GB2574525A - Improvements in drug delivery - Google Patents

Improvements in drug delivery Download PDF

Info

Publication number
GB2574525A
GB2574525A GB1912318.1A GB201912318A GB2574525A GB 2574525 A GB2574525 A GB 2574525A GB 201912318 A GB201912318 A GB 201912318A GB 2574525 A GB2574525 A GB 2574525A
Authority
GB
United Kingdom
Prior art keywords
dccpm
bac
peptide
stabilized
pmo
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
GB1912318.1A
Other versions
GB201912318D0 (en
GB2574525B (en
Inventor
Foster Keith
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sutura Therapeutics Ltd
Original Assignee
Sutura Therapeutics Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sutura Therapeutics Ltd filed Critical Sutura Therapeutics Ltd
Priority to GB1912318.1A priority Critical patent/GB2574525B/en
Priority claimed from GB1522548.5A external-priority patent/GB2545898B/en
Publication of GB201912318D0 publication Critical patent/GB201912318D0/en
Publication of GB2574525A publication Critical patent/GB2574525A/en
Application granted granted Critical
Publication of GB2574525B publication Critical patent/GB2574525B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64—Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/02—Linear peptides containing at least one abnormal peptide link
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Improvements in drug delivery and more particularly to the use of Cell Penetrating Agents (CPA’s) or Cell Penetrating Peptides (CPP’s) which have been stabilized by, for example: i) stapling two amino acids to form Stapled CPP’s (StaP’s) or ii) stitching three or more amino acids to form stitched CPP’s (StiP’s) are claimed. Said CPP’s are conjugated to a drug or Biologically Active Compound (BAC) directly or via a Bi-Functional Linker (BFL) so that the BAC can be carried though a cell membrane by the CPP. The resulting molecules are referred to as Drug Carrying Cell Penetrating Molecules (DCCPM’s). The preferred BAC is an electrically low charge carrying oligonucleotide such as a phosphorodiamate morpholino oligonucleotide (PMO). Said methods can be used the treatment of diseases a or genetic conditions. .

