RLF-X] (SEQ ID NO:4) is a moved bridging residue, such as, but not limited to, RF-[X-KRLF-X] (SEQ ID NO:5) or RFKR-[X-LF-X] (SEQ ID NO: 6).

In another embodiment, the peptide is a branched staple peptide. Branched staple peptides consist of two or more chains of peptides. Branched peptides may be formed using any method known in the art, and in one embodiment a lysine residue is used to branch the two peptide chains.

Functional derivatives of the disclosed peptide sequences can be used. Functional derivatives may have representative fragments or homologues or peptides containing insertions into the original peptide. A typical derivative will have 70%, 80%, 90% or more of the original peptide sequence, and may have up to 200% of the number of amino acids of the original peptide. Derivatives will be used if they enhance the delivery of the biologically active compound.

The peptide sequence may contain modified amino acids (Table 1) to contain functional groups that allow the addition of other moieties. Non-limiting examples of such moieties include acetyl, cholesterol, fatty acids, polyethylene glycols, polysaccharides, aminoglycans, glycolipids, phospholipids, polyphenols, nuclear localization signals, nuclear export signals, antibodies and targeting molecules.

3. Bifunctional Linkers A bifunctional linker can be used to link the BAC to the CPA.

A preferred linker will, for example, connect between an amine group on the BAC and a sulfhydryl (thiol) group (usually a cysteine residue) on the CPA terminus. Examples of substrates to accomplish this include, but are not limited to, SMCC (4-(N-maleimidomethyl)cyclohexane-1-carboxylate succinimidyl), AMAS (N-α -maleimidoacetoxy-oxysuccinimide ester), BMPS (N-β-maleimidopropyl-oxysuccinimide ester), GMBS (N-γ-aleimidobutyryl-oxysuccinimide ester), DMVS (N-δ-maleimidovaleryl-oxy succinimide ester), EMCS (N-ε-maleimidocaproyl-oxysuccinimide ester) and LC-SMCC (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproic acid)).

Another preferred linker system is hydrazinylnicotinic acid ( HNA ), but when the BAC is a PMO, the PMO is modified to incorporate 4-formylbenzoic acid.

Other linkers such as DSG (disuccinimidyl glutarate) and DSCDS (disuccinimidyl-cyclohexyl-1,4-diester) contain the ability to link the 5′-amino group of BAC to the N-terminus of CPA. (Table 5, entries 9 and 10).

The linker may contain other elements that impart desirable properties to the DCCPM, such as a spacer between ON and CPA or elements that will enhance solubility, such as PEGylation sequences. Non-limiting examples are shown in Table 5.

A bioactive compound is covalently attached to the chimeric cell delivery peptide. Moreover, this can be done using any method known in the art. Preferably, the cell delivery peptide is attached to the bioactive compound using a disulfide bridge or a thiolmaleimide linker such as SMCC; the attachment may employ an amide linker or an oxime linker or a thioether linker.

RNA in the Treatment of Duchenne Muscular Dystrophy (DMD) PMO CP8M and PMO HP8M are provided in PCT/GB2016/054028, which serve as comparative controls for the alternative chemistries described herein. DCCPM to enhance steric blockade of
Introduction Duchenne muscular dystrophy (DMD) is the most common hereditary fatal childhood disease worldwide, with a global incidence of approximately 1 in 4000 births37. This severe muscle-wasting disorder is caused in most families by genetic mutations that lead to disruption of the reading frame and premature truncation of the protein dystrophin38,39.

RNA splicing suppression of DMD transcripts holds particular promise. Hybridization of AO to specific RNA sequence motifs prevents correct assembly of spliceosomes, thereby failing to recognize target exons in pre-mRNAs and thus removing them in mature gene transcripts. be done. AO-mediated RNA splicing repression leading to re-expression of a dystrophin protein that is functional when cleaved has been demonstrated in vitro in a preclinical mdx mouse model 32,40-45 and has led to clinical development programs. rice field. 2,10

Although intravenously administered PMO has shown a dose-dependent increase in dystrophin re-expression, with some functional benefit,2,46 restoration of skeletal muscle dystrophin has been observed among patients after many multiple doses. still highly variable. Importantly, many other target tissues (eg, brain and heart) remain resistant to PMO gene transfer even when repeated doses or high-dose procedures are used30-32.

To date, conjugates of unmodified CPA have improved the biodistribution and serum stability of PMOs33-35, but toxicity remains a major obstacle to pipeline development20.

Applicants have found that stabilized, e.g., StaP (or StiP)-based CPA conjugated to PMOs known to cause RNA splicing repression of DMD transcripts is effective in tissue resistant to naked PMOs. We hypothesized that this would result in higher levels of dystrophin recovery and re-expression of dystrophin without the potential for CPA-related toxicity. We provide forward data demonstrating that the novel CPAs have attractive biological and toxicological properties such that these novel DCCPMs or DTCPMs are clinically important.

Materials and Methods General Peptide Synthesis Procedure For peptides in ring-closing metathesis, all peptides were synthesized according to established protocols using standard Fmoc peptide chemistry on Rinkamide MBHA resin. The coupling reaction was carried out by adding a mixture of 10 equivalents of amino acid in NMP, 9.9 equivalents of HCTU and 20 equivalents of DIPEA (equivalents to the initial load of Rinkamide MBHA resin). The reaction was allowed to proceed for at least 1 hour. Coupling of unnatural amino acids (R/S5, R/S8 or B5) was performed with 4 equivalents of amino acids in NMP, 3.9 equivalents of HCTU and 10 equivalents of DIPEA for 2 hours. did. The ring-closing metathesis reaction of olefin-containing unnatural amino acids was performed using Grubbs I catalyst (benzylidene-bis(tricyclohexylphosphine)-dichlororuthenium) dissolved in 1,2-dichloroethane (DCE) to about 10 mg/mL for 2 hours under nitrogen bubbling. ). Excess catalyst was then washed from the DCE-resin and then coupled to the N-terminal FITC. Upon completion, the peptide was simultaneously cleaved from the resin and deprotected using a cleavage cocktail containing 95% TFA, 2.5% TIS and 2.5% water. Crude peptides were dissolved in 50% acetonitrile/water, passed through a 0.2 μm syringe filter, and purified by reverse-phase HPLC using a C-18 column (Agilent, Palo Alto, Calif.). Compound identity and purity were assessed using LC/MS coupling (Agilent, Palo Alto, Calif.). Purified fractions were pooled, evaporated to remove acetonitrile, followed by TFA by Speedvac, then lyophilized to dryness. A non-cycling peptide was also generated as a control.

All peptides were synthesized according to established protocols using standard Fmoc peptide chemistry on Rinkamide MBHA resin or 2-chlorotrityl resin for free acid variants. The coupling reaction was carried out by adding a mixture of 10 equivalents of amino acid in NMP, 9.9 equivalents of HCTU and 20 equivalents of DIPEA (equivalents to the initial load of Rinkamide MBHA resin). The reaction was allowed to proceed for at least 1 hour.

