JPWO2011125245A1 - Method for predicting prognosis of small cell lung cancer using miRNA, method for treating small cell lung cancer, method for improving prognosis of small cell lung cancer, and method for screening agent for treating small cell lung cancer - Google Patents

Abstract

The present invention provides a prognosis method for small cell lung cancer, a method for treating small cell lung cancer, a method for improving prognosis of small cell lung cancer, a therapeutic agent for small cell lung cancer, and a screening method for a therapeutic agent for small cell lung cancer using miRNA. Specifically, the present invention relates to a method for prognosing a small cell lung cancer patient using miR-153, miR-196a, miR-203 or miR-216a as an index, a method for improving the prognosis of a small cell lung cancer using them, and A small cell lung cancer therapeutic method and a small cell lung cancer therapeutic agent targeting the above, and a screening method for a small cell lung cancer therapeutic agent using the same.

Description

  The present invention relates to the fields of small cell lung cancer prognosis prediction, examination, and diagnosis method using miRNA, small cell lung cancer treatment method, small cell lung cancer prognosis improvement method, and small cell lung cancer therapeutic agent screening method.

  High-grade pulmonary neuroendocrine tumors consist of small cell lung cancer (SCLC) and large cell neuroendocrine cancer (LCNEC). SCLC is a very high-grade lung cancer, but is generally less sensitive because of its high sensitivity to chemotherapy. However, although the sensitivity to chemotherapy is high in the early stage of treatment, the sensitivity is often low and the prognosis is very poor.

On the other hand, microRNA (hereinafter referred to as “miRNA”) is a non-coding RNA having a small nucleotide of about 20 to 25 that is not translated into protein. As for miRNA, a primary transcript (pri-miRNA) of about several hundred bases is first transcribed from a DNA region that does not encode a protein. The primary transcript is processed into a secondary transcript (pre-miRNA) by Drosha with the complex. Then, after being transported to the cytoplasm, it is processed by Dicer and becomes a double-stranded mature miRNA of about 20 to 25 nucleotides. It is known that one of the two miRNAs forms a complex with RISC and binds to the 3 ′ untranslated region of the target mRNA to cause translational repression. Many miRNAs are known to exist in organisms including humans. Recently, the relationship with diseases, particularly cancer, has attracted attention, and miRNA expression patterns are used for cancer diagnosis and miRNA expression is controlled. It has been proposed to be used for cancer treatment (Patent Document 1).
For example, the expression of the let-7 family is decreased in lung cancer, and the decreased expression is a poor prognostic factor, and when miR-17-92 clusters that are overexpressed in lung cancer are overexpressed, a growth promoting effect is observed. On the other hand, suppression of expression by antisense oligos has been shown to cause proliferation suppression and cell death induction specifically in lung cancer cell lines that strongly express miR-17-92 clusters (Non-Patent Document 1, 2). In colorectal cancer, the expression levels of miR-143 and miR-145 decreased, and miR-143 was shown to show antitumor effects when administered to model animals as an agonist. (Non-patent Document 3).
In lung adenocarcinoma and lung squamous cell carcinoma, expression levels of hsa-mir-126, has-mir-205 and has-mir-21 are increased or decreased, and expression of hsa-mir-155 is high or hsa. -Lung adenocarcinoma patients with low expression of let-7a-2 have been shown to have a worse prognosis than patients with low expression of hsa-mir-155 or high expression of hsa-let-7a-2 ( Patent Document 2).
In addition, in non-small cell lung cancer (NSCLC) patients, it has been shown that when let-7 expression is reduced, the risk of early death is high (Non-Patent Document 4). However, in SCLC it is not well understood what miRNAs are associated with disease prognosis.

WO2004 / 043387 WO2007 / 081720

Hayashita Y. et al. et al. , Cancer Res. 65: 9628-9632 (2005) Matsubara H. et al. et al. , Oncogene 26: 6099-6105 (2007) Akao Y. et al. et al. , Cancer Gene Therapy (2010), 1-11, doi: 10.1038 / cgt. 2009.88 Takamizawa J. et al. et al. , Cancer Research 64: 3753-3756 (2004).

  The present invention has been made in view of the above situation, and an object of the present invention is to provide a method for analyzing a miRNA related to SCLC and examining the prognosis of an SCLC patient using the miRNA.

  As a result of various studies to solve the above problems, the present inventor has found that miR-153, miR-196a, miR-203 or miR-216a is related to the prognosis of SCLC, and has completed the present invention. It was.

That is, the present invention is as follows:
[1] A small sample for measuring at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof in a biological sample derived from a small cell lung cancer patient A test method for determining prognosis in a patient with cell lung cancer.
[2] In the above method, when the expression level of miR-153, miR-216a or a precursor thereof is higher than the expression level in the control biological sample, the prognosis is determined to be poor. ] The method of description.
[3] The method according to [1], wherein the prognosis is poor when the expression level of miR-203 or a precursor thereof is lower than the expression level in a control biological sample.
[4] In the above method, when the expression level of miR-196a or a precursor thereof is smaller than the expression level in a biological sample derived from a small cell lung cancer patient having a good prognosis, the prognosis is judged to be poor. The method according to [1].
[5] A method for treating small cell lung cancer,
(1) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-196a, miR-203 or a precursor thereof is decreased compared to a control biological sample, the decrease Administering at least one miRNA, a precursor thereof, or a vector that expresses them; and / or
(2) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-153, miR-216a or a precursor thereof is increased compared to the control biological sample, the miRNA or Administering at least one compound that inhibits the function of their precursors;
A method of treating small cell lung cancer, comprising:
[6] A method for improving the prognosis of small cell lung cancer,
(1) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-196a, miR-203 or a precursor thereof is decreased compared to a control biological sample, the decrease Administering at least one miRNA, a precursor thereof, or a vector that expresses them; and / or
(2) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-153, miR-216a or a precursor thereof is increased compared to the control biological sample, the miRNA or Administering at least one compound that inhibits the function of the precursor;
A method for improving the prognosis of small cell lung cancer, comprising:
[7] The method according to [1] to [6], wherein the biological sample is derived from a group consisting of serum, plasma, lung cancer tissue, and cells.
[8] A therapeutic agent for small cell lung cancer comprising at least one of miR-196a, miR-203, a precursor thereof, or a vector expressing them.
[9] A therapeutic agent for small cell lung cancer comprising a compound that inhibits at least one function of miR-153, miR-216a or a precursor thereof.
[10] A prognosis improving agent for small cell lung cancer comprising at least one of miR-196a, miR-203, a precursor thereof, or a vector that expresses them.
[11] A prognosis improving agent for small cell lung cancer comprising a compound that inhibits at least one function of miR-153, miR-216a or a precursor thereof.
[12] A screening method for a small cell lung cancer therapeutic agent or a small cell lung cancer prognosis improving agent, which is selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof. A screening method using at least one function change as an index.
[13] The method according to [12], wherein the change in function is an increase in the expression level of miR-196a, miR-203 or a precursor thereof.
[14] The method according to [12], wherein the change in function is inhibition of expression of miR-153, miR-216a or a precursor thereof.
[15] The change in function is promotion of binding of miR-196a, miR-203 or a precursor thereof to a base sequence targeted by miR-196a, miR-203 or a precursor thereof. ] The method of description.
[16] The change in function is inhibition of binding of miR-153, miR-216a or a precursor thereof to a base sequence targeted by miR-153, miR-216a or a precursor thereof. ] The method of description.
Is to provide.

Furthermore, the present invention provides
[1] A small sample for measuring at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof in a biological sample derived from a small cell lung cancer patient A method for predicting, examining and / or diagnosing prognosis in patients with cell lung cancer.
[2] In the above method, when the expression level of miR-153, miR-216a or a precursor thereof is higher than the expression level in the control biological sample, the prognosis is diagnosed or determined as [1] ] The method of description.
[3] The method according to [1], wherein in the above method, the prognosis is diagnosed or determined when the expression level of miR-203 or a precursor thereof is lower than the expression level in a control biological sample.
[4] In the above method, when the expression level of miR-196a or a precursor thereof is less than the expression level in a biological sample derived from a small cell lung cancer patient with a good prognosis, diagnosis or poor prognosis The method according to [1], wherein the determination is performed.
[5] In a biological sample derived from a patient with small cell lung cancer, at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof is a control biological sample. A method of treating small cell lung cancer, which is increased or decreased in comparison, comprising:
(1) When the expression level of at least one of miR-196a, miR-203, or a precursor thereof is decreased, the reduced at least one miRNA, a precursor thereof, or the expression thereof is expressed Administering a vector; or / and
(2) When the expression level of at least one of miR-153, miR-216a or a precursor thereof is increased, at least one compound that inhibits the function of the miRNA or a precursor thereof is administered about;
A method of treating small cell lung cancer, comprising:
[6] A method of treating small cell lung cancer,
(1) In a biological sample derived from a small cell lung cancer patient, at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof is measured,
(2) if the expression level is reduced compared to the control biological sample, administering the reduced at least one miRNA, a precursor thereof, or a vector expressing them; and / or
(3) If the expression level is increased compared to the control biological sample, administering at least one compound that inhibits the function of the miRNA or a precursor thereof;
A method of treating small cell lung cancer, comprising:
[7] In a biological sample of a patient with small cell lung cancer, at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof is compared with a control biological sample A method of improving the prognosis of small cell lung cancer that is increasing or decreasing,
(1) When the expression level of at least one of miR-196a, miR-203, or a precursor thereof is decreased, the reduced at least one miRNA, a precursor thereof, or the expression thereof is expressed Administering a vector; or / and
(2) When at least one expression level of miR-153, miR-216a or a precursor thereof is increased, administering at least one compound that inhibits the function of the miRNA or a precursor thereof ;
A method for improving the prognosis of small cell lung cancer, comprising:
[8] A method for improving the prognosis of small cell lung cancer,
(1) In a biological specimen derived from a small cell lung cancer patient, at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof is measured,
(2) if the expression level is reduced compared to the control biological sample, administering the reduced at least one miRNA, a precursor thereof, or a vector expressing them; and / or
(3) If the expression level is increased compared to the control biological sample, administering at least one compound that inhibits the function of the miRNA or a precursor thereof;
A method for improving the prognosis of small cell lung cancer, comprising:
[9] The method according to [1] to [8], wherein the biological sample is derived from a group consisting of serum, plasma, lung cancer tissue, and cells.
[10] A therapeutic agent for small cell lung cancer or a prognosis improving agent for small cell lung cancer, comprising at least one of miR-196a, miR-203, a precursor thereof, or a vector that expresses them.
[11] A therapeutic agent for small cell lung cancer or a prognosis improving agent for small cell lung cancer, comprising a compound that inhibits at least one function of miR-153, miR-216a or a precursor thereof.
[12] In a biological sample of a small cell lung cancer patient, at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof is compared with a control biological sample A therapeutic agent for treating small cell lung cancer that is increasing or decreasing,
(1) When the expression level of miR-196a, miR-203 or a precursor thereof is decreased, the decreased at least one miRNA, a precursor thereof, or a vector expressing them; or / as well as,
(2) When the expression level of miR-153, miR-216a or a precursor thereof is increased, at least one compound that inhibits the function of the miRNA or a precursor thereof;
A therapeutic agent for treating small cell lung cancer.
[13] The therapeutic agent according to [12], wherein the biological sample is derived from a group consisting of serum, plasma, lung cancer tissue, and cells.
[14] In a biological sample of a patient with small cell lung cancer, at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof is compared with a control biological sample A prognostic improver for improving the prognosis of small cell lung cancer that is increasing or decreasing,
(1) When the expression level of miR-196a, miR-203 or a precursor thereof is decreased, the decreased at least one miRNA, a precursor thereof, or a vector expressing them; or / as well as,
(2) When the expression level of miR-153, miR-216a or a precursor thereof is increased, at least one compound that inhibits the function of the miRNA or a precursor thereof;
A prognosis improving agent for small cell lung cancer, comprising:
[15] The prognosis improving agent according to [14], wherein the biological sample is derived from a group consisting of serum, plasma, lung cancer tissue, and cells.
Is to provide.

