JPWO2017159739A1 - Anti-cancer agent - Google Patents

Abstract

Disclosed is an anticancer agent containing an NRF3 inhibitor as an active ingredient, and a cancer treatment method comprising a step of administering an effective amount of an NRF3 inhibitor to a mammal.

Description

  The present invention relates to an anticancer agent and a cancer treatment method.

  Cancer is one of the diseases with high morbidity and mortality both in Japan and overseas. Currently, inhibitors such as nucleic acid synthesis and growth factor receptors are used in clinical treatment as anticancer agents. However, such known anticancer agents often act on normal cells and often have serious side effects.

  Therefore, development of a new antitumor agent that does not affect the survival and proliferation of normal cells is desired.

  NRF3 [Nuclear factor (erythoid-derived2) -like 3; NFE2L3] is a basic leucine zipper-type transcription factor belonging to the Cap'n'Collar family, and forms a heterodimer with a small Maf transcription factor group to form DNA. Combined (Non-Patent Documents 1 and 2). Gene candidates that NRF3 directly transcribes include NAD (P) H: quinone oxidoreductase-1 (NQO1), which is one of phase II drug-metabolizing enzymes, and smooth muscle actin αA and 22α, which are smooth muscle cell markers ( Non-patent documents 3, 4).

  The expression level of human NRF3 mRNA is high in placenta, particularly chorionic villi (Non-patent Documents 2 and 5). On the other hand, expression in the heart, brain, lung, kidney, pancreas, leukocyte, large intestine, thymus and spleen is moderate to low, and almost no expression in the testis, prostate, skeletal muscle and uterus (Non-patent Document 2). ).

  Research using genetically modified mice shows no significant change due to Nrf3 deficiency (Non-patent Documents 6 and 7), but reports that lymphoma is enhanced by continuous exposure to the carcinogen benzopyrene contained in tobacco smoke. (Non-patent Document 8). In addition, Nrf3-deficient mice exposed to a high concentration of the antioxidant dibutylhydroxytoluene induce acute lung injury and weight loss (Non-patent Document 9). Furthermore, the basal expression level of the anti-inflammatory protein Pparγ2 is increased in the lung and white adipose tissue of Nrf3-deficient mice (Non-patent Document 9). These reports suggest that NRF3 is involved in inflammation and metabolic abnormalities.

  In addition, it has been reported that the expression level of Nrf3 increases rapidly when reprogramming from macaque fibroblasts to pluripotent stem cells (Non-patent Documents 10 and 11). In addition, it has also been revealed that it is involved in mouse smooth muscle cell differentiation and avian embryogenesis (Non-patent Document 12).

Sykiotis GP, Bohmann D (2010) Stress-activated Cap’n’Collar transcription factors in aging and human disease.Sci Signal 3 (112): re3.doi: 10.1126 / scisignal.3112re3 Kobayashi A, Ito E, Toki T, Kogame K, Takahashi S, Igarashi K, Hayashi N, Yamamoto M (1999) Molecular cloning and functional characterization of a new Cap'n'Collar family transcription factor Nrf3.J Biol Chem 274 (10 ): 6443-6452 Sankaranarayanan K, Jaiswal AK (2004) Nrf3 negatively regulates antioxidant-response element-mediated expression and antioxidant induction of NAD (P) H: quinone oxidoreductase1 gene.J Biol Chem 279 (49): 50810-50817 Pepe AE, Xiao Q, Zampetaki A, Zhang Z, Kobayashi A, Hu Y, Xu Q (2010) Crucial role of nrf3 in smooth muscle cell differentiation from stem cells. Circ Res 106 (5): 870-879.doi: 10.1161 /CIRCRESAHA.109.211417 Chenais B, Derjuga A, Massrieh W, Red-Horse K, Bellingard V, Fisher SJ, Blank V (2005) Functional and placental expression analysis of the human NRF3 transcription factor.Mole Endocrinol 19 (1): 125-137.doi: 10.1210 / me.2003-0379 Derjuga A, Gourley TS, Holm TM, Heng HH, Shivdasani RA, Ahmed R, Andrews NC, Blank V (2004) Complexity of CNC transcription factors as revealed by gene targeting of the Nrf3 locus. Mol Cell Biol 24 (8): 3286 -3294 Kobayashi A, Ohta T, Yamamoto M (2004) Unique function of the Nrf2-Keap1 pathway in the inducible expression of antioxidant and detoxifying enzymes.Methods Enzymol 378: 273-286 Chevillard G, Paquet M, Blank V (2011) Nfe2l3 (Nrf3) deficiency predisposes mice to T-cell lymphoblastic lymphoma.Blood 117 (6): 2005-2008.doi: 10.1182 / blood-2010-02-271460 Chevillard G, Nouhi Z, Anna D, Paquet M, Blank V (2010) Nrf3-deficient mice are not protected against acute lung and adipose tissue damages induced by butylated hydroxytoluene. FEBS Lett 584 (5): 923-928.doi: 10.1016 /j.febslet.2010.01.028 Ben-Yehudah A, CAt Easley, Hermann BP, Castro C, Simerly C, Orwig KE, Mitalipov S, Schatten G (2010) Systems biology discoveries using non-human primate pluripotent stem and germ cells: novel gene and genomic imprinting interactions as well as unique expression patterns. Stem Cell Res Ther 1 (3): 24.doi: 10.1186 / scrt24 Byrne JA, Pedersen DA, Clepper LL, Nelson M, Sanger WG, Gokhale S, Wolf DP, Mitalipov SM (2007) Producing primate embryonic stem cells by somatic cell nuclear transfer.Nature 450 (7169): 497-502.doi: 10.1038 / nature06357 Etchevers HC (2005) The Cap'n'Collar family member NF-E2-related factor 3 (Nrf3) is expressed in mesodermal derivatives of the avian embryo. Int J Dev Biol 49 (2-3): 363-367.doi: 10.1387 / ijdb.041942he