Description

[0001] The present invention relates to improvements in drug delivery.
[0002] More particularly it relates to the use of Cell Penetrating Agents (CPA’s), and more particularly still to the use of Cell Penetrating Peptides (CPP’s) which have been stabilized by, for example: i) stapling two amino acids to form Stapled CPP’s (StaP’s) or ii) stitching three or more amino acids to form stitched CPP’s (StiP’s).
[0003] These stabilized CPP’s are conjugated to a drug or Biologically Active Compound (BAC) directly or via a Bi-Functional Linker (BFL) so that the BAC can be carried though a cell membrane by the CPP. The resulting molecules are referred to as Drug Carrying Cell Penetrating Molecules (DCCPM’s).
[0004] The preferred BAC’s delivered in this manner are oligonucleotides (ON’s).
[0005] The invention also relates to a method of facilitating the uptake of a BAC into a cell, the use of a DCCPM in the treatment of a disease requiring alteration of an endogenous or exogenous gene, a method of improving the bioavailability of a drug or BAC, a method of introducing a drug or BAC to a site which is refractory to the drug or BAC in its native state, a method of treating a subject comprising administering the DCCPM’s of the invention and to a pharmaceutical composition comprising the DCCPM and one or more pharmaceutically acceptable excipients.
BACKGROUND TO THE INVENTION [0006] In the treatment of all diseases it is desirable to deliver a drug or BAC into the body, and more preferably into a cell, at a target site, in a manner that ensures a maximal effect with minimal toxicity. This can be challenging.
[0007] An example of drugs or BACs which are delivered in a targeted manner are oligonucleotides (ON’s), which term includes ON analogues.
[0008] ON’s can target essential DNA and RNA sequences and can modulate gene expression in a number of ways that includes steric blocking to suppress (i) RNA splicing, (ii) protein translation or (iii) other nucleic acidmucleic acid or nucleic acid:protein interactions.
[0009] Specifically, the hybridisation of ON’s to specific RNA sequence motifs prevents correct assembly of the spliceosome, so that it is unable to recognise the target exon(s) in the premRNA and hence excludes these exon in the mature gene transcript. Exclusion of an in-frame exon can lead to a truncated yet functional gene product; exclusion of an out of frame exon results in a frame-shift of the transcript, potentially leading to a premature stop codon and a reduction in the target gene expression level.
[0010] Additionally, ON’s can be designed to target 5’ translation initiation start sites of viral gene transcript(s) to prevent binding of the translational machinery. Using antisense oligonucleotides (ASO) to suppress viral translation is a well-established technology1 and has progressed into clinical trials for viral haemorrhagic fevers such as Marburg and Ebola2·3.
[0011] Also, ON’s can be designed to form aptamers such that the secondary and tertiary structures can bind proteins or other cellular targets thus impacting on specific gene expression levels.
[0012] An advantage of steric blocking based suppression is that siRNA/RNAi based RNase Idinduction of the RNA Induced Silencing Complex results in a reduced likelihood of off target side effects. In addition, ON’s can be engineered as aptamers, to bind small proteins or metabolites.
[0013] Indeed, uncharged ON backbones such as phosphorodiamate morpholino oligonucleotides (PMOs) represent attractive BAC’s and have an impeccable safety record in a preclinical and clinical setting 2·4-7. However, their ability to penetrate cells and access their targets is compromised due to their uncharged nature8 [0014] Overcoming the problem of facilitating their entry into cells is therefore desirable.
[0015] Over the last 20 years much research has been dedicated to developing CPA’s that facilitate delivery of drugs and BAC’s to the biological site of action.
[0016] The approach has been to use charged peptides, either as non-covalent complexes or as covalent conjugates, to facilitate cell entry of a BAC. A peptide capable of effecting peptidemediated cell delivery may also be referred to as a Cell Delivery Peptide (CDP). Examples include: poly arginine, penetratin (based upon an antennapedia homeodomain), or PMO internalization peptides (PIPs).
[0017] However, since their first description, 9 and given that many CPPs contain multiple arginines, β-alanine and 6-aminohexanoic acid residues, {e.g. poly-Arg12, TAT, Penetratin, Pip6a) [database maintained at http://crdd.osdd.net/raqhava/cppsite/11 °, it is surprising that no CPP-delivered drug has progressed through all phases of clinical trials. In part, this may be because the common arginine-rich core, which makes most CPP’s effective, also causes membrane deformities 11 and in higher mammals that manifests as prohibitive toxic side effects such as tubular degeneration of the kidney 12.
[0018] The Applicant has overcome this major impediment by utilising stabilized CPA’s. By linking a drug or BAC to a stabilized CPA, including stitched and stapled peptides, they have surprisingly obtained enhanced cellular uptake dynamics, 10-20 fold better than current state of the art CPA’s13·14.
[0019] One way to prepare stapled and stitched peptides, two linked amino acids (stapled) or three or more linked amino acids (stitched), is to incorporate amino acids into the peptide that are modified to bear e.g. an olefin (alkene) group (which may be incorporated at defined relative positions during solid-phase peptide synthesis). For example, on-resin ring-closing metathesis is then used to close one (stapled) or two or more (stitched) all-hydrocarbon cross-links that induce the peptide to adopt a stabilised structure, typically, but not essentially an alpha helix. For StaP’s, it is preferred to use either one or both enantiomers of the un-natural amino acids, termed the S5 (S-pentenylalanine) or R5 (FFpentenylalanine), or the S8 (S-octenylalanine) or R8 (FFoctenylalanine), depending on the stereo-chemical configuration. For StiP’s, a further unnatural olefin-bearing a, a-di-substituted amino acid (B5 or B8) is utilised. Cross linking strategies are however not restricted to ring-closing metathesis of un-natural olefin-bearing a, adi-substituted amino acids. Other cross-linking chemistry’s may be used to stabilize the peptide, such as ring-closing metathesis between O-allylserine analogues (S-OAS or R-OAS).
[0020] The cellular entry dynamics of existing CPAs and the StiP’s and StaP’s differ. Traditional CPPs enter cells via energy-independent direct plasma membrane translocation or via energydependent, clathrin and caveo I in-mediated endocytosis; whereas the StiP’s and StaP’s utilised in the invention enter via an energy dependent, but clathrin and caveolin independent mechanism 13·15. Given that StiP’s and StaP’s uptake is abrogated with reduced cellular decoration of heparin sulphate 13 a macropinocytotic entry mechanism is inferred16.
[0021] Relative to their unmodified peptide precursors, all-hydrocarbon StaP’s and StiP’s generally exhibit robust cellular uptake, significant resistance to proteolytic degradation, and in vivo stability that can support a half-life of more than 12 hours in non-human primates17. It is likely that this increase in drug-likeness stems from the highly rigidified structure and the burial of the backbone amide bonds in the core of e.g. the α-helix. This structural rigidity also decreases the likelihood that StiP’s and StaP’s will be immunogenic, as the design of major histocompatibility complexes is such that peptides must adopt an extended conformation to be presented. The potential lack of membrane toxicity and immunogenicity enhances the clinical translatability of compounds when conjugated to drugs and BAC’s such as ON’s.
[0022] ONs can be used to induce a steric block to any gene in humans, animals and lower order organisms and thus can be applied to natural disease (including genetic and age-related diseases) or acquired diseases in humans and animals.
[0023] For example, viral haemorrhagic fevers (VHFs) are animal-borne illnesses in which a prolonged inflammatory cytokine response leads to the gradual destruction of veins and arteries. Causes of VHF include Ebola and Marburg viruses and several Arenaviruses; these diseases are presently considered untreatable. Viral haemorrhagic fevers are characterized by high fever and bleeding disorders, and can cause death by shock and organ failure. ASOs can be designed to target 5’ translation initiation start sites of viral gene transcript(s) to prevent binding of the translational machinery. Using ASO to suppress viral translation is a wellestablished technology 1 and has progressed into clinical trials for viral haemorrhagic fevers such as Marburg and Ebola 2·3. One PMO, AVI-7537 was evaluated for human use in the West African Ebola outbreak in 2014-15.
[0024] Some tissues are particularly refractory to naked PMO transfection, e.g. heart, which may reflect differential vesicle-mediated PMO uptake mechanisms 15. In fact, direct intra-cardiac injection of naked PMO does not even lead to efficient transfection 18, and refractory tissues tend to require repeat administration or high dose strategies 19-21. However, whilst CPP conjugation improves PMO bio-distribution and serum stability22-24, toxicity is still a major roadblock for pipeline development12.