  INDUSTRIAL APPLICABILITY According to the present invention, a method for predicting prognosis, testing and diagnosis of SCLC using miRNA is provided. In addition, the present invention provides an SCLC therapeutic method, an SCLC prognostic improvement method, an SCLC therapeutic agent, and an SCLC therapeutic screening method using miRNA. The present invention contributes to simple and accurate SCLC prognosis determination.

FIG. 1 shows the classification of 600 miRNA expression by hierarchical clustering. Rows and columns indicate the miRNA and case, respectively. For each miRNA, the color on the “7.0” side (original data red) indicates high expression, and the color on the “−7.0” side (original data blue) indicates low expression. The lower bar shows small cell lung cancer (SCLC) (“1”, original data blue), large cell neuroendocrine cancer (LCNEC) (“2”, original data light blue), adenocarcinoma (Ad) (“3”, Original data pink), squamous cell carcinoma (Sq) (“4”, original data brown), normal lung (NL) (“5”, original data yellow) were shown. Small cell lung cancer specimens are roughly classified into two groups, and specimens from patients with poor prognosis and specimens from patients with good prognosis are well separated into separate groups. FIG. 2 shows survival curves for Group 1 SCLC (SCLC 1) and Group 2 SCLC (SCLC 2). FIG. 3 (A) shows normal lung tissue samples (NL), lung adenocarcinoma tissue samples and lung squamous cell carcinoma tissue samples (Ad + Sq), good prognosis group (SCLC2), and poor prognosis group for each miRNA expression level. A comparison between (SCLC1) is shown. *: P <0.05, **: p <0.01, ***: p <0.001, NS: p ≧ 0.05 (vs. poor prognosis group (SCLC1)). FIG. 3 (B) shows the correlation between the expression level of each miRNA and the quantitative RT-PCR. FIG. 4 shows the relationship between each miRNA and prognosis. FIG. 5 shows classification by hierarchical clustering using 3 miRNA expressions. Rows and columns indicate the miRNA and case, respectively. The color on the “2.4” side (original data red) indicates high expression, and the color on the “−2.4” side (original data blue) indicates low expression. The second bar from the bottom shows three groups classified by clustering. The bottom bar represents a poor prognosis group (SCLC1 group) and a good prognosis group (SCLC2 group) by clustering with 600 miRNAs. When these three miRNAs are used, classification almost similar to that when 600 are used can be obtained, and small cell lung cancer can be classified into a good prognosis group and a poor prognosis group. The bottom panel shows the survival curves for each group. FIG. 6 shows classification by hierarchical clustering using 4 miRNA expressions. Rows and columns indicate the miRNA and case, respectively. The color on the “3.2” side (original data red) indicates high expression, and the color on the “−3.2” side (original data blue) indicates low expression. The second bar from the bottom shows two groups classified by clustering. The bottom bar represents a poor prognosis group (SCLC1 group) and a good prognosis group (SCLC2 group) by clustering with 600 miRNAs. When these four miRNAs are used, almost the same classification as when 600 are used can be obtained, and small cell lung cancer can be classified into a good prognosis group and a poor prognosis group. The bottom panel shows the survival curves for each group. FIG. 7 shows the survival curves of the SCLC high-risk group and low-risk group classified by the prognostic prediction model using miR-153, miR-203, and miR-216a. The prognosis prediction model using these three miRNAs can also classify small cell lung cancer into a good prognosis group and a poor prognosis group. FIG. 8 shows tissue sections of cancer tissues of the small cell lung cancer high-risk group (A) and low-risk group (B) classified by the prognosis prediction model using miR-153, miR-203, and miR-216a. FIG. 9 shows the results of evaluating the validity of the prognostic prediction model using three miRNAs (miR-153, miR-203, and miR-216a). The test set was classified based on the classification model built on the randomized learning set. The operation was repeated 1,000 times. (A) The result of survival analysis is shown as a histogram of p-value (by log rank test). The median and geometric mean of the p-values were 0.048 and 0.041, respectively, indicating that this prognosis prediction model can accurately predict small cell lung cancer prognosis on average. (B) Histogram of the number of prediction errors when compared with classification by hierarchical clustering using 600 miRNAs. The coincidence rate and disagreement rate with hierarchical clustering were 0.874 and 0.126, respectively, and it was shown that this prognosis prediction model can generally reproduce classification using 600 miRNAs. FIG. 10 shows the suppression of growth of small cell lung cancer cells by miR-153 inhibitors and miR-203 mimics (miR-203 mimic). Panels (A) and (C) show RT-PCR analysis of miR-153 and miR-203 expression levels in poor prognosis group (SCLC1 group), good prognosis group (SCLC2 group), and various SCLC cell lines, respectively. Shows the results. Panel (B) shows the results of transfection of miR-153 inhibitor into SCLC cell line DMS 53, and panel (D) shows the results of transfection of miR-203 (miR-203 mimic) into SCLC cell line SCB5. Show. As a result, in both cases, it was confirmed that cell proliferation was suppressed as compared with the negative control. The 96 hr cell number reduction due to the introduction of miR-203 mimic compared to controls was statistically significant.

  The following definitions are provided to facilitate understanding of the invention described herein.

  Prognosis means the medical outlook or the patient's life expectancy about the patient's cancer course after some treatment (eg, chemotherapy, radiation therapy, surgical resection). Poor prognosis includes, for example, shorter survival after treatment, worsening or rapid deterioration of clinical features, progression of stage or rapid progression, and recurrence Or it means that the period until recurrence is short. A good prognosis is, for example, a longer survival after treatment, a clinical feature improving or faster to improve, a stage not progressing or slow to progress, or a recurrence Or it means that the period until recurrence is long.

  A biological sample derived from a cancer patient means, for example, a cancer tissue (eg, a small cell lung cancer tissue) collected from a cancer patient, a lymph node adjacent to the cancer tissue, a body fluid containing blood such as plasma and serum, and cells. It is not limited. In particular, cancer tissue collected from cancer patients is preferred. The cancer tissue can be collected with an endoscope or obtained by surgery.

  For separation of miRNA from body fluids, particularly serum or plasma, the method of Mitchell et al. (PNAS (2008), 105 (30), 10513-10518) and Zhu et al. (BMC Research Note (2009), 2 (89)) is used. Can be used.

  The cells may be cells contained in body fluids such as blood, serum, plasma, urine, synovial fluid, cerebrospinal fluid, cerebrospinal fluid, semen, or lymph fluid, or cells contained in cancer tissue. It may be a circulating cancer cell ("CTC").

  Examples of a method for obtaining circulating cancer cells include a method using immunomagnetic beads. Immunomagnetic beads include epithelial cell adhesion molecule (EpCAM), cytokeratins such as cytokeratin-8, 19, etc., which have antibodies against antigens selectively observed on the surface of cancer cells, and are recognized on the surface of cancer cells. Some of them have antibodies against CD45 expressed on the surface of blood cells. For example, circulating cancer cells can be isolated using EASYSEP (registered trademark) human EpCAM positive kit (Stemcell Technologies) and EasySep (registered trademark) Human CD45 Depletion kit (Stemcell Technologies). Other methods for isolating circulating cancer cells include the ISET method (Vona G et al., 2000, Am J Pathol. 2000 156: 57-63).

  The control biological sample may be, for example, a healthy subject, a cancer patient other than small cell lung cancer, for example, a biological sample of a lung adenocarcinoma or lung squamous cell carcinoma patient, or a biological sample of a patient who has been judged to have a good prognosis. Although it means, it is not limited to these, What is necessary is just to select an optimal thing suitably according to a biological sample, miRNA to measure, etc. As the control biological sample of a healthy person, for example, a biological sample derived from the same site as the biological sample to be examined (for example, the same tissue, organ, cell, for example, lung tissue) can be used. For example, when measuring miR-153, miR-203, and miR-216a, a healthy subject, a biological sample of a lung adenocarcinoma, a lung squamous cell carcinoma patient, or a small cell lung cancer patient with a good prognosis When a biological sample is used as a control biological sample and miR-196a is measured, a biological sample of a patient who has small cell lung cancer but a good prognosis can be used as a control biological sample.

  The object to be measured in the test method for determining the prognosis and the method for predicting, testing and / or diagnosing the prognosis of the present invention is a specific miRNA or a precursor thereof. The precursor means pri-miRNA that is a primary transcript or pre-miRNA that is a secondary transcript.

  miR-153 is a miRNA whose mature sequence is represented by UUGCAUAUGUCCAAAAAGUGAUC (SEQ ID NO: 1). As miR-153 precursor such as mir-153-1 (SEQ ID NO 2: CUCACAGCUGCCAGUGUCAUUUUUGUGAUCUGCAGCUAGUAUUCUCACUCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGCAGGUGUGGC), mir-153-2 (SEQ ID NO 3: AGCGGUGGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG), and the like.

  miR-196a is a miRNA whose mature sequence is represented by UAGGUAGUUUCAUGUUGUUGGG (SEQ ID NO: 4). As miR-196a precursor, e.g. mir-196a-1 (SEQ ID NO 5: GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCACCCGAUUCAC), mir-196a-2 (SEQ ID NO 6: UGCUCGCUCAGCUGAUCUGUGGCUUAGGUAGUUUCAUGUUGUUGGGAUUGAGUUUUGAACUCGGCAACAAGAAACUGCCUGAGUUACAUCAGUCGGUUUUCGUCGAGGGC), and the like.

  miR-203 is a miRNA whose mature sequence is represented by GUGAAAAUGUUUAGGACCACAUAG (SEQ ID NO: 7). As a miR-203 precursor, for example, mir-203 (SEQ ID NO: 8: GUGUUGGGGGACUGCGCGCGUGGGGUCCAGUGGUUCUUAACAGUUCAACAGUUCUGUGAGCGCAUUGUGUAGAGCAGGACGACUGAGCGCG

  miR-216a is a miRNA whose mature sequence is represented by UAAUUCUCAGCUGGCAACUGUGA (SEQ ID NO: 9). As a precursor of miR-216a, for example, mir-216a (SEQ ID NO: 10: GAUGGCUGUGUGUUGGGCUUAAUUCUCAGCUGGCAACUGUGGAGAUGUGUCAUGAUCAUCCCUCACAGUGGUUCAUGUUGAUGUUGAUGUUGAUGUUGAUGUUGAUGUUGAUGUUGAUCU

  These miRNAs and their precursors can be obtained, for example, by isolating them from natural products, chemically synthesizing them or using genetic recombination techniques, using conventionally known methods. it can.

