JPWO2018052126A1 - Method for identifying cell heterogeneity in megakaryocyte cell group and method for producing platelets - Google Patents

Abstract

Identify the heterogeneity of megakaryocyte cells and sort the cells. A method for discriminating cell heterogeneity in a megakaryocyte group comprising the following steps: (1) megakaryocyte cells comprising an mRNA comprising a marker gene operably linked to a nucleic acid sequence specifically recognized by a microRNA. And (2) identifying a group of cells having different characteristics using the translation amount of the marker gene as an index.

Description

The present invention relates to a method for identifying heterogeneity of cells in a megakaryocyte group, and a method for selecting cells having high platelet-producing ability from megakaryocytes by using miRNA expression as an index.

The platelet preparation is administered for the purpose of treatment and prevention of symptoms to a patient exhibiting a bleeding tendency associated with thrombocytopenia after treatment with an anticancer agent or massive bleeding during surgery or injury.
Currently, the manufacture of platelet products relies on blood donation, but there is a need for a safer supply of platelets and a stable supply of platelets. To meet these needs, a method for producing platelets from megakaryocytes cultured in vitro has been developed today. The present applicants have established a method for establishing an immortalized megakaryocyte progenitor cell lines (imMKCL) immortalized using pluripotent stem cells as a source (for example, Patent Documents 1 and 2; (See Patent Document 1).

International Publication No.2012 / 157586 International Publication No. 2014/123242

Nakamura et al, Cell Stem Cell. 2014 Apr 3; 14 (4): 535-48.

The immortalized megakaryocyte progenitor cell line can be stored by freezing, and has many advantages such as the ability to promote artificial multinucleation. From this immortalized megakaryocyte progenitor cell line, platelets can be produced according to demand. Can be stably manufactured in large quantities. In search of more efficient production of platelets, the present inventors have found for the first time that the immortalized megakaryocyte progenitor cell line after establishment is heterogeneous. This is a finding that could not be obtained by conventional cell surface marker identification. For example, the megakaryocyte group has been found to contain a group of cells having high platelet-producing ability and a group of cells that are not. In addition, it has also been found that the yield may be unstable if platelet production is performed using such a heterogeneous cell population as it is. For megakaryocyte cell lines, a limiting dilution method, which is a classic selection method for selecting the proliferation ability, is known. However, such selection of only proliferative ability cannot select a cell group with high platelet production ability during the maturation process.

As a general method for sorting cells, as a method for quantitatively classifying cells, for example, cell profiling based on multivariate measurement using a microarray or next-generation sequencing is known. In recent years, a method has been established for accurately discriminating living cells using miRNA expression as an index (International Publication No. 2015/105172).

A method of identifying the heterogeneity of megakaryocyte cells and selecting a cell group, particularly, a method of selecting a cell group having a high platelet-producing ability is desired.

As a result of intensive studies to solve the above problems, the present inventors have found that a megakaryocyte cell group can be selected using microRNA expression as an indicator, and the present invention has been completed.

That is, the present invention provides the following matters.
[1] A method for identifying heterogeneity of cells in a megakaryocyte group comprising the following steps: (1) mRNA comprising a marker gene operably linked to a nucleic acid sequence specifically recognized by microRNA A step of introducing the cell into a megakaryocyte cell group, and (2) a step of identifying a cell group having different characteristics using the translation amount of the marker gene as an index.
[2] A method for selecting a cell group having a high platelet-producing ability from a megakaryocyte group including the following steps:
(1) introducing mRNA containing a marker gene operably linked to a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family into a megakaryocyte cell group; and (2) the marker gene. A process of selecting a cell group having a high platelet production ability using the translation amount of.
[3] The method according to [2], wherein the step of introducing the mRNA into a cell group is performed in the growth phase of megakaryocyte cells.
[4] The nucleic acid sequence specifically recognized by the microRNA selected from the let-7 family and the marker gene are linked in the 5 ′ to 3 ′ direction, [2] Or the method as described in [3].
[5] Any of [2] to [4], wherein the selecting step selects a cell group having a low amount of translation of the marker gene from a cell group having low microRNA activity selected from the let-7 family The method according to claim 1.
[6] The method further includes the step of introducing into the cell group a control mRNA that does not have a nucleic acid sequence specifically recognized by the microRNA selected from the let-7 family and includes a marker gene different from the marker gene. [2] The method according to any one of [5].
[7] The method according to any one of [1] to [6], wherein the screening step is performed using flow cytometry.
[8] The method according to any one of [1] to [6], wherein the selecting step is performed using an image analyzer.
[9] The method according to any one of [1] to [6], wherein the marker gene is a drug resistance gene.
[10] The method according to any one of [1] to [9], wherein the microRNA selected from the let-7 family is let-7a-5p.
[11] A step of selecting a cell group having high platelet production ability by the method according to any one of [1] to [10];
Culturing the selected cell group;
And a step of recovering platelets from the culture obtained by the culturing step.
[12] A megakaryocyte cell selection kit comprising mRNA comprising a marker gene operably linked to a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family.
[13] The mRNA is a nucleic acid in which a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family and the marker gene are linked in a 5 ′ to 3 ′ direction. The megakaryocyte cell sorting kit according to [12].
[14] The megakaryocyte cell selection kit according to [12] or [13], wherein the microRNA selected from the let-7 family is let-7a-5p.
[15] A step of forcibly expressing an oncogene, a polycomb gene, and an apoptosis-inhibiting gene in an undifferentiated cell from a megakaryocyte to obtain an immortalized megakaryocyte,
And suppressing the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, and in the step of obtaining the immortalized megakaryocyte cells, the NR6A1 gene and / or the Lin28A gene are forced A method for producing platelets, comprising a step of expressing.
[16] A step of forcibly expressing an oncogene, a polycomb gene, and an apoptosis-suppressing gene in an undifferentiated cell from a megakaryocyte to obtain an immortalized megakaryocyte cell;
A step of inhibiting forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, and encoding the Lin28A gene in the cell in the step of obtaining the immortalized megakaryocyte cells A method for producing platelets, comprising a step of reducing the amount of methylation in a CpG island region of a promoter of DNA.
[17] The method according to [16], wherein the step of reducing the amount of methylation includes a step of shaking and culturing cells in the step of obtaining the immortalized megakaryocyte cells.
[18] Inducing differentiation of pluripotent stem cells to obtain undifferentiated cells from megakaryocytes,
A step of forcibly expressing an oncogene, a polycomb gene, and an apoptosis-suppressing gene in an undifferentiated cell than the megakaryocyte cell to obtain an immortalized megakaryocyte cell;
Suppressing the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, the step of obtaining undifferentiated cells from the megakaryocyte cells, the pluripotent stem cell A method for producing platelets, comprising a step of culturing using a substrate selected from Matrigel®, laminin 421 or a fragment thereof, or laminin 121 or a fragment thereof, or a combination thereof.

According to the present invention, the heterogeneity of cells in a megakaryocyte cell group can be identified by using the activity of microRNA as an index. In particular, from the megakaryocyte cell group, a cell group having a high resolution and a high platelet production ability can be selected. Since the method according to the present invention can be applied in a state where the cells are alive, it is particularly advantageous in that the cells after sorting can be used in medical applications. In addition, the method of the present invention can be carried out by introducing mRNA into a cell group, and this mRNA is decomposed with a half-life of about 1 day and rapidly removed from the cell. The virus infection and DNA persistence in the plant will not cause problems such as damage to the genome. It is also advantageous in a simple detection method using a cytometer. According to the method of the present invention, since selection is possible in the growth phase of megakaryocyte cells, efficient platelet production can be achieved by selecting and maturating only cells with high platelet production ability. Become.

Figure 1 shows the structure of miRNA-responsive mRNA in which the expression level of fluorescent protein is suppressed in response to let-7a-5p activity, the structure of control mRNA that expresses fluorescent protein regardless of miRNA activity, and uses this It is a figure which shows the scheme of the cell separation which had. Fig. 2 shows that there are cell groups with different let-7a-5p activity under megakaryocyte growth conditions (DOX ON) and let-7a-5p under conditions of platelet production from megakaryocytes (DOX OFF) using SeV2 imMKCL. A cell group with low activity indicates that there is much platelet production. Fig. 3 shows the platelet production conditions after separation into a cell population (L) with a low let-7a-5p activity and a cell group (H) with a high megakaryocyte growth condition (DOX ON) based on the let-7a-5p activity. As a result of measuring let-7a-5p activity over time, the activity of the cell population with low let-7a-5p activity (L) remains low, and the activity of the high cell group (H) is It remains high, indicating that the trend of high activity does not change until day4. Fig. 4 shows that let-7a-5p activity is reduced by let-7a-5p inhibitor (left figure), and a group of cells whose let-7a-5p activity is reduced by let-7a-5p inhibitor (H + Inhibitor ) Indicates that platelet production is as high as the cell population with low let-7a-5p activity (L) under megakaryocyte growth conditions (DOX ON) (right figure). Figure 5 shows quantitative PCR of the expression levels of 3 genes (C-MYC, BMI1, and BCLXL) in a cell population with low let-7a-5p activity (L) and a high cell group (H) under megakaryocyte growth conditions (DOX ON) As a result of the confirmation, it is shown that there is no significant difference in the expression level. Figure 6 shows the purpose of finding the target of let-7a-5p. RNA sequencing is performed on cell populations with high and low let-7a-5p activity, gene expression is compared, and cell population with low activity. There are 691 genes that are expressed more than twice as much, and it can be a target of let-7a-5p among 691 genes using three miRNA target prediction databases: miRSystem, miRDB, and miRSearch After selecting one, it shows that 18 genes are picked up. FIG. 7 plots the expression levels of 18 genes, and shows that among them, the two genes LIN28A and NR6A1 are highly expressed in the cell population with low let-7a-5p activity. FIG. 8 shows that the expression level of LIN28A does not change even when an inhibitor is introduced, and the expression level of NR6A1 decreases in a population with high let-7a-5p activity, and the effect is rescued by the inhibitor. Indicates that it is a 5p target. Moreover, it shows that Lin28B is also a target of let-7a-5p. FIG. 9 shows that in addition to LIN28B and NR6A1, IGF2BP1 is also a target of let-7a-5p. FIG. 10 is a diagram showing the experimental results of examining the effect of NR6A1 on platelet production. FIG. 10 (a) shows that imMKCL in a group with high Let-7a-5p activity was infected with a virus that does not express anything. The number of platelets produced in the case (Mock) and in the case of infection with a virus expressing NR6A1 (NR6A1 O / E) is shown with the former as 100%. FIG. 10 (b) shows the number of platelets produced when Negative Control and NR6A1 siRNAs # 1 and # 3 are introduced into SeV2 imMKCL, with Negative Control being 100%. FIG. 10 (c) shows the platelet production number when the negative control and NR6A1 siRNAs # 1 and # 3 are introduced into cord blood-derived megakaryocyte cells, with the negative control being 100%. FIG. 11 is a diagram showing experimental results of examining the influence of Lin28A, B on platelet production. FIG. 11 (a) shows the addition of Lin28A siRNA to a cell population with low let-7a-5p activity (Group L). It is a figure which shows that let-7a-5p activity rose by this. FIG. 11 (b) shows a sample (Let7-Low vehicle), let-7a-, which uses a Let-7a-5p-responsive tagBFP mRNA switch and co-introduces vehicle and switch into a cell population with low let-7a-5p activity. Sample with co-introduced Lin28A siRNA and switch into a cell population with low 5p activity (Let7-Low Lin28B siRNA), Sample with co-introduced Lin28B siRNA and switch into a cell population with low let-7a-5p activity (Let7-Low Lin28B siRNA) ), Average fluorescence intensity (MFI) of tagBFP in each of the introduced samples (Let7-High vehicle) in which vehicle and switch are co-introduced into a cell population with high let-7a-5p activity, let-7a This shows that -5p activity was increased by Lin28A siRNA but not by Lin28A siRNA. FIG. 11 (c) shows whether DNA encoding the Lin28A gene is methylated in each of the 16 CpG sequences contained in the promoter CpG islands for 7 to 8 samples of Group L and H, respectively. The white circle represents unmethylated and the black circle represents methylated CpG. FIG. 11 (d) shows the percentage of methylation of CpG in a cell population with low let-7a-5p activity (Group L) and a cell population with high activity (Group H). FIG. 12 (a) shows an experimental scheme in which static culture (static) is conventionally changed to static culture (static) or shaking culture (flask) in the culture conditions in each state of DOX ON and DOX OFF. FIG. 12 (b) is a graph showing the relative amounts of LIN28A and NR6A1 when the amount of mRNA extracted from statically cultured cells is 1. (C) is a graph showing the number of platelet production obtained under each of these conditions as a relative number with 100% when cultured as DOX on (Static) -DOX off (Static). d) The result of analyzing the methylation of the LIN28A promoter region CpG island in DNA in cells statically or statically shaken (flask) for 1 week with DOX on in the same manner as described above. Indicates. FIG. 13 is a diagram showing the experimental results of examining the influence of iPS cell culture conditions before differentiation induction on platelet production. FIG. 13 (a) is a graph showing the amount of LIN28A mRNA measured by quantitative PCR in cells at various stages induced to differentiate from MKiPS cells. FIG. 13 (b) shows the results after differentiation induction from MKiPS cells. The results of measuring the Let-7a-5p activity for the 14th and 35th cells are shown, and FIG. 13 (c) shows the LIN28AmRNA when the LIN28AmRNA expression level extracted from the MKiPS11 cell line cultured in Laminin511 is 1. 13 (d) is a graph showing the relative amount of platelet production when the number of platelets produced by megakaryocytes differentiated from the MKiPS11 cell line cultured with Laminin511 is taken as 100%. It is a graph showing.