  An object of this invention is to provide the anticancer agent and cancer treatment method which do not act on a normal cell, and act on a cancer cell specifically.

  As a result of intensive studies to achieve the above object, the present inventors have found that the transcription factor NRF3 is highly expressed in a plurality of tumor sites such as the large intestine and lung, human colon cancer cells, prostate cancer cells, In lung cancer cells and glioma cells, when the expression level of NRF3 was reduced by the siRNA method, it was found that the proliferation of these cancer cells can be significantly reduced. Furthermore, we confirmed that the induction of apoptosis and cell cycle (G0 / G1 phase) arrest were caused by the decreased expression of NRF3 in human colon cancer cells.

  Based on these findings, the present invention has been completed through further studies, and provides the following anticancer agents and the like.

Item 1. An anticancer agent containing an NRF3 inhibitor as an active ingredient.
Item 2. Item 2. The anticancer agent according to Item 1, wherein the NRF3 inhibitor is at least one selected from the group consisting of the following (1) to (6):
(1) a double-stranded RNA having an RNAi effect on the NRF3 gene,
(2) DNA capable of expressing double-stranded RNA having RNAi effect on NRF3 gene,
(3) an antisense nucleic acid for the transcript of the NRF3 gene or a part thereof,
(4) a nucleic acid having ribozyme activity that specifically cleaves the transcript of the NRF3 gene,
(5) an antibody that binds to NRF3,
(6) A low molecular weight compound that binds to NRF3.
Item 3. Item 3. The anticancer agent according to Item 1 or 2, wherein the NRF3 inhibitor is the following (1) and / or (2):
(1) a double-stranded RNA having an RNAi effect on the NRF3 gene,
(2) DNA capable of expressing double-stranded RNA having an RNAi effect on the NRF3 gene.
Item 4. Item 4. The item according to any one of Items 1 to 3, which is for colorectal cancer, prostate cancer, lung cancer, glioma, breast cancer, uterine cancer, gastric cancer, ovarian cancer, renal cancer, thymoma, small intestine cancer, or pancreatic cancer. Anti-cancer agent.
Item 5. A method for treating cancer comprising a step of administering an effective amount of an NRF3 inhibitor to a mammal.
Item 6. Use of NRF3 inhibitors in the manufacture of anticancer drugs.
Item 7. NRF3 inhibitor for use in the prevention and / or treatment of cancer.
Item 8. A pharmaceutical composition for preventing and / or treating cancer comprising an NRF3 inhibitor as an active ingredient.

  The anticancer agent of the present invention utilizes a new action mechanism and has an excellent anticancer action. Furthermore, since the anticancer agent of the present invention has an excellent property of not acting on normal cells but acting specifically on cancer cells, it is expected to reduce side effects over known anticancer agents. Is done.