  The miRNA or precursor thereof used in the test method for determining the prognosis and the method for predicting, testing and / or diagnosing the prognosis may be used alone or in combination of two or more. However, it is preferable to use a combination of two or more in terms of improving accuracy of prediction, inspection and / or diagnosis. For example, miRNA and its precursor may be combined, or two or more different miRNAs may be combined.

  For example, a combination containing at least miRNA-153 and miRNA-216a is suitable in the present invention. Further, it may be a combination including at least miRNA-153 and miR-203, or may be a combination including at least miRNA-216a and miR-203. In the present invention, a combination containing at least miR-153, miR-203, and miR-216a is particularly suitable. Also preferred are combinations comprising miR-153, miR-203, miR-216a, and miR-196a.

  In the test method for determining prognosis and the method for predicting, testing, or diagnosing prognosis according to the present invention, for example, total RNA is first extracted from a biological sample. Examples of the extraction method include known methods such as guanidine ultracentrifugation (Chirgwin, JM, et al., Biochemistry (1979) 18, 5294-5299), AGPC method (Chomczynski, P. et al., Anal. Biochem. (1987) 162, 156-159).

  Next, the expression level of miRNA or a precursor thereof according to the present invention can be measured using total RNA obtained from a biological sample. Any known method can be used for quantitative measurement of miRNA or a precursor thereof. Specifically, for example, the RT-PCR method and its modified method, the Northern blot method, the in situ hybridization method, and the method using a microarray can be mentioned. In the RT-PCR method, the expression level can be accurately measured by a quantitative RT-PCR (qRT-PCR) method.

Next, the expression level of the miRNA or the precursor thereof according to the present invention in a biological sample derived from a patient to be examined to determine the prognosis, and in a biological sample derived from a patient to be predicted, examined and / or diagnosed. Can be compared with the expression level of the miRNA according to the present invention or a precursor thereof in a control biological sample. As a result of comparison, miR-153, miR-216a or a precursor thereof in a biological sample derived from a patient to be examined to determine a prognosis, a biological sample derived from a patient to be predicted, examined and / or diagnosed When the expression level of is increased compared to the expression level of miR-153, miR-216a or their precursors in the control biological sample, it can be determined that the prognosis is poor. Note that if it is rising, judging that the prognosis is poor means that if not (if it is not rising), it is judged that the prognosis is not bad (or good). Good. Provided in the present invention are methods that include any of them, and methods that include both.
That is, in the present invention, the expression level of miR-153, miR-216a or a precursor thereof in the patient-derived biological sample is compared with the expression level of miR-153, miR-216a or a precursor thereof in the control biological sample. It relates to a method for predicting, judging, diagnosing, testing and / or determining that the prognosis is poor if it is elevated and / or otherwise the prognosis is good (and / or not bad). For example, the expression level of miR-153, miR-216a or a precursor thereof in a biological sample derived from a patient with a poor prognosis is the expression level of miR-153, miR-216a or a precursor thereof in a control biological sample. 2 times, preferably 3 times, more preferably 5 times, more preferably 10 times, more preferably 20 times, more preferably 50 times, more preferably 100 times, more preferably 1000 times, most preferably 10000 times It has risen above each value. For example, the expression level of miR-153, miR-216a, miR-203, or a precursor thereof in a biological sample derived from a patient whose prognosis is not poor (good) is the same as the expression level in a control biological sample. Specifically, for example, the ratio of the sample with high expression / the sample with low expression is less than 2 times, less than 1.8 times, less than 1.5 times, or less than 1.3 times.
On the other hand, the expression level of miR-203 or a precursor thereof in a biological sample derived from a patient for which the prognosis is predicted, judged, diagnosed, examined, and / or determined is the expression level of miR-203 or a precursor thereof in a control biological sample. If it is reduced compared to, the prognosis can be judged as poor. Further, when the decrease is made, it is judged that the prognosis is poor. If not (if it is not reduced), it means that the prognosis is judged not bad (or good). Good. Provided in the present invention are methods that include any of them, and methods that include both. That is, the present invention has a poor prognosis when the expression level of miR-203 or a precursor thereof in the biological sample derived from the patient is reduced compared to the expression level of miR-203 or a precursor thereof in the control biological sample. And / or relates to a method of predicting, judging, diagnosing, testing and / or determining that the prognosis is good (and / or not bad) otherwise. For example, the expression level of miR-203 or a precursor thereof in a biological sample derived from a patient with a poor prognosis is ½ times, preferably 1 / of the expression level of miR-203 or a precursor thereof in a control biological sample. 3 times, more preferably 1/5 times, more preferably 1/10 times, more preferably 1/20 times, more preferably 1/50 times, further preferably 1/100 times, more preferably 1/1000 times The most preferable value is 1 / 10,000 times or less.
In addition, the expression level of miR-196a or a precursor thereof in a biological sample derived from a patient for which the prognosis is predicted, judged, diagnosed, examined and / or determined is determined in a biological sample derived from a small cell lung cancer patient having a good prognosis. If the expression level of miR-196a or its precursor is decreased, it can be determined that the prognosis is poor. Further, when the decrease is made, it is judged that the prognosis is poor. If not (if it is not reduced), it means that the prognosis is judged not bad (or good). Good. Provided in the present invention are methods that include any of them, and methods that include both. That is, in the present invention, the expression level of miR-196a or a precursor thereof in a biological sample derived from the patient is compared with the expression level of miR-196a or a precursor thereof in a biological sample derived from a small cell lung cancer patient having a good prognosis. It relates to a method for predicting, judging, diagnosing, testing and / or determining that the prognosis is poor if it is decreasing and / or that the prognosis is good (and / or not bad) otherwise. For example, the expression level of miR-196a or a precursor thereof in a biological sample derived from a patient with a poor prognosis is the expression level of miR-196a or a precursor thereof in a biological sample derived from a small cell lung cancer patient with a good prognosis. Compared to 1/2 times, preferably 1/3 times, more preferably 1/5 times, more preferably 1/10 times, more preferably 1/20 times, more preferably 1/50 times, more preferably 1 / fold. The value is reduced to 100 times, more preferably 1/1000 times, most preferably 1 / 10,000 times or less. For example, when using a biological sample from a patient who has been determined to be healthy, lung adenocarcinoma, or lung squamous cell carcinoma as a control biological sample, the biological sample derived from the patient for whom the prognosis is predicted, judged, diagnosed, examined and / or judged If the expression level of miR-196a or its precursor in the sample is higher than the expression level of miR-196a or its precursor in the control biological sample, it can be judged that the prognosis is not poor (good), etc. If not, it can be determined that the prognosis is poor. That is, the present invention has a poor prognosis when the expression level of miR-196a or its precursor in the patient-derived biological sample is not increased compared to the expression level of miR-196a or its precursor in the control biological sample and It relates to a method for predicting, judging, diagnosing, examining and / or determining that the prognosis is good (and / or not bad) when it is elevated.
For example, the expression level of miR-196a or a precursor thereof in a biological sample derived from a patient whose prognosis is not poor (good) is, for example, that of a healthy person, lung adenocarcinoma, or lung squamous cell carcinoma 2 times, preferably 3 times, more preferably 5 times, more preferably 10 times, more preferably 20 times, more preferably 50 times, more preferably 100 times, even more preferably compared to the same expression level in the control biological sample. The expression level of miR-196a or a precursor thereof in a biological sample derived from a patient having a 1000-fold, most preferably 10,000-fold increase or more and a poor prognosis is, for example, healthy, lung adenocarcinoma, or The expression level is similar to that in the control biological sample of a patient determined to be squamous cell carcinoma of the lung. Specifically, for example, the ratio of the high expression / low sample is not doubled. , Less than 1.8-fold, less than 1.5, or less than 1.3 times.
Here, one control biological sample may be used, but a plurality of biological samples may be used, for example, a plurality of healthy human biological samples may be used, or a healthy biological sample and a cancer patient biological sample may be used in combination. Also good.

  According to the test method for determining the prognosis and the method for predicting, testing and / or diagnosing the prognosis according to the present invention described above, the prognosis of a patient determined or diagnosed as small cell lung cancer is treated with chemotherapy, radiation, and the like. Predict, judge, determine, test and / or diagnose before therapy or surgery. Therefore, the treatment to be performed thereafter can be optimized. It is also possible to confirm the therapeutic effect by using the method for predicting, judging, judging, examining and / or diagnosing the prognosis according to the present invention at any time during chemotherapy and radiation therapy. Furthermore, the prognosis according to the present invention can be predicted, judged, judged, examined and / or diagnosed after surgery by using the method for predicting, judging, judging, examining and / or diagnosing the prognosis according to the present invention. is there.

Note that the prediction and inspection method of the present invention can be implemented separately from the diagnosis. For example, even if a diagnosis is performed by a doctor, a test can be performed by a person who is not a doctor (for example, an external organization) and the doctor can make a diagnosis based on the test result. By inspecting a biological sample so that it is not directly associated with the patient from which it is derived, for example, the inspection method of the present invention can be implemented separately from the diagnostic method. For example, a biological sample may be converted into an ID. In addition, the test method of the present invention is also useful in situations where the prognostic distribution of patients with small cell lung cancer is statistically investigated, such as when it is not finally linked to patient diagnosis.
The present invention also detects a method for obtaining an intermediate result for the diagnostic method of the present invention, a test method for determining a prognosis in a patient with small cell lung cancer, and a prognostic marker or indicator in a patient with small cell lung cancer. A method for examining the prognosis of a biological sample derived from a patient with small cell lung cancer, a test method for determining or diagnosing the prognosis in a patient with small cell lung cancer, and in a patient with small cell lung cancer It also relates to non-diagnostic methods for examining prognosis. The steps of each method may be performed according to the above description, and in the final step, information on prognosis is provided as an intermediate or non-diagnostic result rather than a diagnosis.

  The present invention also relates to at least one selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or their precursors in the examination, prediction, judgment, determination and diagnosis of the present invention. It relates to the use of probes, primers, and nucleic acids that hybridize to the at least one. The probe, primer, and nucleic acid are useful as a drug for performing the test, prediction, judgment, determination, and diagnosis of the present invention, that is, a test agent, a diagnostic agent, and the like. The present invention also relates to the diagnostic agent and the diagnostic agent comprising the probe, primer and nucleic acid, and the use of the probe, primer and nucleic acid in the production of the diagnostic agent or the diagnostic agent. The probe, primer, and nucleic acid are preferably those that specifically hybridize with miR-153, miR-196a, miR-203, miR-216a or their precursors. For example, stringent conditions, specifically 1 × SSC (1 × SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7.0) at 37 ° C., or 1 × SSC at 40 ° C., 45 ° C., 50 ° C., or 55 ° C., preferably 0.5 × SSC at 37 ° C. It may be a nucleic acid that hybridizes under the conditions of 37 ° C., 40 ° C., 45 ° C., or 50 ° C. at 0.2 ° C., 40 ° C., 45 ° C., or 50 ° C. For example, one of the nucleic acids to be hybridized is labeled, the other is immobilized on a membrane, and both are incubated. Hybridization conditions include, for example, 5 × SSC, 7% (W / V) SDS, 100 μg / ml denatured salmon sperm DNA, 5 × Denhardt solution (1 × Denhardt solution is 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, and 0.2% Ficoll) May be performed in a solution containing After incubating for a sufficient period of time (eg, 3, 4, 5 or 6 hours or more), washing is performed under the above conditions, and by detecting whether the labeled nucleic acid is hybridized, the nucleic acid is hybridized under the condition. Or not.