[0025] For effective clinical translation of steric blocking ASOs, CPPs need to effectively deliver the BAC to either the cytoplasm or nucleoplasm whilst limiting any toxicity associated with cell entry.
[0026] Thus, providing DCCPM’s which are able to deliver a drug or BAC more efficiently or to a target site, or with lower toxicity would be highly desirable.
BRIEF SUMMARY OF THE DISCLOSURE [0027] In accordance with a first aspect of the present invention there is provided a drug carrying cell penetrating molecule (DCCPM) comprising:
i. a biologically active compound (BAC), and ii. a cell penetrating agent (CPA), which BAC and CPA are linked directly or via a bi-functional linker (BFL), and wherein the CPA is a stabilized peptide (CPP).
[0028] The peptide has been stabilized by having a conformation imposed upon it, by for example stapling two conformationally adjacent amino acids together to from a stapled peptide (StaP), or stitching at least three conformationally adjacent amino acids to form a stitched peptide (StiP).
[0029] The stapling or stitching results in the formation of a cross link or bridge between two conformationally adjacent amino acids of the peptide.
[0030] In a preferred embodiment the cross link or bridge comprises two components, a hydrocarbon bridge and a terminal methyl group. The hydrocarbon bridge may be composed of a double hydrocarbon bond or following a further reduction to a single hydrocarbon bond.
[0031] The CPP preferably comprises at least two un-natural amino acids bearing allhydrocarbon tethers {e.g. a-methyl,a-pentenyl glycine).
[0032] The preferred stapled or stitched CPPs incorporate one or more of: a (S)pentenylalanine (S5) or its enantiomer (R5), a S-octenylalanine (S8) or its enantiomer (R8) or combinations thereof (e.g F?-octenylalanine/S-pentenylalanine (R8/S5) or S-octenylalanine/F?pentenylalanine (S8/R5).
[0033] The preferred unnatural amino acids incorporated into the CPPs and reacted to form a cross link or bridge between them are illustrated in Table 1 and some exemplary and preferred resulting CPPs are illustrated in Table 2.
[0034] Table 1
Unnatural Amino Acids
>3 'Π k Me S5:n=1 SS : n=4 \ v J Tn (n L n c V'v $ J-HN CO-| B5:n=1 BS:n=4 ψη \ Me |-HN R5 : n=1 R8 : n=4
) o ( XH |-ΗΝ· CO-j S-OAS O ( H R-OAS
[0035] Table 2
Peptide sequence Length f ’eptide Type
pAla-RKF-SS-RLF-SS 8 i, i+4 Staple
pAla-RKF-S5-RLF-S5 (reduced) 8 i, i+4 Staple
pAla-RKF-S5-RLF-S5-SY 10 i, i+4Staple
pAia-RKF-SS-RLF-SS-SY (reduced) 10 i, i+4Staple
pAla-RELRREI-SS-LCR-SS-HHST 16 i, i+4Staple
3Ala-RELRREI-S5-LCR-S5-HHST 16 i, i+4 Staple
pAla-S8-RQARRN-85-RRRWRE-S8-QR 17 i, +4, i+11 Stitch
0Ala-S8-RQARRN-85-RRRWRE-S8-QR (reduced) 17 i, +4, i+11 Stitch
pAla-S8-RQARRQ-B5-RRRWRE-S8-QR 17 i, +4, i+11 Stitch
βΑ I a-SS- RQARRQ- 85- RRRWR E-S8- QR (re duce d) 17 i. +4, i+11 Stitch
pAla-TRQ-S5-RRN-B5-RRRWRE-S8-QR 17 i, +4, ί+ll Stitch
£Ala-TRQ-S5-RRN-85-RRRWRE-S8-QR (reduced) 17 i, +4, i+11 Stitch
PAIa-TRQ-S5-RRQ-85-RRRWRE-S8-QR 17 i. +4, i+11 Stitch
pAla-TRQ-S5-RRQ-85-RRRWRE-S8-QR (reduced) 17 i, +4, i+11 Stitch
pAla-TRQ-S5-RRA-B5-RRRWRE-S8-QR 17 i, +4, i+11 Stitch
pAla-TRQ-S5-RRA-B5-RRRWRE-S8-QR (reduced) 17 i. +4, i+11 Stitch
S5= α-methyl, α-alkenylglycine with 5 carbon chain S8= α-methyl, a-alkenylglycine with 8 carbon chain B5= a-methyl, α-alkenyiglycine with two 5 carbon chain [0036] Alternative CPPs and their method of manufacture are disclosed in Chu et al, 2014 and associated supplementary information and are incorporated by reference13.
[0037] The exemplified stabilized peptide comprises two or more olefin bearing side chains that 5 are covalently formed, typically by means of a ring-closing metathesis.
[0038] The stabilized conformation typically comprises at least one alpha helix. It may however, in the alternative, comprise at least one beta sheet or comprises at least one alpha helix and one beta sheet.
[0039] The preferred BAC is an oligonucleotide (ON), more preferably still an anti-sense 10 oligonucleotide (AON). Different anti-sense oligonucleotide chemistries are illustrated in Table 3 with the use of phosphorodiamate morpholino oligonucleotides (PMOs) being preferred.
[0040] Table 3
ξ
0 ““Ί li f S O-i i>. D 0 ““t > > δ 1-0 y
0 X NHX 0 OMe
S=p-O© 0=1 d .0 ·.,: Ο-Ρ-Οθ
3,,..
Phosphorothioate (PS) N*3 Phosphoramidite (NP) 2-0-Methyl (2’ O-Me)
0—1 hb O u δ O-η g
0 o .— 1 OMe οθ Aho
0=P“Orx 0-: P -o'· ο^ρ-οθ
0... θ,.
2'-O-Methoxyethvl (MOE)
Locked Nucleic Acid (LNA; Unlocked Nucleic Acid (UNA)
’NH £ o~ Ί
1 ^-οζ/ 0
/ o f ,o N
>-ΝΗ O' 0 ~P O' t 0,, XN-P=O 7 <
Peptide Nucleic Acid (PNA) 2’F-Arabino Nucleic Acid Phoshoramidate
2'F-ANA: morpholino (PMO)
%
o O~ 1 Li 8
J- o
'('1 Ab Π [
ό 9 -
O^P-Y O= -p-o'·
0,. Y= 0, s cm
Tncydo-DNA (tcDNA) S-constrained-ethyi (cET)
[0041] The BAC may target and alter the expression of an endogenous or exogenous gene. Endogenous gene targets include but are not limited to genes associated with neuromuscular disease, metabolic disease, cancer, age-related degenerative diseases and exogenous gene targets include those of an acquired viral infection.
[0042] Whilst the BAC may be linked to the CPP directly the Applicant has found the use of a desirable BFL. Exemplary, non-limiting BFL chemistries are illustrated in Table 4.
[0043] Table 4
I pressri,. icystoine ίϊ?· aSasfedi to tirte' w
ter »« ssagent Requiresnsat
1 7$ S»CC y
·- V'·/ 5 Ams ¥
3 BWS ¥ e.g. ^Ata-RKF-S5· RLF-S5
4 o -. A 1? Tv v..·'· \ c* .-V ¥
5 xJi ..-s. j '' X....· X..X x< % DWS y
s P escs y
7 J ° -5 jj ’ O Lc-smcc Y
c o --·>·0n A o o DSG N
3 . AH DSCDS N
[0044] In a preferred chemistry an amine to sulphydryl cross linker containing N10 hydroxysuccinimide esters and malemide reactive groups separated by a cyclohexane spacer is utilized, namely succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC Compound II, Fig 1).
[0045] Thus a CPA, such as Compound III (Fig 1) may be covalently linked to a first end of the BFL (Compound II) with the BAC (Compound I) being covalently or non-covalently linked to a second end of the BFL to generate a DCCPM (Compound V).
[0046] According to a second aspect of the invention there is provided a method for facilitating the uptake of a biologically active compound (BAC) into a cell by the conjugation of the biologically active compound, directly or via a bi-functional linker (BFL), to a cell penetrating agent (CPA) which is a stabilized peptide, to form a drug carrying cell penetrating molecule (DCCPM) and presenting said DCCPM to said cell in a suitable vehicle.
[0047] According to a third aspect of the present invention there is provided a DCCPM of the first aspect of the invention for use in the treatment of a disease requiring alteration of the expression of an endogenous or exogenous gene.
[0048] The DCCPM may be used in the treatment of a, for example, neuromuscular disease, metabolic disease, cancer, age-related degenerative disease or to treat an acquired viral infection.
[0049] In one embodiment the DCCPM is used in the treatment of a muscular dystrophy e.g. Duchenne muscular dystrophy.
[0050] In such an embodiment the DCCPM may comprise an AON targeting exon 51 of the dystrophin gene.
[0051] In accordance with a forth aspect of the present invention there is provided a method of improving the bioavailability of a drug or BAC comprising linking the drug or BAC to a CPP which is a stabilized peptide.
[0052] In accordance with a fifth aspect of the present invention there is provided a method of introducing a drug or BAC to a site which is refractory to a drug or BAC in its native state comprising linking the drug or BAC to a CPP which is a stabilized peptide and administering it to a subject.
[0053] The DCCPMs of the invention can be used to administer the drug or BAC to a target tissue, such as, for example the heart, brain or muscle.
[0054] In accordance with a sixth aspect of the present invention there is provided a method of treating a subject to alter the expression of an endogenous or exogenous gene comprising administering a DCCPM of the invention to a subject.
[0055] In accordance with a seventh aspect of the present invention there is provided a composition comprising a DCCPM of the invention and one or more pharmaceutically acceptable excipients enabling the composition to be administered orally, parenterally, intravenously or topically.
BRIEF DESCRIPTION OF THE DRAWINGS [0056] Embodiments of the invention are further described hereinafter with reference to the accompanying Drawings, in which:
[0057] Figure 1 shows a general schematic of a FITC labeled DCCPM (compound V). A FITC labeled PMO (compound I) is linked to succinimidyl 4-(N-maleimidomethyl)cyclohexane-1carboxylate (SMCC; compound II) forming a SMCC linked PMO intermediate (compound IV) and then to a CPA (compound III), forming compound V.
[0058] Figure 2 shows a general schematic of a FITC labeled DCCPM in which the n-termini of the FITC labelled PMO (compound I) and the CPA (compound III) are linked via a bi-functional linker disuccinimidyl glutarate (DSG) forming compound VI.
[0059] Figure 3 shows a general schematic of a FITC labeled DCCPM in which the FITC labelled PMO (compound I) and the CPA (compound III) are linked directly forming compound VII.
[0060] Figure 4 shows the liquid chromatography-mass spectrometry conformation of the synthetic steps and the molecular masses of compound I (Figure 4a); compound IV (Figure 4b); and compound V (Figure 4c).