It is a photograph which shows the measurement result of the NRF3 expression level (mRNA) in the normal site | part and tumor site | part of each organ. N: Normal site, T: Tumor site It is a graph which shows the measurement result of the NRF3 expression level (mRNA) in the normal site | part and tumor site | part of each organ. The vertical axis represents the average value of fluorescence intensity. N: Normal site, T: Tumor site ^* : p <0.05, ^*** : p <0.001 (Mean ± SE, Paired t-test) It is a graph which shows the correlation with the NRF3 expression level and cancer stage in a uterus, an ovary, a large intestine, and a colon. The vertical axis shows [(tumor fluorescence intensity) − (normal site fluorescence intensity)]. Error bars indicate SD. ^* : p <0.05 (Kruskal Wallis H-test / Mann-Whitney U-test) It is a graph which shows the correlation with the NRF3 expression level in a mammary gland, and a tumor diameter. The vertical axis shows [(tumor fluorescence intensity) − (normal site fluorescence intensity)]. Y = 18.30X-50.95, R ² = 0.25 (n = 20, Spearman's correction) It is a graph which shows the proliferation rate of a human cancer cell when the expression level of NRF3 is reduced by siRNA. (1): Colon cancer cell HCT116, (2): Prostate cancer cell LNCaP, (3): Lung cancer cell A549, (4): Glioma cell A172 ^*** ; p <0.005, n = 3, Tukey / ANOVA It is a graph which shows the ratio of the human colon cancer cell HCT116 by which apoptosis was induced when the expression level of NRF3 was reduced by siRNA. ^* : p <0.05, ^** : p <0.01, ^*** : p <0.005, n = 3, Tukey / ANOVA It is a graph which shows the ratio of the human colon cancer cell HCT116 by which G0 / G1 phase stop was induced when the expression level of NRF3 was reduced by siRNA. ^*** : p <0.005, n = 3, Tukey / ANOVA 2 is a photograph and a graph showing the results of in vitro analysis using NRF3-overexpressing human lung cancer cells H1299 (control cells are GFP-overexpressing cells). (A) Western blot of NRF3, (B) Time course of total cell number (n = 3, mean ± SD, Unpaired t-test) 2 is a photograph and graph showing the results of mouse transplantation analysis using NRF3-overexpressing human lung cancer cells H1299 (control cells are GFP-overexpressing cells). (A) Tumor photograph 23 days after transplantation (bar = 10 mm) (B) Tumor size change over time (n = 11, mean ± SD) (C) Tumor weight 23 days after transplantation (n = 11, mean ± SD, ^*** : p <0.005, Mann-Whitney U-test)

  Hereinafter, the present invention will be described in detail.

  In the present specification, “comprise” includes the meaning of “essentially consist of” and the meaning of “consist of”.

  In the present invention, “nucleic acid” means RNA or DNA. In the present specification, a gene encoding NRF3 is referred to as an NRF3 gene, and when simply described as NRF3, it means a protein.

  In the present invention, “gene” includes double-stranded DNA, single-stranded DNA (sense strand or antisense strand), and fragments thereof, unless otherwise specified. In the present invention, “gene” refers to a regulatory region, a coding region, an exon, and an intron without distinction unless otherwise specified.

  In the present invention, “nucleic acid”, “nucleotide” and “polynucleotide” are synonymous and include both DNA and RNA, and may be double-stranded or single-stranded.

  The anticancer agent of the present invention is characterized by containing an NRF3 inhibitor as an active ingredient.

  In the present invention, the term “NRF3 inhibitor” means all compounds that can inhibit the function of NRF3. Examples of such compounds include compounds that inhibit or suppress the expression of the NRF3 gene, functions or activities of NRF3, and the like. Or the compound etc. which reduce is mentioned.

Preferable examples of the NRF3 inhibitor include the following (1) to (6). These can be used alone or in combination of two or more. Of these, the following (1) and (2) are particularly preferred.
(1) a double-stranded RNA having an RNAi effect on the NRF3 gene,
(2) DNA capable of expressing double-stranded RNA having RNAi effect on NRF3 gene,
(3) an antisense nucleic acid for the transcript of the NRF3 gene or a part thereof,
(4) a nucleic acid having ribozyme activity that specifically cleaves the transcript of the NRF3 gene,
(5) an antibody that binds to NRF3,
(6) A low molecular weight compound that binds to NRF3.

  NRF3 is a transcription factor, officially named Nuclear factor, erythroid 2-like 3, also known as NFE2L3, and was first isolated from HeLa cells in 1999 (A Kobayashi et al., J Biol Chem. 1999 Mar 5 ; 274 (10): 6443-6452). The nucleotide sequence of the NRF3 gene is registered on the NCBI website as RefSeq Accession No. NM_004289 (human) (SEQ ID NO: 1) and NM_010903 (mouse) (SEQ ID NO: 2). The amino acid sequence is RefSeq Accession No. NP_004280 ( Human) (SEQ ID NO: 3) and NP_035033 (mouse) (SEQ ID NO: 4).

  The NRF3 gene in the present invention includes degenerates and mutants thereof other than those having a base sequence registered in the database as described above. Those encoding proteins having biological activity equivalent to the protein consisting of the sequence are desirable. Examples of proteins having equivalent biological activity include proteins derived from other organisms.

  Examples of the mutant include (a) 1 or 2 or more, for example, 1 to 50, 1 to 25, 1 to 12, 1 to 9 in the amino acid sequences registered in the database as described above. A gene encoding a protein comprising an amino acid sequence in which 1 to 5 amino acids are substituted, deleted or added, (b) 70% or more, 80% or more of the nucleotide sequence registered in the database as described above And genes comprising nucleotide sequences having 90% or more and 95% or more identity.

  The identity of the base sequence can be calculated using an analysis tool that is commercially available or available through a telecommunication line (Internet). The base sequence identity (%) can be determined using a program commonly used in the art (for example, BLAST, FASTA, etc.) by default.

  Hereinafter, the NRF3 inhibitors (1) to (6) will be described.