Synthesis of Peptides with Modified and Unnatural Amino Acids Temporary deprotection of the Fmoc group was performed by two 20 minute treatments of the resin-bound peptide with 20% (v/v) piperidine in DMF. After extensive flow washing with DMF, coupling of each consecutive amino acid was performed by a single 30 minute incubation with the appropriate preactivated NR-Fmoc amino acid derivative. All protected amino acids (1 mmol) were dissolved in cartridges with 3.8 mL of 0.25 M DEPBT in DMF as part of the synthesizer program just prior to delivery to the reaction vessel. 1 mL of DIEA was then added directly to the cartridge, causing up to 2 minutes of activation before introduction of the coupling solution to the NR-deprotected resin-bound peptide. After completion of the coupling, the resin was thoroughly flow washed in preparation for the next deprotection/coupling cycle.

Synthesis on Lactam-Containing Amino Acids (eg K1E5) Side-chain protections of glutamic acid and lysine were composed of Fm and Fmoc groups, respectively. After acetylation of the amino terminus with Ac2O/NMM (2 mmol, respectively, 114 and 189 μL, respectively) in a manner analogous to any other NR-Boc-amino acid, the Fmoc and Fm side chain protecting groups were removed with 20% piperidine. The resin-bound peptide was washed with DMF and then treated with 1.9 mM HBTU (3.8 mL x 0.5 M in DMF) and 1.9 mM DIEA for 2 hours, resulting in lactam formation.

Selective Transformation of Lysine to N6-Diazolysine Target lysine residues for transformation are protected with Mtt protecting groups, where they are protected with Boc protecting groups like other lysine residues not requiring transformation. . The sequence RK(Boc)FK(Mtt)-RLF-B of this example, where B is the incorporated unnatural amino acid (S)-N-Fmoc-2-(2'-propynyl)alanine ) (0.31 mmol/g, 300 mg) was suspended in a 1% TFA solution in DCM (10 mL) and stirred for 3 min. The solution instantly turns yellow. The resin was then washed with DCM (2x), MeOH (1x) and DCM (2x). The process was repeated 8 times until the solution remained colorless. The resin-bound peptide was carried on to the next step without further manipulation. Triflic anhydride (Tf2O, 316 μL, 1.87 mmol) was dissolved in a vigorously stirred mixture of NaN3 (600 mg, 9.2 mmol) in H2O (1.5 mL) and CH2Cl2 (3 mL) at 0 °C. added dropwise. The resulting mixture was allowed to warm to room temperature and stirred for 2 hours. The aqueous layer was extracted twice with CH2Cl2 and the combined organic layers were washed with saturated aqueous Na2CO3. The resulting solution of TfN3 in CH2Cl2 was slowly added to the resin-bound peptide suspended in a solution of CuSO4.5H2O (2 mg, 8 mmol) and K2CO3 (5 mg, 36 mmol) in MeOH (1 mL). The reaction mixture was swirled at room temperature for 18 hours. After completion of the diazo transfer, a Kaiser test could be performed, but colorless resin beads meant that conversion of amino groups to azide functionality was complete. The resin was then washed sequentially with DCM, MeOH, DMF and DCM.

Peptide Cleavage and Deprotection Resin-bound peptides with azide/alkynyl bearings were deprotected by treatment with TFA/TIS/H2O (95:2.5:2.5 v/v) for 4 hours at room temperature and solid support. disconnected from After filtration of the resin, the TFA solution was concentrated under reduced pressure and precipitated into ether to give the desired product as a solid, which was then purified by reverse phase chromatography.

High Resolution Mass Spectrometry High resolution mass spectra were recorded on a Thermo scientific LQT Orbitrap XL under electrospray ionization (ESI) or atmospheric pressure ionization (API) conditions where indicated.

Circular Dichroism (CD) Spectroscopy CD analysis was performed on an Applied Photophysics Chirascan Circular Dichroism spectrometer. Samples were dissolved in D2O up to 0.125 W/W% and data were acquired at room temperature in triplicate and then averaged and smoothed using the built-in qCD software. A graph was plotted by subtracting the blank D2O spectrum from the acquired data to obtain blank correction.

Synthesis of PMO-CP8M PMO (91.64 mg, 10 μmol) was dissolved in PBS (5 mL, pH 7.2) and SMCC linker (27.2 mg, 50 μM, 5 μM) dissolved in MeCN/HO (1:1, 1 mL). (fold excess) was added and incubated at room temperature. After 30 minutes, the mixture was desalted using sephadex g25 hydrated with complexing buffer (PBS 1×, pH 6.8) and also used as eluent.

K1E4-CP8M (17.8 mg, 11.4 μmol) was dissolved in Milli-Q water (4 mL) and EDTA solution (0.1 mL, 100 mM) and premixed with immobilized TCEP (2.5 mL) for 1 hour. Final concentration of EDTA was 2 mM.

MeCN (8 mL) and EDTA solution (0.1 mL, 100 mM) were added to freshly desalted SMCC-modified PMO prior to peptide addition. Depleted peptides were eluted from immobilized TCEP into tubes with SMCC-modified PMO and stirred at room temperature for 2 hours.

The solution was loaded onto 3 x 560 mg HLB columns, washed with Milli-Q water to remove any salts, and then washed with 10% MeCN in water. Some PMO was removed from the column when washed with 20% MeCN. 20% MeCN was sufficient to remove uncomplexed PMO from the HLB column. The column was washed with 20% MeCN until the eluent was eliminated. Finally, the PMO complex was eluted with 50% MeCN in water. The eluted product was then subjected to size exclusion chromatography using sephadex superfine g25 hydrated in Milli-Q water which was also used as the eluent.

Synthesis of PMO-HP8M and modification of PMO to PMO-4FB 4-FB (250 mg, 1.5 mM) was dissolved in DMF with COMU (1.2 g, 2.6 mM) and NHS (230 mg, 2.0 mM). and stirred for several minutes. 4-FB did not completely dissolve until DIEA was added. DIEA (0.54 mL, 3.0 mM) was then added when the reaction mixture changed from colorless to pale yellow/orange. The reaction mixture was stirred for 1 hour and monitored by TLC using 5% MeOH in DCM. The mixture was separated with DCM to remove DMF and then purified by flash chromatography with DMC to elute the top spot staining positively with 2,4DNP. The product was collected as an off-white solid, 112mg (30%).

PMO (30.4 mg, 3 μM) was added to the solution of 4-FB, dissolved in 10 carbonate buffer:MeCN (50% MeCN), NHS-activated 4-FB (10 mg, 32 μM) was added, and Stir overnight. The mixture was then desalted using Sephadex G25 superfine with water:MeCN as eluent. MeCN was removed by rotary evaporation and then the remaining eluent was lyophilized. 24 mg of lyophilized product was obtained with a yield of 83%.

Conjugation of PMO-4FB to HP8M HP8M was dissolved in milli-Q ultrapure water (100 μL) to give a 12 mg/mL solution. Aldehyde-modified PMO (7 mg, 0.76 μM) was dissolved in water/MeCN (300 μL, 1:1) and desalted using Sephadex G25 superfine and water/MeCN (1:1) as eluent. The collected fractions were then diluted with a water:MeCN mixture (1:1) to a total volume of 1 mL and the PMO content was analyzed by UV/vis and found to be 6.5 mg/mL or 705 μM. HNA peptide and Analine (10 mM final concentration) were then added and UV/vis monitored for evidence of A354 and used to calculate conjugation of PMO to peptide.

