JPWO2010100831A1 - Methyltransferase enzyme - Google Patents

Abstract

The present invention is a gene comprising a polynucleotide selected from any of the following (a) to (c), a method for producing an enzyme encoded by the gene, and a method for producing a methylated product using the enzyme; (A) a polynucleotide comprising the base sequence represented by SEQ ID NO: 1, (b) hybridizing with a polynucleotide comprising the base sequence complementary to the base sequence represented by SEQ ID NO: 1 under stringent conditions, And a polynucleotide encoding a polypeptide having methyltransferase enzyme activity, (c) a polynucleotide comprising a nucleotide sequence having a homology of 64% or more with the nucleotide sequence represented by SEQ ID NO: 1, and methyl A polynucleotide encoding a polypeptide having transferase enzyme activity.

Description

The present invention relates to a novel methyltransferase enzyme and a method for producing the same. Furthermore, the present invention relates to a method for producing a methylated product by methylating a hydroxyl group (hydroxy group) in a compound using the enzyme.
This application claims priority on March 2, 2009 based on Japanese Patent Application No. 2009-047953 for which it applied to Japan, and uses the content here.

  In recent years, patients with various lifestyle-related diseases due to changes in living environment and dietary habits are increasing in developed countries including Japan. Major lifestyle-related diseases include diabetes, hypertension, dyslipidemia and the like, and the number of those who develop these diseases is increasing. In addition, so-called reserve forces that show signs even if they do not cause serious symptoms are also increasing. In addition to these lifestyle-related diseases, the increase in allergic patients due to changes in the living environment and the increase in patients with eye fatigue due to the spread of personal computers (personal computers) are also serious problems.

  For patients with these symptoms and their reserves, one means of trying to improve them is the intake of functional foods such as health foods and foods for specified health use. Extracts from various plants and microorganisms are used as active ingredients in functional foods. Of these, many have been developed that contain polyphenols extracted from plant fruits, leaves, and the like as active ingredients.

  Examples of polyphenols include flavones, flavonols, flavanones, isoflavones, anthocyanins, flavanols, ellagitannins, phenylpropanoids, anthocyanidins, proanthocyanidins, chalcones, aurones, phenylethanoids, etc. Is mentioned. More specifically, gallic acid, ellagic acid, hydroxytyrosol, epigallocatechin 3-O-gallate (EGCG), epicatechin-3-O-gallate (ECG), catechin gallate (CG), gallocatechin-3- O-gallate (GCG), epicatechin (EC), catechin (C), epigallocatechin (EGC), gallocatechin (GC), chromanin, delphinidin, delphinidin 3-O-glucoside, procyanidin B2 (PB2), caffeic acid, Examples include chlorogenic acid, rosmarinic acid, caffeic acid phenethyl ester, strictinin, quercetin, isoquercitrin, rutin, myricetin, butein, sulfretin, luteolin, and eriodictyol. These polyphenols are characterized by having multiple phenolic hydroxyl groups in their structure, and have antioxidant activity, blood pressure rise inhibition, blood sugar level rise inhibition, internal fat accumulation inhibition, arteriosclerosis inhibition, anti-inflammatory action, anticancer activity Various functions such as allergy suppression, anti-cariogenic activity, deodorant activity, antibacterial activity, etc. have been studied and reported. In addition to these polyphenols, various functionalities have been studied and reported for plant-derived components.

  A wide variety of polyphenols extracted and purified from plants are used as food materials, and their effects are expected. However, the absorbability of polyphenol itself into the living body is not necessarily good. Even in the result of comparing the absorbability after ingestion of polyphenols to humans, it has been reported that the maximum blood concentration is several μmol / l (for example, see Non-Patent Document 1).

  Plants contain methylated polyphenols having a hydroxyl group modified with a methyl group. For example, epigallocatechin-3-O- (3-O-methyl) gallate (EGCG3) is used for tea varieties such as “Aoshin Daipan”, “Benihomare”, “Benifuuji”, “Benifuuki”, etc. Me) and epigallocatechin-3-O- (4-O-methyl) gallate (EGCG4 "Me). When these methylated catechins were orally administered to mice, the methylated catechin concentration in blood 60 minutes after administration was about 9 times that in the free form compared to epigallocatechin-3-O-gallate (EGCG). High value was shown (for example, refer nonpatent literature 2). In addition, as a result of comparing the EGCG concentration in plasma and the EGCG3 ”Me concentration after allowing a person to drink“ Benifuuki ”tea beverage containing EGCG3” Me, EGCG3 ”Me shows better absorbability and in plasma The disappearance of metabolism was also mild (see, for example, Non-Patent Document 3).

  There have been many reports that methylated polyphenols are superior not only in absorbability but also in functionality compared to polyphenols not modified with methyl groups. For example, for histamine release inhibition test using mouse mast cells, EGCG3 "Me, epigallocatechin-3-O- (3,5-O-dimethyl) gallate, and epi (3-O-methyl) gallocatechin-3 -O- (3,5-O-dimethyl) gallate showed a high antiallergic action as compared with EGCG and showed a tendency that the action became stronger as the methyl group increased (for example, see Patent Document 1). In addition, when the permeability of 7-hydroxyflavone, 7,4′-dihydroxyflavone, chrysin, apigenin, and methylated products thereof to human Caco-2 cells was compared, the methylated product was better. (For example, see Non-Patent Document 4.) Similarly, in the stability test using the human liver cell S9 fraction, the methylated product is better. (For example, see Non-patent Document 4.) Furthermore, the methylated form of chrysin and apigenin has about 10 times the growth inhibitory effect of human SCC cancer cells compared to the unmethylated form. High activity was obtained (for example, refer nonpatent literature 5).

  On the other hand, as a method for methylating a hydroxyl group of a compound, there is a method using a chemical synthesis / modification method. For example, Patent Document 2 or 3 discloses a method for methylating EGCG which is a kind of polyphenol. Further, as a method other than the chemical synthesis method, there is a method for producing a methylated product using an enzymatic method. For example, catechol-O-methyltransferase extracted from the livers of rats, pigs and cattle is commercially available as a reagent product, and methylated products can be produced using these enzymes. In addition, there is also a report of an enzyme conversion method using plant-derived methyltransferase (see, for example, Patent Document 4).