(Double-stranded RNA with RNAi effect)
By using double-stranded RNA having an RNAi effect on NRF3, expression of the NRF3 gene can be inhibited or suppressed.

  RNAi (RNA interference) is the introduction of double-stranded RNA consisting of a sense RNA consisting of the same sequence as the mRNA sequence of a target gene and an antisense RNA consisting of a complementary sequence into the cell. This refers to a phenomenon in which target gene expression is inhibited by destroying mRNA of a target gene and inhibiting translation into a protein. The details of the RNAi mechanism are still unknown, but an enzyme called DICER (a member of the RNase III nuclease family) contacts double-stranded RNA, and double-stranded RNA is called small interfering RNA (siRNA). The main mechanism is considered to be broken down into small pieces. The double-stranded RNA having an RNAi effect in the present invention includes the siRNA.

  The double-stranded RNA having the RNAi effect in the present invention includes a molecule having a structure in which one end of the double-stranded RNA is closed, for example, siRNA (shRNA) having a hairpin structure. That is, the RNA includes a molecule that can form a double-stranded RNA structure in the molecule.

  The RNA used for RNAi in the present invention need not be completely identical to the NRF3 gene or a partial region of the gene, but preferably has perfect identity.

  The double-stranded RNA having the RNAi effect of the present invention is usually a sense RNA consisting of the same sequence as any continuous RNA region in the mRNA of the NRF3 gene, and an antisense RNA consisting of a sequence complementary to the sense RNA. Is a double-stranded RNA. The length of the “arbitrary arbitrary RNA region” is usually 20 to 30 bases, and preferably 21 to 23 bases. However, even a long-chain RNA that does not have an RNAi effect as it is can be decomposed into siRNA having an RNAi effect in a cell, so the length of a double-stranded RNA in the present invention is particularly Not limited. In addition, long double-stranded RNA corresponding to the full-length or almost full-length region of NRF3 gene mRNA can be decomposed in advance with DICER, for example, and the degradation product can be used as the double-stranded RNA of the present invention. This degradation product may include double-stranded RNA molecules (siRNA) having an RNAi effect.

  In addition, since double-stranded RNA having an overhang of several bases at the end is generally known to have a high RNAi effect, the double-stranded RNA of the present invention has an overhang of several bases at the end. Is desirable. The length of the base forming this overhang is not particularly limited, but is preferably a 2-base overhang. In the present invention, for example, a double-stranded RNA having an overhang such as TT (thymine × 2), UU (uracil × 2) or the like can be used, particularly preferably a 19-base double-stranded RNA and an TT overhang. It is a molecule having The double-stranded RNA in the present invention includes molecules in which the base that forms an overhang is DNA.

  In addition, siRNAs containing natural nucleotides are susceptible to degradation because they are sensitive to ribonucleases. In the present invention, in order to compensate for this drawback, 2′-O-methylated siRNA in which the 2′OH group of uridine and cytidine in siRNA is methylated may be synthesized and used.

  The “double-stranded RNA having an RNAi effect on the NRF3 gene” in the present invention can be prepared based on the information on the base sequence of the NRF3 gene that is the target of the double-stranded RNA. For example, based on the base sequence described in SEQ ID NO: 1 or 2, an arbitrary continuous RNA region of mRNA that is a transcription product of the sequence is selected, and a double-stranded RNA corresponding to this region is prepared.

  Specific examples of the “double-stranded RNA having RNAi effect” in the present invention include the double-stranded RNAs (SEQ ID NOs: 5 and 6, 7 and 8, 9 and 10) described in Examples. .

  In the double-stranded RNA of the present invention, not all nucleotides need to be ribonucleotides (RNA). That is, in the present invention, one or more ribonucleotides constituting the double-stranded RNA can be the corresponding deoxyribonucleotides.

  In the present invention, the nucleic acid constituting the double-stranded RNA can be, for example, a nucleic acid analog such as LNA (Locked Nucleic Acid). Since the LNP is a substance resistant to nucleases, the RNAi effect can be maintained for a longer time.

  The double-stranded RNA of the present invention can be synthesized chemically or in vitro or in vivo using DNA encoding the double-stranded RNA of the present invention.

  In addition, the double-stranded RNA having the RNAi effect in the present invention may be one using DNA capable of expressing the double-stranded RNA in a cell. The DNA capable of expressing such a double-stranded RNA is usually an independent or continuous DNA that encodes one strand of the double-stranded RNA and a DNA that encodes the other strand of the double-stranded RNA. DNA having a structure linked to a promoter so that it can be expressed. The DNA can be easily produced by a known genetic engineering technique. Examples of the DNA include an expression vector obtained by inserting a DNA encoding the RNA of the present invention into a known expression vector.

(Antisense nucleic acid)
By using an antisense nucleic acid for the transcript of the NRF3 gene or a part thereof, the expression of the NRF3 gene can be inhibited or suppressed.