Cell Culture and Gene Transfer HeLa pLuc705 cells were cultured in high glucose DMEM supplemented with 10% fetal calf serum (Sigma, UK) at 37° C. in an 8% CO2/92% air atmosphere.

HeLa pLuc705 cells were set up in 96-well plates with appropriate dilutions (up to 100 μM) of test compounds, either FITC-labeled peptides or FITC-labeled PMO conjugates, diluted in complete medium. Cells were then trypsinized, diluted to 4 x 105 cells/mL and 100 μL added to each well to give a final volume of 200 μL in each well. Cells were then incubated at either 4 or 37° C. for either 4 or 24 hours.

Flow Cytometry Uptake of fluorescently labeled PMOs and peptides was determined by flow cytometry using an Accuri C6 flow cytometer. Cells were washed with PBS and glycine buffer prior to analysis in PBS containing 2.5% FBS, released with trypsin and kept on ice. After appropriate gating, cellular fluorescence in single live cells was measured using FlowJo software. Untreated cells were used to establish gating settings for determining % fluorescein-positive cells, and mean fluorescence intensity (MFI) was also calculated. Uptake was determined by gating cells that were able to eliminate transient cell death (To-pro-3), but demonstrated the ability to retain cell membrane integrity.

HPLC Analysis Samples were tested on XB-C18 modified with Kinetex, 2.6 μM particle size, 100 Å pores. Samples were tested with a gradient of 0-80% MeCN at 60° C. and a flow rate of 1.5 mL/min over 8 minutes.

Statistical Analysis All data are reported as the mean±standard error or standard deviation of the mean, as indicated. Statistical differences between treated and control groups were assessed by SigmaStat (Systat Software, UK) and Student's t-test or two-way ANOVA were applied. Significance was accepted at P-value <0.05 using Bonferroni post hoc analysis.

Results Stabilized peptide K1E4/5/6-P8M-FITC and uncyclized equivalents K1E4/5/6-P8M-NC-FITC, RCM1,5-P8M-FITC and equivalent uncyclized RCM1,5- Solid phase syntheses of P8M-FITC-NC, RCM1,5-CP8M, and equivalent uncyclized RCM-CP8M-NC and RCM1,5-HP8M were performed using standard Fmoc chemistry on rink amide resin. yielded the desired product identified by LC-MS in Table 7 below.

HPLC analysis of the uncyclized peptide K1E4/5/6-CP8M-FITC-NC showed an elution time of 6.22-6.29 minutes using a 0-80% gradient over 8 minutes.

HPLC analysis of the cyclized peptide K1E4/5/6-CP8M-FITC showed an increase in elution time over the non-cyclized peptide (Table 8).

HPLC analysis of RCM1,5-CP8M showed a decrease in retention time of the cyclized product compared to the non-cyclized product, the retention times of K1E4-CP8M and K1E4-CP8M as exemplified in Table 8 below. Similar to the K1E6-CP8M peptide.

Circular dichroism data indicate that the solvation structure of the K1E4/5/6-CP8M peptide can be influenced both by the presence of charged fluorochromes or the position of the cross-links (FIGS. 12a and 12b).

K1E4- _CP8M exhibits an extended 310 helix/poly(Pro)II helix with a maximum at 219 nm and a minimum at 196 nm. K1E6-CP8M shows similar characteristic maxima and minima (FIG. 12).

K1E5-CP8M exhibits the characteristics of a random coil or disordered structure, indicated by a low ellipticity of about 8 above 210 nm and a minimum of about 196 nm (FIG. 12).

HeLa pLuc 705 cells incubated in the presence of K1E4/5-CP8M-FITC and K1E4/5/6-CP8M-NC-FITC showed no difference in uptake of stabilizing versus destabilizing peptides (Fig. 13ai ~aii). Surprisingly, K1E6-CP8M showed a significant difference in uptake compared to the destabilized peptide (Fig. 13aiii; n=4, error bars indicate standard deviation, two-way ANOVA was performed. * represents p<0.05, ** represents p<0.001). A 22% increase in FL1+ cells was observed at 11.1 μM when K1E6-CP8M-FITC was compared to non-cyclized controls. The difference in FL1+ cells further increased to 43% difference at 3.7 μM (maximum difference of 65% at 1.23 μM) and remained consistently higher at all tested concentrations. This is because the location of the cross-links that affect cellular uptake is documented in PCT/GB2016/054028, where ring-closing metathesis between amino acid positions 1 and 5 within a peptide is It has been shown to be efficient, demonstrating non-intuitiveness between different cyclization techniques.

HeLa pLuc 705 cells incubated in the presence of K1E4/5-CP8M-FITC and K1E4/5/6-CP8M-NC-FITC showed a significant 2-log increase in mean fluorescence intensity over K1E6-CP8M at concentrations above 10 μM. -FITC peptide only (compared to its non-cyclized control); FIG. 13bi-biii; n=4, error bars indicate standard deviation, two-way ANOVA was performed . * represents p<0.05.

HeLa pLuc 705 cells incubated in the presence of K1E4/5-CP8M-FITC and K1E4/5/6-CP8M-NC-FITC show no deleterious cytotoxicity over the entire concentration range (0.05 μM to 100 μM; Figure 13ci-iii).

HeLa pLuc 705 cells incubated in the presence of K1E4/5/6-CP8M conjugated PMOs showed an enhancement in cellular uptake compared to unconjugated PMOs (FIG. 14).

HeLa pLuc 705 cells incubated in the presence of RCM1,5-CP8M-FITC-labeled peptide show dose-dependent uptake of the peptide at similar levels to the K1E6-CP8M-FITC peptide.

Charge variants of RCM1,5-CP8M-FITC (Fig. 15a; namely RCM1,5-CP8M-FITC 3+, RCM1,5-CP8M-FITC 2+, RCM1,5-CP8M-FITC 1+ and RCM1,5-CP8M-FITC 0+) HeLa pLuc 705 cells incubated in the presence of FITC-labeled peptides. Figure 15a showed differential responses to peptide dose and cell viability. The data show that RCM1,5-P8M-FITC-1+ showed a significant difference compared to other treatments in FL1+ cells at all concentrations below 33 μM, ranging from 2% to 60% difference in FL1-positive cells. It shows that it has a decrease. RCM1,5-P8M-FITC-0+ increased compared to other treatments in the number of FL1+ cells over various concentrations ranging from a 10% increase to a 40% increase (maximal difference at 0.41 μM ) (n=5, error bars indicate standard deviation, * represents p<0.05, ** represents p<0.001, *a represents RCM1,5-P8M- represents interactions between FITC-1+ and all other groups, *b represents interactions between RCM1,5-P8M-FITC-0+ and all other groups).