  The present invention also relates to a method for treating small cell lung cancer and a method for improving the prognosis of small cell lung cancer. In practicing, reference can be made to the description of the diagnosis, prediction, judgment, determination and diagnosis method of the present invention, and any combination of the description and the description of the treatment method of the present invention is disclosed herein. Is done. Specifically, for example, in the treatment method and the method for improving the prognosis of the present invention, for the biomaterials derived from patients with small cell lung cancer, the control biological sample, the measurement and comparison of the expression level, etc., the diagnostic method and test of the present invention It is the same as the description of the method. For example, in the comparison of the expression level of miR-196a or a precursor thereof, the expression level in a biological sample derived from a patient with small cell lung cancer having a good prognosis can be used as a comparison target. In the method of treating small cell lung cancer according to the present invention, for example, miR-196a, miR-203 or their precursors are reduced in the expression of miR-196a, miR-203 or their precursors. This can be done by administering a precursor.

The miRNA to be administered or a precursor thereof may be partially modified to improve or stabilize the resistance to nuclease. For example, the 2′-OH of the ribose of pyrimidine nucleotides may be fluorinated or methylated. Well, you may add cholesterol, steroid, bile acid, polyethylene glycol and the like.
Specifically, the nucleotides that make up the nucleic acid may be natural nucleotides, modified nucleotides, artificial nucleotides, or combinations thereof. The nucleic acid may be composed of RNA, may be RNA / DNA chimera, may contain other nucleic acid analogs, and may contain any combination thereof. Nucleic acids include not only those linked by phosphodiester bonds but also those having amide bonds or other backbones (such as peptide nucleic acids (PNA)). Nucleic acids include, for example, natural and artificial nucleic acids, and may be nucleic acid derivatives, nucleic acid derivatives, nucleic acid analogs, and the like. Such nucleic acid analogs are well known in the art and include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral methylphosphonates, 2'-O-methylribonucleotides, peptide nucleic acids (PNA), and the like. Not. The backbone of PNA may include a backbone consisting of aminoethylglycine, polyamide, polyethyl, polythioamide, polysulfinamide, polysulfonamide, or combinations thereof (Krutzfeldt, J. et al., Nucleic Acids Res. 35: 2885-2892; Davis, S. et al., 2006, Nucleic Acids Res. 34: 2294-2304; Boutla, A. et al., 2003), Nucleic Acids Res. 31: 4973-4980; Hutvagner, G. et al., 2004, PLoS Biol. 2: E98; Chan, JA et al., 2005, Cancer Res. 65: 6029-6033; Esau, C. et al., 2004, J. Biol. Chem. 279: 52361- 52365; Esau, C. et al., 2006, Cell Metab. 3: 87-98).

  Nucleic acid modifications are specifically 2 ′ or 3 ′ sugar modifications such as 2′-O-methyl (2′-O-Me) ylated nucleotides or 2′-deoxynucleotides, or 2′-fluoro, difluorotoluyl. , 5-Me-2'-pyrimidine, 5-allylamino-pyrimidine, 2'-O-methoxyethyl (2'-O-MOE), 2'-O-aminopropyl (2'-O-AP), 2 ' -ON-Methylacetamide (2'-O-NMA), 2'-O-dimethylaminoethyloxyethyl (2'-DMAEOE), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'- O-dimethylaminopropyl (2′-O-AP), 2′-hydroxy nucleotide, phosphorothioate, 4′-thionucleotide, 2′-O-trifluoromethyl nucleotide, 2′-O-ethyl-trifluoromethoxy nucleotide, 2'-O-difluoromethoxy-ethoxy nucleotide, or 2'-ara-fluoronucleotide, Locked nucleic acid (LNA), 2'-O, 4'-C-ethylene cross-linked nucleic acid (2 ' -O, 4'-C-ethylene bridged nucleic acid (ENA)), etc., other bridged nucleic acid (BNA), hexitol nucleic acid (HNA), morpholino nucleic acid, tricyclo-DNA (tcDNA), Examples include polyether nucleic acids (US Pat. No. 5,908,845), cyclohexene nucleic acids (CeNA), and combinations thereof. Further, difluorotoluyl (DFT) modification, for example, substitution of 2,4-difluorotoluyluracil or guanidine to inosine may be performed.

  The nucleic acid may also contain a conjugate at the end. Examples of the conjugate include lipophilic substances, terpenes, protein binding substances, vitamins, carbohydrates, retinoids, peptides, and the like. Specifically, C5-aminoalkyl dT, naproxen, nitroindole, folic acid, colanic acid, ibuprofen, retinoid, polyethylene glycol (PEG), C5 pyrimidine linker, glyceride lipid (eg dialkyl glyceride derivatives), vitamin E, cholesterol, thio Examples include cholesterol, dU-cholesterol, alkyl chains, aryl groups, heterocyclic complexes, and modified sugars (D-ribose, deoxyribose, glucose, etc.). The conjugate and the nucleic acid can be bound via, for example, an arbitrary linker, and specific examples include a pyrrolidine linker, serinol linker, aminooxy, or hydroxyprolinol linker. In addition, a cell permeation signal can be appropriately added to the nucleic acid. For example, many cell-permeable peptides for introducing nucleic acids into cells are known (WO2008 / 082885). Specific examples include arginine-rich peptides such as polyarginine, such as HIV-1 Tat (48-60), HIV-1 Rev (34-50), FHV Coat (35-49), BMV Gag ( 7-25), HTLV-II Rex (4-16), a partial peptide thereof, or an inverso or retro-inverso thereof. As the amino acid, d-form may be used as appropriate. A cell-penetrating peptide or the like may be bound to a nucleic acid by a known linker. Such modified nucleic acids, nucleic acid derivatives, nucleic acid derivatives, nucleic acid analogs, and the like are also included in the miRNA or precursor thereof of the present invention.

MiR-196a and miR-203 mimics mimicking natural miR-196a and miR-203 are already commercially available (eg MISSION ^™ microRNA Mimics, Sigma-Aldrich Corporation; miRIDIAN miRNA Mimic, Dharmacon, Lafayette, LA). These can be appropriately used as miR-196a and miR-203, respectively.

  The method for administering miRNA or a precursor thereof to a patient is not particularly limited. For example, the miRNA according to the present invention or a precursor thereof may be administered as it is, and liposomes, lipofectins, cellfectins, polycations, nanoparticles, etc. May be administered in combination.

  Moreover, the DNA encoding the miRNA according to the present invention or a precursor thereof (pri-miRNA, pre-miRNA, etc.) can be inserted into an expression vector for administration. Here, as expression vectors, pME18S (Med.immunol. 20: 27-32 (1990)), pEF-BOS (Nucleic Acids Res. 18: 5322 (1990)), pCDM8 (Nature 329: 840-842 (1987)). , PRSVneo, pSV2-neo, pcDNAI / Amp (Invitrogen), pcDNAI, pAMoERC3Sc, pCDM8 (Nature 329: 840 (1987)), pAGE107 (Cytotechnology 3: 133 (1990)), pREP4 (InJ. 101: 1307 (1987)), pAMoA, pAS3-3, pCAGGS (Gene 108: 193-200 (1991)). , PBK-CMV, pcDNA3.1 (Invirtogen), pZeoSV (Stratagene) and the like.

  The promoter for RNA transcription is not particularly limited, and a Pol I promoter, Pol II promoter, Pol III promoter, a bacteriophage (RNA polymerase recognition sequence of T4 phage or T7 phage) promoter, and the like can be used. Examples of the polymerase II (Pol II) promoter include CMV promoter and β-globin promoter. In order to express a relatively short RNA within a few hundred bases, it is preferable to use a polymerase III (Pol III) promoter that can be expressed in a higher amount than Pol II. Examples of the Pol III promoter include U6 promoter, H1 promoter, tRNA promoter, 7SK promoter, 7SL promoter, Y3 promoter, 5S rRNA promoter, Ad2 VAI and VAII promoter (Das, G. et al., 1988). , EMBO J. 7: 503-512; Hernandez, N., 1992, pp. 281-313, In SL McKnight and KR Yamamoto (ed.), Transcriptional regulation, vol. 1. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY; Kunkel, GR, 1991, Biochim. Biophys. Acta 1088: 1-9; Lobo, SM, and N. Hernandez, 1989, Cell 58: 55-67; Mattaj, IW et al., 1988, Cell 55: 435 -442; Geiduschek, EP and GA Kassavetis, 1992, pp.247-280, In Transcriptional regulation. Monograph 22 (ed. SL McKnight and KR Yamamoto), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.).

Moreover, miRNA which concerns on this invention, or its precursor can also insert the nucleic acid which codes them in a well-known viral vector, and can also administer it. For example, the following various viral vectors for gene therapy are known (see Adolph K.W. ed., Viral Genome Methods, CRC Press, Florida (1996)).
Retrovirus vector adenovirus vector vaccinia virus vector poxvirus vector adeno-associated virus vector
HVJ vector etc.

  Administration may be oral administration or parenteral administration (eg, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, cutaneous administration, mucosal administration, intrarectal administration, intravaginal administration, local administration to cancer tissue) But you can.

  In the method for treating small cell lung cancer according to the present invention, a known small cell lung cancer therapeutic agent may be administered together with the miRNA according to the present invention or a precursor thereof, or radiation therapy may be performed.

  In the method for improving the prognosis of small cell lung cancer according to the present invention, miR-196a, miR-203 or their Doing by administering the precursor. As the administration method, the same method as the method for treating small cell lung cancer according to the present invention can be used. For the compound, nucleic acid, vector, and other conditions to be used, the description regarding the method for treating small cell lung cancer according to the present invention can be referred to, and any combination of the description and the description of the improvement method of the present invention can be referred to. , Disclosed herein.

  In the method for treating small cell lung cancer according to the present invention, miR-153, miR-216a or a precursor thereof is applied to a patient having increased expression of miR-153, miR-216a or a precursor thereof. Inhibits the function of Specifically, for example, it can be performed by administering at least one compound that reduces the function of miR-153, miR-216a, or a precursor thereof.

  The compound that reduces the function is not particularly limited. For example, double-stranded RNA (including RNAi constructs such as siRNA) against miR-153, miR-216a, or a precursor thereof (also, single-stranded RNA) For example, antisense oligonucleotides, ribozymes, or expression vectors that express them can be used. These compounds only need to reduce the function of the miRNA or precursor thereof according to the present invention. For example, all or part of the compound binds to at least a part of the miRNA or precursor thereof according to the present invention, What inhibits this miRNA or its precursor binding | binding to the base sequence (target base sequence) which this miRNA or its precursor targets is mentioned. Further, the compound may be RNA or DNA as long as it reduces the function of miRNA or a precursor thereof according to the present invention, may be a chimeric type containing DNA and RNA in the same strand, and one strand is DNA. A hybrid type in which the other strand is RNA can also be used.