[0061] Figure 5 shows a dose dependent increase in DCCPM delivery into a human osteosarcoma cell line (U2OS) maintained in culture, without transfection reagent. The biologically active compound was a PMO with a sequence:
Sequence id 1: 5’GGCCAAACCTCGGCTTACCTGAAAT3’ (an antisense reagent targeted to exon 23 of the mouse dystrophin gene, that causes the exclusion of exon 23 during mRNA splicing maturation); the bi-functional linker was SMCC; the StaP was pAla-RKF-S5-RLF-S5. This configuration of DCCPM is depicted as PMO-SMCC-StaP in the subsequent figures.
[0062] Figure 6 shows a graphical representation of the dose dependent increase in PMOSMCC-StaP delivery into U2OS cells maintained in culture, without transfection reagent shown in Figure 5.
[0063] Figure 7 shows PMO-SMCC-StaP delivery into a mouse cell line that harbours the mdx mutation of the dystrophin gene (H2K mdx) maintained in culture, without transfection reagent.
[0064] Figure 8 shows an agarose gel electrophoresis image demonstrating that exon exclusion of the mouse dystrophin exon 23 is restricted to H2K mdx cells that have been transfected with either 5μΜ PMO-SMCC-StaP or 5μΜ naked PMO alone. 24 hours after incubation with PMOSMCC-StaP or naked PMO, H2K mdx cells were recovered and RNA isolated. The RNA was reversed transcribed and an amplification between exons 20 and 26 of the mouse dystrophin gene, followed by a nested amplification between exon 20 and 26 was performed to yield a full length product of 901 bp fragment if exon 23 is present or 688bp fragment if exon 23 is excluded.
[0065] Figure 9 shows immunocytochemical staining for dystrophin from Tibialis anterior muscles of mdx mice following an intramuscular injection of either 2.2 nmol PMO-SMCC-StaP or 2.2nmol naked PMO into the Tibialis anterior muscle. Muscles were recovered 7 day post administration.
[0066] Figure 10 shows a graphical representation of an immunocytochemical staining for dystrophin from Tibialis anterior muscles of mdx mice injected with either 2.2 nmol PMO-SMCCStaP or 2.2nmol naked PMO. The total number of dystrophin positive fibres is equivocal between groups, with no statically significant difference. This data suggest that the conjugation of a SMCC-StaP complex to a PMO does not alter the biological activity of the PMO.
[0067] Figure 11 shows immunocytochemical staining for dystrophin from diaphragm muscles of mdx mice following an intraperitoneal injection of 9mg/kg PMO-SMCC-StaP or 9mg/kg naked PMO. Muscles were recovered 7 days post administration. There is a greater level of dystrophin restoration in diaphragm muscles from PMO-SMCC-StaP treated cohort compared to the PMO cohort.
[0068] Figure 12 shows immunocytochemical staining for dystrophin from heart muscles of mdx mice following an intraperitoneal injection of 9mg/kg PMO-SMCC-StaP or 9mg/kg naked PMO. Muscles were recovered 7 days post administration. Dystrophin restoration was restricted to heart muscle of the PMO-SMCC-StaP treated cohort only. The heart is refractory to PMO induced restoration of dystrophin at this dose.
[0069] Figure 13 shows immunocytochemical staining for dystrophin from the cerebellum of mdx mice following an intraperitoneal injection of 9mg/kg PMO-SMCC-StaP or 9mg/kg naked PMO. Cerebella were recovered 7 days post administration. Dystrophin restoration was restricted to purkinje cell of the PMO-SMCC-StaP treated cohort only. The cerebellum is refractory to PMO induced restoration of dystrophin at this dose.
DETAILED DESCRIPTION [0070] The invention is illustrated with reference to a single example which proves the benefit of the claimed invention.
[0071] An exemplary drug carrying cell penetrating molecule (DCCPM) was produced with a FITC label in order to demonstrate cellular uptake (Example 1).
[0072] The exemplary DCCPM comprises:
i) a biologically active compound (BAG) - (see Table 3 for non-limiting examples);
ii) a cell penetrating agent (CPA) which is a stabilized peptide (See Table 1 for nonlimiting examples); and iii) a bi-functional linker (BFL) (see Table 4 for non-limiting examples) [0073] The three components forming the DCCPM are described in more detail below, although as illustrated in Fig 3, the BAC and CPA can be linked directly.
1. The Biologically Active Compound.
[0074] The biologically active compound is any compound that can exert a biological effect within a biological cell. Preferably, though not essentially, the BAC is one which will impact on the expression of one or more endogenous or exogenous genes. Examples include nucleic acids, DNAzymes, ribozymes, aptamers and pharmaceuticals. Preferred biologically active compounds for use in the present invention include electrically neutral oligonucleotides (charge -1 to +1 at pH 7.5) such as polynucleic acids (PNAs) or PMOs or their modified derivatives that might impart an electric charge (either positive or negative).
[0075] The biologically active compound may be used as a steric blocking compound to suppress or enhance: i) RNA splicing; ii) protein translation or iii) other nucleic acidmucleic acid or nucleic acid:protein interactions, altering the gene expression of endogenous or exogenous (pathogen derived) genes.
[0076] The hybridisation of ON’s to specific RNA sequence motifs prevents correct assembly of the spliceosome, so that it is unable to recognise the target exon(s) in the pre-mRNA and hence excludes these exon in the mature gene transcript. Exclusion of an inframe exon can lead to a truncated yet functional gene product; exclusion of an out of frame exon results in a frame-shift of the transcript, potentially leading to a premature stop codon and a reduction in the target gene expression level.
[0077] Additionally, ON’s can be designed to target 5’ translation initiation start sites of viral gene transcript(s) to prevent binding of the translational machinery. Using ASO to suppress viral translation is a well-established technology and has progressed into clinical trials for viral haemorrhagic fevers such as Marburg and Ebola.
[0078] Also, ON can be designed to form aptamers such that the secondary and tertiary structures can bind proteins or other cellular targets thus impacting on specific gene expression levels.
[0079] Non-limiting exemplary ON chemistries are illustrated in Table 3.
[0080] In one example, the target is exon 51 of the dystrophin gene and comprises the sequence:
Sequence id 2: 5’CUCCAACAUCAAGGAAGAUGGCAUUUCUAG3’
2. The cell penetrating agent (CPA) which is a stabilized peptide [0081] The cell penetrating agents of the invention are stabilized peptides.
[0082] The peptides may be stabilized by stapling, to form a stapled peptide (StaP), or by stitching to form a stitched peptide (StiP) [0083] All-hydrocarbon staples and stitches may confer, on e.g. an α-helical structure, protease resistance, cellular penetrance, and biological activity.
[0084] Non-limiting examples of stapled and stitched peptide sequences are illustrated in Table 2 and include peptide sequences including S5, S8 and B5 (as defined in Table 2).
[0085] Stabilisation of e.g. the α-helical structure can be achieved by, for example, a ringclosing metathesis and may be catalysed by a variety of ruthenium catalysts including Grubbs generations 1 and 2 and Grubbs-Hoyveda generations 1 and 2.
[0086] All the peptide components (amino acids, unnatural amino acids, unstapled/unstitched, partially stapled/stitched and stapled/stitched peptides) may exist in specific geometric or stereoisomeric forms. All compounds include cis- and irans-isomers, (R)- and (S)-enantiomers, diastereoisomers and racemic mixtures thereof.
[0087] Preferred isomer/enantiomers will be enriched to give a greater proportion of one particular isomer/enantiomers. Embodiments thereof may be made of 90%, 95%, 98% or 99% by weight of a preferred isomer/enantiomers.
[0088] Non-limiting examples of unnatural amino acids used in stabilising a peptide structure are illustrated in table 1.
[0089] In one embodiment the applicant employs α,α-disubstituted unnatural amino acids bearing all-hydrocarbon tethers {e.g. a-methyl,o-pentenyl glycine) [0090] For single turn stapling, one embodiment could employ a (S)-pentenylalanine (S5) at, e.g. /, / + 4 positions, and in another embodiment, for double turn stapling, a combination of either F?-octenylalanine/S-pentenylalanine (R8/S5) or S-octenylalanine/F?-pentenylalanine (S8/R5) at e.g. /, / + 7 positions can be used. The same pairings can be used to install more than one staple within a given peptide template. S5 can be substituted at /, B5 at postion /+ 4 positions, and S8 can be been substituted at /, / +4, /+11 positions to generate stitched peptides. The S5 configured amino acid and its enantiomer R5, or S8 configured amino acid and its enantiomer R8, differ only in the opposite stereochemical configuration of the staple they bear.
[0091] Based upon the inclusion of a single or a double turn staple peptides may comprise of one or more of the sequences in Table 2. Based upon specific peptide shown in Table 2, a person skilled in the art can easily envisage peptides with 3, 4, 5 or more turn stabilising staples.
[0092] In one embodiment the cell penetrating agent has a stitch or staple peptide comprising the sequence 3-Ala-RFK-S5-RLF-S5.