HeLa pLuc 705 cells incubated in the presence of FITC-labeled peptides based on charge variants of RCM1,5-CP8M-FITC had differential mean fluorescence intensities (Fig. 15b). No significant difference in MFI between given concentrations of RCM1,5-P8M-FITC-0+, 1+ and 2+ is observed. However, RCM1,5-P8M-FITC-3+ shows an increase in MFI (up to about 1 log increase) at higher concentrations >1 μM (n=5, error bars indicate standard deviation, * indicates p <0.05, ** indicates p<0.001).

FIG. 15c shows HeLa cells incubated with RCM1,5-P8M-FITC-3+, RCM1,5-P8M-FITC-2+, RCM1,5-P8M-FITC-1+, RCM1,5-P8M-FITC-0+ for 4 hours. Comparison of % viable cells as judged by gating cells compared to negative control of pLuc 705 cells (n=3, error bars indicate standard deviation, * represents p<0.05, * a represents the interaction between RCM1,5-P8M-FITC-3+ and RCM1,5-P8M-FITC-2+, *b represents RCM1,5-P8M-FITC-2+ and RCM1,5-P8M -FITC-0+, *c represents the interaction between RCM1,5-P8M-FITC-0+ and RCM1,5-P8M-FITC-3+). Data show a significant reduction (32% reduction) when comparing RCM1,5-CP8M-FITC-3+ with RCM1,5-CP8M-FITC-2+ in the number of viable cells recovered at the highest concentration of 100 μM. and an increase (20% increase) when comparing RCM1,5-CP8M-FITC-2+ with RCM1,5-CP8M-FITC-0+ in the number of cells. Similarly, RCM1,5-CP8M-FITC-3+ at 33 μM showed a 20% reduction in % viable cells compared to RCM1,5-CP8M-FITC-2+ and RCM1,5-CP8M-FITC-0+ . No other significant effects were observed at any other concentration except 0.05 μM. RCM1,5-CP8M-FITC-0+ at 0.05 μM showed a 23% increase over RCM1,5-CP8M-FITC-3+ and RCM1,5-CP8M-FITC-2+ in live cells. This has important implications for clinical interpretation of RCM-based CPP variants with reduced charge.

A comparison of the viability of HeLa pLuc 705 cells when incubated with either RCM1,5-P8M-FITC-3+ or the K1E4/5/6-CP8M-FITC series of peptides showed that doses of 0.05-100 μM To the extent K1E4/5/6-CP8M-FITC is shown to have no negative effect on cell viability (FIG. 16). A comparison of RCM1,5-P8M-FITC to the K1E5-P8M-FITC peptide shows a 70-99% increase in viability over a range of concentrations. This has important implications for the clinical interpretation of CPPs based on lactamization.

CONCLUSIONS From the data generated, CPA stabilized by stapling via an alternative cross-linking technique to that disclosed by Applicants in PCT/GB2016/054028 was demonstrated in vitro. can be seen to be effective during cell entry at .

The importance of the position of the cross-links within the peptide sequence has been exemplified as a specific chemistry, which can profoundly affect the solvating conformation and subsequent cellular uptake of stabilizing peptides as determined by flow cytometry. . Surprisingly, therefore, it is intuitive that cross-linking based on different chemical cyclization techniques, which are orthogonal to their sequence, will produce peptides with either the same conformation or the same cell-penetration properties. I can't. This may be the case for other cyclization chemistries.

CPA stabilized by the cyclization chemistry of lactamization is stabilized in a helical conformation, which is not an α-helix. K1E4-CP8M and K1E6- _CP8M exhibit an elongated 310 helix or poly(Pro)II helix structure.

CPA stabilized by cyclization chemistry of lactamization does not cause cell death in vitro. This has important clinical implications for DCCPM based on this technology.

HPLC analysis of the cyclized and uncyclized K1E4/5/6-CP8M peptide showed a retention time similar to the uncyclized peptide of 6.22 minutes (Table 8), although the cyclization process and resulting The stabilized peptides obtained in 1 showed an increase in retention time (Table 8). Peptides with putative conformations of 3 ₁₀ helices or poly(Pro)II helices have broadly similar retention times of K1E4-CP8M = 6.62 min and K1E6-CP8M = 6.57 min, and the conformations The potential use of HPLC to identify changes in is emphasized.

CPA stabilized by cyclization chemistry of lactamization facilitates PMO cell entry when conjugated to PMO.