  For example, the compound that decreases the function of miRNA or a precursor thereof may be a nucleic acid (including a nucleic acid analog) that acts as an antagonist or inhibitor on the miRNA or a precursor thereof. For example, an antisense nucleic acid that binds to the miRNA or a precursor thereof, an RNAi construct for the miRNA or a precursor thereof (including a double-stranded RNA such as siRNA), a ribozyme that cleaves the miRNA or a precursor thereof, and an miRNA or a thereof Nucleic acids that inhibit precursors. These nucleic acids contain a base sequence that is complementary to at least a part or all of the base sequence of the miRNA or a precursor thereof in order to recognize a miRNA or a precursor thereof that has a reduced function.

  miRNA recognizes a target base sequence consisting of several bases present in the 3'-untranslated region of the target gene. This target base sequence is, for example, a base sequence complementary to the first to eighth base sequences at the 5 'end of miRNA (Nature 433: 769-773 (2005)). Accordingly, for example, miRNA can be effectively inhibited by RNA having a sequence complementary to the base sequence at the 5 ′ end of miRNA that lowers the function. Such RNA may be completely complementary to the above 5 'base sequence of miRNA (bases 1-8, 2-7, or 3-8 from the 5' end of miRNA). Or there may be 1-2 gaps. Preferably, this base sequence is completely complementary, and continuously contains at least 8 bases, more preferably 9 bases, more preferably 10 bases of complementary bases for miRNA. More preferably, it contains a total of 11 bases or more, more preferably 12 bases or more, and more preferably 13 bases or more complementary bases for miRNA. Complementary bases may be contiguous or may include one or more (2, 3, 4) gaps. Mismatch with miRNA can suppress cleavage by RISC and increase the inhibitory activity of miRNA. Thus, it need not be completely complementary to the miRNA and can also be designed to contain a bulge.

  For example, the compound is at least 85% or more, preferably 90% or more, based on at least a part (for example, 6, 7, 8, 9, 10, 15 to 30 bases) or all of the miRNA according to the present invention or a precursor thereof. More preferably 95% or more, even more preferably 98% or more, even more preferably 99% or more, and most preferably 100% sequence homology (identity).

  The compound to be administered may be partially modified to improve or stabilize the resistance to nuclease. For example, the 2′-OH of the ribose of pyrimidine nucleotides may be fluorinated or methylated, Steroids, bile acids, polyethylene glycols, etc. may be added.

For example, an antisense nucleic acid that binds to miRNA or a precursor thereof may contain about 15-30 bases or more. Antisense nucleic acids may also contain one or more modified backbones and / or base moieties. Specifically, antisense nucleic acids include natural and modified oligonucleotides such as phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, H-phosphonate type, triester, alpha- Anomers, peptide nucleic acids, other artificial nucleic acids, and nucleic acid modifying compounds are included. The antisense nucleic acid may also contain 2′-O-alkylated ribonucleotides.
The antisense nucleic acid may contain a base sequence complementary to the base sequence of miRNA, for example, 15 bases or more, 16, 17, 18, 19, 20, 25, 30, 35, 40 bases or more. Complementary sequences may be contiguous or may include one or more (2, 3, 4) gaps (Schmajuk et al., 1999, J. Biol. Chem., 274, 21783-21789, Delihas et al., 1997, Nature, 15, 751-753, Stein et al., 1997, Antisense NA Drug Dev., 7, 151, Crooke, 2000, Methods Enzymol., 313, 3-45; Crooke, 1998, Biotech. Genet. Eng. Rev., 15, 121-157, Crooke, 1997, Ad. Pharmacol., 40, 1-49). The antisense nucleic acid is, for example, at least 85% or more, preferably 90%, based on at least a part (for example, 6, 7, 8, 9, 10, 15 to 30 bases) or all of the miRNA or a precursor thereof according to the present invention. % Or more, more preferably 95% or more, even more preferably 98% or more, even more preferably 99% or more, and most preferably 100% sequence homology (identity).

  The RNAi construct for the miRNA or a precursor thereof includes, for example, a base sequence complementary to at least a part of the target miRNA or the precursor thereof, and reduces the function of the miRNA (decreases the expression level of the miRNA, or RNA having an activity that inhibits the binding of the miRNA to a target gene or increases the expression level of the gene), and may be about 14 to 50 nucleotides, preferably 19 to 30 nucleotides, or The above may be included. Preferably, the double stranded portion of the RNAi construct is about 21-23 nucleotides in length. The RNAi construct may be siRNA (including hairpin type single-stranded RNA), or may be RNA (for example, double-stranded RNA) that generates siRNA by processing with Dicer in the cell. RNAi constructs such as siRNA and double stranded RNA may contain DNA. For example, TT may be included at the 3 'end.

  In addition, it is known that target miRNAs can be effectively inhibited by oligonucleotides such as 2'-O methyl (2'-OMe) RNA, locked nucleic acid (LNA), and antago mir. Methods for inhibiting target miRNAs are also known (Hutvagner, G. et al. (2004) PLoS Biol, 2, E98; Meister, G. et al. (2004) Rna, 10, 544-550; Orom, UA et al (2006) Gene, 372, 137-141; Krutzfeldt, J. et al. (2005) Nature, 438, 685-689; Ebert, MS et al. (2007) Nat Methods, 4, 721-726).

  Examples of ribozymes that cleave miRNA or its precursor include ribozymes that cleave target miRNA or its precursor (WO90 / 11364; US Pat. No. 5,093,246; Sarver et al., Science 247: 1222-). 1225). The ribozyme includes any nucleic acid enzyme, and may be, for example, an RNA-type ribozyme, a DNA-type ribozyme (deoxyribozyme), or a DNA-RNA chimeric ribozyme. In order to specifically cleave the target miRNA or its precursor, a ribozyme can be appropriately generated using techniques well known to those skilled in the art (Haselof and Gerlach, 1988, Nature, 334: 585-591; Zaug et al., 1984, Science, 224: 574-578; Zaug and Cech, 1986, Science, 231: 470-475; Zaug et al., 1986, Nature, 324: 429-433; WO88 / 04300; Been and Cech 1986, Cell, 47: 207-216).

  The nucleic acid that inhibits the miRNA or precursor thereof is preferably a nucleic acid that hybridizes with the miRNA sequence under physiological conditions. Examples of physiological conditions include 1 × SSC (1 × SSC is 150 mM NaCl, 15 mM sodium citrate, pH 7.0), 37 ° C. More preferably, it may be a nucleic acid that hybridizes with miRNA under stringent conditions. The stringent conditions are, for example, 1 × SSC or 0.5 × SSC, 42 ° C., more preferably 1 × SSC or 0.5 × SSC, 45 ° C., more preferably 1 × SSC or 0.5 ×. The conditions are SSC and 50 ° C. In hybridization, for example, either RNA containing a miRNA sequence or nucleic acid that inhibits miRNA is labeled, the other is immobilized on a membrane, and both are hybridized. Hybridization conditions include, for example, 5 × SSC, 7% (W / V) SDS, 100 μg / ml denatured salmon sperm DNA, 5 × Denhardt solution (1 × Denhardt solution is 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin, and 0.2% Ficoll) For example, at 37 ° C., 45 ° C., or 50 ° C. After incubating for a sufficient period of time (eg, 3, 4, 5 or 6 hours or more), washing is performed under the above conditions, and by detecting whether the labeled nucleic acid is hybridized, the nucleic acid is hybridized under the condition. Or not. The nucleic acid may be RNA or DNA, may be a chimeric type containing DNA and RNA in the same strand, or a hybrid type in which one strand is DNA and the other strand is RNA.

  Double-stranded RNA (including siRNA), antisense oligonucleotide, ribozyme and the like may be administered as they are, but may be administered by a known method such as using an expression vector. As the expression vector, for example, those described in the present specification can be used.

  A method for producing an efficient miRNA inhibitor is already known (Vermeulen A et al. RNA 13, 723-730 (2007)). In addition, miR-153 inhibitors and miR-216a inhibitors are already commercially available (eg Synthetic human miRNA inhibitor oligonucleotide, GeneCopoeia, Inc., Rockville, MD; miRIDIAN microRNA Hairpin Inhibitor, Dharmacon, Lafayette, LA). These can be used as miRNA inhibitors as appropriate.

  In the method for improving the prognosis of small cell lung cancer according to the present invention, miR-153, miR-216a or their precursors are increased in patients with increased expression of miR-153, miR-216a or their precursors. It is performed by administering double-stranded RNA (including siRNA), antisense oligonucleotide, ribozyme, etc. to the precursor. As the administration method, the same method as the method for treating small cell lung cancer according to the present invention can be used. In addition, regarding the compound, nucleic acid, vector, and other conditions to be used, the above description regarding the method for treating small cell lung cancer according to the present invention can be referred to, and any of these descriptions and the description of the improvement method of the present invention can be referred to. Combinations of these are disclosed herein.

  The therapeutic agent and prognosis improving agent according to the present invention include miR-196a, miR-203, a precursor thereof or a vector expressing them, miR-153, miR-216a or a precursor thereof according to the present invention as an active ingredient. Containing at least one kind of compound that inhibits the function of pharmacologically, and optionally adding pharmaceutically acceptable excipients, tonicity agents, solubilizers, stabilizers, preservatives, soothing agents, etc. It can be prepared as a pharmaceutical composition such as tablets, powders, granules, capsules, liposome capsules, injections, liquids, nasal drops and the like, and can also be lyophilized. These can be prepared according to conventional methods.

  The therapeutic agent and prognosis improving agent according to the present invention can be appropriately adjusted according to the patient's condition and used in preferable amounts. For example, it can be administered in the range of 0.001 to 100 mg / kg, preferably 0.1 to 10 mg / kg, but is not particularly limited. Further, for example, such a dose may be divided into several times, and such a dose may be administered several times.

  The therapeutic agent and prognosis improving agent according to the present invention can be pharmacologically evaluated in the following in vitro or in vivo system, for example.

Examples of the in vitro pharmacological evaluation include a cell growth inhibition assay and a colony formation inhibition assay. In the cell growth inhibition assay, for example, the therapeutic agent or prognosis improving agent according to the present invention is brought into contact with a cancer cell expressing the miRNA according to the present invention or a precursor thereof, and a ³ H-thymidine uptake assay after a predetermined period of time, The cell growth inhibitory activity can be evaluated by MTT assay or the like. In the colony formation assay, for example, the therapeutic agent or prognosis improving agent according to the present invention is contacted with cancer cells expressing the miRNA according to the present invention or a precursor thereof, followed by Giemsa staining after culture, and the number of resistant colonies is determined. It can be evaluated by counting. In addition to cancer cells expressing miRNA or a precursor thereof according to the present invention, animal cells or yeast cells directly introduced with the nucleic acid encoding the miRNA or precursor thereof, or the miRNA or precursor thereof are encoded. A transformed cell obtained by introducing a vector expressing a nucleic acid into a host cell such as an animal cell or a yeast cell can be used. As miRNA, for example, miR-153, miR-216a or a precursor thereof can be used, but not limited thereto.

  In vivo pharmacological evaluation can be performed by administering an appropriate amount of the therapeutic agent or prognosis improving agent according to the present invention to a cancer animal model. For example, the size of the tumor can be used as an index for the evaluation. As a cancer animal model, for example, a cancer-bearing animal model in which a cancer cell expressing the miRNA according to the present invention or a precursor thereof is transplanted can be used, but it is not particularly limited thereto.