Hereinafter, the present invention will be described in detail with reference to embodiments. However, the present invention is not limited to the following embodiments.

[Method for identifying cell heterogeneity in megakaryocyte populations]
The present invention, according to one embodiment, relates to a method for identifying cell heterogeneity in a megakaryocyte population comprising the following steps.
(1) introducing mRNA containing a marker gene operably linked to a nucleic acid sequence specifically recognized by microRNA into a megakaryocyte cell group, and (2) using the amount of translation of the marker gene as an index Identifying different cell groups.

In the present embodiment, cell heterogeneity in a megakaryocyte group can be identified by mRNA containing a marker gene operably linked to a nucleic acid sequence specifically recognized by microRNA. Conventionally, megakaryocytes can be identified, distinguished, and differentiated in the process of proliferation and maturation in addition to being identified as “megakaryocytes” by cell surface markers described in detail below. could not. The present embodiment relates to a method for identifying cell heterogeneity by mRNA. As a specific example, a method for selecting a cell group having high platelet-producing ability will be described below, but the present invention is not limited to this.

[Method for selecting cells with high platelet-producing ability]
According to one embodiment, the present invention relates to a method for selecting a cell group having high platelet-producing ability from a megakaryocyte cell group, comprising the following steps.
(1) introducing an mRNA containing a marker gene operably linked to a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family into a cell group, and (2) translation of the marker gene A process of selecting a cell group having high platelet production ability using the amount as an index.

In the selection method of the present invention, the megakaryocyte cell group into which mRNA is introduced refers to a cell group mainly composed of megakaryocyte cells as defined below. A “megakaryocyte” is the largest cell present in the bone marrow in vivo and is characterized by releasing platelets. In addition, the cell surface markers CD41a, CD42a, and CD42b are positively characterized, and in addition, a marker selected from the group consisting of CD9, CD61, CD62p, CD42c, CD42d, CD49f, CD51, CD110, CD123, CD131, and CD203c May be further expressed. A “megakaryocyte” has a genome 16 to 32 times that of a normal cell when it is multinucleated (multiploidy). However, in the present specification, the term “megakaryocyte” has the above characteristics. As long as it is, it includes both multinucleated megakaryocytes and pre-multinucleated megakaryocytes. “Pre-multinucleated megakaryocyte” is also synonymous with “immature megakaryocyte” or “proliferative megakaryocyte”.

Megakaryocyte cells can be obtained by various known methods. Non-limiting examples of the method for producing megakaryocyte cells include the method described in International Publication No. 2011/034073. In this method, an immortalized megakaryocyte cell line that proliferates indefinitely can be obtained by forcibly expressing an oncogene and a polycomb gene in “an undifferentiated cell than a megakaryocyte”. Further, according to the method described in International Publication No. 2012/157586, an immortalized megakaryocyte cell line can also be obtained by forcibly expressing an apoptosis-suppressing gene in “undifferentiated cells than megakaryocyte cells”. . These immortalized megakaryocyte cell lines are polynucleated by releasing the forced expression of the gene and release platelets.

In order to obtain megakaryocyte cells, the methods described in the above documents may be combined. In that case, the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene may be performed simultaneously or sequentially. For example, a multinucleated megakaryocyte cell may be obtained by forcibly expressing an oncogene and a polycomb gene, suppressing the forced expression, then forcibly expressing an apoptosis suppressing gene, and suppressing the forced expression. In addition, multinucleated megakaryocyte cells can be obtained by forcibly expressing an oncogene, a polycomb gene, and an apoptosis-suppressing gene at the same time and simultaneously suppressing the forced expression. First, an oncogene and a polycomb gene are forcibly expressed, followed by forcibly expressing an apoptosis-inhibiting gene, and the forcible expression is simultaneously suppressed to obtain multinucleated megakaryocyte cells. In the present specification, the step of forcibly expressing a gene may be referred to as a growth phase or a state where the gene can be proliferated, and the step of suppressing the forced expression may be referred to as a maturation phase.

In the present invention, “cells that are undifferentiated from megakaryocytes” means cells that have the ability to differentiate into megakaryocytes and that have various differentiation stages ranging from hematopoietic stem cell lines to megakaryocytes. Non-limiting examples of cells that are undifferentiated from megakaryocytes include hematopoietic stem cells, hematopoietic progenitor cells, CD34 positive cells, megakaryocytes / erythroid progenitor cells (MEP). These cells can be obtained by isolation from, for example, bone marrow, umbilical cord blood, and peripheral blood, and further obtained by inducing differentiation from pluripotent stem cells such as ES cells and iPS cells, which are more undifferentiated cells. You can also.

In the present invention, “oncogene” refers to a gene that induces canceration of a cell in a living body, such as a MYC family gene (for example, c-MYC, N-MYC, L-MYC), SRC family. And protein kinase family genes such as genes, RAS family genes, RAF family genes, c-Kit, PDGFR, and Abl.

“Polycomb gene” is known as a gene that negatively regulates the CDKN2a (INK4a / ARF) gene and functions to avoid cellular senescence (Ogura et al., Regenerative Medicine vol.6, No.4, pp26 -32; Jseus et al., Jseus et al., Nature Reviews Molecular Cell Biology vol.7, pp667-677, 2006; Proc. Natl. Acad. Sci. USA vol.100, pp211-216, 2003). Non-limiting examples of polycomb genes include BMI1, Mel18, Ring1a / b, Phc1 / 2/3, Cbx2 / 4/6/7/8, Ezh2, Eed, Suz12, HADC, Dnmt1 / 3a / 3b .

“Apoptosis-suppressing gene” refers to a gene having a function of suppressing cell apoptosis, and examples thereof include BCL2 gene, BCL-xL gene, Survivin gene, MCL1 gene and the like.

The forced expression of genes and the release of forced expression are described in International Publication No. 2011/034073, International Publication No. 2012/157586, International Publication No. 2014/123242, or Nakamura S et al, Cell Stem Cell. 14, 535-548, It can be carried out by the method described in 2014, other known methods or a method analogous thereto. For example, when a drug-responsive gene expression induction system such as Tet-on (registered trademark) or Tet-off (registered trademark) system is used for forced expression of gene and its release, in the forced expression step, Corresponding agents such as tetracycline or doxycycline may be contained in the medium, and forced expression may be suppressed by removing them from the medium.

Culture conditions for megakaryocyte cells when forced expression of genes and suppression (cancellation) of forced expression are performed can be normal conditions. For example, the temperature can be about 35 ° C. to about 42 ° C., about 36 ° C. to about 40 ° C., or about 37 ° C. to about 39 ° C., and can be 5-15% CO ₂ and / or 20% O _2. .

The medium for culturing megakaryocyte cells is not particularly limited, and a known medium suitable for producing platelets from megakaryocyte cells or a medium equivalent thereto can be appropriately used. For example, a medium used for animal cell culture can be prepared as a basal medium. Examples of the basal medium include IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Dulbecco's modified Eagle's Medium (DMEM) medium, Ham's F12 medium, RPMI 1640 medium, Fischer's medium, Neurobasal Medium (Life Technologies) ) And mixed media thereof.

The culture medium may contain serum or plasma, or may be serum-free. If necessary, the medium can be, for example, albumin, insulin, transferrin, selenium, fatty acids, trace elements, 2-mercaptoethanol, thiolglycerol, monothioglycerol (MTG), lipids, amino acids (eg L-glutamine), ascorbic acid It may also contain one or more substances such as heparin, non-essential amino acids, vitamins, growth factors, low molecular weight compounds, antibiotics, antioxidants, pyruvate, buffers, inorganic salts, cytokines and the like. Cytokines are proteins that promote blood cell differentiation, such as vascular endothelial growth factor (VEGF), thrombopoietin (TPO), various TPO-like substances, Stem Cell Factor (SCF), ITS (insulin-transferrin-selenite). ) Supplements, ADAM inhibitors, etc. A preferable medium in the present invention is an IMDM medium containing serum, insulin, transferrin, serine, thiolglycerol, ascorbic acid, and TPO. Furthermore, SCF may be included, and heparin may also be included. Each concentration is not particularly limited, however, for example, TPO can be about 10 ng / mL to about 200 ng / mL, or about 50 ng / mL to about 100 ng / mL, and SCF is about 10 ng / mL to about 200 ng. Heparin can be about 10 U / mL to about 100 U / mL, or about 25 U / mL. Phorbol esters (eg, phorbol-12-myristate-13-acetate; PMA) may be added.