JP 2008-189628 A Japanese Patent Laid-Open No. 61-145177 JP 2002-255810 A JP 2006-141242 A

Manach, 4 others, The American journal of clinical nutrition, 2005, Vol. 81, pages 230S-242S, review. Mitsuaki Sano, 3 others, FRAGRANCE JOURNAL, 2004, pp. 46-52. Yamamoto (Maeda) Mari, 2 outside, Cytotechnology, 2007, Volume 55, pages 135-142. Wen, 1 other, Drug Metabolism and Disposition, 2006, Vol. 34, No. 10, pp. 1786-1792. Walle, 5 others, Biochemical pharmacology, 2007, Vol. 73, No. 9, pp. 1288-1296.

  However, it is currently difficult to use a chemical substance produced by chemical synthesis as a food or drink in terms of cost and safety. In addition, in the method for producing a methylated product using an enzyme, there is a problem that it is difficult to extract and purify the enzyme in large quantities from animals or plants. Furthermore, when considering the development of foods and drinks, it is not preferable to use animal-derived enzymes because of concerns about infectious diseases and the like. On the other hand, a plant-derived methyltransferase can be obtained by culturing plant cells and extracting and purifying the enzyme from the culture. However, when plant cells are cultured, a special culture facility is required. A very long culture period is required. In addition, the enzyme activity obtained is often low, and when considering industrial production, the production cost becomes very expensive.

  The present invention has been made in view of the above problems, and can be used for foods and drinks, can be easily accepted by consumers, and can be mass-produced when considering industrial production. It aims at providing the manufacturing method of the methylated body using an enzyme.

  As a result of diligent research to solve the above-mentioned problems, the present inventors have a dietary experience, can be mass-produced, and are in the cultured mycelium of basidiomycete Enokitake (Flamulina velutipes), which is recognized by consumers. In addition, the present inventors have found that there is a novel methyltransferase enzyme that methylates hydroxyl groups using various compounds having a hydroxyl structure such as various polyphenols as substrates, and completed the present invention by isolating and identifying this novel enzyme I let you.

  That is, the present invention provides (1) a gene comprising a polynucleotide selected from any one of the following (a) to (c): (a) a polynucleotide comprising the nucleotide sequence represented by SEQ ID NO: 1 (B) a polynucleotide that hybridizes with a polynucleotide comprising a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 1 under a stringent condition and encodes a polypeptide having methyltransferase enzyme activity (C) a polynucleotide having a polynucleotide comprising a nucleotide sequence having 64% or more homology with the nucleotide sequence represented by SEQ ID NO: 1 and encoding a polypeptide having methyltransferase enzyme activity (2) ) It encodes a polypeptide selected from any of the following (a) to (c) A gene; (a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2; (b) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2; (C) a polypeptide having a homology of 62% or more with the amino acid sequence represented by SEQ ID NO: 2 and having a methyltransferase enzyme activity, (3) ) A polypeptide selected from any of the following (a) to (c); (a) a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2; (b) an amino acid sequence represented by SEQ ID NO: 2; It consists of an amino acid sequence in which one or several amino acids are deleted, substituted or added, and has methyltransferase enzyme activity. Polypeptide, (c) SEQ ID NO: has the amino acid sequence and 62% or more homology represented by 2, and a polypeptide having methyltransferase enzyme activity,

(4) A recombinant expression vector comprising the gene according to (1) or (2), (5) a transformant comprising the recombinant expression vector according to (4) (6) The transformant according to (5) above, which is a microorganism, (7) The transformant according to (5) above, which is a plant cell, plant tissue, or plant ,

(8) A transformant according to any one of (5) to (7) above is cultured, and a polypeptide having methyltransferase enzyme activity is purified from the obtained culture. (9) A method for methylating a hydroxyl group in a compound using a methyltransferase enzyme, wherein the methyltransferase enzyme cultivates the transformant according to any one of (5) to (7) above. A method for producing a methylated product, which is a polypeptide selected from any of the following (a) to (c ′) purified from the obtained culture; (a) SEQ ID NO: 2 A polypeptide comprising the amino acid sequence represented by (b) wherein one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 A polypeptide having an amino acid sequence and having methyltransferase enzyme activity, (c ′) a basidiomyce having 50% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity A polypeptide derived from a fungus, (10) a method for purifying a methylated product, wherein the methylated product is purified from a transformed plant containing the recombinant expression vector according to (4), (11) the (4) ) A methylated polyphenol-containing composition purified from a transformed plant containing the recombinant expression vector according to (12), (12) using a methyltransferase enzyme extracted from basidiomycetes, (13) the following (a) to (c): A method for producing a methyltransferase enzyme, which comprises extracting and purifying a polypeptide selected from basidiomycetes; (a) a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2, (b A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity; (c ′) SEQ ID NO: 2 (14) a polypeptide having the amino acid sequence represented by SEQ ID NO: 2 having a homology of 50% or more with the amino acid sequence represented by SEQ ID NO: 2, and a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 Methyl transfer, characterized in that it is extracted and purified from The present invention provides a method for producing a ase enzyme.

  The polypeptide encoded by the gene of the present invention is a novel methyltransferase enzyme that can be applied to food and drink and is advantageous for industrial production. By using the gene and polypeptide of the present invention, methylated products of compounds having a hydroxyl structure such as various polyphenols can be efficiently produced.