  As one embodiment of the present invention, designing an antisense sequence complementary to the untranslated region near the 5 ′ end of the mRNA of the NRF3 gene can be effective in inhibiting gene translation. It is also possible to use a sequence complementary to the coding region or the 3 ′ untranslated region. Thus, the nucleic acid containing the antisense sequence of the sequence of the non-translated region as well as the translated region of the NRF3 gene can be included in the antisense nucleic acid of the present invention. The sequence of the antisense nucleic acid is desirably a sequence complementary to the target gene or a part thereof, but it is not necessary to be completely complementary as long as the expression of the gene can be effectively suppressed. On the other hand, the complementarity is preferably 90% or more, more preferably 95% or more. In order to effectively suppress the expression of the target gene using an antisense nucleic acid, the length of the antisense nucleic acid is preferably 15 bases or more. Furthermore, it is preferable to use a plurality of antisense nucleic acids complementary to different sequences of the target gene in order to avoid non-specific effects.

  Moreover, the antisense nucleic acid in the present invention may be one using DNA capable of expressing the antisense nucleic acid in a cell. The DNA can be easily produced by a known genetic engineering technique. Examples of the DNA include an expression vector obtained by inserting a DNA encoding the antisense nucleic acid of the present invention into a known expression vector.

(Nucleic acid having ribozyme activity)
By using a nucleic acid having a ribozyme activity that specifically cleaves the transcript of the NRF3 gene, expression of the NRF3 gene can be inhibited or suppressed.

  The ribozyme means an RNA molecule having catalytic activity, and there are ribozymes having various activities. It is possible to design a ribozyme that specifically cleaves the mRNA of the NRF3 gene by a known method.

  The nucleic acid having the ribozyme activity may be one using DNA capable of expressing the nucleic acid having the ribozyme activity. The DNA can be easily produced by a known genetic engineering technique. Examples of the DNA include an expression vector obtained by inserting a DNA encoding a nucleic acid having ribozyme activity in the present invention into a known expression vector.

(antibody)
By using an antibody that binds to NRF3, the function or activity of NRF3 can be inhibited or reduced.

Antibodies that bind to NRF3 can be prepared by methods known to those skilled in the art. The antibody of the present invention is not particularly limited as long as it can bind to NRF3, and includes polyclonal antibodies, monoclonal antibodies, humanized antibodies, modified antibodies and the like. The antibody may also be an antibody fragment, and examples of such an antibody fragment include Fab, Fab ′, F (ab ′) ₂ , Fv, scFv and the like. Furthermore, antibody isotypes include IgG (IgG1, IgG2, IgG3, IgG4), IgM, IgA, IgD, etc., but any of them can be used without limitation.

(Low molecular compound)
By using a low molecular weight compound that binds to NRF3, the function or activity of NRF3 can be inhibited or reduced.

  The low molecular weight compound that binds to NRF3 may be either a natural or artificial compound, and can be screened by a known method.

  The anticancer agent of the present invention may be mixed with a pharmaceutically acceptable carrier. These pharmaceutically acceptable carriers include, for example, excipients, buffers, preservatives, stabilizers, suspending agents, isotonic agents, surfactants, binders, disintegrants, coloring agents, flavoring agents, lubricants. Examples of the additives include fluid additives, fluidity promoters, and flavoring agents.

  In formulating the anticancer agent of the present invention, according to a conventional method, the above carrier can be added as necessary. Examples of the carrier include light anhydrous silicic acid, lactose, mannitol, starch, gelatin, Corn starch, crystalline cellulose, carmellose sodium, carmellose calcium, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylacetal diethylaminoacetate, polyvinylpyrrolidone, medium chain fatty acid triglyceride, polyoxyethylene hydrogenated castor oil 60, sucrose, carboxymethylcellulose, inorganic salts, etc. Can be added.

  As the types of dosage forms of the anticancer agent of the present invention, tablets, pills, powders, powders, granules, fine granules, soft or hard capsules, film coating agents, sublingual agents, pellets as oral agents And pastes include parenteral preparations such as injections, transdermal preparations, ointments, plasters, suppositories, and liquids for external use. Select the optimal dosage form according to the route of administration, administration subject, etc. Can do.

  The “anticancer agent” in the present invention may be expressed as an antitumor agent, an antitumor agent, an antitumor pharmaceutical composition or the like.

  When a DNA capable of expressing a double-stranded RNA having an RNAi effect, an antisense RNA, and a nucleic acid having a ribozyme activity in the present invention is administered in vivo, a viral vector such as a retrovirus, an adenovirus, or a Sendai virus, a liposome, etc. Non-viral vectors can be used. In addition, when administering double-stranded RNA having RNAi effect, antisense nucleic acid, and nucleic acid having ribozyme activity in vivo in the present invention, non-viral vectors such as liposomes, polymer micelles, and cationic carriers should be used. Can do. Examples of the administration method include an in vivo method and an ex vivo method.