In the production method according to the present invention, the step of culturing megakaryocyte cells may be performed under conditions of serum-free and / or feeder cell-free. Preferably, the method is carried out by culturing megakaryocytes produced according to the method of the present invention in a medium containing TPO. In the platelet production process, if it can be performed free of serum and feeder cells, the problem of immunogenicity hardly occurs when the obtained platelet is used clinically. In addition, if platelets can be produced without using feeder cells, it is not necessary to adhere feeder cells, so suspension culture can be performed in a flask or the like, which can suppress manufacturing costs and is suitable for mass production. . If no feeder cells are used, a conditioned medium may be used. The conditioned medium is not particularly limited and can be prepared according to methods known to those skilled in the art. For example, the conditioned medium can be obtained by appropriately culturing feeder cells and removing the feeder cells from the culture with a filter.

Specifically, the step of forcibly expressing the above genes in undifferentiated cells from megakaryocytes can be performed according to a conventional method of those skilled in the art. For example, vectors expressing these genes, or these genes Can be achieved by introducing the protein into an undifferentiated cell from a megakaryocyte in the form of a protein or RNA that encodes. Furthermore, it can be carried out by bringing low molecular weight compounds or the like that induce the expression of these genes into contact with undifferentiated cells from megakaryocytes.

Examples of vectors expressing these genes include retrovirus, lentivirus, adenovirus, adeno-associated virus, herpes virus, Sendai virus and other viral vectors, animal cell expression plasmids (eg, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo) and the like can be used. A retroviral vector or a lentiviral vector is preferable in that it can be carried out by single introduction. Examples of promoters used in expression vectors include EF-α promoter, CAG promoter, SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia) Virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, etc. are used. In addition to the promoter, the expression vector may optionally contain an enhancer, a poly A addition signal, a selection marker gene, an SV40 replication origin, and the like. Useful selection marker genes include, for example, dihydrofolate reductase gene, neomycin resistance gene, puromycin resistance gene and the like.

In the expression vector of the present invention, since the expression of the gene is controlled by tetracycline or doxycycline, a drug-responsive vector having a tetracycline-responsive element in the promoter region may be used. In addition, in order to cut out a gene from a vector using the Cre-loxP system, an expression vector in which a loxP sequence is placed so as to sandwich the gene and / or promoter region with the loxP sequence may be used.

In the production of megakaryocytes, cells that have been cultured with forced expression of an apoptosis-suppressing gene are treated with (a) an actomyosin complex function inhibitor, (b) a treatment with a ROCK inhibitor, c) at least one of treating with an HDAC inhibitor. By these treatments, more stable proliferation and multinucleation can be promoted.

A person skilled in the art can determine the optimum concentration in the case of treating cells with an actomyosin complex function inhibitor, a ROCK inhibitor, an HDAC inhibitor or the like by preliminary experiments. Further, a period and a method for processing can be appropriately selected by those skilled in the art. For example, in the case of treatment with blebbistatin, which is a myosin heavy chain II ATPase inhibitor, 2 to 15 μg / ml, or about 5 to 10 μg / ml is added to the culture solution, and the culture period is, for example, 5 to 10 days. The degree, in particular, about 6 to 7 days is preferable. Further, Y27632 which is a ROCK inhibitor is used at 5 to 15 μM, or 8 to 12 μM, preferably about 10 μM, and valproic acid which is an HDAC inhibitor is 0.1 to 1 mM, or 0.2 to 0.7 mM, preferably Can be used at about 0.5 mM. The treatment time for Y27632 and valproic acid is 10 to 21 days, preferably about 14 days.

Examples of ROCK (Rho-associated coiled-coil forming kinase) inhibitors include [(R)-(+)-trans-N- (4-pyridyl) -4- (1-aminoethyl)- In some cases, such as cyclohexanecarboxamide, 2HCl, H ₂ O] (Y27632), antibodies that inhibit Rho kinase activity, or nucleic acids (eg, shRNA) should also be used as ROCK inhibitors. Can do.

The HDAC inhibitor has an action of inhibiting histone deacetylase (HDAC) activity. So far, many HDAC inhibitors are known, and examples include valproic acid, trichostatin A, SAHA (suberoylanilide hydroxamic acid), APHA (aroylpyrrolylhydroxyamide), etc. Valproic acid, trichostatin A and the like can be preferably used. When the drug used has a salt form, it may be used in a salt form.

A person skilled in the art can determine the optimum concentration in the case of treating cells with an actomyosin complex function inhibitor, a ROCK inhibitor, an HDAC inhibitor or the like by preliminary experiments. Further, a period and a method for processing can be appropriately selected by those skilled in the art. For example, in the case of treatment with blebbistatin, which is a myosin heavy chain II ATPase inhibitor, 2 to 15 μg / ml, or about 5 to 10 μg / ml is added to the culture solution, and the culture period is, for example, 5 to 10 days. The degree, in particular, about 6 to 7 days is preferable. Further, Y27632 which is a ROCK inhibitor is used at 5 to 15 μM, or 8 to 12 μM, preferably about 10 μM, and valproic acid which is an HDAC inhibitor is 0.1 to 1 mM, or 0.2 to 0.7 mM, preferably Can be used at about 0.5 mM. The treatment time for Y27632 and valproic acid is 10 to 21 days, preferably about 14 days.

After the forced expression step, the method further includes a step of culturing the megakaryocyte or megakaryocyte progenitor cell obtained in the step while suppressing the forced expression. As a method for suppressing or stopping forced expression, for example, when forced expression is performed using a drug-responsive vector, it may be achieved by not contacting the corresponding drug with the cell. Specifically, when the gene is forcibly expressed by doxycycline or tetracycline, the forced expression can be suppressed by culturing the cells in a medium from which these are removed. In addition, when the above-mentioned vector containing LoxP is used, it may be achieved by introducing Cre recombinase into the cell. Further, when a transient expression vector and RNA or protein introduction are used, the contact with the vector or the like may be stopped. The medium used in this step can be performed using the same medium as described above.

The culture conditions for culturing while suppressing or stopping forced expression are as described above. The culture period can be appropriately determined while monitoring the number of megakaryocytes, and is, for example, about 2 days to 10 days, preferably about 3 days to 7 days. Desirably at least 3 days. In addition, it is desirable to perform subculture as appropriate during the culture period.

Also in the step of suppressing forced gene expression, a ROCK inhibitor and / or an actomyosin complex function inhibitor is added to the medium. As a ROCK inhibitor and an actomyosin complex function inhibitor, the same thing as what was used by the manufacturing method of the multinucleated megakaryocyte mentioned above can be used. Examples of the ROCK inhibitor include Y27632. Examples of the actomyosin complex function inhibitor include blebbistatin, which is a myosin heavy chain II ATPase inhibitor. A ROCK inhibitor may be added alone, a ROCK inhibitor and an actomyosin complex function inhibitor may be added alone, or a combination thereof may be added.

The ROCK inhibitor and / or the actomyosin complex function inhibitor is preferably added at 0.1 μM to 30 μM, for example, 0.5 μM to 25 μM, 5 μM to 20 μM, and the like. The culture period after adding the ROCK inhibitor and / or the actomyosin complex function inhibitor may be 1 to 15 days, and may be 3 days, 5 days, 7 days, or the like. By adding a ROCK inhibitor and / or an actomyosin complex function inhibitor, it is possible to further increase the proportion of CD42b positive platelets.

In addition, US 2012-0238023 A1 (International Publication No. 2011/034073), US 2014-0127815 A1 (International Publication No. 2012/157586), US, which discloses a non-limiting example of the above-described method for producing megakaryocytes 2016-0002599 A1 (International Publication No. 2014/123242) is hereby incorporated by reference.

The megakaryocyte group into which the mRNA is introduced is preferably a megakaryocyte group in a proliferative state. The megakaryocyte group in a proliferative state is selected from the group consisting of an oncogene, a polycomb gene, and an apoptosis-suppressing gene in a cell that is undifferentiated from the megakaryocyte in the method for producing a megakaryocyte described above. A state in which at least one of the genes is forcibly expressed. Therefore, for example, it may be a group of megakaryocytes cultured in a growth medium containing doxycycline or tetracycline, or may be a group of megakaryocytes in which a gene is forcibly expressed by other methods. Good. There is no particular limitation on the time of introduction of mRNA as long as it is cultured in a growth medium, and it may be immediately after the start of the culture for growth. It may be 3 to 4 days after the start of culture. Even after the introduction of mRNA, the culture for propagation can be continued for 5 months or more over a necessary period according to a normal method.

In the method of the present invention, the selected “cell group having high platelet-producing ability” refers to a group of cells classified as another cell group using the expression of microRNA selected from the let-7 family as an index. Say.

In the present invention, “selecting a cell group having a high platelet-producing ability” means that the platelet-producing ability is relatively selected from the megakaryocyte group found by the present inventors to be a heterogeneous cell group. For a high cell group, it means to present signal information that can be distinguished from other cell groups, that is, to be detectable, and in particular, to present visually recognizable information. Note that “visually recognizable information” is not limited to emitting a signal that can be directly recognized by the cell, but the signal emitted by the cell is visually expressed by a numerical value, a chart, an image, or the like. It is information that has been converted into information that can be recognized by the person, and is information that can be visually recognized by those skilled in the art. In the present specification, the term sorting means that after the sorting, a cell group having a high platelet-producing ability is recognized, a cell group having a high platelet-producing ability is identified, a cell group having a high platelet-producing ability is identified, Classify cells with high platelet-producing ability, isolate cells with high platelet-producing ability, remove undesired cells, determine the viability of desired chondrocytes, and identify cells with high platelet-producing ability Detection or quantification, and fractionation based on a specific physical or chemical signal of a cell group having a high platelet-producing ability.