It is the figure which showed the base sequence of the methyl transferase gene derived from Enokitake, and the corresponding amino acid sequence. It is the result of comparing the amino acid sequence of the amino acid sequence represented by SEQ ID NO: 2, the above-mentioned two types of basidiomycete genes, and the top four genes having high homology as a result of homology search. It is a figure showing the arrangement | sequence estimated to be the consensus arrangement | sequence of O-methyltransferase enzyme from the area | region shown to 1-4 in FIG. 2A. In Example 1, it is a two-dimensional electrophoresis image of the active fraction which has a methyltransferase enzyme activity fractionated from the enokitake mushroom mycelium culture. In Example 2, E. coli lysate before IPTG treatment (lane 1), E. coli lysate after IPTG treatment (lane 2), and purified product obtained from IPTG-treated E. coli lysate using histidine tag (lane 3). ) SDS-PAGE electrophoresis image. In Example 5, it is the figure which showed the EGCG methylated body concentration in the natural type enzyme reaction liquid fractionated after each reaction time. In Example 5, it is the figure which showed the EGCG methylated body density | concentration in the recombinant enzyme reaction liquid fractionated after each reaction time. In Example 6, it is the figure which showed the EGCG methylated body density | concentration in the enzyme reaction liquid of each pH. In Example 7, it is the figure which showed the EGCG methylated body density | concentration in the enzyme reaction liquid of each temperature. In Example 8, it is the figure which showed the composition of the green tea catechin of the thing processed with the natural type enzyme, and a blank.

  In the present invention, the methyltransferase enzyme activity means an enzyme activity that catalyzes a reaction of methylating a hydroxyl group in a substrate using a compound having a hydroxyl group as a substrate. The hydroxyl group to be methylated is not particularly limited, but is preferably a phenolic hydroxyl group. The substrate is not particularly limited as long as it is a compound having a hydroxyl structure, but is preferably a compound having a phenolic hydroxyl group, more preferably a polyphenol.

  The gene of the present invention is a gene derived from a basidiomycete encoding a polypeptide having methyltransferase enzyme activity (hereinafter sometimes referred to as “the enzyme of the present invention”). Basidiomycetes are easier to cultivate (cultivate) than plants, and therefore extract and purify enzymes from basidiomycetes rather than extract and purify enzymes from plants and animal tissues. It can be obtained simply and stably at a low cost. That is, the methyltransferase enzyme encoded by the gene of the present invention is very advantageous for industrial production.

  The gene of the present invention is not particularly limited as long as it is a gene derived from a basidiomycete, and may be a gene derived from a basidiomycete commercially available for edible use, such as Lactaria bicolor or Phanerochaete chrysosporium (hereinafter referred to as “Rhocaria bamboo”). And a gene derived from basidiomycetes such as model mushrooms, sponge mushrooms, yakei rotake and cholera bamboo. The gene of the present invention is preferably a gene derived from basidiomycetes suitable for edible use because it is suitable for the production of methylated compounds of edible compounds. Examples of basidiomycetes suitable for edible use include shiitake mushrooms, shimeji mushrooms, maitake mushrooms, enokitake mushrooms, cypress mushrooms, oyster mushrooms, aratake mushrooms, tamogitake mushrooms, eringgi, abalone mushrooms and the like. The gene of the present invention is particularly preferably a gene derived from Enokitake (Flamulina velutipes).

  The gene of the present invention is preferably a gene comprising a polynucleotide comprising the base sequence represented by SEQ ID NO: 1 (hereinafter sometimes referred to as “enokitake mushroom-derived methyltransferase gene”). The enokitake mushroom-derived methyltransferase gene is a novel gene isolated and identified from enokitake by the present inventors by the method of Example 1 described later. The gene is a gene encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 (hereinafter sometimes referred to as “enokitake mushroom-derived methyltransferase enzyme”), and has the nucleotide sequence represented by SEQ ID NO: 1. The 45th to 734th positions are coding regions. FIG. 1 shows the nucleotide sequence of the enokitake mushroom-derived methyltransferase gene and the corresponding amino acid sequence.

  As a result of performing a homology search on the nucleotide sequence represented by SEQ ID NO: 1 and the amino acid sequence represented by SEQ ID NO: 2 using a publicly available NCBI (National Center for Biotechnology Information) database, The highly homologous gene is the foxtail mushroom-derived gene S238N-H82 (accession number: XM — 001878803), which had a homology of about 63.6% in terms of base sequence and about 61.6% in terms of amino acid sequence.

  Similarly, homology search was performed using a database of model mushrooms, basidiomycetes for which the entire genome sequence was known (http://genome.jgi-psf.org/Phchr1/Phchrl.home.html). As a result, the most homologous gene was the O-methyltransferase gene (Protein ID: 127115), which had a homology of about 63.9% in terms of base sequence and about 56.8% in terms of amino acid sequence.

  FIG. 2A is a result of comparing the amino acid sequence represented by SEQ ID NO: 2, the genes of the above-mentioned two types of basidiomycetes, and the top four genes having high homology as a result of homology search. In FIG. 2A, “F. velutepes” represents the amino acid sequence represented by SEQ ID NO: 2. In addition, “L. bicolor S238N-H82” is a foxtail bamboo-derived gene S238N-H82, “P. chrysosporium” is a model mushroom-derived O-methyltransferase gene, and “B. indicica subsp.” Is Beijerindicia subsp. O-methyltransferase family protein gene (accession number: YP — 001832797), “B. ambifaria AMMD” is the Burkholderia ambifaria AMMD-derived O-methyltransferase family protein gene (accession number: YP — 777310), “B. MSMB43-derived O-methyltransferase family protein gene (accession number: ZP — 0246606609), and “E. sakazakii” is Enterobacter sakazakii ATCC BAA-894-derived gene (accession number: YP — 001437785) Represents the deduced amino acid sequence.

  The present inventors have found from the alignment that the regions shown in 1 to 4 in FIG. 2A are regions that are highly conserved among all seven types of genes. In the amino acid sequence represented by SEQ ID NO: 2, region 1 is the 70th to 88th region, region 2 is the 139th to 148th region, region 3 is the 171st to 175th region, region Reference numeral 4 denotes the 215th to 223rd areas. Furthermore, the present inventors deduced a consensus sequence of the O-methyltransferase enzyme from the amino acid sequences of these four regions. FIG. 2B shows the sequence estimated to be a consensus sequence of the O-methyltransferase enzyme from the region indicated by 1 to 4 in FIG. 2A. In FIG. 2B, “x” means any amino acid residue, and “(/)” means any amino acid residue in parentheses.