  The present invention also provides miR-153, miR-196a, miR-203, miR-216a, their precursors, their expression vectors, and compounds that inhibit the functions of the miRNA or its precursors (including expression vectors). At least one selected from the group consisting of: a use for the treatment of small cell lung cancer, a use for improving the prognosis of the lung cancer, a use in the manufacture of a medicament or a medicament for the treatment of the lung cancer, and the lung cancer It relates to the use in the manufacture of a medicament or medicament for improving the prognosis of The present invention also provides miR-153, miR-196a, miR-203, miR-216a, their precursors, their expression vectors, and compounds that inhibit the functions of the miRNA or its precursors (including expression vectors). At least one selected from the group consisting of: a use for inhibiting the growth of small cell lung cancer cells; and a use for producing a medicament or a medicament for inhibiting the growth of the cells. The present invention also relates to a therapeutic agent for small cell lung cancer and a prognosis improving agent for small cell lung cancer, comprising at least one selected from the group. The present invention also relates to a growth inhibitor of small cell lung cancer cells, comprising at least one selected from the group. The present invention also includes a composition for inhibiting the growth of small cell lung cancer cells, a composition for the treatment of small cell lung cancer, comprising at least one selected from the group and a pharmaceutically acceptable carrier, And a composition for improving the prognosis of small cell lung cancer. Examples of the pharmaceutically acceptable carrier include distilled water, phosphate buffered saline (PBS), sodium chloride solution, Ringer's solution, culture solution and the like. Moreover, vegetable oil, suspension agent, surfactant, stabilizer, biocide, etc. may be contained.

The present invention also provides miR-153, miR-196a, miR-203, miR-216a, their precursors, their expression vectors, and compounds that inhibit the functions of the miRNA or its precursors (including expression vectors). At least one selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof in at least one biological sample derived from a patient with small cell lung cancer selected from the group consisting of The present invention relates to a use for treating small cell lung cancer in which the expression level is changed (increased or decreased) compared to a control biological sample, and a use for improving the prognosis of the small cell lung cancer. Moreover, the present invention is selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof in at least one biological sample derived from a patient with small cell lung cancer. Use in the manufacture of a medicament or medicament for treating small cell lung cancer in which at least one expression level is altered (increased or decreased) compared to a control biological sample, and improves the prognosis of the small cell lung cancer For use in the manufacture of a medicament or medicament.
Specifically, the treatment or the prognosis improvement is
(1) When at least one expression level of miR-196a, miR-203 or a precursor thereof is decreased, express at least one miRNA or a precursor thereof or the reduced one Or / and
(2) When the expression level of at least one of miR-153, miR-216a or a precursor thereof is increased, at least one compound that inhibits the function of the miRNA or a precursor thereof is administered May be included.

  The present invention also relates to use of at least one selected from the group consisting of miR-196a, miR-203, their precursors, and their expression vectors for treating small cell lung cancer, and prognosis of small cell lung cancer. The invention relates to use for improving, use in the manufacture of a medicament or medicament for treating small cell lung cancer, and use in the manufacture of a medicament or medicament for improving the prognosis of small cell lung cancer. Specifically, use for treating small cell lung cancer in which the expression level of at least one of miR-196a, miR-203 or a precursor thereof is decreased, and for improving the prognosis of the small cell lung cancer The invention relates to use, in the manufacture of a medicament or medicament for treating the small cell lung cancer, and in use in the manufacture of a medicament or medicament for improving the prognosis of the small cell lung cancer.

  The present invention also relates to the use of a compound (including an expression vector) that inhibits at least one function of miR-153, miR-216a or a precursor thereof for treating small cell lung cancer, prognosis of small cell lung cancer The present invention relates to a use for improving the prognosis, a use in the manufacture of a medicament or medicament for treating small cell lung cancer, and a use in the manufacture of a medicament or medicament for improving the prognosis of small cell lung cancer. Specifically, use for treating small cell lung cancer in which the expression level of at least one of miR-153, miR-216a or a precursor thereof is increased, and for improving the prognosis of the small cell lung cancer The invention relates to use, in the manufacture of a medicament or medicament for treating the small cell lung cancer, and in use in the manufacture of a medicament or medicament for improving the prognosis of the small cell lung cancer.

The present invention is also selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a, their precursors, and compounds (including expression vectors) that inhibit the function of the miRNA or its precursors. At least one use for treating small cell lung cancer, use for improving the prognosis of small cell lung cancer, and use in the treatment or manufacture of a medicament or medicament for improving the prognosis The treatment or the prognostic improvement is
(1) In a biological specimen derived from a small cell lung cancer patient, at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof is measured,
(2) if the expression level is decreased compared to the control biological sample, administering the decreased at least one miRNA or a precursor thereof, or a vector expressing them; or / and ,
(3) a step of administering at least one compound (including an expression vector) that inhibits the function of the miRNA or a precursor thereof when the expression level is increased compared to the control biological sample;
Concerning use, including

The present invention also relates to use of at least one selected from the group consisting of miR-196a, miR-203, their precursors, and their expression vectors for treating small cell lung cancer, prognosis of small cell lung cancer Use in the manufacture of a medicament or medicament for treating small cell lung cancer, and use in the manufacture of a medicament or medicament for improving the prognosis of small cell lung cancer comprising the treatment or the prognosis Improvement of
(1) In a biological sample derived from a small cell lung cancer patient, at least one expression level selected from the group consisting of miR-196a, miR-203, or a precursor thereof is measured,
(2) When the expression level is reduced as compared to the control biological sample, administering the reduced at least one miRNA or a precursor thereof, or a vector expressing them,
Concerning use, including
The present invention also relates to the use of miR-153, miR-216a, and a compound (including an expression vector) that inhibits the function of at least one of the precursors for treating small cell lung cancer, and prognosis of small cell lung cancer. Use in improving, use in the manufacture of a medicament or medicament for treating small cell lung cancer, and use in the manufacture of a medicament or medicament for improving the prognosis of small cell lung cancer comprising the treatment or the prognosis The improvement is
(1) In a biological specimen derived from a small cell lung cancer patient, at least one expression level selected from the group consisting of miR-153, miR-216a, or a precursor thereof is measured,
(2) a step of administering at least one compound (including an expression vector) that inhibits the function of the miRNA or a precursor thereof when the expression level is increased compared to a control biological sample;
Concerning use, including

  In the above uses, reference can be made to the description of the diagnosis, prediction and testing methods of the present invention, any combination of those descriptions and the above description of use being disclosed herein. For example, a biological sample derived from a small cell lung cancer patient, a control biological sample, and measurement and comparison of the expression level are the same as those described for the diagnostic method and test method of the present invention. For example, in the comparison of the expression level of miR-196a or a precursor thereof, the expression level in a biological sample derived from a patient with small cell lung cancer having a good prognosis can be used as a comparison target.

  The present invention also provides a therapeutic agent for small cell lung cancer, which uses at least one function change selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof as an index, The present invention relates to a prognosis improving agent for cell lung cancer and a screening method for those candidate compounds. The screening method according to the present invention is based on the finding that the expression level of a specific miRNA is associated with the prognosis in a biological sample derived from a patient with small cell lung cancer. Therefore, the therapeutic agent for small cell lung cancer, the prognosis improving agent for small cell lung cancer, and the candidate compound screening method thereof according to the present invention include miR-153, miR-196a, miR-203, miR-216a or a precursor thereof. This is a screening method using as an index a change in at least one function selected from the group consisting of:

  Here, “change in function” includes, for example, a case where the expression level of miRNA or a precursor thereof according to the present invention changes. In addition, the expression level of the miRNA or precursor thereof according to the present invention does not change, but the expression level of the gene having the target base sequence of the miRNA or precursor thereof is changed by modifying the miRNA or precursor thereof. When the activity changes, the expression level of the miRNA according to the present invention or its precursor does not change, but the expression or activity of a factor that changes the expression level of the gene having the target base sequence of the miRNA or its precursor changes. The case where the expression level of the gene having the target base sequence of the miRNA or a precursor thereof changes depending on circumstances is also included.

The first screening method can be performed using, for example, an increase in the expression level of miR-196a, miR-203 or a precursor thereof as an index.
More specifically, for example, a screening method including the following steps (A) to (C) can be mentioned.
(A) a step of contacting a test compound with a cell expressing a nucleic acid encoding miR-196a, miR-203 or a precursor thereof;
(B) measuring the expression level of a nucleic acid encoding miR-196a, miR-203 or a precursor thereof,
(C) The process of selecting the test compound which increased the expression level of the nucleic acid which codes miR-196a, miR-203, or those precursors compared with the case where a test compound is not added.

The second screening method can be performed using, for example, a decrease in the expression level of miR-153, miR-216a or a precursor thereof as an index.
More specifically, for example, a screening method including the following steps (A) to (C) can be mentioned.
(A) a step of contacting a test compound with a cell expressing a nucleic acid encoding miR-153, miR-216a or a precursor thereof;
(B) a step of measuring the expression level of a nucleic acid encoding miR-153, miR-216a or a precursor thereof,
(C) The process of selecting the test compound which reduced the expression level of the nucleic acid which codes miR-153, miR-216a, or those precursor compared with the case where a test compound is not added.

The third screening method is performed by, for example, promoting the binding of miR-196a, miR-203 or a precursor thereof to a base sequence targeted by miR-196a, miR-203 or a precursor thereof. can do. The binding of miRNA to the target base sequence may detect physical binding, or may detect binding functionally using the biological effect of binding as an index.
More specifically, for example, a screening method including the following steps (A) to (C) can be mentioned.
(A) a step of contacting a test compound with a cell expressing a nucleic acid encoding miR-196a, miR-203 or a precursor thereof;
(B) a step of measuring the expression level of a gene (target gene) having a base sequence targeted by miR-196a, miR-203 or a precursor thereof;
(C) A test compound in which the expression level of a gene (target gene) having a base sequence targeted by miR-196a, miR-203 or a precursor thereof is reduced as compared with the case where no test compound is added. Process to select

The fourth screening method is performed using, for example, inhibition of binding of miR-153, miR-216a or a precursor thereof to a base sequence targeted by miR-153, miR-216a or a precursor thereof as an indicator. can do.
More specifically, for example, a screening method including the following steps (A) to (C) can be mentioned.
(A) a step of contacting a test compound with a cell expressing a nucleic acid encoding miR-153, miR-216a or a precursor thereof;
(B) a step of measuring the expression level of a gene (target gene) having a base sequence targeted by miR-153, miR-216a or a precursor thereof;
(C) A test compound in which the expression level of a gene (target gene) having a base sequence targeted by miR-153, miR-216a or a precursor thereof is increased as compared with the case where no test compound is added. Process to select

  The “test compound” in the step (A) according to the present invention is not particularly limited. For example, natural compounds, organic compounds, inorganic compounds, nucleic acids (including nucleic acid analogs), proteins, peptides and other single compounds, Vectors expressing them, as well as compound libraries, gene library expression products, cell extracts, cell culture supernatants, fermented microbial products, marine organism extracts, plant extracts, prokaryotic cell extracts, eukaryotic single cells Mention may be made of extracts or animal cell extracts. The nucleic acid may be modified and may contain a conjugate. Specific examples thereof are as described in this specification. The test compound can be appropriately labeled and used as necessary. Examples of the label include a radiolabel and a fluorescent label. Moreover, there is no restriction | limiting in particular as "a some test compound", For example, in addition to the said test compound, the mixture which mixed multiple types of these test compounds is also contained.