In the method of the present invention, the indicator microRNA is a microRNA selected from the let-7 family. The microRNAs belonging to the let-7 family include hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7d-5p, hsa-let-7e-5p, hsa-let-7f-5p , Hsa-let-7g-5p, hsa-let-7i-5p, hsa-let-7a-3p, hsa-let-7b-3p, hsa-let-7d-3p, hsa-let-7e-3p, hsa -let-7f-1-3p, hsa-let-7f-2-3p, hsa-let-7g-3p, hsa-let-7i-3p, hsa-let-7a-2-3p, hsa-let-7c -5p, hsa-let-7c-3p, hsa-miR-98-5p, hsa-miR-98-3p, hsa-miR-99a-5p, hsa-miR-99a-3p, hsa-miR-99b-5p , Hsa-miR-99b-3p, has-miR-100-5p, hsa-miR-100-3p, hsa-miR-125a-5p, hsa-miR-125a-3p, hsa-miR-125b-5p, hsa -miR-125b-1-3p, hsa-miR-125b-2-3p, hsa-miR-202-5p, hsa-miR-202-3p, but are not limited to these. Among them, let-7a-5p, let-7g-5p, and let-7i-5p are preferable as the microRNA serving as an index, but are not limited thereto. In the following description of the present specification, microRNA selected from the let-7 family may be referred to as let-7 miRNA. Therefore, the messenger RNA (mRNA) introduced into the megakaryocyte population is a marker gene that is operably linked to a sequence that is specifically recognized by let-7 miRNA (also called the target sequence of let-7 miRNA). Including. Such mRNA is also referred to as let-7 miRNA-responsive mRNA or miRNA switch. It is also referred to as let-7a-5p responsive mRNA based on the specific miRNA name. Hereinafter, the case where let-7 miRNA is let-7a-5p will be described in detail, but the present invention is not limited to the microRNA. For other let-7 miRNAs, the target sequence and mRNA sequence can be determined and carried out in the same manner as the let-7a-5p target sequence described below. When a let-7a-5p is present in an mRNA containing a marker gene operably linked to a let-7a-5p target sequence, translation of the marker gene is controlled according to its activity. Preferably, when let-7a-5p is present, translation of the marker gene is suppressed according to its activity, so that the amount of protein translated from the marker gene (hereinafter referred to as marker protein) is reduced. It is mRNA that decreases quantitatively.

The target sequence of let-7a-5p refers to a sequence that can specifically bind to let-7a-5p. The miRNA target sequence is preferably, for example, a sequence that is completely complementary to the indicator miRNA.

Alternatively, the let-7a-5p target sequence may have a mismatch (mismatch) with a completely complementary sequence as long as it can be recognized in let-7a-5p. The mismatch from the sequence completely complementary to the marine RNA may be any mismatch that can be normally recognized by let-7a-5p in cells with high platelet-producing ability. It is said that there may be a discrepancy of about 40-50%. Such discrepancy is not particularly limited, class 1 base, 2 bases' 3 bases, 4 bases, 5 bases, 6 bases, 7 bases, 8 bases, 9 bases, or 10 bases or 1%, 5% of all recognition sequences 10%. 20%. 30% or 40% discrepancy. In particular, like let-7a-5p target sequence on let-7a-5p provided by cells, especially in the part other than the seed region, that is, about 16 bases on the 3 ′ side of let-7a-5p The 5 ′ region in the target sequence corresponding to may contain multiple mismatches, and the seed region portion may contain no mismatches, or may contain mismatches of 1 base, 2 bases, or 3 bases.

A marker gene is a gene that is translated in a cell, functions as a marker, and encodes an arbitrary protein that enables selection of a cell group. Examples of proteins that can be translated into cells and function as markers include, for example, proteins that can be visualized and quantified by assisting fluorescence, luminescence, coloration, or fluorescence, luminescence, or coloration. It may be. As fluorescent proteins, blue fluorescent proteins such as Sirius and EBFP; cyan fluorescent proteins such as mTurquoise, TagCFP, AmCyan, mTFP1, MidoriishiCyan, and CFP; TurboGFP, AcGFP, TagGFP, Azami-Green (for example, hmAGl), ZsGreen, EmGFP, Green fluorescent proteins such as EGFP, GFP2, and HyPer; Yellow fluorescent proteins such as TagYFP, EYFP, Venus, YFP, PhiYFP, PhiYFP-m, Turbo YFP, ZsYellow, mBanana; Kusabira Orange (eg, hmKO2), mOrange Color fluorescent proteins; red fluorescent proteins such as TurboRFP, DsRed-Express, DsRed2, TagRFP, DsRed-Monomer, AsRed2, mStrawberry, etc .; TurboFP602, mRFP1, JRed, KillerRed, mCherry, HcRed, KeimaRed (eg, hd KeimaRed), mRasberry And near infrared fluorescent proteins such as mPlum, but are not limited thereto.

A photoprotein can be exemplified by aequorin, but is not limited thereto. Examples of proteins that assist fluorescence, luminescence, or coloration include, but are not limited to, enzymes that decompose fluorescence, luminescence, or color precursors such as luciferase, phosphatase, peroxidase, and β-lactamase. Here, in the present invention, when a protein that assists fluorescence, luminescence, or coloration is used as a marker gene, in the selection of cells having high platelet-producing ability, the corresponding precursor is brought into contact with the cell, or the cell is handled. This can be done by introducing a precursor that

Another example of a protein that can function as a marker in a cell is a protein that directly affects the function of the cell. Cell growth protein, cell death protein, apoptosis control protein, cell signal factor, drug resistance gene, transcription control factor, translation control factor, differentiation control factor, reprogramming induction factor, RNA binding protein factor, chromatin control factor, membrane protein However, it is not limited to these. For example, a cell growth protein functions as a marker by proliferating only cells that express it and specifying the proliferated cells. The cell killing protein causes cell death of a cell that expresses it, thereby killing the cell itself containing or not containing a specific miRNA, and functions as a marker indicating cell viability. The cell signal factor functions as a marker by the cell that expresses it emits a specific biological signal and specifies this signal. Examples of the cell killing protein include Bax and Bim.

In the present invention, the marker gene may comprise a gene encoding a localization signal. Examples of the localization signal include a nuclear localization signal, a cell membrane localization signal, a mitochondrial localization signal, a protein secretion signal, and more specifically, classical nuclear translocation sequences (NLS), M9 Examples include, but are not limited to, sequences, mitochondrial target sequences (MTS), and endoplasmic reticulum translocation sequences. Such a localization signal is particularly advantageous when the screening step in the method of the present invention is performed on an image by imaging cytometry or the like described later.

In the present invention, when a translation control factor is used as a marker gene, mRNA having a second marker gene whose translation is controlled by the translation control factor is simultaneously introduced into a cell. An example of mRNA having a second marker gene whose translation is controlled by such a protein is an mRNA having a second marker gene sequence operably linked to an RNA sequence to which the protein capable of controlling translation can be bound. Is done.

In the present invention, the miRNA target sequence and the marker gene are functionally linked to each other in the 5 ′ UTR, 3 ′ UTR, and / or the open reading frame (including the start codon) that encodes the mer strength gene. Alternatively, it means that at least one let-7a-5p target sequence is provided in the open reading frame. The mRNA preferably comprises a Cap structure (7 methylguanosine 5 ′ phosphate), an open reading frame encoding a marker gene, and a poly A tail in the 5 ′ to 3 ′ orientation from the 5 ′ end, Provide at least one let-7a-5p target sequence in the 'UTR, 3'UTR, and / or in the open reading frame. The location of the let-7a-5p target sequence in the mRNA may be 5'UTR or 3'UTR, may be within the open reading frame (3 'to the start codon), and these All may have a let-7a-5p target sequence. Thus, the number of let-7a-5p target sequences may be one, two, three, four, five, six, seven, eight or more.

Preferably, there is one let-7a-5p target sequence in the 5 ′ UTR. This is because efficient translation suppression can be achieved. At this time, the number of bases and the type of base between the Cap structure and the let-7a-5p target sequence are arbitrary as long as they do not contain AUG as the start codon and it is difficult to form a stem structure or a three-dimensional structure. Good. For example, the number of bases between the Cap structure and the let-7a-5p target sequence can be designed to be 0 to 50 bases, preferably 10 to 30 bases, but is not limited thereto. In addition, the number of bases and the type of base between the let-7a-5p target sequence and the start codon may be arbitrary as long as they do not easily form a stem structure or a three-dimensional structure, and the let-7a-5p target sequence The number of bases between and the start codon can be designed to be 0 to 50 bases, preferably 10 to 30 bases, but is not limited thereto. It has been confirmed that even when there are four let-7a-5p target sequences in 3′UTR, it is possible to achieve translational repression.

The let-7a-5p-responsive mRNA preferably contains a modified base such as pseudouridine or 5-methylcytidine instead of ordinary uridine and cytidine. This is to reduce cytotoxicity. The positions of the modified bases can be all or part of the uridine and cytidine independently, and if they are part of the base, they can be random positions at an arbitrary ratio.

Let-7a-5p-responsive mRNA can be synthesized by a person skilled in the art by any method known in genetic engineering if the sequence is determined according to the above. In particular, it can be obtained by an in vitro transcription synthesis method using a template DNA containing a promoter sequence as a template.

For the present invention, the step of introducing let-7a-5p-responsive mRNA into a megakaryocyte cell group (hereinafter referred to as the introduction step) includes lipofection method, liposome method, electroporation method, calcium phosphate coprecipitation method, Let-7a-5p-responsive mRNA can be directly introduced into cells contained in a cell group using DEAE dextran method, microinjection method, gene gun method and the like. Alternatively, the let-7a-5p-responsive mRNA can be introduced into the megakaryocyte group by introducing a vector encoding the nucleic acid sequence of the designed let-7a-5p-responsive mRNA into the megakaryocyte group.

When let-7a-5p-responsive let-7a-5p and control mRNA (hereinafter also referred to as control mRNA) are used, it is preferable to co-introduce these mRNAs into a megakaryocyte group. This is because the activity ratio of marker proteins expressed from two or more co-introduced mRNAs is constant within the cell population. The introduction amount at this time varies depending on the mRNA to be introduced, the introduction method, the kind of the introduction reagent, and the like, and those skilled in the art can appropriately select these in order to obtain a desired translation amount. Here, the control mRNA refers to mRNA that does not have a let-7a-5p target site and encodes a marker gene different from the marker gene encoded by let-7a-5p-responsive mRNA. The amount of control mRNA introduced can also be appropriately selected by those skilled in the art to obtain a desired translation amount. Control mRNA is mRNA that expresses a marker gene regardless of the presence of let-7a-5p.

When let-7a-5p-responsive mRNA is introduced into a cell, if the given let-7a-5p is present as RISC in the cell, the marker gene encoded by let-7a-5p-responsive mRNA The amount of translation is suppressed. The amount of translation is controlled quantitatively according to the let-7a-5p activity. That is, the amount of translation of the marker gene is relatively small in cells having a large amount of let-7a-5p, and the amount of translation of a marker gene is relatively large in cells having a small amount of let-7a-5p. On the other hand, when the predetermined let-7a-5p does not exist in the cell, or when the predetermined let-7a-5p does not exist as RISC, the translation amount of the marker gene encoded by the let-7a-5p-responsive mRNA is suppressed. Never happen. Therefore, the translation amount of the marker gene differs between a plurality of cells having different abundance of let-7a-5p. In this specification, the case where let-7a-5p is present as RISC is also referred to as “when let-7a-5p activity is present”, and the amount of let-7a-5p in the activated state is The case where the amount is relatively large is also referred to as “when the activity of let-7a-5p is high”. On the other hand, the control mRNA expresses the marker protein regardless of the let-7a-5p activity. This is because even if introduced, since the let-7a-5p target sequence does not exist, translation control is not performed according to the expression level of let-7a-5p.