Reduced-charge variants of CPA stabilized by the cyclization chemistry of ring-closing metathesis are efficient cell-penetrating peptides with improved toxicological properties in vitro. This has important clinical implications for DCCPM based on this technique.
[1]
i. a biologically active compound (BAC);
ii. cell permeabilization agent (CPA), wherein BAC and CPA are linked directly or via a bifunctional linker (BFL); ), wherein said CPA is a stabilizing peptide (CPP) on which it is formed by forming a stapled peptide (StaP) or forming a stitched peptide (StiP) A conformationally stabilized peptide (CPP), said StiP or StaP comprising a cross-link or bridge between at least two amino acids of said peptide, and said cross-link or bridge formed by olefin metathesis. A drug-carrying cell permeation molecule (DCCPM) that provides a cyclization between said at least two amino acids that are not free.
[2]
Cyclization is
i. condensation of aldehydes or ketones with hydrazines or protected hydrazines;
ii. thiol-enemichael addition;
iii. disulfide formation;
iv. Huisgen 1,3 dipolar cycloaddition;
v. reactions between amines and carboxylic acids;
vi. a singlet- or triplet-based Calbyne reaction; or vii. DCCPM according to paragraph [1], achieved by one or more of Suzuki or Sonogashira coupling.
[3]
DCCPM according to item [2], wherein in iv) the triazole is formed between an azide- or electron-deficient nitrile-containing amino acid and a propynyl-containing amino acid.
[4]
The DCCPM according to item [3], wherein the azide is azidridine.
[5]
The DCCPM according to item [3], wherein the propynyl-containing amino acid is lysine, glutamic acid or aspartic acid.
[6]
DCCPM according to item [2], wherein in v) the lactam is formed between a free amine-containing amino acid and a carboxylic acid-containing amino acid.
[7]
DCCPM according to item [6], wherein the lactam is formed by cross-linking lysine with glutamic acid or aspartic acid.
[8]
The DCCPM of any one of paragraphs [1]-[7], wherein each crosslink has a nominal continuous length of 2-20 atoms.
[9]
The DCCPM according to any one of paragraphs [1] to [8], wherein said stabilized peptide comprises at least one alpha helix, an extended ₃₁₀ helix or a poly(Pro)II helix.
[10]
The DCCPM according to any one of items [1] to [8], wherein said stabilized peptide comprises at least one β-sheet, or hairpin, or turn.
[11]
paragraph [9] or [10], wherein said stabilized peptide comprises at least one α-helix, an extended 310 _- helix or a poly(Pro)II helix and one β-sheet, turn or hairpin DCCPM as described.
[12]
The DCCPM according to any one of items [1] to [11], wherein the BAC is an oligonucleotide (ON).
[13]
The DCCPM according to item [12], wherein the ON is an ON having an electrically low charge.
[14]
The DCCPM according to item [13], wherein the ON is an ON having an electrically neutral charge.
[15]
The DCCPM of paragraph [13] or [14], wherein the ON is a peptide nucleic acid (PNA) or a phosphorodiamidate morpholino oligonucleotide (PMO) or a variant thereof.
[16]
The DCCPM according to any one of items [12] to [15], wherein the ON is an antisense oligonucleotide (AO).
[17]
The DCCPM of paragraph [16], wherein said ON is an antisense oligonucleotide comprising a chemical entity selected from the compounds of Table 4, including an ON with a hybrid chemical entity.
[18]
The DCCPM according to item [12], wherein the BAC is a phosphorodiamidate morpholino oligonucleotide (PMO).
[19]
The DCCPM of any one of items [1] to [17], wherein the BAC modifies expression of an endogenous or exogenous gene.
[20]
The DCCPM of paragraph [19], wherein the endogenous gene targets neuromuscular disease, metabolic disease, cancer, age-related degenerative disease or acquired viral infection.
[21]
The DCCPM according to any one of paragraphs [1] to [19], wherein the BFL comprises a chemical selected from the chemicals in Table 6.
[22]
The DCCPM of paragraph [21] comprising an amine to sulfhydryl crosslinker containing an N-hydroxysuccinimide ester and a maleimide reactive group separated by a cyclohexane spacer.
[23]
The DCCPM according to item [21] or [22], wherein said BFL is succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC).
[24]
The DCCPM according to item [21], wherein the BFL is HNA and is incorporated at the end of the CPP.
[25]
The DCCPM of paragraph [24], wherein said BFL is HNA and said ON is modified to incorporate 4-formylbenzoic acid to facilitate covalent conjugation.
[26]
The DCCPM of paragraph [23], wherein said SMCC is pegylated.
[27]
The DCCPM of paragraphs [24] or [25], wherein said HNA is pegylated.
[28]
The DCCPM of paragraph [21], wherein the CPA is covalently linked to the first end of the BFL.
[29]
The DCCPM of paragraph [21], wherein said BAC is covalently linked to the second end of said BFL.
[30]
The DCCPM of paragraph [1], having a size greater than 1.5 KDa.
[31]
Cellular uptake of biologically active compounds (BACs) is further enhanced by forming stabilized peptides, stapled peptides (StaP) or stitched peptides (StiP). A method facilitated by conjugation of said biologically active compound to a cell permeabilization agent (CPA), which is a stabilized peptide having a defined conformation, wherein said StiP or StaP comprises at least two amino acids of said peptide. directly or providing cyclization between said at least two amino acids not formed by olefin metathesis via a bifunctional linker (BFL).
[32]
The DCCPM according to any one of items [1] to [30], which is used for the treatment of diseases requiring alteration of expression of endogenous or exogenous genes.
[33]
DCCPM according to paragraph [32], which is used for treatment of neuromuscular disease, metabolic disease, cancer, age-related degenerative disease or acquired viral infection.
[34]
DCCPM according to paragraph [32], for use in the treatment of Duchenne muscular dystrophy.
[35]
The DCCPM of paragraph [34], comprising an AO targeting said dystrophin gene.
[36]
A method of improving the bioavailability of an agent or BAC, wherein the agent or BAC is treated with stabilized peptides to form stapled peptides (StaP) or stitched peptides (StiP ), wherein said StiP or StaP is a cross-linked peptide between at least two amino acids of said peptide. or a bridge, and said cross-link or bridge provides cyclization between said at least two amino acids not formed by olefin metathesis.
[37]
A method of introducing a drug or BAC to a site that is refractory to said drug or BAC in its native state, said drug or BAC being a stabilized peptide, comprising a staple forming a stitched peptide (StaP) or forming a stitched peptide (StiP) to a stabilized peptide CPP having a conformation provided thereon, said StiP or StaP comprises a cross-link or bridge between at least two amino acids of said peptide, and said cross-link or bridge provides cyclization between said at least two amino acids not formed by olefin metathesis; A method comprising conjugating and administering it to a subject.
[38]
The method of paragraph [37], wherein the tissue is one of heart, brain, muscle or liver.