  In the present invention, “contact” may mean that the test compound comes into contact outside and / or inside the cell, and can be performed, for example, by adding the test compound to the cell culture medium. . Moreover, a transfection reagent, a virus vector, etc. can be utilized suitably.

  Cells expressing miR-153, miR-196a, miR-203, miR-216a or their precursors, and / or genes having a target base sequence include cells that naturally express them, artificial In addition, cells expressing them can be used. Specifically, examples of the cell in which the nucleic acid encoding the miRNA or the precursor thereof according to the present invention is expressed include, for example, cancer cells and animal cells into which the nucleic acid encoding the miRNA or a precursor thereof is directly introduced. Or yeast cells, or transformed cells obtained by introducing a vector expressing a nucleic acid encoding the miRNA or a precursor thereof into a host cell such as an animal cell or a yeast cell. For example, when the binding between miRNA and target is used as an index, or when the expression level of miRNA is detected using miRNA stability or degradation as an index, miR-153, miR-196a, miR-203, miR- Cells expressing 216a or their precursors can be expressed exogenously, for example, with an expression vector or the like. In the case of screening for a compound that changes the expression level by increasing or decreasing the transcription activity, cells expressing miR-153, miR-196a, miR-203, miR-216a or their precursors are preferably naturally Cells expressing them are used.

  Any known measurement method is used for measuring the expression level of the nucleic acid encoding the miRNA or its precursor in the step (B) according to the present invention and the gene having the target base sequence of the miRNA or its precursor. it can. Specifically, for example, RT-PCR, a modified method thereof, a Northern blot method, an in situ hybridization method, and a method using a microarray can be exemplified. Further, the target base sequence of the miRNA or a precursor thereof is inserted into a known appropriate reporter gene expression vector, the vector is introduced into a suitable host cell, the cell is contacted with a test substance, and the reporter gene Screening according to the present invention can also be performed using expression as an indicator. That is, the gene having the target base sequence of step (B) according to the present invention may be a natural target gene of the miRNA, or a reporter gene prepared by incorporating the target base sequence of the miRNA. Also good. For example, a target base sequence can be incorporated into 3′-UTR of a reporter gene (GFP, luciferase gene, etc.) and used. As the target base sequence, a sequence that hybridizes with miRNA can be used as appropriate, and even if it is not completely complementary to miRNA or has a bulge, it can be a target. The target gene can be constructed by inserting a plurality of copies of the target base sequence, for example, in tandem. A specific reporter gene may be prepared by a known method (Vermeulen A et al. RNA 13, 723-730 (2007); Ebert, MS et al., Nat. Methods 4, 721-726 (2007) ).

  The base sequence targeted by the miRNA or its precursor (target base sequence) is the number recognized by the miRNA or its precursor existing in the 3′-untranslated region of the mRNA that causes the translational repression of the miRNA or its precursor. The base sequence of a nucleic acid consisting of bases. For example, the base sequence complementary to the first to eighth base sequences at the 5 ′ end of miRNA is the target base sequence (Nature 433: 769-773 (2005)), and such a sequence is converted into a 3′-untranslated region. It is highly possible that the gene contained in is a target gene. The target gene can be obtained, for example, by a method for searching a gene DATA base using a target base sequence, HITS-CLIP method (Nature 460: 479-486 (2009)).

  The present invention is further illustrated by the following examples, but is not limited to the following examples. References and other references mentioned herein are incorporated as part of this specification.

Materials and Methods Among lung cancer tissue specimens surgically excised between 1995 and 2008 at the Cancer Research Institute Hospital or Ariake Hospital, 35 small cell lung cancer (SCLC) tissue specimens, 11 large cells Neuroendocrine cancer (LCNEC) tissue specimens, 4 adenocarcinoma (Ad) tissue specimens, 5 squamous cell carcinoma (Sq) tissue specimens, and 8 normal lung (NL) tissue specimens for analysis It was. All samples were collected with patient consent and their use was approved by our ethics committee.

The patient background is shown in Table 1. Most were combined with chemotherapy before or after surgery.

Total RNA Extraction and MicroRNA Analysis A frozen tissue section was sliced and subjected to HE staining, and a specimen in which the proportion of tumor cells in the section was 70% or more was used for Total RNA extraction. Total RNA was extracted with mirVana miRNA Isolation Kit (Applied Biosystems). The quality of the extracted RNA was evaluated with an Agilent 2100 bioanalyzer (manufactured by Agilent). Total RNA labeled with Cy3 was hybridized to Human miRNA Microarray (manufactured by Agilent) loaded with 866 human miRNAs registered in miRBase database v12.0.

Computer analysis of microarray data Microarray data was analyzed using GeneSpring GX10 software (manufactured by Agilent). Normalization was performed with a 75% tile value of the miRNA expression level of each sample, and analysis was performed with 600 miRNAs having a raw signal value of 5 or more. Extraction of miRNA having a difference in expression was performed by a signal ratio (2.0 or more), and ANOVA and Tukey post hoc test (p <0.05). Benjamini-Hochberg correction was used for multiple test correction. Hierarchical clustering was performed using the Pearson coefficient as a measure of similarity.

Quantitative RT-PCR
MiR-153, miR-196a, miR-203, and miR-216a cDNAs were synthesized using Taqman microRNA kit (Applied Biosystem). Quantitative RT-PCR was performed using Taqman microRNA assays (Applied Biosystem) containing Taqman probes and primers compatible with the miRNA. U6 was used as an endogenous control for miRNA expression level correction.

<Result>
MiRNA whose expression is changed by SCLC
Statistical analysis extracted 101 miRNAs with significantly different expression between SCLC and normal lung. 67 were significantly decreased by SCLC and 34 were significantly increased by SCLC.

It was classified into two groups by SCLC sub-group hierarchical clustering classified by hierarchical clustering (FIG. 1, groups 1 and 2). Group 1 consisted of only neuroendocrine cancers (SCLC 20 cases, LCNEC 3 cases), whereas group 2 classified neuroendocrine cancers (SCLC 15 cases, LCNEC 8 cases) and non-neuroendocrine cancers (4 cases of squamous cell carcinoma) It was done. The remaining non-neuroendocrine cancers were also classified in Group 2. The classification by mRNA expression profiling performed previously by the present inventors (Jones MH et al., Lancet, 2004, 363: 775-781) and the classification by miRNA expression profiling were almost the same.

（表は、６００のｍｉＲＮＡを用いた教師なし階層クラスタリングにより同定されたＳＣＬＣサブグループ間の臨床的特徴の比較を表す。）A comparison of survival curves and clinicopathological background of group 1 SCLC (SCLC 1) and group 2 SCLC (SCLC 2) is shown in FIG. 2 and Table 2, respectively.

(The table represents a comparison of clinical features between SCLC subgroups identified by unsupervised hierarchical clustering with 600 miRNAs.)

  SCLC 2 had a significantly better prognosis than SCLC 1 (5-year survival rate 79% vs. 0%, p = 0.007). We examined 12 patients who were able to determine the therapeutic effect after chemotherapy before surgery. SCLC 1 was successful 6 cases / invariant 3 cases, SCLC 2 was successful 2 cases / invariant 1 case. There was no obvious difference in sensitivity.

  In 14 cases of SCLC 1 and 13 cases of SCLC 2 in which proGRP values were measured before the start of treatment, serum proGRP values were significantly lower in SCLC 2 (26.4 pg / ml vs. 50.9 pg / ml, p < 0.01). The proGRP value correlates with the tumor volume, but the stage of the case in which proGRP was measured was not significantly different between the two groups (SCLC 1; Stage I was 6 cases, Stage II-IV was 8 cases. SCLC. 2; 4 cases of Stage I, 9 cases of Stage II-IV, p = 0.80). The smoking index was significantly higher with SCLC 2 (1347 vs. 824, p = 0.03). Tumor diameter tended to be large with SCLC 2. The proGRP value is also affected by the tumor volume, but in this study, the difference in stage between the two groups is not clear, and the difference in value may reflect the difference in proGRP production ability It was. From these results, it is speculated that neuroendocrine activity is involved in the prognosis of SCLC. In addition, miR-153, miR-216a decreased expression group, miR-196a, miR-203 increased expression group tend to have a low serum proGRP value that increases in neuroendocrine cancer, and a positive rate of neuroendocrine markers (immunostaining) Tended to be low.

SCLC prognosis and miRNA expression Among the SCLC patient tissue samples used in the analysis in Example 1, 10 SCLC tissue samples that survived without recurrence for 3 years or more and 14 SCLC patients who died of cancer in less than 3 years Was selected, and miRNAs that differed in expression between the two were searched. Extraction of miRNA having a difference in expression was carried out by signal ratio (2.0 or more) and ANOVA and Tukey post hoc test (p <0.05).

As a result of analysis, miR-153, miR-196a, miR-203, or miR-216a was found as a miRNA having a difference in expression between the two. Normal lung tissue sample (NL), lung adenocarcinoma tissue sample (Ad), lung squamous cell carcinoma tissue sample (Sq), and SCLC good prognosis group (SCLC2) and poor prognosis group (SCLC1) classified by hierarchical clustering ) MiRNA expression levels were compared (FIG. 3A). Of the four, miR-153, miR-203, and miR-216a have altered expression only in the SCLC poor prognosis group (SCLC1), and the expression in the SCLC good prognosis group (SCLC2) is normal lung or lung cancer other than SCLC It was the same. In particular, the expression levels of miR-153 and miR-216a were higher in any group with poor prognosis than in any group, and the expression levels of miR-203 were lower than in any group. Moreover, the expression level of miR-196a was increased in the good prognosis group compared to the poor prognosis group.
Hierarchical clustering suggests that the miRNA expression profile of SCLC with good prognosis is close to that of normal lung and non-neuroendocrine cancers, so these miR-153, miR-216a, and miR-203 may be particularly relevant for prognosis It was considered expensive. Therefore, the expression levels of these three were also measured by quantitative RT-PCR. Microarray data and quantitative RT-PCR results correlated well (FIG. 3B). Compared with the poor prognosis group (SCLC1), the good prognosis group (SCLC2) had significantly decreased miR-153 and miR-216a expression and significantly increased miR-203 and miR-196a expression.

  Thirty-five SCLC patients used for analysis in Example 1 were classified into a decreased expression group and an increased expression group with the median as a cut-off value for each of miR-153, miR-196a, miR-203, or miR-216a. . The clinical characteristics and survival curves of both groups are shown in Table 3 and FIG. The miR-153, miR-216a expression decreased group, and miR-196a expression increased group had significantly better prognosis. The miR-203 expression increased group also had a favorable prognosis.

（表は、ＳＣＬＣ症例をｍｉＲ−１５３、ｍｉＲ−２０３、ｍｉＲ−２１６ａ、およびｍｉＲ−１９６ａの高／低発現群に分類したときの臨床的特徴の比較を示す。喫煙インデックスおよび化学療法への反応性は表２の脚注を参照。）

(The table shows a comparison of clinical features when SCLC cases are classified into high / low expression groups of miR-153, miR-203, miR-216a, and miR-196a. Smoking index and response to chemotherapy. (See footnote in Table 2 for gender.)