  Furthermore, as a result of homology search with a plant-derived methyltransferase enzyme using the NCBI database for the amino acid sequence represented by SEQ ID NO: 2, the gene derived from soybean (Zea mays) (accession number: AY279004) The homology was 53.9% for the nucleotide sequence and 30.4% for the amino acid sequence. Similarly, genes derived from rice (Olyza sativa) (accession number: AY279004), 50.7% (base sequence) and 30.0% (amino acid sequence), genes derived from Arabidopsis thaliana (accession number: MN — 116065) The homology was about 52.3% (base sequence) and 30.8% (amino acid sequence). Further, as a result of comparing EGCG isolated from tea described in Patent Document 4 with a methyltransferase enzyme capable of being methylated, the homology was about 53.9% in the base sequence and about 30.4% in the amino acid sequence. It was.

  It is a well-known fact that even when the gene of the present invention is partially modified with a small number of bases, the methyltransferase enzyme activity of the gene can be maintained. Such modification can be performed using a known technique such as a partial-specific mutagenesis method. Therefore, as long as the gene of the present invention encodes a gene having methyltransferase enzyme activity, a gene comprising a base sequence in which one or more bases of the base sequence represented by SEQ ID NO: 1 are substituted, deleted, or added. It may consist of nucleotides. For example, methyltransferase enzyme activity is impaired by artificially inserting, deleting or substituting one or more bases into the base sequence represented by SEQ ID NO: 1 by using a known gene recombination technique. It is possible to make a mutant gene that has not been improved, or a mutant gene with improved enzyme activity.

  Specifically, the gene of the present invention hybridizes with a polynucleotide comprising a nucleotide sequence complementary to the nucleotide sequence represented by SEQ ID NO: 1 under stringent conditions and has a methyltransferase enzyme activity. It may be a gene consisting of a polynucleotide encoding a peptide.

  In the present invention and the present specification, “stringent conditions” include, for example, the method described in Molecular Cloning (Sambrook et al., Cold Spring Harbor Laboratory Press). For example, hybridization can be performed by incubating at 40 to 65 ° C. for several hours to overnight in a hybridization buffer composed of 2 × SSC, 10% by weight dextran sulfate, and 50% formamide. The washing buffer used for washing after incubation is preferably a 1 × SSC solution containing 0.1 wt% SDS, more preferably a 0.1 × SSC solution containing 0.1 wt% SDS. The 20 × SSC solution is 3M sodium chloride and 0.3M citric acid solution (pH 7.0).

  The gene of the present invention may be a gene encoding a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2. For example, it may be a gene in which bases other than the coding region of the base sequence represented by SEQ ID NO: 1 have been deleted, substituted, added, etc., in the coding region of the base sequence represented by SEQ ID NO: 1. It may be a gene in which one or several bases are replaced (a gene having a silent mutation).

  Furthermore, the gene of the present invention includes a polypeptide having an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity It may be a gene encoding. This is because even such a gene functions in the same manner as the enokitake mushroom-derived methyltransferase gene.

  The gene of the present invention may be a homologous gene of enokitake mushroom-derived methyltransferase gene in other basidiomycetes. Such a homologous gene is obtained by using a known gene analysis method such as Molecular Cloning (Sambrook et al., Cold Spring Harbor Laboratory) using information such as the nucleotide sequence represented by SEQ ID NO: 1 and the amino acid sequence represented by SEQ ID NO: 2. Press) can be used. Specifically, for example, total RNA is extracted from basidiomycetes having methyltransferase enzyme activity, and the target homologous gene or a fragment thereof is obtained by RT-PCR using a degenerate primer or the like. By cloning the obtained gene fragment into a vector capable of determining a base sequence such as a pUC vector or a pGEM vector, determining the base sequence, and performing a RACE-PCR method or the like based on the determined sequence, The full length of the homolog gene can be obtained. At this time, for example, by designing a degenerate primer for the consensus sequence shown in FIG. 2B and using it, a homologous gene fragment can be obtained more efficiently. In addition, the homologous gene of an enokitake mushroom-derived methyltransferase gene can be obtained from organisms other than basidiomycetes, such as microorganisms and plants, by the same technique.

  Specifically, such a homologous gene has a homology of 40% or more, preferably 50% or more, more preferably 55% or more, and further preferably 62% or more with the amino acid sequence represented by SEQ ID NO: 2. And a gene encoding a polypeptide having methyltransferase enzyme activity.

  Such a homologous gene has, for example, a polynucleotide comprising a nucleotide sequence having a homology of 64% or more, preferably 70% or more, more preferably 80% or more with the nucleotide sequence represented by SEQ ID NO: 1. And a gene comprising a polynucleotide encoding a polypeptide having methyltransferase enzyme activity.

  When searching for homology between a base sequence and an amino acid sequence, in general, a method that first searches for a core portion of homology without considering GAP and performs alignment processing from there (Homology Search), There is a method (Maximum Matching) in which the base (amino acid residue) pairs that match between the base (amino acid) sequences are maximized while considering the deletion. The value of “homology” in the present invention and the specification of the present application indicates a value obtained by analysis using Maximum Matching. In addition, the homology search by Maximum Matching can be performed using general analysis software such as GENETYX Version 6.1.0 (manufactured by GENETYX).

  The enzyme of the present invention can be obtained by extracting from an organism containing the gene of the present invention and purifying it. A purification method from a living organism is not particularly limited, and can be appropriately selected from publicly known known purification methods. Moreover, what is necessary is just to refine | purify until the state which methyltransferase enzyme activity is exhibited, and a refinement | purification degree is not specifically limited, Crude purification may be sufficient.

  Specifically, basidiomycetous fruit bodies or mycelia containing the gene of the present invention are crushed by sonication or the like in an appropriate buffer solution, and the recovered supernatant is used as a crude enzyme of the enzyme of the present invention. It can be. In addition, the supernatant of the basidiomycete fruit body or mycelium may be collected after homogenizing in an appropriate buffer. As the buffer solution for obtaining the crude enzyme, for example, a Tris buffer solution or a phosphate buffer solution having a pH of 6.5 to 8.5 can be used.