[39]
A method of treating a subject to alter expression of an endogenous or exogenous gene, comprising administering the DCCPM of any one of paragraphs [1]-[30] or [32]-[35]. A method that includes steps.
[40]
A composition comprising the DCCPM of any one of items [1]-[30] or [32]-[35] and one or more pharmaceutically acceptable excipients.
[41]
The composition of paragraph [40] adapted for oral, parenteral, intravenous or topical administration.
[51]
i. a biologically active compound (BAC), wherein the BAC is a phosphorodiamidate morpholino oligonucleotide (PMO) having a charge of -3 to +3 at pH 7.5 or a variant thereof; ,
ii. a cell permeabilization agent (CPA), wherein the BAC and the CPA are linked directly or via a bifunctional linker (BFL). a molecule (DCCPM),
Said CPA is a stabilized peptide (CPP), forming a stapled peptide (StaP) or a stitched peptide (StiP) to form a conformation provided thereon. wherein said StiP or said StaP is between two conformationally adjacent amino acids, as opposed to by the introduction of another bridging molecule, between the conformationally adjacent amino acids wherein the stabilized conformation has at least one extended 3 ₁₀ helix or poly (Pro) II helix,
Said drug-carrying cell-permeable molecule (DCCPM).
[52]
DCCPM of paragraph [51], wherein said lactam is formed between a free amine-containing amino acid and a carboxylic acid-containing amino acid.
[53]
DCCPM of paragraph [52], wherein said lactam is formed by cross-linking lysine with glutamic acid or aspartic acid.
[54]
The DCCPM of paragraph [53], wherein each crosslink has a nominal continuous length of 2-20 atoms.
[55]
The DCCPM according to any one of items [51] to [54], wherein the PMO is a PMO having an electrically neutral charge and has a charge of -1 to +1 at pH 7.5.
[56]
The DCCPM of any one of paragraphs [51]-[55], wherein said PMO modifies expression of an endogenous or exogenous gene.
[57]
The DCCPM of paragraph [56], wherein said endogenous gene targets neuromuscular disease, metabolic disease, cancer, age-related degenerative disease or acquired viral infection.
[58]
The DCCPM of any one of paragraphs [51]-[57], wherein the BFL comprises a chemical selected from the chemicals of Table 5.
[59]
The DCCPM of paragraph [58] comprising an amine to sulfhydryl crosslinker containing an N-hydroxysuccinimide ester reactive group and a maleimide reactive group separated by a cyclohexane spacer.
[60]
DCCPM according to item [58] or [59], wherein said BFL is succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC).
[61]
The DCCPM of paragraph [60], wherein said BFL is hydrazinylnicotinic acid (HNA) and is incorporated at the end of said CPP.
[62]
The DCCPM of paragraph [61], wherein said BFL is HNA and said PMO is modified to incorporate 4-formylbenzoic acid to facilitate covalent conjugation.
[63]
The DCCPM of paragraph [60], wherein said SMCC is pegylated.
[64]
The DCCPM of paragraphs [61] or [62], wherein said HNA is pegylated.
[65]
The DCCPM of paragraph [58], wherein said CPA is covalently linked to the first end of said BFL.
[66]
The DCCPM of paragraph [58], wherein said BAC is covalently linked to the second end of said BFL.
[67]
DCCPM according to paragraph [51], having a size greater than 1.5 KDa.
[68]
Cellular uptake of a bioactive compound (BAC) is facilitated by conjugation of said bioactive compound to a cell permeabilization agent (CPA) to form a drug-carrying cell permeation molecule (DCCPM), and said DCCPM to said A method of presentation in a medium suitable for cells, comprising:
said BAC is a phosphorodiamidate morpholino oligonucleotide (PMO) or variant thereof having a charge of -3 to +3 at pH 7.5;
Said CPA is a stabilized peptide (CPP), forming a stapled peptide (StaP) or a stitched peptide (StiP) to form a conformation provided thereon. The stabilized peptide (CPP) having
wherein said StiP or said StaP is between conformationally adjacent amino acids by direct cyclization resulting in a lactam between two conformationally adjacent amino acids, as opposed to by introduction of another bridging molecule; directly formed, said stabilized conformation having at least one extended 3 ₁₀ helix or poly (Pro) II helix;
the aforementioned method.
[69]
The DCCPM according to any one of items [51] to [67], which is used for the treatment of diseases requiring alteration of expression of endogenous or exogenous genes.
[70]
DCCPM according to paragraph [69], which is used for treatment of neuromuscular disease, metabolic disease, cancer, age-related degenerative disease or acquired viral infection.
[71]
DCCPM according to paragraph [69], for use in the treatment of Duchenne muscular dystrophy.
[72]
The DCCPM of paragraph [69], comprising an AO targeting said dystrophin gene.
[73]
A method for improving the bioavailability of a drug, i.e. a bioactive compound (BAC), comprising:
wherein said BAC is a phosphorodiamidate morpholino oligonucleotide (PMO) or variant thereof having a charge of -3 to +3 at pH 7.5;
said method comprising linking said BAC to a stabilized peptide (CPP);
wherein said CPA is a stabilized peptide (CPP) on which it is formed by forming a stapled peptide (StaP) or by forming a stitched peptide (StiP) The stabilized peptide (CPP) having a conformation,
wherein said StiP or said StaP is between conformationally adjacent amino acids by direct cyclization resulting in a lactam between two conformationally adjacent amino acids, as opposed to by introduction of another bridging molecule; directly formed, said stabilized conformation having at least one extended 3 ₁₀ helix or poly (Pro) II helix;
the aforementioned method.
[74]
A drug, i.e., a biologically active compound (BAC), is used to introduce the BAC and a cell permeabilizing agent (CPA) into a site that is refractory to the BAC in its native state. An agent comprising
wherein said BAC is a phosphorodiamidate morpholino oligonucleotide (PMO) or variant thereof having a charge of -3 to +3 at pH 7.5;
said BAC is linked to said CPP;
wherein said CPP has a conformation provided thereon by forming a stapled peptide (StaP) or by forming a stitched peptide (StiP);
wherein said StiP or said StaP is between conformationally adjacent amino acids by direct cyclization resulting in a lactam between two conformationally adjacent amino acids, as opposed to by introduction of another bridging molecule; directly formed, said stabilized conformation having at least one extended 3 ₁₀ helix or poly (Pro) II helix;
Said agent.
[75]
The agent according to Item [74], wherein the tissue is one of heart, brain, muscle or liver.
[76]
An agent for treating a subject to alter the expression of an endogenous or exogenous gene, comprising the DCCPM of any one of paragraphs [51]-[67] or [69]-[72] , said agents.
[77]
A composition comprising the DCCPM of any one of paragraphs [51]-[67] or [69]-[72] and one or more pharmaceutically acceptable excipients.
[78]
The composition of paragraph [77] adapted for oral, parenteral, intravenous or topical administration.