[0093] In another embodiment the peptide is a branched stapled peptide. The branched stapled peptide comprises of 2 or more chains of peptides. Branched peptides may be formed using any method know to the art; in one embodiment a lysine residue is used to branch two peptide chains.
[0094] Functional derivatives of disclosed peptide sequences could be used. Functional derivatives may have representative fragments or homologues or peptides that include insertions to the original peptide. Typical derivative would have 70%, 80%, 90% or more of the original peptide sequence and may have up to 200% of the number of amino acids of the original peptide. The derivatives would be used to enhance the delivery of a biologically active compounds.
3. Bi-functional Linker [0095] A bi-functional linker may be used to link the BAC to the CPA.
[0096] Preferred linkers will link between, for example, an amine group and a sulfhydryl (thiol) group (usually a cysteine residue). Examples of substrates to achieve this include, but are not limited to, SMCC (succinimidyl 4-(N-maleimidomethyl)cyclohexane-1 -carboxylate), AMAS (N-amaleimidoacet-oxysuccinimide ester, BMPS (Ν-β-maleimidopropyl-oxysuccinimide ester), GMBS (Ν-γ-aleimidobutyryl-oxysuccinimide ester), DMVS (Ν-δ-maleimidovaleryloxysuccinimide ester, EMCS (N- ε-malemidocaproyl-oxysuccinimide ester), and LC-SMCC (Succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate) as exemplified in Table 4.
[0097] Other linkers such as DSG (disuccinimidyl gluterate) and DSCDS (disuccinimidylcyclohexl-1,4-diester) will include the ability to link the 5’-amino group of the BAC to the Nterminus of the CPA (Table 4, entries 8 and 9).
[0098] The biologically active compound is covalently or non-covalently attached to the chimeric cell delivery peptide. Again, this can be done using any method known in the art. Preferably, the cell delivery peptide is attached to the biologically active compound by means of a disulphide bridge or a thiol maleimide linker e.g. SMCC; the attachment may be by means of an amide linker (preferably a stable amide linker) or an oxime linker or a thioether linker.
EXAMPLE 1: (Proof of principle)
DCCPM to enhance RNA steric blocking in treating Duchenne muscular dystrophy (DMD).
Introduction [0099] Duchenne muscular dystrophy (DMD) is the most common inherited lethal childhood disease in the world, with a worldwide incidence of approximately 1 in 4000 live births 25. This severe muscle-wasting disorder is caused in the majority of families by gene mutations leading to disruption of the reading frame and premature truncation of the protein dystrophin 26·27.
[00100] RNA splicing suppression of the DMD transcript has particular promise. The hybridisation of ASOs to specific RNA sequence motifs prevents correct assembly of the spliceosome, so that it is unable to recognise the target exon(s) in the pre-mRNA and hence excludes them in the mature gene transcript. ASO-mediated RNA splicing suppression resulting in the re-expression of a truncated, yet functional dystrophin protein has been demonstrated in vitro and in the pre-clinical mdx mouse model21·28-33, which led to clinical development programs7·34.
[00101] Although intravenously administered PMOs have demonstrated a dosedependent increase in dystrophin re-expression with some functional benefit7·35, skeletal muscle dystrophin restoration is still very variable between patients after many multiple administrations. Importantly, many other target tissues (e.g. brain and heart) remain refractory to PMO transfection even when repeat administration or high dose strategies are employed19-21.
[00102] To date unmodified CPA conjugation improves PMO bio-distribution and serum stability22-24, however toxicity is still a major roadblock for pipeline development12.
[00103] Applicant hypothesised that a CPA based upon a stabilized e.g. StaP (or StiP) conjugated to a PMO known to cause RNA splicing suppression of the DMD transcript, would lead to a greater level of dystrophin restoration and re-expression of dystrophin in tissues refractory to naked PMO without the potential for CPA related toxicity.
Materials and Methods
PMO and Peptide Conjugation
PMO were synthesised with a 5’ amine group and 3’ fluorescein isothiocyanate (FITC) label and purified >90% by Genetool LLC (Philomath, Oreg. USA). All peptides were synthesized following an established protocol using standard Fmoc-peptide chemistry on Rink amide MBHA resin. The coupling reactions were performed by the addition of a mixture of 10 equivalents of the amino acids, 9.9 equivalents of HCTU and 20 equivalents of DIPEA in NMP (equivalents relative to initial loading of Rink amide MBHA resin). The reactions were allowed to proceed for at least one hour. Coupling of non-natural amino acids (R/S5, R/S8 or B5) was performed with 4 equivalents of the amino acid, 3.9 equivalents of HCTU and 10 equivalents of DIPEA in NMP for two hours. The ring closing metathesis reaction of the olefin-containing non-natural amino acids was facilitated with Grubbs I catalyst (benzylidene-bis(tricyclohexylphosphine)dichlororuthenium) dissolved to approximately 10mg/mL in 1,2-dichloroethane (DCE) for two hours under nitrogen bubbling. Subsequently, excess catalyst was washed from the resin with DCE and then coupled with an N-terminal FITC. Upon completion, peptides were simultaneously cleaved from the resin and de-protected using a cleavage cocktail containing 95% TFA, 2.5% TIS and 2.5% water. Crude peptides were dissolved in 50% acetonitrile/water, passed through a 0.2 pm syringe filter, and purified by reverse phase HPLC using a C-18 column (Agilent, Palo Alto, CA). Compound identification and purity was assessed using coupled LC/MS (Agilent, Palo Alto, CA). Purified fractions were pooled and evaporated to remove acetonitrile and trace TFA by Speedvac and then lyophilized to dryness.
Cell Culture and Transfection [00104] U2OS cell (Human osteosarcoma) were cultured in high glucose DMEM supplemented with 10% foetal calf serum (Sigma, UK) at 37°c under a 8% CO2/92% air atmosphere.
[00105] H2K mdx mouse myoblasts were cultured at 33°C under a 8% CO2/92% air atmosphere in high-glucose DMEM supplemented with 20% fetal calf serum, 0.5% chicken embryo extract (PAA laboratories Ltd, Yeovil, UK), and 20 units/ml γ-interferon (Roche applied science, Penzberg, Germany). Cells were then treated with trypsin and plated at 8x104/cm2in 24-well plates coated with 0.1mg/ml ECM gel (Sigma). H2K mdx cells were transfected 24 h seeding with treatment in a final volume of 0.2 ml of normal growth media. Following 4 hours of transfection, the PMO or PMO-SAP was removed and replaced with DMEM supplemented with 5% horse serum. Fluorescence and RNA extraction was performed 48 hours post transfection. [00106] U2OS cells were incubated with PMO or PMO-SMCC-StaP at increasing concentration (0.5μΜ, 1.0μΜ, 5.0μΜ and 10μΜ) with any facilitation transfection reagent. H2K mdx mouse myoblasts were incubated with PMO or PMO-SAP at 5.0μΜ. Levels of FITC fluorescence was quantified at 494 nm to determine relative entry of PMO and PMO-SAP.
RNA Extraction and nested RT-PCR Analysis [00107] Total RNA was isolated from H2K mdx mouse myoblasts cells (RNeasy, Qiagen, UK). The RNA was reversed transcribed (nanoscript2, Primer Design UK) and an amplification between exons 20 and 26, followed by a nested amplification between exon 20 and 26 was performed to yield a full length product of 901 bp or 688bp if the mouse dystrophin exon 23 was excluded. Products loaded in a 1% agarose gel (buffered with tris acetate 40mM and 1mM ethylenediaminetetraacetic acid).
Animals [00108] 12 week old mdx female mice were used in all experiments (n=4 for each control and test groups). All experiments were carried out in the Animal unit, School of Biological Science, University of Reading, Reading, UK according to procedures authorized by the UK Home Office. Mice were killed by CO2 inhalation or cervical dislocation at desired time points, and muscles and other tissues were snap-frozen in liquid nitrogen-cooled isopentane and stored at -80°C.
Administration of PMO or PMO-StaCPA [00109] Intramuscular administrations: Tibialis anterior muscles of mdx mice injected with either 2.2 nmol PMO-SMCC-StaP or 2.2nmol naked PMO. Systemic administration: mdx mice were subject to an intraperitoneal injection of 9mg/kg PMO-SMCC-StaP or 9mg/kg naked PMO.
Histology and Immunoctyochemistry [00110] 10μΜ cryosections were cut and dystrophin protein was determined using rabbit polyclonal antibody to dystrophin (ab15277; Abeam, Cambridge, UK). Routine haematoxylin and eosin staining was used to assess general pathology and morphology.
Statistical Analysis [00111] All data are reported as mean values ±SEM. Statistical differences between treatment groups and control groups were evaluated by SigmaStat (Systat Software, UK) and student's t test was applied. Significance was accepted for p-values<0.05.
Results [00112] FITC labelled PMO was conjugated to the bi-functional linker (SMCC) and a StaP (PAIa-RKF-S5-RLF-S5) as confirmed by mass spectrometry (Figure 4). Subsequently PMOSMCC-StaP and naked PMO were transfected into a standard cell line (U2OS) to determine if the StaP conferred enhanced cell entry to the cell. Naked PMO were refractory to cell entry, giving only a background FITC fluorescence signal, compared to a dose dependant increase in fluorescence with PMO-SMCC-StaP (Figures 5 and 6). The lack of signal above background does not allow statistical analyses of the comparative increase in fluorescence, but clearly demonstrated that without the StaP conjugation, PMO did not enter the cell.