  The amount of the NRF3 inhibitor, which is an active ingredient in the anticancer agent of the present invention, is appropriately selected according to the dosage form, administration route, etc., but is usually about 0.0001 to 90% by mass, preferably 0.001 in the total amount of the preparation. About 70% by mass.

  The anticancer agent of the present invention is administered to mammals including humans. The method for administering the anticancer agent of the present invention is not particularly limited, and can be performed by methods known to those skilled in the art, such as intraarterial injection, intravenous injection, and subcutaneous injection. The dosage of the anticancer agent of the present invention can be appropriately determined finally based on the judgment of a doctor in consideration of the type of dosage form, administration method, patient age and weight, patient symptoms, and the like.

  The types of cancer that can be treated with the anticancer agent of the present invention are gastric cancer, colon cancer (rectal cancer, colon cancer), small intestine cancer, liver cancer, pancreatic cancer, lung cancer, pharyngeal cancer, esophageal cancer, renal cancer, gallbladder and bile duct. Cancer, head and neck cancer, bladder cancer, prostate cancer, breast cancer, uterine cancer (cervical cancer, endometrial cancer), ovarian cancer, brain tumor (for example, glioma), thymoma, leukemia, malignant lymphoma, etc. Among them, colon cancer, prostate cancer, lung cancer, glioma, breast cancer, uterine cancer, stomach cancer, ovarian cancer, renal cancer, thymoma, small intestine cancer and pancreatic cancer, especially colon cancer, prostate cancer, lung cancer, glioma, ovary High effects are expected for cancer and uterine cancer.

  The anticancer agent of the present invention has an excellent anticancer action. In addition, since the anticancer agent of the present invention utilizes a new mechanism of action that targets NRF3, it has an excellent property of acting specifically on cancer cells without acting on normal cells. Have. As a result, a reduction in side effects is expected compared to known anticancer agents that also act on normal cells.

  Examples are given below to illustrate the present invention in more detail. However, the present invention is not limited to these examples.

Test example 1
Using a cancer profiling array (Clontech, 7841-1), the NRF3 expression level (mRNA) in the normal site and tumor site of each organ was measured. As a probe template, two approximately 500 bp long fragments represented by SEQ ID NOs: 11 and 12 appearing by digesting NRF3 cDNA with Hind / EcoRI were mixed and used. The NRF3 expression level was quantified by measuring the fluorescence intensity using image analysis software Image J.

  The results are shown in FIGS. 2-4 was created based on the quantitative data obtained from the results of FIG. It was found that NRF3 is highly expressed in tumor sites of various organs (FIG. 1). A particularly significant increase in expression was observed in colon cancer, colon cancer, uterine cancer and ovarian cancer (FIG. 2). In colon cancer, colon cancer, uterine cancer, and ovarian cancer, in which significant increase in expression was observed, NRF3 expression was found to increase with stage progression (FIG. 3). In breast cancer, NRF3 expression was positively correlated with tumor diameter (FIG. 4).

Test example 2
The effect on cell proliferation when the expression level of NRF3 was reduced by the siRNA method was examined. As cells, human colon cancer cell HCT116, human prostate cancer cell LNCaP, human lung cancer cell A549, and human glioma cell A172 were used.

HCT116 cells and A172 cells are mixed with D-MEM medium (containing high glucose, L-glutamine, phenol red) (Wako Pure Chemical Industries, Ltd., 044-29765) with a final concentration of 10% FBS (Nichirei Biosciences, Inc.). 171012), a penicillin / streptomycin mixed solution (Thermo Fisher Scientific, 15140-122) having a final concentration of 40 units / mL was added, and the cells were cultured at 37 ° C. in a 5% CO ₂ environment.

A549 cells were added to D-MEM medium (containing high glucose, L-glutamine, phenol red) (Wako Pure Chemical Industries, Ltd., 044-29765) at a final concentration of 2 mM L-glutamine (Nacalai Tesque, 16948). -04), FBS with a final concentration of 10% (Nichirei Biosciences, Inc., 171012), penicillin / streptomycin mixed solution (Thermo Fisher Scientific, 15140-122) with a final concentration of 40 units / mL, added at 37 ° C., 5 The cells were cultured in a% CO ₂ environment.

LNCaP cells were prepared in RPMI 1640 medium (containing L-glutamine) (Nacalai Tesque, Inc., 30264-56) with a final concentration of 10% FBS (Nichirei Biosciences, Inc., 171012) and a final concentration of 40 units / mL penicillin. / Streptomycin mixed solution (Thermo Fisher Scientific, 15140-122) was added and cultured in a 37 ° C., 5% CO ₂ environment.

Immediately after seeding 0.5 × 10 ⁵ cells in a 12 well plate (Thermo Fisher Scientific, 150628), Opti-MEM (Thermo Fisher Scientific, 31985070) 100 μL per well, 20 pmol siRNA, Lipofectamine® RNAiMAX Reagent ( Thermo Fisher Scientific, 13778150) 2.5 μL of the mixed solution was added.