Next, a cell sorting step (hereinafter also referred to as a sorting step) is performed using the translation amount of the marker gene as an index. In the selection step, cells are selected from the translation amount of the marker gene as described above. The present inventors have reported that megakaryocyte cells with relatively high let-7a-5p activity have relatively low platelet-producing ability and megakaryocyte cells with relatively low let-7a-5p activity It has been found that the productivity is relatively high (FIGS. 1 and 2). When a fluorescent protein is used as a marker protein, referring to the histogram of FIG. 1, the cell group located at the lower right of the line indicated by Control is a megakaryocyte cell whose translation is suppressed in response to let-7a-5p. Represents a group. Among them, a cell group having a relatively high fluorescence intensity indicated by a white arrow indicates a megakaryocyte cell group having a relatively low let-7a-5p activity. A cell group having a relatively low fluorescence intensity indicated by a black arrow indicates a megakaryocyte group having a relatively high let-7a-5p activity. A megakaryocyte cell group can be selected based on such let-7a-5p activity and the translational control amount of the marker gene. The level of fluorescence intensity is relative and may vary depending on the characteristics of the megakaryocyte cell group to be selected and the characteristics of the marker protein, so that those skilled in the art can appropriately determine and classify the threshold value. In that case, for example, a preliminary experiment on rescue of activity using an inhibitor of let-7a-5p, which will be described later in the Examples, or a preliminary experiment on the amount of platelet production may be performed to determine the threshold value. it can.

In a preferred embodiment, the marker gene may be a drug resistance gene. The “drug resistance gene” may be any gene that expresses a protein having resistance to the corresponding drug. Examples include, but are not limited to, antibiotic resistance genes. Examples of antibiotic resistance genes include kanamycin resistance gene, ampicillin resistance gene, puromycin resistance gene, blasticidin resistance gene, gentamicin resistance gene, kanamycin resistance gene, tetracycline resistance gene, chloramphenicol resistance gene, etc. . In the present invention, preferably, a puromycin resistance gene or a blasticidin resistance gene is used as the antibiotic resistance gene. When the marker gene is a drug resistance gene, the expression of the drug resistance gene is selectively suppressed in a megakaryocyte group with high let-7a-5p activity. For this reason, the megakaryocyte group with high let-7a-5p activity is killed by a decrease in resistance to the corresponding drug. Therefore, these dead cells can be selectively removed.

  Alternatively, when a translation control factor is used as a marker gene, cells can be selected from the translation amount of the second marker gene introduced into the cell at the same time. By using mRNA having the second marker gene whose translation is suppressed by the marker gene described above, the translation amount of the second marker gene is proportional to the expression level of let-7a-5p serving as an index. That is, when the cell group with high platelet production ability is a cell with a low expression level of the indicator let-7a-5p, a cell with a low translation amount of the second marker gene is selected, and the indicator let-7a When the expression level of -5p is high, cells having a high translation amount of the second marker gene can be selected. When a cell killing protein is used as a marker gene, cells with a high expression level of let-7a-5p serving as an index can be specifically induced to be removed.

  Specifically, the selection step can be performed by detecting a signal from the marker protein using a predetermined detection device. Examples of the detection device include, but are not limited to, a flow cytometer, an imaging cytometer, a fluorescence microscope, a light emission microscope, and a CCD force mela. As such a detection device, those suitable for those skilled in the art can be used depending on the protein and the selection mode. For example, when the marker protein is a fluorescent protein or a luminescent protein, it is possible to quantify the protein by using a detection device such as a flow cytometer, an imaging cytometer, a fluorescence microscope, or a CCD camera. In the case of a protein that assists fluorescence, luminescence, or coloration, a marker protein quantification method using a detection device such as a luminescence microscope, a CCD camera, or a luminometer is possible. When the marker protein is a membrane-localized protein In addition to cell surface protein-specific detection reagents such as antibodies and marker protein quantification methods using the detection devices described above, the marker protein quantification process such as a magnetic cell separation device (MACS) is not required. Cell isolation methods are possible.

When mRNA is introduced into a megakaryocyte cell group in the proliferative phase, after selecting a cell group having a high platelet-producing ability, if necessary, culture for proliferation of the selected megakaryocyte cell group is performed. Can continue. Subsequently, the forced expression of the gene can be suppressed (released), the megakaryocyte can be matured, and used for the production of platelets according to the normal method for producing megakaryocyte.
Alternatively, even when mRNA is introduced into a megakaryocyte group other than the proliferative phase, the production of megakaryocyte cells after selection is continued according to the normal method for producing megakaryocyte cells and used for platelet production. Can do.

According to this embodiment, a cell group having a relatively high platelet-producing ability can be selected from a megakaryocyte cell group using miRNA expression as an index. This selection can be performed during the growth phase of megakaryocytes. Therefore, only the selected cell group having a relatively high ability to produce platelets can be easily selected in the growth phase, and only the cell population can be increased, so that only the cell population having a high ability to produce platelets is matured thereafter. Therefore, the platelet production efficiency in the final stage is increased.

[Platelet production method]
The present invention, according to another embodiment, is a method for producing platelets, comprising:
(I) a step of selecting a megakaryocyte cell group having high platelet production ability by the method described in the previous embodiment;
(Ii) culturing the selected cell group;
(Iii) collecting platelets from the culture obtained by the culturing step.

“Platelets” are one of the cellular components in blood and are characterized by CD41a positive and CD42b positive. Platelets play an important role in thrombus formation and hemostasis, and are also involved in tissue regeneration after injury and pathophysiology of inflammation. When platelets are activated by bleeding or the like, receptors for cell adhesion factors such as Integrin αIIBβ3 (glycoprotein IIb / IIIa; a complex of CD41a and CD61) are expressed on the membrane. As a result, platelets aggregate and fibrin is coagulated by various blood coagulation factors released from the platelets, thereby forming a thrombus and promoting hemostasis.

The function of platelets can be measured and evaluated by a known method. For example, the amount of activated platelets can be measured using an antibody against PAC-1 that specifically binds to Integrin αIIBβ3 on the activated platelet membrane. Similarly, CD62P (P-selectin), which is a platelet activation marker, may be detected with an antibody, and the amount of activated platelets may be measured. For example, flow cytometry can be used by gating with an antibody against the activation-independent platelet marker CD61 or CD41, and then detecting the binding of anti-PAC-1 antibody or anti-CD62P antibody. These steps may be performed in the presence of adenosine diphosphate (ADP).

In addition, evaluation of platelet function can be performed by examining whether or not it binds to fibrinogen in the presence of ADP. Binding of platelets to fibrinogen results in integrin activation required early in thrombus formation.

Furthermore, the evaluation of platelet function can also be performed by visualizing and observing the thrombus formation ability in vivo, as shown in FIG. 6 of WO 2011/034073.

The method for producing platelets according to this embodiment is based on the prior art methods disclosed by the present applicants disclosed in International Publication No. 2011/034073, International Publication No. 2012/157586, and International Publication No. 2014/123242. In the process, megakaryocytes are selected using let-7a-5p-responsive mRNA according to the embodiment described above, and platelets are produced in the selected megakaryocytes. Therefore, it can be carried out in the same manner as these methods except that sorting is performed at a predetermined time.

For example, in a preferred embodiment, when the selection method is performed in the step of forcibly expressing a predetermined gene in a state in which megakaryocyte cells can proliferate, the step of forcibly expressing to a necessary level after the selection may be continued. it can. Then, the process of suppressing the forced expression of a gene which matures a megakaryocyte can be implemented.

The platelets obtained in the present invention can be administered to patients as a preparation. In administration, platelets obtained by the method of the present invention are, for example, human plasma, infusion, citric acid-containing physiological saline, glucose acetated Ringer's solution, PAS (platelet additive solution) (Gulliksson, H. et al., Transfusion, 32: 435-440, (1992)) and the like. The storage period is about 3 to 7 days, preferably 4 days. As storage conditions, it is desirable to store with shaking and stirring at room temperature (20-24 degrees).

[Megakaryocyte sorting kit]
According to still another embodiment of the present invention, there is provided a megakaryocyte cell selection kit, which is a marker gene operably linked to a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family. MRNA comprising. In a preferred embodiment, the microRNA selected from the let-7 family (let-7miRNA) is let-7a-5p, and the mRNA is a let-7a-5p-responsive mRNA or miRNA switch in the previous embodiment. It may be the described mRNA. In addition to this, the cell selection kit does not have a let-7miRNA target sequence and contains a control mRNA containing a marker gene different from let-7miRNA-responsive mRNA, and reagents necessary for introduction into these megakaryocytes, let -7 miRNA inhibitors, let-7 miRNA, and the like.

[Platelet production method]
The present invention, according to another embodiment, is a method for producing platelets, comprising:
(A) in an undifferentiated cell than a megakaryocyte cell, forcibly expressing an oncogene, a polycomb gene, and an apoptosis inhibitor gene to obtain an immortalized megakaryocyte cell;
(B) suppressing the forced expression and culturing megakaryocyte cells, and in the step of obtaining the immortalized megakaryocyte cells, including a step of forcibly expressing the NR6A1 gene.

The step (a) for obtaining immortalized megakaryocyte cells and the step (b) for culturing megakaryocyte cells are as described above. In this embodiment, the step of forcibly expressing the NR6A1 gene is included in the step of obtaining immortalized megakaryocyte cells.

Forced expression of the NR6A1 gene is carried out by preparing a viral vector incorporating these genes in the same manner as the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene in the process of obtaining immortalized megakaryocyte cells. can do. Specifically, forced expression of NR6A1 gene and cancellation of forced expression are performed in International Publication No. 2011/034073, International Publication No. 2012/157586, International Publication No. 2014/123242, or Nakamura S et al, Cell Stem Cell. 14, 535-548, 2014, other known methods, or a method analogous thereto. The template sequence of the NR6A1 gene is shown in SEQ ID NO: 49. The forced expression of the NR6A1 gene can be performed in the step (a) of obtaining immortalized megakaryocyte cells, and the forced expression of the R6A1 gene is almost simultaneously with the cancellation of the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene. Cancellation can also be performed.