[00113] When transfection experiments were conducted in the H2K mdx mouse myoblasts cells, it confirmed the finding that naked PMO are refractory to cell entry, which was overcome with the conjugation of a StaP (Figure 7) and that the StaCPA mediated delivery of PMO resulted in the steric blockade of RNA editing of the dystrophin transcript, such that exon 23 was excluded from the transcript (Figure 8).
[00114] In order to determine if the StaP hindered the biological activity of the PMO, direct intramuscular administrations (2.2 nmol) were conducted into the Tibialis anterior muscle of mdx female mice, with muscle recovered 7 days post-administration. The percentage of dystrophin re-expression was equivocal between the PMO-SMCC-StaP (805.75) and the naked PMO (762.25) with no statistical significant difference (n=4, p=0.863; Figures 9 and 10). Thus it was determined that the StaP does not confer any steric hindrance to the biological activity of the PMO.
[00115] Systemic intra-peritoneal administrations of PMO-SMCC-StaP and naked PMO were conducted in mdx females to determine if the SAP moiety enhanced cell entry. Suboptimal amounts (9mg/kg) were administered and a series of tissues (skeletal muscle, heart and brain) recovered 7 days post-administration (Figures 11,12 and 13).
Conclusion [00116] From the example it can be seen that the conjugation of a CPA, stabilized by stapling, to a BAC (in the form of a PMO), via a BFL, facilitates entry of the PMO entry into a cell. The StaP CPA facilitated PMO entry in both in vitro and in vivo assay systems.
[00117] In the in vivo model of RNA splicing suppression demonstrated that the biological action of an α-helical peptide conjugated PMO is equivalent to naked PMO following intramuscular administration, thus determining that no steric hindrance is exerted upon the PMO when coupled to an α-helical peptide moiety.
[00118] More significantly the data demonstrates the fact that in the in vivo model of RNA splicing suppression the stabilized CPA enhanced cell entry into skeletal muscle.
[00119] Surprisingly, and very significantly, it has been demonstrated that tissues refractory to naked PMO transfection re-express dystrophin protein in both the heart and brain (purkinje cell) compartments when the PMO is conjugated with a StaP (Figures 12 and 13). [00120] The repertoire of human and animal diseases that can be addressed is now expanded and enhanced due to the increased pharmacodynamics of the PMOs when conjugated with a stabilised peptide. Neuromuscular disease, metabolic disease, cancer, agerelated degenerative diseases and acquired viral infection can all be targeted.
References;
Iversen, P. L. etal. Discovery and early development of AVI-7537 and AVI-7288 for the treatment of Ebola virus and Marburg virus infections. Viruses 4, 2806-2830, doi: 10.3390/V4112806 (2012).
Heald, A. E. etal. Safety and pharmacokinetic profiles of phosphorodiamidate morpholino oligomers with activity against ebola virus and marburg virus: results of two single-ascending-dose studies. Antimicrob Agents Chemother58, 6639-6647, doi:10.1128/aac.03442-14 (2014).
Warren, T. K. et al. Advanced antisense therapies for postexposure protection against lethal filovirus infections. Nat Med 16, 991-994, doi:10.1038/nm.2202 (2010).
Dirin, M. & Winkler, J. Influence of diverse chemical modifications on the ADME characteristics and toxicology of antisense oligonucleotides. Expert Opin Biol Ther~\3, 875-888, doi:10.1517/14712598.2013.774366 (2013).
Sazani, P. etal. Repeat-dose toxicology evaluation in cynomolgus monkeys of AVI4658, a phosphorodiamidate morpholino oligomer (PMO) drug for the treatment of duchenne muscular dystrophy. IntJ Toxicol 30, 313-321, doi: 10.1177/1091581811403505 (2011).
Sazani, P., Weller, D. L. & Shrewsbury, S. B. Safety pharmacology and genotoxicity evaluation of AVI-4658. Int J Toxicol 29, 143-156, doi:10.1177/1091581809359206 (2010).
Mendell, J. R. et al. Eteplirsen for the treatment of Duchenne muscular dystrophy. Ann Neurol74, 637-647, doi:10.1002/ana.23982 (2013).
Heemskerk, H. A. etal. In vivo comparison of 2'-O-methyl phosphorothioate and morpholino antisense oligonucleotides for Duchenne muscular dystrophy exon skipping. J Gene Med 11,257-266, doi:10.1002/jgm.1288 [doi] (2009).
Derossi, D., Joliot, A. H., Chassaing, G. & Prochiantz, A. The third helix of the Antennapedia homeodomain translocates through biological membranes. J Biol Chem 269, 10444-10450 (1994).
Gautam, A. et al. CPPsite: a curated database of cell penetrating peptides. Database : the journal of biological databases and curation 2012, bas015, doi:10.1093/database/bas015 (2012).
Hirose, H. etal. Transient focal membrane deformation induced by arginine-rich peptides leads to their direct penetration into cells. Mol Ther 20, 984-993, doi:10.1038/mt.2011.313 (2012).
Moulton, Η. M. & Moulton, J. D. Morpholinos and their peptide conjugates: therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim Biophys Acta 1798, 2296-2303, doi:10.1016/j.bbamem.2O10.02.012 (2010).
Chu, Q. etal. Towards understanding cell penetration by stapled peptides. MedChemComm 6, 111 -119, doi: 10.1039/C4MD00131A (2015).
Hilinski, G. J. etal. Stitched α-Helical Peptides via Bis Ring-Closing Metathesis. Journal of the American Chemical Society 136, 12314-12322, doi:10.1021 /ja505141 j (2014).
Lehto, T. etal. Cellular trafficking determines the exon skipping activity of Pip6a-PMO in mdx skeletal and cardiac muscle cells. Nucleic Acids Res 42, 3207-3217, doi:10.1093/nar/gkt1220 (2014).
Nakase, I. etal. Interaction of arginine-rich peptides with membrane-associated proteoglycans is crucial for induction of actin organization and macropinocytosis. Biochemistry 46, 492-501, doi:10.1021/bi0612824 (2007).
Chang, Y. S. etal. Stapled alpha-helical peptide drug development: a potent dual inhibitor of MDM2 and MDMX for p53-dependent cancer therapy. Proc Natl Acad Sci U SA 110, E3445-3454, doi:10.1073/pnas.1303002110 (2013).
Vitiello, L. etal. In vivo delivery of naked antisense oligos in aged mdx mice: analysis of dystrophin restoration in skeletal and cardiac muscle. Neuromuscul Disord 18, 597-605, doi:S0960-8966(08)00141-7 [pii]10.1016/j.nmd.2008.05.011 [doi] (2008).
Jearawiriyapaisarn, N., Moulton, Η. M., Sazani, P., Kole, R. & Willis, M. S. Long-term improvement in mdx cardiomyopathy after therapy with peptide-conjugated morpholino oligomers. Cardiovasc Res 85, 444-453, doi:cvp335 [pii]10.1093/cvr/cvp335 [doi] (2010).
Wu, B. etal. One-year treatment of morpholino antisense oligomer improves skeletal and cardiac muscle functions in dystrophic mdx mice. Mol TherlQ, 576-583, doi:10.1038/mt.2010.288 (2011).
Wu, B. etal. Effective rescue of dystrophin improves cardiac function in dystrophindeficient mice by a modified morpholino oligomer. Proc Natl Acad Sci U S A 105,1481414819, doi:0805676105 [pii]10.1073/pnas.0805676105 [doi] (2008).
Jearawiriyapaisarn, N. etal. Sustained dystrophin expression induced by peptideconjugated morpholino oligomers in the muscles of mdx mice. Mol TherlQ, 1624-1629, doi:mt2008120 [pii]10.1038/mt.2008.120 [doi] (2008).
Betts, C. etal. Pip6-PMO, A New Generation of Peptide-oligonucleotide Conjugates With Improved Cardiac Exon Skipping Activity for DMD Treatment. Molecular therapy. Nucleic acids 1, e38, doi:10.1038/mtna.2012.30 (2012).
Ivanova, G. D. etal. Improved cell-penetrating peptide-PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle. Nucleic Acids Res 36, 6418-6428 (2008).
Mendell, J. R. etal. Evidence-based path to newborn screening for Duchenne muscular dystrophy. Ann Neurol71,304-313, doi:10.1002/ana.23528 (2012).
Hoffman, E. P., Brown, R. H., Jr. & Kunkel, L. M. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Ce//51,919-928. (1987).
Monaco, A. P., Bertelson, C. J., Liechti-Gallati, S., Moser, H. & Kunkel, L. M. An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics 2, 90-95 (1988).
Aartsma-Rus, A. etal. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet 12, 907-914 (2003).
Alter, J. etal. Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 12, 175-177 (2006).
Kinali, M. etal. Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, doseescalation, proof-of-concept study. Lancet Neurol 8, 918-928, doi:S14744422(09)70211-X [pii]10.1016/S1474-4422(09)70211-X [doi] (2009).
Lu, Q. L. etal. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci U S A 102, 198-203 (2005).
van Deutekom, J. C. etal. Local dystrophin restoration with antisense oligonucleotide PRO051. N Engl J Med 357, 2677-2686, doi:357/26/2677 [pii]10.1056/NEJMoa073108 [doi] (2007).
Wu, B. etal. Dose-dependent restoration of dystrophin expression in cardiac muscle of dystrophic mice by systemically delivered morpholino. Gene Ther 17, 132-140, doi:gt2009120 [pii]10.1038/gt.2009.120 [doi] (2010).
Goemans N, C. C., Kraus JE, et al. Drisapersen efficacy and safety in Duchenne muscular dystrophy: results of a phase III, randomized, double-blind, placebo-controlled trial (study DMD114044). World Muscle Society Congress; Asilomar, CA, USA; Oct 1-5, 2013 (2103).
Cirak, S. etal. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. Lancet 378, 595-605,