  As NRF3 siRNA, # 1 (sense strand: CGCAAAUUGGACAUAAUUUTT (SEQ ID NO: 5), antisense strand: AAAAUUAUGUCCAAUUUGCGTT (SEQ ID NO: 6)) corresponding to three different target sequences, # 2 (sense strand: GGAUCAAAGUGAUUCUGAUTT (SEQ ID NO: 7), Antisense strand: AUCAGAAUCACUUUGAUCCAA (SEQ ID NO: 8)) and # 3 (sense strand: GCAAAGAAGGAAACUCUUATT (SEQ ID NO: 9), antisense strand: UAAGAGUUUCCUUCUUUGCUU (SEQ ID NO: 10)) were used. As control siRNA (siCtrl), sense strand: UUCUCCGAACGUGUCACGUTT (SEQ ID NO: 13) and antisense strand ACGUGACACGUUCGGAGAATT (SEQ ID NO: 14) were used.

  72 hours after introduction of siRNA, the medium was aspirated and cells were detached with 0.05% trypsin-EDTA solution (Thermo Fisher Scientific, 25300-062). Then, the total cell number was measured using the blood cell conversion board.

  The results of calculating the growth efficiency when the control siRNA (siCtrl) is 1 are shown in FIG. Three days after the introduction of NRF3 siRNA, a significant decrease in proliferation was observed in all the cells of HCT116, LNCaP, A549, and A172. This strongly indicates that NRF3 is a novel therapeutic target molecule for cancer.

Test example 3
The effect on cell death (apoptosis) when the NRF3 expression level was decreased by siRNA method was investigated. As a cell, human colon cancer cell HCT116 was used.

HCT116 cells were prepared in D-MEM medium (containing high glucose, L-glutamine, and phenol red) (Wako Pure Chemical Industries, Ltd., 044-29765) with a final concentration of 10% FBS (Nichirei Biosciences, Inc., 171012). Then, a penicillin / streptomycin mixed solution (Thermo Fisher Scientific, 15140-122) having a final concentration of 40 units / mL was added, and the cells were cultured at 37 ° C. in a 5% CO ₂ environment.

Immediately after seeding HCT116 cells in 6-well plates (Thermo Fisher Scientific, 140675) at 1 x 10 ⁵ cells, Opti-MEM (Thermo Fisher Scientific, 31985070) 200 μL per well, 40 pmol siRNA, LipofectamineTM RNAiMAX Reagent ( Thermo Fisher Scientific, 13778150) 5 μL of the mixed solution was added.

  NRF3 siRNA # 1 (sense strand: CGCAAAUUGGACAUAAUUUTT, antisense strand: AAAUUAUGUCCAAUUUGCGTT), # 2 (sense strand: GGAUCAAAGUGAUUCUGAUTT, antisense strand: AUCAGAUCACUUUGAUCCAA), and # 3 (sense strand: GCACUGAAG) , Antisense strand: UAAGAGUUUCCUUCUUUGCUU) was used. Moreover, sense strand: UUCUCCGAACGUGUCACGUTT and antisense strand ACGUGACACGUUCGGAGAATT were used as control siRNA (siCtrl).

  Forty-eight hours after siRNA introduction, the medium was aspirated and the cells were detached with 0.05% trypsin-EDTA solution (Thermo Fisher Scientific, 25300-062). Subsequently, staining was performed using Alexa Fluor (TM) 488 Annexin v / Dead cell Apoptosis Kit (Thermo Fisher Scientific, V13241) or Click-iT EdU Alexa Fluor 647 Flow Cytometry Assay Kit (Thermo Fisher Scientific, C10424), and FACSAria II ( The ratio of apoptotic cells or G0 / G1 phase arrested cells was measured by BD Bioscience.

  The results are shown in FIGS. Two days after introduction of NRF3 siRNA, apoptosis induction was observed in HCT116 cells (FIG. 6). This strongly indicates that NRF3 is a novel therapeutic target molecule for cancer. Two days after NRF3 siRNA introduction, cell cycle arrest in G0 / G1 phase was observed in HCT116 cells (FIG. 7). This strongly indicates that NRF3 enhances cancer growth.

Test example 4
A plasmid that expresses human full-length NRF3 fused with a FLAG tag on the N-terminal side (FLAG-NRF3 plasmid) and a plasmid that expresses green fluorescent protein fused with a FLAG tag on the N-terminal side (FLAG-GFP plasmid) as a control Each was introduced into human lung cancer cells H1299. H1299 cells were prepared in RPMI 1640 medium (containing L-glutamine) (Nacalai Tesque, Inc., 30264-56) with a final concentration of 10% FBS (Nichirei Biosciences, Inc., 171012) and a final concentration of 40 units / mL penicillin. / Streptomycin mixed solution (Thermo Fisher Scientific, 15140-122) was added and cultured in a 37 ° C., 5% CO ₂ environment.