  Further, the basidiomycetes from which the enzyme is extracted may be those immediately after collection, may be commercially available, or may be a culture. The mycelium of basidiomycetes can be cultured by a conventional method.

  The crude enzyme thus obtained can be used for the enzymatic reaction as it is. Furthermore, a purified product can be obtained from the crude enzyme by combining centrifugation, ultrafiltration membrane, salting out, and various types of chromatography.

  A methylated product can be produced by reacting the purified enzyme of the present invention with a compound to be methylated at the hydroxyl group as a substrate and contacting with the compound. The substrate is not particularly limited as long as it is a compound having a hydroxyl structure, but is preferably a compound having a phenolic hydroxyl group. Among the compounds having a phenolic hydroxyl group, the enzyme substrate of the present invention is preferably polyphenol. Examples of the polyphenol as the substrate include flavones, flavonols, flavanones, isoflavones, anthocyanins, flavanols, ellagitannins, phenylpropanoids, anthocyanidins, proanthocyanidins, chalcones, aurones, phenyletanes. Examples include noids. More specifically, gallic acid, ellagic acid, hydroxytyrosol, epigallocatechin 3-O-gallate (EGCG), epicatechin-3-O-gallate (ECG), catechin gallate (CG), gallocatechin-3- O-gallate (GCG), epicatechin (EC), catechin (C), epigallocatechin (EGC), gallocatechin (GC), chromanin, delphinidin, delphinidin 3-O-glucoside, procyanidin B2 (PB2), caffeic acid, Examples include chlorogenic acid, rosmarinic acid, caffeic acid phenethyl ester, strictinin, quercetin, isoquercitrin, rutin, myricetin, butein, sulfretin, luteolin, and eriodictyol.

  Specifically, the purified enzyme of the present invention is suspended in a buffer solution of pH 5 to 10, preferably pH 6 to 9, more preferably pH 6.5 to 8.5, and further a compound serving as a substrate and a methyl group. A methylated product can be obtained in the enzyme reaction solution by adding a donor and reacting at 0 to 60 ° C., preferably 10 to 50 ° C., more preferably 30 to 42 ° C. In addition, as a donor of a methyl group, it can select and use suitably from the substances generally used in the case of methylation of a hydroxyl group, such as S-adenosyl-L-methionine (SAM).

  The methylated product obtained by the enzyme reaction can be extracted from the enzyme reaction solution by using a solvent or the like that can extract the methylated compound. In addition, you may use an enzyme reaction liquid for extraction, after concentrating. In addition, the methylated product can also be obtained by subjecting the enzyme reaction solution to a column packed with a synthetic adsorbent, adsorbing the methylated product to the synthetic adsorbent, further washing, and elution using an appropriate solvent. It is possible to obtain The obtained methylated product can be further purified using HPLC (High Performance Liquid Chromatography).

  In particular, when the enzyme of the present invention is a methyltransferase enzyme recovered from an edible basidiomycete such as enokitake, the enzyme is highly safe, so that it can be used to produce a methylated product of a compound used for food. Very suitable. In addition, as mentioned above, basidiomycetes can be easily cultivated (cultivated) easily, so that the enzyme of the present invention recovered from edible basidiomycetes such as enokitake is sufficient for foods and drinks, pharmaceuticals, cosmetics and the like. Suitable for industrial production of products that require safety.

  The enzyme of the present invention may be produced using a gene recombination technique. Specifically, the gene of the present invention is incorporated into an expression vector, a recombinant expression vector is prepared, the recombinant expression vector is introduced into an organism (host) that expresses the enzyme of the present invention, and the recombinant expression is performed. A transformant containing the vector is produced.

  The host into which the recombinant expression vector is introduced is not particularly limited, and may be any microorganism, plant cell, plant tissue, plant body, insect-derived or mammalian-derived cultured cell, and the like. Examples of the microorganism include Escherichia coli, yeast (Saccharomyces cerevisiae, Pichia pastoris), Bacillus subtilis (Bacillus genus), lactic acid bacteria (Streptococcus genus, Lactobacillus genus), and molds. Moreover, as a plant tissue, the tissue itself extract | collected from the plant body may be sufficient, and the callus obtained by giving a dedifferentiation process etc. may be sufficient. In addition, the cultured cells may be cultured cell lines established from mammals or insect-derived cultured cells such as SF9 cells.

  The expression vector into which the gene of the present invention is incorporated is not particularly limited as long as it can be incorporated so that the enzyme of the present invention encoded by the gene of the present invention can be expressed in the host organism into which the vector is introduced. However, it can be appropriately selected from known expression vectors that can be introduced into the host species. For example, as an expression vector to be introduced into a microorganism such as Escherichia coli, a pET vector, a pQE vector, or the like can be used. As an expression vector to be introduced into yeast, pYE vectors, pYCP vectors and the like can be used. As a vector to be introduced into the lactic acid bacterium, a commercially available vector corresponding to the lactic acid bacterium host can be used. In addition, as an expression vector to be introduced into a plant cell, plant tissue, or plant body, a binary vector widely used in the Agrobacterium method may be used. In addition, as an expression vector to be introduced into cultured cells, an expression vector that is commercially available as a eukaryotic cell expression vector can be used. A commercially available expression vector used for an expression system such as an adenovirus expression system, a retrovirus expression system, or a baculovirus expression system may be used. Recombinant expression vectors in which the gene of the present invention is incorporated into these expression vectors can be prepared by conventional methods.

  The produced recombinant expression vector can be introduced into the host using various known methods depending on the host species. For example, when a microorganism such as Escherichia coli is a host, a transformant can be obtained by introducing a recombinant expression vector using an electroporation method, a heat shock method, a calcium phosphate method, or the like. When yeast is the host, a lithium method, an electroporation method, or the like can be used. When the host is a lactic acid bacterium, an electroporation method, a conjugation method, or the like can be used. In the case of plant cells and the like, an Agrobacterium method, a particle gun method, an electroporation method, or the like can be used. In the case of cultured cells, a transformant can be obtained using a lipofection method or various virus infections.