References;
1 Chiriboga, C.; A. et al. Results from a phase 1 study of nusinersen (ISIS-SMN(Rx)) in children with spinal muscular atrophy. Neurology 86, 890-897, doi: 10.1212/WNL. 0000000000002445 (2016).
2 Mendell, J.; R. et al. Eteplirsen for the treatment of Duchenne muscular dystrophy. Ann Neurol 74, 637-647, doi: 10.1002/ana. 23982 (2013).
3 Iversen, P.; L. et al. Discovery and early development of AVI-7537 and AVI-7288 for the treatment of Ebola virus and Marburg virus infections. Viruses 4, 2806-2830, doi: 10.3390/v4112806 (2012).
4 Heald, A.; E. et al. Safety and pharmacokinetic profiles of phosphorodiamidate morpholino oligomers with activity against ebola virus and marburg virus: results of two single-descending. Antimicrob Agents Chemother 58, 6639-6647, doi: 10.1128/aac. 03442-14 (2014).
5 Warren, T.; K. et al. Advanced antisense therapies for postexposure protection against lethal filovirus infections. Nat Med 16, 991-994, doi: 10.1038/nm. 2202 (2010).
6 Campbell, J.; M. , Bacon, T.; A. & Wickstrom, E. Oligodeoxynucleoside phosphorothioate stability in subcellular extracts, culture media, sera and cerebrospinal fluid. Journal of biochemical and biophysical methods 20, 259-267 (1990).
7 Agrawal, S.; , Mayrand, S.; H. , Zamecnik, P.; C. & Pederson, T. Site-specific excision from RNA by RNaseH and mixed-phosphate-backbone oligodeoxynucleotides. Proc Natl Acad Sci USA 87, 1401-1405 (1990).
8 Tereshko, V.; et al. Correlating structure and stability of DNA duplexes with incorporated 2'-O-modified RNA analogues. Biochemistry 37, 10626-10634, doi: 10.1021/bi980392a (1998).
9 Shibahara, S.; et al. Inhibition of Human immunodeficiency virus (HIV-1) replication by synthetic oligo-RNA derivatives. Nucleic Acids Res 17, 239-252 (1989).
10 Goemans N, C.; C. , Kraus JE, et al. Drisapersen efficiency and safety in Duchenne muscular dystrophy: results of a phase III, randomized, double-blind, placebo-controlled trial (study DMD114044). World Muscle Society Congress; Asilomar, CA, USA; Oct 1-5, 2013 (2103).
11 Goemans, N.; M. et al. Long-Term Efficacy, Safety, and Pharmacokinetics of Drisapersen in Duchenne Muscular Dystrophy: Results from an Open-Label Extension Study. PLoS One 11, e0161955, doi: 10.1371/journal. pone. 0161955 (2016).
12 Dirin, M.; & Winkler, J.; Influence of diverse chemical modifications on the ADME characteristics and toxicity of antisense oligonucleotides. Expert Opin Biol Ther 13, 875-888, doi: 10.1517/14712598.2013.774366 (2013).
13 Sazani, P.; et al. Repeat-dose toxicology evaluation in cynomolgus monkeys of AVI-4658, a phosphorodiamidate morpholino oligomer (PMO) drug for the treatment of duchenne musculoskeletal. Int J Toxicol 30, 313-321, doi: 10.1177/1091581811403505 (2011).
14 Sazani, P.; , Weller, D.; L. & Shrewsbury, S. B. Safety pharmacology and genotoxicity evaluation of AVI-4658. Int J Toxicol 29, 143-156, doi: 10.1177/1091581809359206 (2010).
15 Heemskerk, H.; A. et al. In vivo comparison of 2'-O-methyl phosphorothioate and morpholino antisense oligonucleotides for Duchenne muscular dystrophy exon skipping. J Gene Med 11, 257-266, doi: 10.1002/jgm. 1288 [doi] (2009).
16 Kreutz, M.; et al. Antibody-antigen-adjuvant conjugates enable co-delivery of antigen and adjuvant to dendritic cells in cis but only have partial targeting specificity. PLoS One 7, e40208, doi: 10.1371/journal. pone. 0040208 (2012).
17 Derossi, D.; , Joliot, A.; H. , Chassaing, G.; & Prochiantz, A.; The third Helix of the Antennapedia Home domain translocates through biological membranes. J Biol Chem 269, 10444-10450 (1994).
18 Gautam, A.; et al. CPP site: a curated database of cell penetrating peptides. Database: the journal of biological databases and curation 2012, bas015, doi: 10.1093/database/bas015 (2012).
19 Hirose, H.; et al. Transient focal membrane deformation induced by arginine-rich peptides leads to their direct penetration into cells. Mol Ther 20, 984-993, doi: 10.1038/mt. 2011.313 (2012).
20 Moulton, H.; M. & Moulton, J.; D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim Biophys Acta 1798, 2296-2303, doi: 10.1016/j. bba mem. 2010.02.012 (2010).
21 Tunnemann, G.; et al. Live-cell analysis of cell penetration ability and toxicity of oligo-arginines. J Pept Sci 14, 469-476, doi: 10.1002/psc. 968 (2008).
22 Chu, Q. et al. Towards underlying cell penetration by stapled peptides. MedChemComm 6, 111-119, doi: 10.1039/C4MD00131A (2015).
23 Hilinski, G.; J. et al. Stitched α-Helical Peptides via Bis Ring-Closing Metathesis. Journal of the American Chemical Society 136, 12314-12322, doi: 10.1021/ja505141j (2014).
24 Cantel, S.; et al. Synthesis and conformational analysis of a cyclic peptide obtained via i to i+4 intramolecular side-chain to side-chain azide-alkyne 1,3-dipolar cycloadit. The Journal of organic chemistry 73, 5663-5674, doi: 10.1021/jo800142s (2008).
25 Bracken, C.I. , Gulyas, J.; , Taylor, J.; W. & Baum, J.; Synthesis and Nuclear Magnetic Resonance Structure Determination of an. alpha. - Helical, Bicyclic, Lactam-Bridged Hexapeptide. Journal of the American Chemical Society 116, 6431-6432, doi: 10.1021/ja00093a052 (1994).
26 Lehto, T.; et al. Cellular trafficking determines the exon skipping activity of Pip6a-PMO in mdx skeleton and cardiovascular muscle cells. Nucleic Acids Res 42, 3207-3217, doi: 10.1093/nar/gkt1220 (2014).
27 Nakase, I.; et al. Interaction of arginine-rich peptides with membrane-associated proteoglycans is crucial for induction of action organization and macropinocytosis. Biochemistry 46, 492-501, doi: 10.1021/bi0612824 (2007).
28 Chang, Y.; S. et al. Stapled alpha-helical peptide drug development: a potential dual inhibitor of MDM2 and MDMX for p53-dependent cancer therapy. Proc Natl Acad Sci USA 110, E3445-3454, doi: 10.1073/pnas. 1303002110 (2013).
29 Vitiello, L.; et al. In vivo delivery of naked antisense oligos in aged mdx mice: analysis of dystrophin restoration in skeletal and cardiovascular muscle. Neuromuscul Disord 18, 597-605, doi: S0960-8966 (08) 00141-7 [pii] 10.1016/j. nmd. 2008.05.011 [doi] (2008).
30 Jerawiriyapaisarn, N.E. , Moulton, H.; M. , Sazani, P.; , Kole, R. & Willis, M. S. Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers. Cardiovasc Res 85, 444-453, doi: cvp335[pii] 10.1093/cvr/cvp335[doi] (2010).
31 Wu, B.; et al. One-year treatment of morpholino antisense oligomer improves skeletal and cardiovascular muscle functions in dystrophic mdx mice. Mol Ther 19, 576-583, doi: 10.1038/mt. 2010.288 (2011).
32 Wu, B.; et al. Effective rescue of dystrophin improves cardiac function in dystrophin-deficient mice by a modified morpholino oligomer. Proc Natl Acad Sci USA 105, 14814-14819, doi: 0805676105 [pii] 10.1073/pnas. 0805676105 [doi] (2008).
33 Jerawiriyapaisarn, N.J. et al. Sustained dystrophin expression induced by peptide-conjugated morpholino oligomers in the muscles of mdx mice. Mol Ther 16, 1624-1629, doi: mt2008120 [pii] 10.1038/mt. 2008.120 [doi] (2008).
34 Betts, C.I. et al. Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular therapy. Nucleic acids 1, e38, doi: 10.1038/mtna. 2012.30 (2012).
35 Ivanova, G.; D. et al. Improved cell-penetrating peptide-PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle. Nucleic Acids Res 36, 6418-6428 (2008).
36 Lautrette, G.; , Touti, F.; , Lee, H.; G. , Dai, P.; & Pentelute, B.; L. Nitrogen Arylation for Macrocyclization of Unprotected Peptides. J Am Chem Soc 138, 8340-8343, doi: 10.1021/jacs. 6b03757 (2016).
37 Mendell, J.; R. et al. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Ann Neurol 71, 304-313, doi: 10.1002/ana. 23528 (2012).
38 Hoffman,E. P. , Brown, R. H. , Jr. & Kunkel, L.; M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell 51, 919-928. (1987).
39 Monaco, A.; P. , Bertelson, C.; J. , Liechti-Gallati, S.; , Moser, H.; & Kunkel, L.; M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 2, 90-95 (1988).
40 Aartsma-Rus, A.R. et al. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet 12, 907-914 (2003).
41 Alter, J.; et al. Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 12, 175-177 (2006).
42 Kinali, M.; et al. Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, formulation. Lancet Neurol 8, 918-928, doi: S1474-4422 (09) 70211-X [pii] 10.1016/S1474-4422 (09) 70211-X [doi] (2009).
43 Lu, Q. L. et al. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA 102, 198-203 (2005).
44 van Deutekom,J. C. et al. Local dystrophin restoration with antisense oligonucleotide PRO051. N Engl J Med 357, 2677-2686, doi: 357/26/2677 [pii] 10.1056/NEJ Moa073108 [doi] (2007).
45 Wu, B.; et al. Dose-dependent restoration of dystrophin expression in cardiovascular muscle of dystrophic mice by systematically delivered morpholino. Gene Ther 17, 132-140, doi: gt2009120 [pii] 10.1038/gt. 2009.120 [doi] (2010).
46 Cirak, S.; et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-labeled laboratory, 2-phase Lancet 378, 595-605, doi: 10.1016/s0140-6736(11) 60756-3 (2011).