In another embodiment of the method for producing platelets,
In an undifferentiated cell than a megakaryocyte, an oncogene, a polycomb gene, and an apoptosis inhibitor gene are forcibly expressed to obtain an immortalized megakaryocyte,
A step of inhibiting forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, and encoding the Lin28A gene in the cell in the step of obtaining the immortalized megakaryocyte cells Reducing the amount of methylation in the CpG island region of the promoter of the DNA.

The detection of methylation in the CpG island region of the promoter of the DNA encoding the Lin28A gene in cells was performed using MeCP2 suppresses LIN28A expression via binding to its methylated-CpG islands in pancreatic cancer cells (Oncotarget. 2016 Mar 22; 7 (12 ): 14476-14485), for example, using QIAGEN's DNA extraction kit, Zymo Research's EZ DNA Methylation-Gold Kit, or similar commercial kits, and following these kit instructions can do. The term “in the cell” as used herein may be a cell in the step (a) of obtaining an immortalized megakaryocyte cell or a cell in the step (b) of culturing the megakaryocyte cell, but immortalized. It is preferable to judge based on the state in the cell in the step (a) of obtaining megakaryocyte cells. The step of reducing the amount of methylation can be performed by shaking and culturing the cells. The step of reducing the amount of methylation can be performed in step (a) of obtaining immortalized megakaryocyte cells, step (b) of culturing megakaryocyte cells, or both of these steps. Since it is preferable that the determination reference time is the step (a) of obtaining immortalized megakaryocyte cells, it is preferable to perform shaking culture in the step (a) of obtaining immortalized megakaryocyte cells. The conditions for shaking culture are, for example, 50 rpm or more, preferably 100 rpm or more, although depending on the culture scale. Moreover, when setting it as such conditions, it is preferable that the period of shaking culture shall be about 3 to 10 days. When the amount of methylation is decreased and the amount of methylation is, for example, about 20% or less, preferably about 13% or less, the activity of let-7a-5p can be suppressed, and maturation of megakaryocytes is inhibited. It is more preferable because the factor can be removed.

In another aspect of the method for producing platelets,
Inducing differentiation of pluripotent stem cells to obtain undifferentiated cells from megakaryocytes,
A step of forcibly expressing an oncogene, a polycomb gene, and an apoptosis-suppressing gene in an undifferentiated cell than the megakaryocyte cell to obtain an immortalized megakaryocyte cell;
Suppressing the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, the step of obtaining undifferentiated cells from the megakaryocyte cells, the pluripotent stem cell Culturing with a substrate containing Matrigel®.

This embodiment includes a step of inducing differentiation of pluripotent stem cells to obtain undifferentiated cells from megakaryocytes. The pluripotent stem cells are not particularly limited, and include ES cells and iPS cells, but iPS cells are preferable. iPS cells can be produced by introducing a specific reprogramming factor into somatic cells in the form of DNA or protein, and have almost the same properties as ES cells, such as pluripotency and proliferation ability by self-replication, Somatic cell-derived artificial stem cells (K. Takahashi and S. Yamanaka (2006) Cell, 126: 663-676; K. Takahashi et al. (2007), Cell, 131: 861-872; J. Yu et al. al. (2007), Science, 318: 1917-1920; Nakagawa, M. et al., Nat. Biotechnol. 26: 101-106 (2008); International Publication WO2007 / 069666). Such may be used. In particular, it may be an iPS cell produced by the method disclosed in International Publication WO2016 / 167329, and may be an iPS cell in which an oncogene, a polycomb gene, and an apoptosis-suppressing gene are knocked in. Not.

  In the present embodiment, in the step of obtaining undifferentiated cells from megakaryocytes, pluripotent stem cells are selected from Matrigel (registered trademark), laminin 421 or a fragment thereof, laminin 121 or a fragment thereof, or a combination thereof. Incubate with the substrate. Matrigel (registered trademark) and laminin are both one of the extracellular cell matrices constituting the basement membrane. Matrigel (registered trademark) is mainly composed of laminin and contains type IV collagen, heparin sulfate proteoglycan, entactin / nidogen, and growth factor. Laminin has many isoforms, and each isoform has 5 types of α chains (α1, α2, α3, α4, α5), 3 types of β chains (β1, β2, β3) and 3 types. Γ chains (γ1, γ2, and γ3) each as a subunit chain associate on the C-terminal side to form a coiled-coil structure, thereby forming a heterotrimeric molecule stabilized by a disulfide bond. The laminin 421 used in the present embodiment is composed of an α4 chain, a β2 chain and a γ1 chain, and the laminin 121 is composed of an α1 chain, a β2 chain and a γ1 chain. As these fragments, for example, E8 fragment is preferable. Laminin may be a natural form or a modified form in which one or more amino acid residues are modified as long as the biological activity is maintained. Laminin can be obtained by any known production method, and a commercially available product can also be used. The method for producing laminin is not particularly limited, and examples thereof include a method for purifying from laminin-expressing cells and a method for producing as a recombinant protein, but are not limited thereto. The method for producing a laminin fragment is not particularly limited, and examples thereof include a method for digesting full-length laminin with a proteolytic enzyme such as elastase, fractionating and purifying the desired fragment, and a method for producing a recombinant protein. However, it is not limited to these. Both laminin and laminin fragments are preferably produced as recombinant proteins from the viewpoint of production amount, quality uniformity, production cost, and the like.

Techniques for preparing undifferentiated cells from megakaryocytes by differentiation induction from pluripotent stem cells such as iPS cells have been established, and culture conditions other than the substrate can be carried out based on known techniques . For example, the conditions described in detail in International Publication WO2011 / 034073 may be the same as the conditions for inducing undifferentiated cells from megakaryocytes from pluripotent stem cells. Specifically, cells obtained from net-like structures prepared from iPS cells (also referred to as iPS-sac) as “cells that are undifferentiated from megakaryocytes” (particularly immediately after separation from net-like structures) The culture conditions for inducing cells) may be used. A “net-like structure” prepared from iPS cells is a three-dimensional sac-like structure (with a space inside) derived from ES cells or iPS cells, which is formed by an endothelial cell population or the like and has hematopoiesis inside. Including progenitor cells. For details of net-like structures, see, for example, TAKAYAMA et al., BLOOD 2008, 111: 5298-5306. The cell culture conditions suitable for preparing the net-like structure from human iPS cells vary depending on the iPS cells used. For example, as the medium, IMDM supplemented with FBS at a final concentration of 15% is used. Also in this case, those appropriately added with growth factors and supplements can be used. Furthermore, in order to efficiently form a net-like structure, VEGF is added in an amount of 0 to 100 ng / ml, more preferably about 20 ng / ml. The culture environment varies depending on the type of ES cell or iPS cell to be used. For example, conditions of 5% CO ₂ , 36 to 38 ° C., preferably 37 ° C. can be used.

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples do not limit the present invention.

Preparation of template DNA for IVT (in vitro transcription)
5'UTR template (no miRNA target sequence) and 3'UTR template were used with corresponding primers and KOD-Plus-Neo (KOD-401, TOYOBO), after 94 ° C 2 min, 98 ° C, PCR amplification was carried out under conditions of 10 sec, 68 ° C, 1 min for 25 cycles. The genes encoding tagBFP and hmAG1 are obtained from template plasmids (pTAP-tagBFP and pFucci-S / G2 / M Green-Hyg (Expression vector), respectively) and corresponding primers and KOD-Plus-Neo (KOD-401, TOYOBO). Using, PCR amplification was carried out under conditions of 25 cycles of 94 ° C, 2 min, and 98 ° C, 10 sec, 68 ° C, 1 min for 25 cycles.

Full DNA Template, which is the template for IVT, is 94 ° C 2 min using the PCR product prepared above and the corresponding primer (for those with miRNA response element, use oligo DNA instead of 5 'UTR). Thereafter, PCR amplification was performed under the conditions of 25 cycles of 98 ° C for 10 sec and 68 ° C for 1 min. All PCR products were purified using MiniElute PCR purification Kit (QIAGEN). However, those using a plasmid in the PCR reaction were treated with the restriction enzyme Dpn I before purification. The primers and oligonucleotide sequences used are shown in Table 2.

Production and purification of microRNA switch All mRNAs were produced by MegaScript kit (Ambion). At this time, in order to suppress the immune reaction, modified bases pseudoridine-5′-triphosphate and 5-methylcytidine-5′-triphosphate (TriLink Bio Technologies) were added in place of UTP and CTP, respectively. GTP was diluted 5-fold with Anti Reverse Cap Analog (TriLink Bio Technologies). The reaction mixture was incubated at 37 ° C for 6 hours, TURBO DNase (Amibion) was added, and then incubated at 37 ° C for an additional 30 minutes. The obtained mRNA was purified by FavorPrep Blood / Cultured Cells total RNA extraction column (Favorgen Biotech) and incubated at 37 ° C. for 30 minutes using Antarctic phosphatase (New England Biolabs). Then, it further refine | purified by RNeasy Mini Elute Cleanup Kit (QIAGEN). The sequence of the prepared mRNA is shown in Table 3.

Cell culture, platelet production
Nakamura et al, Cell Stem Cell. 2014 Apr 3; 14 (4): 535-48. And iPS cells (TKDN SeV2: established using Sendai virus, established by the method described in International Publication No. 2014/123242. Human fetal dermal fibroblast-derived iPS cells, 585A1, 585B1, 606A1, 648B1 and 692D2: human periphery established using the episomal vector described in Okita K, et al, Stem Cells 31, 458-66, 2012 Immortalized megakaryocyte progenitor cell line Cl-7 (hereinafter also referred to as imMKCL) produced by simultaneously introducing c-MYC, BMI1 and BCL-XL into hematopoietic stem cells derived from blood mononuclear cells (iPS cells) Then, cell culture was performed based on the method described in Nakamura et al, page 12, Cell Culture. However, in the platelet production conditions, C3H10T1 / 2 cells are not used, and in addition to human stem cell factor (SCF) 50 ng / ml, human thrombopoietin (TPO) 50 ng / ml, ROCK (Rho associated protein kinase) inhibitor Y27632 (International Publication No. 2012/157586) 10μM, Aryl hydrocarbon receptor antagonist, StemRegenin 1 (SR1) 0.75nM, ADAM 17 inhibitor, KP457 15μM (Hirata et al., Stem Cell Translational Medicine, in The cells were seeded in 2 ml / well of the medium supplemented with press) at 1 * 10 ⁵ / ml. Plate counts were measured using FACS Verse after days 6-8 when the medium was changed to DOX OFF (medium for platelet production). The DOX ON medium is described in Takayama et al, Blood. 2008 Jun 1; 111 (11): 5298-306. ESC differentiation medium is SCF, TPO at the concentration described above, and doxycycline (Doxycycline) is 0.5 μg. / ml was added. The DOX OFF medium was prepared by adding SCF, TPO, Y27632, KP457 at the concentrations described above.