Claims (35)

1. A drug carrying cell penetrating molecule (DCCPM) comprising:
i. a biologically active compound (BAC), and ii. a cell penetrating agent (CPA), which BAC and CPA are linked directly or via a bi-functional linker (BFL), and wherein the CPA is a stabilized peptide (CPP).
2. A DCCPM as claimed in claim 1 wherein the stabilized peptide has a conformation imposed upon it.
3. A DCCPM as claimed in any of the preceding claims wherein the stabilized peptide is a stapled peptide (StaP).
4. A DCCPM as claimed in any of the preceding claims wherein the stabilized peptide is a stitched peptide (StiP).
5. A DCCPM as claimed in any of the preceding claims wherein the StiP or StaP comprises a cross link or bridge between two amino acids of the peptide.
6. A DCCPM as claimed in claim 5 wherein the cross link or bridge comprises two components, a hydrocarbon bridge and a terminal methyl group.
7. A DCCPM as claimed in claim 5 wherein the peptide comprises at least two unnatural amino acids bearing all-hydrocarbon tethers {e.g. a-methyl,a-pentenyl glycine).
8. A DCCPM as claimed in claim 6 wherein CPA is stabilized with a staple or stitch incorporating one or more of: a (S)-pentenylalanine (S5) or its enantiomer (R5), a S-octenylalanine (S8) or its enantiomer (R8) or combinations thereof (e.g Roctenylalanine/S-pentenylalanine (R8/S5) or S-octenylalanine/F?-pentenylalanine (S8/R5).
9. A DCCPM as claimed in claim 5 comprising a cross link or bridge between one or more of the unnatural amino acids of Table 1.
10. A DCCPM as claimed in claim 9 wherein the stabilized peptide comprises two or more olefin bearing side chains that are covalently formed.
11. A DCCPM as claimed in claim 2 wherein the stabilized conformation comprises at least one alpha helix.
12. A DCCPM as claimed in claim 2 wherein the stabilized conformation comprises at least one beta sheet.
13. A DCCPM as claimed in claim 2 wherein the stabilized conformation comprises at least one alpha helix and one beta sheet.
14. A DCCPM as claimed in claim 1 wherein the BAC is an oligonucleotide (ON).
15. A DCCPM as claimed in claim 14 wherein the ON is an anti-sense oligonucleotide (AON).
16. A DCCPM as claimed in claim 15 wherein the ON is an anti-sense oligonucleotide comprising a chemistry selected from the compounds of Table 3.
17. A DCCPM as claimed in any of the preceding claims wherein the BAC is a phosphorodiamate morpholino oligonucleotide (PMO).
18. A DCCPM as claimed in any of the preceding claims wherein the BAC alters the expression of an endogenous or exogenous gene.
19. A DCCPM as claimed in claim 18 wherein the endogenous gene targets a neuromuscular disease, a metabolic disease, cancer, an age-related degenerative disease or an acquired viral infection.
20. A DCCPM as claimed in any of the preceding claims wherein the BFL comprises a chemistry selected from the chemistries of Table 4.
21. A DCCPM as claimed in claim 20 comprising an amine to sulphydryl cross linker containing N- hydroxysuccinimide esters and malemide reactive groups separated by a cyclohexane spacer.
22. A DCCPM as claimed in claim 20 or 21 wherein the BFL is a succinimidyl 4-(Nmaleimidomethyl) cyclohexane-1-carboxylate (SMCC).
23. A DCCPM as claimed in claim 20 wherein the CPA is linked to a first end of the BFL covalently.
24. A DCCPM as claimed in claim 20 wherein the BAC is linked to a second end of the BFL covalently or non-covalently.
25. A method for facilitating the uptake of a biologically active compound (BAC) into a cell by the conjugation of the biologically active compound to a cell penetrating agent (CPA) which is a stabilized peptide directly or via a bi-functional linker (BFL) to form a drug carrying cell penetrating molecule (DCCPM) and presenting said DCCPM to said cell in a suitable vehicle.
26. A DCCPM as claimed in any of claims 1-20 for use in the treatment of a disease requiring alteration of the expression of an endogenous or exogenous gene.
27. A DCCPM as claimed in claim 26 for use in the treatment of neuromuscular disease, a metabolic disease, cancer, an age-related degenerative disease or an acquired viral infection.
28. A DCCPM as claimed in claim 26 for use in the treatment of Duchenne’s muscular dystrophy.
29. A DCCPM as claimed in claim 28 wherein the DCCPM comprises an AON targeting exon 51 of the dystrophin gene.
30. A method of improving the bioavailability of a drug or BAC comprising linking the drug or BAC to a CPP which is a stabilized peptide.
31. A method of introducing a drug or BAC to a site which is refractory to the drug or BAC in its native state comprising linking the drug or BAC to a CPP which is a stabilized peptide.
32. A method as claimed in claim 31 wherein the tissue is one of heart, brain or muscle.
33. A method of treating a subject to alter the expression of an endogenous or exogenous gene comprising administering a DCCPM as claimed in any of claims 1-29.
34. A composition comprising a DCCPM as claimed in any of claims 1-29 and one or more pharmaceutically acceptable excipients.
35. A composition as claimed in claim 34 which is adapted for administration orally, parenterally, intravenously or topically.
Intellectual Property Office
GB1912318.1A 2015-12-21 2015-12-21 Improved drug delivery by conjugating oligonucleotides to stitched/stapled peptides Active GB2574525B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
GB1912318.1A GB2574525B (en) 2015-12-21 2015-12-21 Improved drug delivery by conjugating oligonucleotides to stitched/stapled peptides