Claims (25)

is a molecule
i. a bioactive oligonucleotide portion comprising a phosphorodiamidate morpholino oligonucleotide (PMO);
ii. a peptide moiety comprising a stapled peptide (StaP) or stitched peptide (StiP) , wherein said bioactive oligonucleotide moiety is directly covalently linked to said peptide moiety, or covalently linked via a bifunctional linker (BFL) moiety, by
Said StaP or said StiP is a stabilized peptide and has a crosslinked conformation comprising a lactam crosslink or a lactam bridge between at least two amino acids of said StaP or said StiP, wherein said cross the link is not formed by olefin metathesis, the StaP or the StiP can penetrate the cell membrane,
said molecule is capable of penetrating cell membranes and is biologically active;
said molecule . 2. The molecule of Claim 1, wherein said lactam bridge is formed between a free amine-containing amino acid and a carboxylic acid-containing amino acid. 3. The molecule of claim 2, wherein said lactam is formed by cross-linking lysine with glutamic acid or aspartic acid. The StaP or the StiP has at least one α-helix, extended 3 ₁₀ contains a helix or a poly(Pro)II helix, or at least one β-sheet or hairpin or turn; or
The StaP or the StiP has at least one α-helix, extended 3 ₁₀ a helix or poly(Pro)II helix, and at least one β-sheet or hairpin or turn,
A molecule according to claim 1 . SEQ ID NO: 1, wherein said PMO is modified by being covalently linked to said StaP or said StiP directly or covalently linked to said StaP or said StiP via said BFL : 5' CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3'. 2. The method of claim 1, wherein the PMO alters expression in humans or animals of endogenous or exogenous genes associated with neuromuscular disease, metabolic disease, cancer, age-related degenerative disease or acquired viral infection. Molecule as described. 2. The molecule of claim 1 , wherein said PMO modifies expression of an endogenous or exogenous gene in humans or animals . said BFL is present in said molecule and there is a covalent bond between said BFL and said PMO and between said BFL and said StaP or StiP; and
The BFL is

(SMCC), the residue of succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, where Z is

and
Y is a covalent bond to the N-terminus of said StaP or said StiP, or Y is

where n is a positive integer;
or

(AMAS), the residue of N-α-maleimidoaceto-oxysuccinimide ester, where Z is

and Y is a covalent bond to the N-terminus of said StaP or said StiP, or Y is

where n is a positive integer;
or

(BMPS), the residue of N-β-maleimidopropyl-oxysuccinimide ester, where Z is

and Y is a covalent bond to the N-terminus of said StaP or said StiP, or Y is

where n is a positive integer;
or

(GMBS), the residue of N-γ-maleimidobutyryl-oxysuccinimide ester, where Z is

and Y is a covalent bond to the N-terminus of said StaP or said StiP, or Y is

where n is a positive integer;
or

(DMVS), the residue of N-δ-maleimidovaleryl-oxysuccinimide ester, where Z is

and Y is a covalent bond to the N-terminus of said StaP or said StiP, or Y is

where n is a positive integer;
or

(EMCS), the residue of N-ε-maleimidocaproyl-oxysuccinimide ester, where Z is

and Y is a covalent bond to the N-terminus of said StaP or said StiP, or Y is

where n is a positive integer;
or

(LC-SMCC), the residue of succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate), where Z is

and Y is a covalent bond to the N-terminus of said StaP or said StiP, or Y is

where n is a positive integer;
or

(SM(PEG) _n ), ie the residue of succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (polyethylene glycol) _n , where n is equal to 1-10 and Z is ,

and Y is either present or absent, and if Y is present, Y is

where n is a positive integer and, if Y is absent, Y is a covalent bond to the N-terminus of said StaP or said StiP;
or

(DSG), the residue of disuccinimidyl glutarate, wherein Z is absent and instead there is a covalent bond to the N-terminus of said StaP or said StiP, or

to N; where n is a positive integer and
or

(DSCDS), ie the residue of disuccinimidyl-cyclohexyl-1,4-diester, wherein Z is absent and instead a covalent bond to the N-terminus of said StaP or said StiP is Yes or

to N, where n is a positive integer. 2. The molecule of claim 1 , wherein said BFL is present in said molecule and comprises an amine to sulfhydryl crosslinker containing an N-hydroxysuccinimide ester reactive group and a maleimide reactive group separated by a cyclohexane spacer . 9. The molecule of claim 8, wherein said BFL comprises SMCC. 10. The molecule of claim 9, wherein said BFL comprises SMCC of claim 8. 8. A molecule according to claim 7 , wherein the endogenous or exogenous gene in humans or animals comprises the dystrophin gene. 7. The molecule of claim 6 , wherein said disease is Duchenne muscular dystrophy. 2. The molecule of claim 1, wherein said BFL is present in said molecule, covalently linked to each of said PMO and said StaP or StiP, and comprises a hydrazinylnicotinic acid (HNA) moiety . 15. The molecule of claim 14 , wherein said HNA is pegylated. 11. The molecule of claim 10, wherein said SMCC is pegylated. 12. The molecule of claim 11 , wherein said SMCC is pegylated. 2. The molecule of Claim 1, wherein said bioactive oligonucleotide comprises RNA. said PMO alters the expression in humans or animals of a gene associated with the disease of Duchenne muscular dystrophy, or said PMO is directly covalently linked to said StaP or said StiP, or said 10. The molecule of claim 9, comprising SEQ ID NO: 1: 5'CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3' modified by being covalently linked to said StaP or said StiP via BFL. said PMO alters the expression in humans or animals of a gene associated with the disease of Duchenne muscular dystrophy, or said PMO is directly covalently linked to said StaP or said StiP, or said 11. The molecule of claim 10, comprising SEQ ID NO: 1: 5'CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3' modified by being covalently linked to said StaP or said StiP via BFL. said PMO alters the expression in humans or animals of a gene associated with the disease of Duchenne muscular dystrophy, or said PMO is directly covalently linked to said StaP or said StiP, or said 12. The molecule of claim 11, comprising SEQ ID NO: 1: 5'CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3' modified by being covalently linked to said StaP or said StiP via BFL. said PMO alters the expression in humans or animals of a gene associated with the disease of Duchenne muscular dystrophy, or said PMO is directly covalently linked to said StaP or said StiP, or said 13. The molecule of claim 12, comprising SEQ ID NO: 1: 5'CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3' modified by being covalently linked to said StaP or said StiP via BFL. 2. The molecule of claim 1, wherein said BFL is present in said molecule and covalently attached to each of said bioactive oligonucleotide and said StaP or said StiP. 2. The molecule of claim 1, wherein said bioactive oligonucleotide comprises RNA, said BFL is present in said molecule and is covalently attached to said bioactive oligonucleotide and said StaP or said StiP, respectively. . A composition comprising the molecule of any one of claims 1-24 and one or more pharmaceutically acceptable excipients.