  By culturing the transformant thus obtained under the optimum conditions for each organism, the enzyme of the present invention can be produced in the transformant. The culture method of the organism for producing the enzyme of the present invention may be liquid culture, solid culture or breeding as long as it is a culture condition and culture method suitable for the organism. For example, if the expression vector introduced into the transformant is of the type induced by isopropyl-β-thiogalactopyranoside (IPTG), the target enzyme protein can be obtained by adding IPTG to the medium during culture. Can be generated.

  The enzyme of the present invention can be obtained by extracting from a culture of a transformant and purifying it. The purification method from the organism is not particularly limited, and extraction and purification can be performed in the same manner as from the fruiting body or mycelium of the basidiomycetes containing the gene of the present invention.

  For example, when producing a transformant, when a microorganism of the type that releases the enzyme of the present invention to the outside of the cell is used as a host, after culturing the obtained transformant, the cell from the culture solution Can be obtained by centrifugation or the like to obtain the target crude enzyme. On the other hand, when the microorganism of the type that produces the enzyme of the present invention in the microbial cell is used as the host, the target crude enzyme is obtained by crushing the microbial cell by treating the microbial cell with ultrasonic waves or a lytic enzyme. Can do. The obtained crude enzyme can be used for the methylation reaction as it is, but it can be further purified as necessary, such as molecular weight fractionation.

  In addition, when the enzyme of the present invention is expressed in a host with a tag generally used for purification of the expressed protein, such as a histidine tag or a Myc tag, using these tags, The enzyme of the present invention can be easily purified.

In addition, the purified enzyme can be used for the production of a methylated product of the compound in the same manner as the enzyme purified from the fruiting body or mycelium of the basidiomycete containing the gene of the present invention.
Specifically, when E. coli is used as a host and expressed with a histidine tag, the enzyme of the present invention purified using the histidine tag from the culture of the transformant has a pH of 5 to 12, preferably Is suspended in a buffer solution of pH 6-9, and a compound serving as a substrate and a donor of a methyl group such as SAM are added and reacted at 0-80 ° C., preferably 0-60 ° C. A methylated product can be obtained in the liquid.

  It was obtained when the organism into which the compound having a hydroxyl group that is a substrate of the enzyme of the present invention is relatively abundant was used as a host into which the recombinant expression vector containing the gene of the present invention was introduced. After culturing the transformant, the methylated product can be directly extracted from the transformant and purified. For example, when a plant having a high polyphenol content, such as tea, is used as a host, polyphenol is extracted from the obtained transformed plant and purified. More methylated polyphenols are contained than polyphenol compositions recovered from converted plants.

  The method for extracting and purifying methylated products from transformants can also be generally performed by the method used for extracting and purifying non-methylated products from host species. For example, a lot of methylated polyphenols are contained by using a method of extracting polyphenols from tea from a transformed plant obtained by introducing a recombinant expression vector containing the gene of the present invention into tea. A methylated polyphenol-containing composition can be produced.

  The methylated product produced by using the enzyme of the present invention can be used in various foods and drinks, pharmaceuticals, quasi drugs and cosmetics. Foods and beverages to which the methylated product is added as a raw material include soft drinks, carbonated drinks, nutritional drinks, fruit drinks, lactic acid drinks and other drinks (including concentrated concentrates and powders for adjustment of these drinks); ice cream, ice cream Frozen desserts such as sherbet and shaved ice; noodles such as buckwheat, udon, harameme, gyoza skin, shumai skin, Chinese noodles, instant noodles; rice cakes, candy, gum, chocolate, tablets, snacks, biscuits, jelly, jam, cream Sweets such as baked confectionery; processed acids such as kamaboko, chikuwa, ham and sausage; processed foods such as processed milk and fermented milk; processed fats and oils such as margarine, mayonnaise, shortening, whipped cream and dressing; Seasonings such as sauces and sauces; soups, stews, salads, prepared dishes, pickles; other various forms of health food, nutrition Assistant food, mention may be made of the specific health foods and the like.

Examples of dosage forms of pharmaceuticals and quasi drugs to which the methylated product is added as a raw material include tablets, liquids, capsules, drinks, and troches.
Cosmetics include basic cosmetics such as face-wash creams, lotions, packs, and serums; makeup cosmetics such as foundations, lipsticks, and eye colors; nail enamels, soaps, bathing agents, sunscreen agents, deodorant sprays, etc. Body cosmetics; hair cosmetics such as shampoos, rinses, hair treatments, hair mousses; hair cosmetics such as hair restorers, hair nourishing agents, hair tonics; and fragrance cosmetics such as perfumes and eau de cologne.

  In producing these, the methylated product can be added together with commonly used auxiliary raw materials and additives. Examples of such raw materials and additives include glucose, fructose, sucrose, maltose, sorbitol, stevioside, rubusoside, corn syrup, lactose, L-ascorbic acid, dl-α-tocopherol, sodium erythorbate, glycerin, propylene Glycol, glycerin fatty acid ester, sucrose fatty acid ester, sorbitan fatty acid ester, gum arabic, carrageenan, casein, gelatin, pectin, agar, vitamin C, vitamin B group, vitamin E, nicotinamide, calcium pantothenate, amino acids, calcium Salts, surfactants, pigments, fragrances, preservatives and the like can be mentioned.

  EXAMPLES Next, although an Example is shown and this invention is demonstrated further in detail, this invention is not limited to a following example.