Introduction and analysis of miRNA switch Human stem cell factor (SCF) 50 ng / ml, human thrombopoietin (TPO) 50 ng / ml in 6-well culture plates under the condition of doxycycline DOX ON (in the presence of doxycycline) In the existing state, miRNA switch was introduced into imMKCL by the lipofection method. Stemfect (Stemgent) 1 μl + Buffer 5.25 μl, 100 ng / μl of control mRNA and let-7a-5p-responsive mRNA 0.75 μl each and Buffer 4.75 μl were mixed, left at room temperature for 15 minutes, and placed in a 96-well plate 50 μl of cell suspension suspended in 1-4 * 10 ⁶ / ml was mixed and allowed to stand at room temperature for 30 minutes, and then 150 μl of medium was added and cultured overnight. The next morning, analysis was performed using FACS Aria II under the condition of DOX ON for cell proliferation.

With the DOX ON condition, cell separation was performed using FACS AriaII (same model as the analysis) for the let-7a-5p group with high activity (activity high) and low group (activity low) (sorting by flow satometer) ). After separation, the suspension was again suspended in a medium (DOX ON) supplemented with doxycycline. It was confirmed that once separated cells remained separated until 2 weeks (FIG. 3). For this reason, experiments were used from 3 days to 2 weeks after separation. 6 days after changing it to DOX OFF (medium for maturation of megakaryocytes and production of platelets), the number of platelet production was significantly increased in the low group (activity low) (Fig. 2). .

After separating with let-7a-5p activity, DOX was turned off, and let-7a-5p activity was examined over time, but the tendency of high activity was maintained (FIG. 3).

let-7a-5p inhibitor and Negetive Control were purchased from Applied Biosystems. Based on preliminary studies, imMKCL was introduced by lipofection, Stemfect (Stemgent) 1 μl + Buffer 5.25 μl, 10 μM miRNA inhibitor and negative control 0.4 μl + Buffer 5.85 μl mixed, 15 The mixture was allowed to stand at room temperature for 50 minutes, mixed with 50 μl of a cell solution suspended in 1-4 * 10 ⁶ / ml in a 96-well plate, allowed to stand at room temperature for 30 minutes, and then 150 μl of medium was added and cultured overnight. The next morning, the cells were washed, a part was analyzed by FACS Aria II, and the rest was suspended in a medium excluding DOX to mature the cells. Inhibitor of high cell population increased platelet production and approximated the low cell population. That is, when let-7a-5p activity was high, it was shown that platelet production release was suppressed (FIG. 4).

After separating the population with high and low let-7a-5p activity by the method described in FIGS. 1 and 2, RNA extraction and cDNA synthesis were performed, and quantitative PCR was performed. RNA extraction was performed using miRNeasy Mini Kit (QIAGEN) according to the manufacturer's instructions. cDNA synthesis was performed using 500 ng of total RNA and using ReverTra Ace (registered trademark) qPCR RT Master Mix (Toyobo) according to the manufacturer's instructions. Primers used for quantitative PCR are as described previously (Nakamura et al, Cell Stem Cell. 2014 Apr 3; 14 (4): 535-48.). Detailed sequences are listed in Table 5 below. As a reagent, SYBR PreMix ExTaq II (Takara Bio Inc.) was used to prepare a mixed solution shown in Table 4 below. As the apparatus, StepOneplus (Applied Biosystems) was used. PCR cycle was 95 ° C for 1 minute → (95 ° C for 10 seconds → 55 ° C for 10 seconds → 72 ° C for 30 seconds) * 40 cycles. GAPDH was used for endogenous control, and ΔΔCT method was used for data analysis. The cause of heterogeneity in let-7a-5p activity may be the effect of 3 genes (C-MYC, BMI1, BCLXL) that are forcibly expressed in imMKCL. Although confirmed by quantitative PCR, there was no statistically significant difference (FIG. 5).

Because let-7a-5p functionally inhibits megakaryocyte maturation and platelet production, the cell population with high and low let-7a-5p activity was used to find the target of let-7a-5p. RNA sequencing was performed on the populations and gene expression levels were compared. A part of the RNA sample used in FIG. 5 was used for RNA sequencing. cDNA synthesis and library preparation were performed according to previous papers (T Nakamura et al, Nucleic Acids Res. 2015 May 19; 43 (9): e60.). For the sequence, MiSeq Reagent Kit v3 (Illumina) was used. There were 691 genes that were expressed more than twice in the low activity cell population. Furthermore, using miRSystem, miRDB, and miRSearch, three miRNA target prediction databases were selected from 691 genes that could be targets of let-7a-5p, and 18 genes were picked up (FIG. 6). Among these genes, it was found that Lin 28A and NR6A1 are highly expressed in a cell population with low let-7a-5p activity (a cell population with high platelet production ability) (FIG. 7).

Quantitative PCR of Lin 28A, Lin 28B, and NR6A1 (FIG. 8) and quantitative PCR of E2F2, TTLL4, TBKBP1, XKR8, CCNF, and IGF2BP1 (FIG. 9) were performed by the methods described with reference to FIGS. Primers for each gene were designed at the Roche Universal Probe Library Assay Design Center, and it was confirmed beforehand that the primers were appropriate using a dilution series. The sequence is shown in Table 5 below. As a result, it was suggested that NR6A1 and Lin28B whose expression levels were rescued by adding inhibitor to a population with high let-7a-5p activity were targets of let-7a-5p (FIG. 8). Similarly, it was suggested that IGF2BP1 is also a target of let-7a-5p (FIG. 9).

Experiments related to introduction and analysis of miRNA switch described in the reagent change destination were performed by changing the lipofection reagent to Screenfect (Wako). Specifically, Screenfect 1 μl + Buffer 7 μl, 100 ng / μl of control mRNA and let-7a-5p-responsive mRNA in 0.5 ul increments + Buffer 7 μl, let stand for 15 minutes, put in a 96-well plate, 2 * 10 50 μl of cell suspension suspended in ⁶ / ml was mixed and allowed to stand at room temperature for 30 minutes, and then 150 μl of medium was added and cultured overnight. Moreover, among the quantitative PCR described above, the primer for NR6A1 was changed to one with less nonspecific amplification as described below. Several experiments were conducted using the primers before and after the change, and it was proved that there was almost no difference in the results.
Forward Primer; CCCAGTCATACAGTCTGAT (SEQ ID NO: 45)
Reverse Primer; AAGCAGGGCAAATAGTTCT (SEQ ID NO: 46)

From the experimental results shown with reference to FIG. 7 as the forced expression destination of NR6A1, it is assumed that NR6A1 is a downstream target gene of Let-7a-5p, and NR6A1 is introduced into cells of a group with high Let-7a-5p activity. It was thought that platelet production that was suppressed by overexpression was rescued. To demonstrate that, a virus was made to overexpress NR6A1. PCR (94 ° C. for 1 minute → (98 ° C. for 5 seconds → 57 ° C. for 10 seconds → 72 ° C. for 1 minute)) using the cDNA (SEQ ID NO: 49) used in the quantitative PCR experiment described above as a template and the following primers: 3 cycles → (98 ° C. 5 seconds → 68 ° C. 10 seconds → 72 ° C. 1 minute) × 40 cycles) to produce an insert. Using the Clontech In-Fusion HD cloning Kit, the tet-dependent NR6A1 expression vector can be obtained by incorporating it into the lentiviral vector (tet-dependent, GFP expression) used in the laboratory according to the determined procedure. Produced. Virus was prepared based on this plasmid.
Forward Primer; CGGTACCCGGGGATCCGCCACCATGGAGCGGGACGAACCG (SEQ ID NO: 47)
Reverse Primer; GCTGACTAGAGGATCCTCATTCCTTGCCCACACTGGT (SEQ ID NO: 48)

  A virus that does not express anything in imMKCL in the group with high Let-7a-5p activity and a virus that expresses NR6A1 are infected so that MOI = 1, and after sufficient cell growth, GFP is positive in the flow cytometer Cells were separated. When the imMKCL was set to DOX off, the number of platelet production measured on day 7 was significantly higher in the NR6A1-infected group (FIG. 10 (a)). This suggests that at least one of the causative genes that let-7a-5p functionally impaired platelet production is NR6A1. It was also found that the number of platelets produced can be increased by forced expression of NR6A1.

In order to prove that NR6A1 is an important gene for megakaryocyte maturation and platelet production, knockdown with siRNA was performed. All siRNAs were purchased from Dharmacon, and as a result of preliminary studies, it was found that introduction into imMKCL can be performed in the same manner as in the experiment using let-7a-5p inhibitor and Negative Control described above with reference to FIG. In addition, preliminary studies have demonstrated that knockdown of AHR (Aryl Hydrocarbon Receptor) promotes platelet production, indicating that this experimental system works normally. NR6A1 siRNA was purchased for 4 types of sequence, and it was proved that sufficient knockdown efficiency was obtained with # 1 and # 3 by preliminary examination. When NR6A1 siRNA # 1, # 3 and negative control siRNA were introduced into imMKCL, platelet production ability was significantly reduced by NR6A1 knockdown (FIG. 10 (b)).

We examined whether let-7a-5p and NR6A1 are important genes not only in imMKCL but also in cord blood-derived megakaryocytes. Umbilical cord blood CD34-positive cells purchased from DS Pharma Biomedical Co., Ltd. SCF 2.5ng / ml, TPO 100ng / ml, FLT3L 2.5ng / ml, IL6 50ng in the ESC differentiation medium described in the previous cell culture and platelet production experiments Culture was performed for 7 days using a medium supplemented with / ml. Among the cells obtained after 7 days, CD41-positive cells were separated using Milteny Biotech MACS beads, and let-7a-5p, negative control, NR6A1 siRNA and negative control were introduced by lipofection method. As a result of preliminary studies, the introduction method was as follows: Stemfect (Stemgent) 1 μl + Buffer 5.25 μl, 10 μM let-7a-5p and negative control, NR6A1 siRNA and negative control 1 μl + Buffer 5.25 μl, and left at room temperature for 15 minutes Add 50 μl of the cell solution suspended in 1-4 * 10 ⁶ / ml in a 96-well plate, let stand at room temperature for 30 minutes, then transfer to the same medium as imMKCL's DOX off medium and incubate for 7 days. The number of platelet production was measured. As a result, Let-7a-5p mimic and NR6A1 siRNA significantly reduced the platelet production ability (FIG. 10 (c)). This revealed that Let-7a-5p is a factor that inhibits maturation and NR6A1 is an important factor that promotes not only imMKCL cell lines but also more common megakaryocytes.