Immediately after seeding 2 × 10 ⁶ cells in a 6-well plate (Thermo Fisher Scientific, 150628), Opti-MEM (Thermo Fisher Scientific, 31985070) 100 μL, 2 μg plasmid DNA, Lipofectamine (trademark) 2000 Transfection Reagent per well (Thermo Fisher Scientific, 11668027) 5 μL of the mixed solution was added. 72 hours after introduction of the plasmid, the medium was replaced with a medium supplemented with G418 (Nacalai Tesque, 08973-14) at a final concentration of 700 μg / ml. The medium was changed every 3-5 days for cloning. Thereafter, a clonal cell line expressing NRF3 was selected by Western blot (FIG. 8A).

The cloned NRF3 or GFP cell line was seeded on a 12-well plate (Thermo Fisher Scientific, 150628) at 2 × 10 ⁴ cells. At this time, RPMI 1640 medium (containing L-glutamine) (Nacalai Tesque, Inc., 30264-56) and final concentration of 10% FBS (Nichirei Biosciences, Inc., 171012), final concentration of 40 units / mL Of penicillin / streptomycin (Thermo Fisher Scientific, 15140-122) was used and cultured in a 37 ° C., 5% CO ₂ environment. The medium was aspirated every 2-3 days for 7 days after the start of measurement, the cells were detached with 0.05% trypsin-EDTA solution (Thermo Fisher Scientific, 25300-062), and the total cell number was measured using a hemocytometer. After the measurement, 1/10 of the total cell detachment solution was seeded on a plate with a new medium, and the culture was continued.

  The result is shown in FIG. 8B. As a result of the measurement, it was clarified that the growth of cancer cells was significantly enhanced by the high expression of NRF3.

Test Example 5
The cloned NRF3 or GFP cell line was added to RPMI 1640 medium (containing L-glutamine) (Nacalai Tesque, 30264-56) at a final concentration of 50 μg / ml G418 (Nacalai Tesque, 08973-14), FBS (Nichirei Bioscience, 171012) at a final concentration of 10%, penicillin / streptomycin mixed solution (Thermo Fisher Scientific, 15140-122) at a final concentration of 40 units / mL was added, and the mixture was added at 37 ° C., 5% CO _2. Cultured in the environment. The medium is aspirated every 2-4 days, and the cells are detached with 0.05% trypsin-EDTA solution (Thermo Fisher Scientific, 25300-062), and 1 × D-PBS (−) to obtain 4-8 × 10 ⁶ cells / 100 μl. ) (Wako Pure Chemical Industries, Ltd., 048-29805).

  Thereafter, 100 μl of one flank was implanted subcutaneously into both ventral sides of 4-week-old female BALB / cAJcl-nu / nu mice (CLEA Japan, Inc.). Subcutaneous transplantation was performed in a safety cabinet and mice were housed in an isolator. During the 23 days after transplantation, the tumor diameter was measured every 2 to 3 days using calipers, and the tumor size was calculated by the following formula: 1/2 x tumor major axis x tumor minor axis x tumor minor axis. 23 days after transplantation, the mice were euthanized by cervical dislocation. After photographing the whole body image and the excised tumor, the weight of the tumor was measured.

  The results are shown in FIG. As a result of these measurements, it was clarified that the high expression of NRF3 significantly increased both tumor size and tumor weight.

Claims (7)

  An anticancer agent containing an NRF3 inhibitor as an active ingredient. The anticancer agent according to claim 1, wherein the NRF3 inhibitor is at least one selected from the group consisting of the following (1) to (6):
(1) a double-stranded RNA having an RNAi effect on the NRF3 gene,
(2) DNA capable of expressing double-stranded RNA having RNAi effect on NRF3 gene,
(3) an antisense nucleic acid for the transcript of the NRF3 gene or a part thereof,
(4) a nucleic acid having ribozyme activity that specifically cleaves the transcript of the NRF3 gene,
(5) an antibody that binds to NRF3,
(6) A low molecular weight compound that binds to NRF3. The anticancer agent according to claim 1 or 2, wherein the NRF3 inhibitor is the following (1) and / or (2):
(1) a double-stranded RNA having an RNAi effect on the NRF3 gene,
(2) DNA capable of expressing double-stranded RNA having an RNAi effect on the NRF3 gene.   It is for colorectal cancer, prostate cancer, lung cancer, glioma, breast cancer, uterine cancer, gastric cancer, ovarian cancer, renal cancer, thymoma, small intestine cancer, or pancreatic cancer, according to any one of claims 1 to 3. Anticancer drugs.   A method for treating cancer comprising a step of administering an effective amount of an NRF3 inhibitor to a mammal.   Use of NRF3 inhibitors in the manufacture of anticancer drugs.   NRF3 inhibitor for use in the prevention and / or treatment of cancer.

Images