[Example 1]
We isolated and identified the methyltransferase gene from Enokitake.
<Screening of methyltransferase enzyme activity>
Japanese shiitake, shimeji, maitake, enokitake, beech shimeji, oyster mushroom, oyster mushroom, tamogitake, eringi, and abalone are commercially available for edible use.
First, the stem parts of these fruit bodies were cut, immersed in 0.5% hypochlorous acid, and then washed with sterilized water. About 5 mm was cut out from the inside of the handle and cultured on a Difco Potato Dextrose Ager medium at 25 ° C. to isolate the mycelium. The obtained mycelium was added to a liquid medium for mycelium culture (0.02% glucose, 0.01% peptone, 0.002% Yeast Extract, 0.002% KH ₂ PO ₄ , 0.001% MgSO ₄ .7H ₂ O) and swirl culture at 28 ° C.
The obtained mycelium culture solution is filtered to collect mycelia, and after adding a crude enzyme solution (20 mM Tris-HCl (pH 7.5), 1 mM DTT, 1 mM EDTA, 10% glycerol) and ultrasonically crushing it. The supernatant was collected by centrifugation. This supernatant was used as a crude enzyme solution for enzyme activity measurement.
In the enzyme activity measurement, EGCG was used as a substrate, and the amount of methylated product produced was used as an index. The composition of the enzyme reaction solution was 20 mM Tris-HCl (pH 7.5), 2.5 mM MgCl ₂ , 0.25 mM EGCG, 0.5 mM SAM, and 50% crude enzyme solution, and a total volume of 3 ml was reacted at 37 ° C. for 16 hours. I let you.
After the reaction, 70 μl of 1N HCl and 5 ml of ethyl acetate were added to 3 ml of the enzyme reaction solution, and the mixture was stirred and centrifuged to recover the organic layer. The organic layer was dried with nitrogen, dissolved in 30% aqueous methanol containing 1% ascorbic acid, and measured using HPLC. The HPLC conditions are shown below.
Column: Wakopak Navi C18-5 (4.6 × 150 mm) and C18-5 (4.6 × 10 mm) (manufactured by Wako Pure Chemical Industries, Ltd.)
Mobile phase A: a solution in which distilled water, acetonitrile, and phosphoric acid are mixed at 400: 10: 1 (v / v) Mobile phase B: a solution in which mobile phase A and methanol are mixed at 2: 1 (v / v) Gradient conditions : 20% solution B (2 minutes) → 80% solution B (25 minutes) → 80% solution B (10 minutes), linear concentration gradient Flow rate: 1 ml / min
Detection: UV280nm

As a result, when the crude enzyme extracted from the enokitake mushroom mycelium was used, epigallocatechin-3-O- (3-O-methyl) gallate, epigallocatechin-3-O- (4-O-methyl) Galate, epigallocatechin-3-O- (3,4-O-dimethyl) gallate, epigallocatechin-3-O- (3,5-O-dimethyl) gallate, epi (4-O-methyl) gallocatechin- Formation of 3-O- (3,5-O-dimethyl) gallate was confirmed. In addition, epigallocatechin-3-O- (3,4-O-dimethyl) gallate, epigallocatechin-3-O- (3,5-O-dimethyl) gallate, epi (4-O-methyl) gallocatechin- Regarding 3-O- (3,5-O-dimethyl) gallate, the peaks were collected and the structure was confirmed using TOF-MS and NMR. In addition, when the crude enzyme solution was boiled and then added to the enzyme reaction solution, or when EGCG or SAM was not added to the enzyme reaction solution, formation of these methylated products was not observed.
From the above results, it was confirmed that the crude enzyme extracted from the enokitake mushroom culture mycelium has methyltransferase enzyme activity.

<Confirmation of various enokitake enzyme activities>
The presence or absence of methyltransferase enzyme activity due to differences in the location of Enokitake was collected. As the mycelium of enokitake mushroom, one purchased from Agricultural Biological Resources Genebank was used and cultured at 25 ° C. on Difco Potato Dextrose Ager medium. The mycelial liquid culture and enzyme activity measurement were performed in the same manner as in the above <Screening of methyltransferase enzyme activity>. MAFF numbers 430204, 430205, 430206, 430207, 430209, 435210, 430212, 430214, 430224, 4308585, 430211, 430213, 435121, 440110, 440111, and 440118 were used for the test. As a result, the enzyme activity of methyltransferase was confirmed in all mycelia although each mycelium had strong and weak enzyme activity.

<Identification of Enokitake Methyltransferase>
The enokitake mycelium was liquid-cultured in the same manner as described above, and the mycelium culture solution obtained was filtered to recover the mycelium and freeze-dried. About 12 g of the lyophilized product was crushed in a mortar and then suspended in 600 ml of a crude enzyme solution. The suspension was sonicated, centrifuged (10,000 rpm × 10 min, 4 ° C.), and the collected supernatant was centrifuged again (30,000 rpm × 30 min, 4 ° C.) to recover the supernatant. . To this supernatant, ammonium sulfate was added so as to be 60% saturated, stirred and centrifuged, and the supernatant was collected. Furthermore, ammonium sulfate was added to the collected supernatant so as to be 80% saturation, and the mixture was stirred and centrifuged to obtain a precipitate. The obtained precipitate was dissolved in 40 ml of a crude enzyme solution, and then desalted using PD-10 (manufactured by GE Healthcare Bioscience). The desalted sample was adsorbed on an anion exchange column (HiPrep 16/10 DEAE FF, manufactured by GE Healthcare Bioscience) equilibrated with Tris buffer (20 mM Tris-HCl (pH 7.5), 1 mM DTT). The fraction in which methyltransferase enzyme activity was confirmed was eluted using a linear concentration gradient of 0-500 mM NaCl solution adjusted with the above Tris buffer, and fractionated as an active fraction. The methyltransferase enzyme activity was confirmed in the same manner as in <Screening of methyltransferase enzyme activity>.
The obtained active fraction was desalted and concentrated with an ultrafiltration column, and then an anion exchange column equilibrated with the above Tris buffer (HiLoad 26/10 Q-sepharose HP, manufactured by GE Healthcare Biosciences) The active fraction was fractionated by elution using a linear concentration gradient of 0-500 mM NaCl solution adjusted with the above Tris buffer. The obtained active fraction was desalted and concentrated with an ultrafiltration column, adsorbed again on the same anion exchange column, and the active fraction was fractionated with the preparative fraction more detailed than the previous conditions. The solution was desalted and concentrated using an ultrafiltration column.