LIN28A
Of the 18 genes picked up as possible targets for let-7a-5p described above, it has been reported that LIN28A is a gene that inhibits Let-7a-5p maturation. In imMKCL, LIN28A regulates Let-7a-5p activity further upstream because there is a large difference in LIN28AmRNA expression between the group with high and low Let-7a-5p activity (Fig. 8). The experiment was conducted considering the possibility. A group of low Let-7a-5p activity, imMKCL (DOX ON), co-introduced with the Let-7a-5p-responsive tagBFP mRNA shown in SEQ ID NO: 16 and Control hmAG1 mRNA shown in SEQ ID NO: 18, or these and LIN28A siRNA Co-introduction was carried out by the lipofection method in the same manner as the experiment of the inhibitor introduction. As a result, an increase in Let-7a-5p activity was observed by LIN28A knockdown (FIG. 11 (a)). Such a result was not seen in the knockdown of LIN28B (FIG. 11 (b)). In the graph, “vehicle” represents transfection of siRNA negative control. In imMKCL, LIN28A was found to be a regulator of Let-7a-5p activity.

To investigate factors that regulate LIN28A expression, we investigated DNA methylation of CpG islands in the LIN28A promoter region. In the state of doxycycline DOX ON (in the presence of doxycycline) where the cells are cultured under the conditions described above for cell culture and platelet production, and the megakaryocyte cell line is proliferating, the cell group with high Let-7a-5p activity and low DNA was extracted from each cell group according to the procedure determined using the QIAGEN DNA extraction kit. Next, bisulfite treatment was performed according to the procedure determined using EZ DNA Methylation-Gold Kit of Zymo Research, and then bisulfite PCR was performed. CpG island searches and bisulfite PCR primers were based on past literature (Oncotarget. 2016 Mar 22; 7 (12): 14476-14485). For PCR enzyme, Toyobo's KOD Multi & Epi was used, and the PCR product thus obtained was used with Takara's Mighty-TA. 95 ° C for 5 minutes → (95 ° C for 30 seconds → 53 ° C for 30 seconds) → 72 ° C. 30 seconds) × 40 cycles → 72 ° C. for 10 minutes. This PCR product is cloned using the Takara Bio Mighty TA Cloning Kit, and a colony PCR performed using the specified primers, with a band appearing at an appropriate position, is amplified by 10 plasmids for each sample. Asked Jen for sequencing. The sequence results were analyzed using the free software QUMA on the web. As a result, it was found that the cell group with high Let-7a-5p activity was considerably methylated, and was nearly 10 times methylated with the cell group with low activity (FIGS. 11 (c) and (d). )). In FIG. 11D, CpG% indicates the number of methylated CpGs relative to the total number of CpGs. This suggests that the LIN28A promoter region CpG island methylation LIN28A and NR6A1 may greatly affect the expression level of LIN28A.

LIN28A promoter region CpG island methylation suppressed LIN28A expression, resulting in increased activity of let-7a-5p and reduced NR6A1 expression to reduce platelet production, thus demethylating the methylation It was thought that platelet production would be increased by increasing LIN28A expression. As a method for releasing methylation, a method of shaking culture of a megakaryocyte cell line was examined. That is, a part of the cell line in the state of DOX on was statically cultured as usual, and one was put 25 ml of culture solution and cells in a 125 ml flask, and cultured with shaking at 100 rpm for one week. Thereafter, even when DOX was turned off, the cells under each condition were subjected to stationary culture and shaking culture, and the platelet production ability was confirmed (FIG. 12 (a)). RNA was extracted from the cells cultured for one week with DOX on, and the expression levels of LIN28A and NR6A1 were measured by RT-PCR. FIG. 12B is a graph showing the relative amounts of LIN28A and NR6A1 when the amount of mRNA extracted from statically cultured cells is 1. As shown in FIG. 12 (b), the expression level of both genes increased when shaking culture was performed. FIG. 12 (c) is a graph showing the number of platelets produced under each of these conditions as a relative number with 100% when cultured as DOX on (Static) -DOX off (Static). From FIG. 12 (c), it can be seen that the cell group shake-cultured with DOX on produced many platelets. Furthermore, methylation of the LIN28A promoter region CpG island in DNA in cells that had been allowed to stand still for one week with DOX on or shake-cultured was analyzed by the same method as described above. The analysis result is shown in FIG. From FIG. 12 (d), the methylation rate decreased by 50% or more in the shaking culture, and it was suggested that there is a shaking culture method as one of the methods for releasing the methylation.

In addition, MKiPS technology was used to investigate whether the culture method at the stage of iPS cells would affect the platelet production ability after the megakaryocyte cell line was created. Specifically, Yamanaka 4 factors (OCT4, SOX2, KLF4, CMYC) were introduced to imMKCL based on the disclosure of International Publication WO2016 / 167329, which is incorporated herein by reference. MKiPS cells were prepared and differentiated into megakaryocytes again to make DOX on, so that imMKCL was made and culture was continued as DOX on. FIG. 13 (a) is a graph showing the amount of LIN28A mRNA measured by quantitative PCR in cells at various stages induced to differentiate from MKiPS cells, and the vertical axis represents the previous items of cell culture and platelet production. The relative amount when the LIN28A expression level in SeV2 imMKCL described in detail is set to 1. FIG. 13 (b) shows that the Let-7a-5p-responsive tagBFP mRNA represented by SEQ ID NO: 16 and the Control hmAG1 mRNA represented by SEQ ID NO: 18 were co-expressed from MKiPS cells after 14 days and 35 days after differentiation induction. The result of introduction and measurement of Let-7a-5p activity are shown. It was confirmed that the expression level of LIN28A decreased with passage (FIG. 13 (a) and Let-7a-5p activity increased (FIG. 13 (b)).

Next, it was verified whether the subsequent platelet production was different depending on the substrate for culturing MKiPS cells. Specifically, two cell lines, MKiPS11 and 12, were cultured on Laminin511 (trade name: iMatrix-511) and Matrigel (registered trademark). Specifically, Laminin or Matrigel is pre-coated on a 6-well plate, 5 * 10 ⁴ / well on Laminin 511, and 1: 4-6 so that no colonies are destroyed on Matrigel. MKiPS11 and 12 were seeded and cultured for one week. The culture medium was exchanged approximately once every two days. Thereafter, some of the cells differentiated by the EB method and collected on day 14 were used for RNA extraction, the rest were cultured with DOX on for one week, and then the number of platelet production was measured after another week as DOX off. RT-PCR was performed using RNA extracted at the stage of Day14. FIG. 13 (c) is a graph showing the relative expression level of LIN28AmRNA when the expression level of LIN28AmRNA extracted from the MKiPS11 cell line cultured with Laminin511 is 1. The expression level of LIN28A was higher in the Matrigel group in both strains (FIG. 13 (c)). Furthermore, about these, the megakaryocyte was cultured on the conditions similar to the experiment of FIG. 2, and the platelet was produced. FIG. 13 (d) is a graph showing the relative amount of platelet production when the number of platelets produced by megakaryocytes differentiated from the MKiPS11 cell line cultured in Laminin511 is taken as 100%. Platelet production was also increased in the Matrigel group (FIG. 13 (d)). Although not shown, when Laminin 121 and Laminin 421 were used instead of Matrigel, the same effect as Matrigel was demonstrated. This suggests that, at the stage of iPS cells, the culture method affects platelet production after preparation of megakaryocyte cell lines.

Claims (18)

  A method for discriminating cell heterogeneity in a megakaryocyte group comprising the following steps: (1) megakaryocyte cells comprising an mRNA comprising a marker gene operably linked to a nucleic acid sequence specifically recognized by a microRNA. And (2) identifying a group of cells having different characteristics using the translation amount of the marker gene as an index.   A method for selecting a cell group having high platelet-producing ability from a megakaryocyte group including the following steps: (1) Functionally linked to a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family A step of introducing mRNA containing the marker gene into a megakaryocyte cell group, and (2) a step of selecting a cell group having a high platelet-producing ability using the translation amount of the marker gene as an index.   The method according to claim 2, wherein the step of introducing the mRNA into a cell group is carried out during the growth phase of megakaryocyte cells.   The nucleic acid sequence specifically recognized by the microRNA selected from the let-7 family and the marker gene are linked in a 5 'to 3' direction, wherein the mRNA is linked in a 5 'to 3' direction. The method described.   5. The selection according to claim 2, wherein the selecting step selects a cell group having a low translation activity of the marker gene from a cell group having a low activity of microRNA selected from the let-7 family. the method of.   The method further comprises the step of introducing into the cell group a control mRNA that does not have a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family and includes a marker gene different from the marker gene. The method of any one of -5.   The method according to any one of claims 1 to 6, wherein the selecting step is performed using flow cytometry.   The method according to claim 1, wherein the selecting step is performed using an image analyzer.   The method according to any one of claims 1 to 6, wherein the marker gene is a drug resistance gene.   The method according to any one of claims 1 to 9, wherein the microRNA selected from the let-7 family is let-7a-5p. A step of selecting a cell group having high platelet production ability by the method according to any one of claims 1 to 10;
Culturing the selected cell group;
And a step of recovering platelets from the culture obtained by the culturing step.   A megakaryocyte cell selection kit comprising mRNA comprising a marker gene operably linked to a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family.   The mRNA is a nucleic acid in which a nucleic acid sequence specifically recognized by a microRNA selected from the let-7 family and the marker gene are linked in a 5 'to 3' direction. The megakaryocyte cell sorting kit described in 1.   The megakaryocyte cell selection kit according to claim 12 or 13, wherein the microRNA selected from the let-7 family is let-7a-5p. In an undifferentiated cell than a megakaryocyte, an oncogene, a polycomb gene, and an apoptosis inhibitor gene are forcibly expressed to obtain an immortalized megakaryocyte,
Including the step of suppressing the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, and the step of forcibly expressing the NR6A1 gene in the step of obtaining the immortalized megakaryocyte cells. , Production method of platelets. In an undifferentiated cell than a megakaryocyte, an oncogene, a polycomb gene, and an apoptosis inhibitor gene are forcibly expressed to obtain an immortalized megakaryocyte,
A step of inhibiting forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, and encoding the Lin28A gene in the cell in the step of obtaining the immortalized megakaryocyte cells A method for producing platelets, comprising a step of reducing the amount of methylation in a CpG island region of a promoter of DNA.   The method according to claim 16, wherein the step of reducing the amount of methylation comprises a step of shaking and culturing the cells in the step of obtaining the immortalized megakaryocyte cells. Inducing differentiation of pluripotent stem cells to obtain undifferentiated cells from megakaryocytes,
A step of forcibly expressing an oncogene, a polycomb gene, and an apoptosis-suppressing gene in an undifferentiated cell than the megakaryocyte cell to obtain an immortalized megakaryocyte cell;
Suppressing the forced expression of the oncogene, polycomb gene, and apoptosis-suppressing gene and culturing megakaryocyte cells, the step of obtaining undifferentiated cells from the megakaryocyte cells, the pluripotent stem cell A method for producing platelets, comprising a step of culturing using a substrate selected from Matrigel®, laminin 421 or a fragment thereof, or laminin 121 or a fragment thereof, or a combination thereof.

Images