  FIG. 5 shows the results of classifying 35 SCLC patients used in the analysis in Example 1 and the survival curve of each group by hierarchical clustering using three of miR-203, miR-153, and miR-216a. FIG. 6 shows the classification by the same clustering using 4 of miR-203, miR-196a, miR-153, and miR-216a and the survival curve of each group. All SCLC patients could be classified into good prognosis group and poor prognosis group.

  Based on a prognostic model built using three of miR-153, miR-203, and miR-216a, 35 SCLC patients were classified. Briefly describing the algorithm of this model, cut-off values are determined for each of the three miRNAs by the decision tree method (miR-153, miR-203, and miR-216a are -0.764, -1.46, respectively). Based on this, patients were classified into a high-risk group and a low-risk group by majority vote of three miRNAs.

  FIG. 7 shows the SCLC-specific survival curves of the poor prognosis group (high risk) and the good prognosis group (low risk), and Table 4 shows the clinical characteristics of the patients.

  Compared to the high-risk group, the low-risk group had a significantly better prognosis (5% survival at 0% vs. 80.4%; p = 0.004). The distribution of stage was similar in the two groups, but in 27 patients whose proGRP levels were measured before treatment, serum proGRP levels were significantly lower in the low risk group than in the high risk group (26.5 pg). / Ml vs. 59.9 pg / ml; p <0.01). Cumulative smoking was significantly higher in the low risk group than in the high risk group (1306 vs. 831; p = 0.04). In 12 cases where preoperative chemotherapy was performed, there was no obvious difference in sensitivity (PR: NC ratio was 6: 3 in the high-risk group and 2: 1 in the low-risk group). The histological findings of the tumors were closely similar in the two groups and were difficult to distinguish without prior knowledge (FIG. 8). Therefore, the present invention can be applied to a sample that is difficult to distinguish from histological findings.

  35 SCLC patients were randomly divided into a learning set (20 patients) and a test set (15 patients) for performance verification. The learning set was selected to consist of 11 SCLC1 patients and 9 SCLC2 patients. Based on the cut-off value determined in the learning set, the test set patients were classified, and the consistency between the survival analysis by the log rank test and the classification by hierarchical clustering of 600 miRNAs was evaluated. This operation was repeated 1,000 times. As a result, the median and geometric mean of the p-value in the log rank test were 0.048 and 0.041, respectively, indicating that the prognosis prediction by this model is accurate on average (FIG. 9 ( A)). The average of the coincidence rate and the discrepancy rate with the hierarchical clustering was 0.874 and 0.126, respectively, and it was shown that the classification by this model can roughly reproduce the classification by 600 miRNAs (FIG. 9B). .

Cancer Cell Growth Inhibition Assay SC1 cell lines MS1 and DMS53 are used. MS1 is cultured in RPMI medium supplemented with 10% FBS, and DMS53 is cultured in DMEM medium supplemented with 10% FBS. miRIDIAN microRNA Hairin Inhibitors / Mimic (Dharmacon, Lafayette, Co, USA) inhibits miR-153 and miR-216a functions and enhances miR-203 and miR-196a functions. Introduction into MS1 cells is performed by electroporation method using Nucleofector II Device (Amaxa). Introduction into DMS53 cells is performed using Lipofectamine ™ 2000 (Invitrogen). Cells introduced with miRIDIAN microRNA Hairpin Inhibitors / Mic negative control are used as controls. The therapeutic effect of miRNA function control is detected by the proliferation curve of the introduced cells.
In addition, cell blocks are prepared from the introduced cells, immunostaining of neuroendocrine markers (Synaptophysin, Chromogranin A, NCAM) is performed, proteins are extracted from the introduced cells, and neuroendocrine markers (Synaptophysin, Chromogranin A, NCAM) are quantified. Evaluate the neuroendocrine character of the introduced cells.

DMS53 (ATCC CRL-2062) and SBC-5 (JCRB NO: JCRB0819, Mitsuhashi, Y. et al., Cancer, 70: 2540) are adhesion-adapted SCLC cell lines of small cell lung cancer cells with miRNA and miRNA inhibitors -2546, 1992). In DMS-53, miR-153 is highly expressed, and in SBC-5, miR-203 is lowly expressed (FIGS. 10 (A) and (C)). DMS53 and SBC-5 were cultured in DMEM medium supplemented with 10% FBS. miRIDIAN miR-153 inhibitor and miRIDIAN miR-203 mimic were prepared by miRIDIAN microRNA Hairpin Inhibitors / Mimic (Dharmacon, Lafayette, Co, USA), and miR-153 function inhibition and miR-203 function enhancement were performed.
(1) miRIDIAN Hairpin Inhibitor IH-300616-08-0005, Human hsa-miR-153, MIMAT0000439, MI0000464, 5 nmol (Mature microRNA Sequence: UUGCAUAGUCACAAAAGUGAUC / SEQ ID NO: 1): ThermoFisher Dharmacon
(2) miRIDIAN Mimic C-300562-03-0005, Human hsa-miR-203, MIMAT0000264, MI0000283, 5 nmol (Mature microRNA Sequence: GUGAAAUGUUUAGGACCACUAG / SEQ ID NO: 7): ThermoFisher Dharmacon

(1) miR-153 inhibitor introduction experiment in DMS-53 5.0x10 ⁵ cells were planted in 1 dish (35 mm) the day before the experiment. On the day, 3 μL of Lipofectamine ^™ 2000 (Invitrogen: cat. # 11668-019) was added at a ratio of 150 μL of OPTI-MEM ^™ I (GIBCO: cat. # 31985) (hereinafter referred to as OPTI-MEM). Lightly vortexed and spun down and left at room temperature for 5 minutes. On the other hand, oligos (miR-153 inhibitor and negative control ^{* 1} ) were similarly diluted to 60 pmol / 3 μL, added to 3 μL at a ratio of 150 μL of OPTI-MEM, and lightly vortexed and spun down. These were added and allowed to stand at room temperature for 20 minutes, and 306 μL each was dispensed into the above-mentioned dish containing cells and culture solution and mixed well. Growth was confirmed by culturing for several days in a 37 ° C., 5% CO ₂ incubator. The number of cells was counted at 0 hr, 48 hrs, and 122 hrs (confluent) for comparison.
(* 1: miRIDIAN microRNA Hairpin Inhibitor Negative Control # 1 IN-001005-01-05 (catalog item))

(2) miR-203mimic introduction experiment in SBC-5
Similar to the experiment in DMS-53, 3.0 × 10 ⁵ cells were planted in one dish (35 mm) the day before the experiment. On the day, 150 μL of OPTI-MEM was added to 3 μL of Lipofectamine ^™ 2000. Lightly vortexed and spun down and left at room temperature for 5 minutes. On the other hand, oligos (miR-203 mimic and negative control ^{* 2} ) were similarly diluted to 60 pmol / 3 μL, respectively, 3 μL of which was added at a ratio of 150 μL of OPTI-MEM, and lightly vortexed and spun down. These were added and allowed to stand at room temperature for 20 minutes, and 306 μL each was dispensed into the above-mentioned dish containing cells and culture solution and mixed well. Growth was confirmed by culturing for several days in a 37 ° C., 5% CO ₂ incubator. The number of cells was counted and compared at 0 hr, 23 hrs, 48 hrs, 51 hrs, 69 hrs, 96 hrs, 120 hrs (confluent).
(* 2: miRIDIAN microRNA Mimic Negative Control # 1 CN-001000-01-05 (catalog item))

(3) Results
It was confirmed that miRIDIAN miR-153 inhibitor inhibits the proliferation of DMS-53. MiRIDIAN miR-203 mimic also reduced SBC-5 proliferation (FIG. 10).
Therefore, it has been clarified that an inhibitor of miR-153 may be used as a therapeutic agent for small cell lung cancer, particularly in patients where miR-153 is highly expressed. In addition, it was revealed that miR-203 mimic could be used as a therapeutic agent for small cell lung cancer, particularly in patients with reduced miR-203 expression. These results suggested that miR-216a inhibitor and miR-196a mimic could also be used as therapeutic agents for small cell lung cancer.

  INDUSTRIAL APPLICABILITY According to the present invention, methods for predicting, examining, and diagnosing SCLC prognosis using miRNA are provided. In addition, the present invention provides an SCLC treatment method, an SCLC prognosis improvement method, an SCLC treatment agent, an SCLC prognosis improvement agent, and an SCLC treatment / prognosis improvement screening method using miRNA.

Claims (16)

A patient with small cell lung cancer that measures at least one expression level selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof in a biological sample derived from a patient with small cell lung cancer Inspection method for determining prognosis in children. The method according to claim 1, wherein the prognosis is determined to be poor when the expression level of miR-153, miR-216a or a precursor thereof is higher than the expression level in a control biological sample. Method. The method according to claim 1, wherein the prognosis is poor when the expression level of miR-203 or a precursor thereof is lower than the expression level in a control biological sample. In the above method, when the expression level of miR-196a or a precursor thereof is smaller than the expression level in a biological sample derived from a small cell lung cancer patient with a good prognosis, the prognosis is determined to be poor. The method of claim 1. A method of treating small cell lung cancer, comprising:
(1) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-196a, miR-203 or a precursor thereof is decreased compared to a control biological sample, the decrease Administering at least one miRNA, a precursor thereof, or a vector that expresses them; and / or
(2) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-153, miR-216a or a precursor thereof is increased compared to the control biological sample, the miRNA or Administering at least one compound that inhibits the function of their precursors;
A method of treating small cell lung cancer, comprising: A method for improving the prognosis of small cell lung cancer,
(1) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-196a, miR-203 or a precursor thereof is decreased compared to a control biological sample, the decrease Administering at least one miRNA, a precursor thereof, or a vector that expresses them; and / or
(2) In a biological sample derived from a patient with small cell lung cancer, when the expression level of at least one of miR-153, miR-216a or a precursor thereof is increased compared to the control biological sample, the miRNA or Administering at least one compound that inhibits the function of the precursor;
A method for improving the prognosis of small cell lung cancer, comprising: The method according to claim 1, wherein the biological sample is derived from a group consisting of serum, plasma, lung cancer tissue, and cells. A therapeutic agent for small cell lung cancer comprising at least one of miR-196a, miR-203, precursors thereof, or vectors expressing them. A therapeutic agent for small cell lung cancer comprising a compound that inhibits at least one function of miR-153, miR-216a or a precursor thereof. A prognosis improving agent for small cell lung cancer comprising at least one of miR-196a, miR-203, a precursor thereof, or a vector expressing the same. A prognosis improving agent for small cell lung cancer comprising a compound that inhibits at least one function of miR-153, miR-216a or a precursor thereof. A method for screening a therapeutic agent for small cell lung cancer or a prognosis improving agent for small cell lung cancer, comprising at least one selected from the group consisting of miR-153, miR-196a, miR-203, miR-216a or a precursor thereof A screening method that uses changes in function as an index. The method according to claim 12, wherein the change in function is an increase in the expression level of miR-196a, miR-203 or a precursor thereof. 13. The method of claim 12, wherein the change in function is inhibition of expression of miR-153, miR-216a or a precursor thereof. The change in function is promotion of binding of miR-196a, miR-203 or a precursor thereof to a base sequence targeted by miR-196a, miR-203 or a precursor thereof. the method of. The change in function is inhibition of binding of miR-153, miR-216a or a precursor thereof to a base sequence targeted by miR-153, miR-216a or a precursor thereof. the method of.

Images