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1912318.1A GB2574525B (en) 2015-12-21 2015-12-21 Improved drug delivery by conjugating oligonucleotides to stitched/stapled peptides
GB1522548.5A GB2545898B (en) 2015-12-21 2015-12-21 Improved drug delivery by conjugating oligonucleotides to stitched/stapled peptides

Publications (3)

Publication Number Publication Date
GB201912318D0 GB201912318D0 (en) 2019-10-09
GB2574525A true GB2574525A (en) 2019-12-11
GB2574525B GB2574525B (en) 2020-09-02

Family

ID=68109014

Family Applications (1)

Application Number Title Priority Date Filing Date
GB1912318.1A Active GB2574525B (en) 2015-12-21 2015-12-21 Improved drug delivery by conjugating oligonucleotides to stitched/stapled peptides

Country Status (1)

Country Link
GB (1) GB2574525B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989003849A1 (en) * 1987-10-28 1989-05-05 Howard Florey Institute Of Experimental Physiology Oligonucleotide-polyamide conjugates
WO2009054725A2 (en) * 2007-10-26 2009-04-30 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
WO2010123369A1 (en) * 2009-04-24 2010-10-28 Prosensa Technologies B.V. Oligonucleotide comprising an inosine for treating dmd
WO2011131693A2 (en) * 2010-04-19 2011-10-27 Nlife Therapeutics, S.L. Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types
WO2013150338A1 (en) * 2012-04-04 2013-10-10 Centre National De La Recherche Scientifique Stapled cell penetrating peptides for intracellular delivery of molecules
WO2014064258A1 (en) * 2012-10-26 2014-05-01 Nlife Therapeutics, S.L. Compositions and methods for selective delivery of oligonucleotide molecules to cell types

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1989003849A1 (en) * 1987-10-28 1989-05-05 Howard Florey Institute Of Experimental Physiology Oligonucleotide-polyamide conjugates
WO2009054725A2 (en) * 2007-10-26 2009-04-30 Academisch Ziekenhuis Leiden Means and methods for counteracting muscle disorders
WO2010123369A1 (en) * 2009-04-24 2010-10-28 Prosensa Technologies B.V. Oligonucleotide comprising an inosine for treating dmd
WO2011131693A2 (en) * 2010-04-19 2011-10-27 Nlife Therapeutics, S.L. Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types
WO2013150338A1 (en) * 2012-04-04 2013-10-10 Centre National De La Recherche Scientifique Stapled cell penetrating peptides for intracellular delivery of molecules
WO2014064258A1 (en) * 2012-10-26 2014-05-01 Nlife Therapeutics, S.L. Compositions and methods for selective delivery of oligonucleotide molecules to cell types

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
JACS, Vol 136, 2014, GJ Hilinski et al, "Stitched a-helical peptides via bis ring-closing metathesis", 12314- 12322 *

Also Published As

Publication number Publication date
GB201912318D0 (en) 2019-10-09
GB2574525B (en) 2020-09-02

Similar Documents

Publication Publication Date Title
GB2545898B (en) Improved drug delivery by conjugating oligonucleotides to stitched/stapled peptides
US20230020092A1 (en) Compositions for delivery of antisense compounds
CA2846218C (en) Cell-penetrating peptides having a central hydrophobic domain
US8575305B2 (en) Cell penetrating peptides
JP7305542B2 (en) Exon skipping by peptide nucleic acid derivatives
US20220062431A1 (en) Compounds comprising stapled or stitched peptides for improved drug delivery
JP2017517253A (en) Multiple oligonucleotide moieties on a peptide carrier
JPWO2017109494A5 (en)
GB2574525A (en) Improvements in drug delivery
JPWO2019002875A5 (en)
GB2580569A (en) Improvements in drug delivery
WO2024069229A2 (en) Biologically active compounds
WO2023034818A1 (en) Compositions and methods for skipping exon 45 in duchenne muscular dystrophy