The concentrated fraction obtained was equilibrated with Tris buffer (20 mM Tris-HCl (pH 7.5), 1 mM DTT, 150 mM NaCl) containing 150 mM NaCl, and a gel filtration column (HiLoad 16/60 Superdex 200 prep grade, GE). Fractionation was performed using Healthcare Bioscience. When each fractionated fraction was subjected to SDS-PAGE electrophoresis and the obtained protein-stained image was compared with the methyltransferase enzyme activity of each fraction, a band correlated with the enzyme activity was located at a position of about 24 to 25 kDa. Was confirmed. The fraction in which the enzyme activity was confirmed was further adsorbed to an anion exchange column (TSK-GEL BIASSIST Q, manufactured by Tosoh Corporation) equilibrated with the above-described Tris buffer, and 0 to 500 mM NaCl adjusted with the above-described Tris buffer. The active fraction was fractionated by elution using a linear concentration gradient of the solution. As a result of subjecting the active fraction to SDS-PAGE electrophoresis again, a specific band was confirmed again at a position of about 24 to 25 kDa. In order to clarify the internal sequence of this enzyme protein, the sample purified by the above anion exchange column (HiLoad 26/10 Q-sepharose HP, manufactured by GE Healthcare Bioscience) was subjected to SDS-PAGE electrophoresis, and the band was gelled. Recovered from.
The recovered band was subjected to in-gel trypsin digestion according to a conventional method, and the internal sequence of the protein was analyzed using LC / MS / MS. Furthermore, the same active fraction was electrophoresed by two-dimensional electrophoresis (first dimension: isoelectric focusing at pH 3-10, second dimension: polyacrylamide gel with a 4-20% gradient), molecular weight of about 24-25 kDa, A spot near pH 5 was recovered from the gel. FIG. 3 is a two-dimensional electrophoresis image. In the figure, the circled spot was collected as the target enzyme protein.
The collected spot was digested with trypsin in gel according to a conventional method, and the internal sequence of the protein present in the spot was confirmed using LC / MS / MS. As a result, internal sequences RVLEVGTLGGYSTTTWARA (SEQ ID NO: 3) and TGGIIIVDNVVR (SEQ ID NO: 4) were obtained. As a result of homology search using NCBI database based on this amino acid sequence, it showed high homology with the internal sequence of known O-methyltransferase.

<Isolation and Identification of Enokitake Methyltransferase Gene>
A degenerate primer was designed based on the sequence information of the internal sequence, and a methyltransferase gene derived from Enokitake was isolated and identified from total-RNA recovered from Enokitake.
Specifically, first, total RNA was recovered from about 1 g of enokitake mushroom mycelium crushed under liquid nitrogen using a mortar using TRI Reagent (manufactured by Sigma). From about 4 μg of the obtained total-RNA, cDNA was synthesized by reacting at 55 ° C. for 50 minutes using a thermoscript RT-PCR system (manufactured by Invitrogen). Using this cDNA as a template, PCR was performed using degenerate primers (FVOMT-F and FVOMT-R) designed based on the sequence information of the internal sequence, and the Enokitake mushroom-derived methyltransferase gene was isolated. The nucleotide sequence of the designed degenerate primer and the PCR conditions are described below. In the nucleotide sequence, S is guanine or cytosine, M is adenine or cytosine, Y is thymine or cytosine, D is adenine, guanine, or thymine, K is guanine or thymine, V is adenine, guanine, Or cytosine, and R represents guanine or adenine, respectively. FVOMT-F: GAGGTSGGMACYYTDGGMGGGSTAFVOMT-R: GCKSACVACRTTRTCMAC PCR conditions: 94 ° C., 5 min → (94 ° C., 1 min → 55 ° C., 1 min → 72 ° C., 1 min) × 40 cycles → 72 ° C., 7 min

  As a result of subjecting the PCR product to agarose gel electrophoresis, an amplification band of about 400 bp was confirmed. The band was cut out from the agarose gel, and the PCR product was collected using QIAquick Gel Extraction Kit (Qiagen) and cloned into the pGEM-T vector (Promega), and then Escherichia coli JM-109 (Takara). Transformed into The obtained transformant was cultured with shaking in LB medium at 37 ° C. overnight, and a plasmid was extracted from the obtained culture using QIAprep Spin Miniprep Kit (manufactured by Qiagen). The base sequence of the extracted plasmid insert was confirmed by Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and ABI PRISM 3100-AVANT Genetic Analyzer (Applied Biosystems).

  Based on the confirmed partial base sequence of the gene, specific primers (FVOMT-5′GSP1, FVOMT-5′GSP2, FVOMT-3′GSP1, FVOMT-3′GSP2) are designed, and 5 ′ and 3 The RACE-PCR method was performed to obtain the full length on the 'side. The nucleotide sequence of the designed specific primer is shown below. FVOMT-5'GSP1: AGCCCTCTTAGCCCTCAACAAAGTAFVOMT-5'GSP2: TCTTCGGATCTCGAAGGTGATFVOMT-3'GSP1: ATCACTTCTGAGCTCGAAGAFVOMT-3'GSP2: TACTTTGTTGAGGCTATAGAGCT

In 5′RACE-PCR, first, 2.5 μg of isolated total-RNA was reacted at 55 ° C. for 50 minutes using FVOMT-5′GSP1 primer and using Thermoscript RT-PCR system (manufactured by Invitrogen). CDNA was synthesized. Subsequently, from the obtained cDNA, 5′RACE System for Rapid Amplification of cDNA Ends, Version 2.0 (manufactured by Invitrogen) was used, and the FVOMT-5′GSP1 primer and the FVOMT-5′GSP2 primer were used on the 5 ′ side. Was isolated and the base sequence was confirmed.
Similarly, 3′RACE-PCR is performed by synthesizing cDNA using a thermoscript RT-PCR system (manufactured by Invitrogen), and 3′RACE System for Rapid Amplification of cDNA Ends, Version 2.0 (manufactured by Invitrogen). Using the obtained cDNA, 3′-side isolation was performed using the FVOMT-3′GSP1 primer and the FVOMT-3′GSP2 primer, and the nucleotide sequence was confirmed.
Based on the confirmed 5′-end and 3′-end base sequences, the following FVOMT-5′NdeI primer and FVOMT-3′BamHI primer were designed and RT-PCR was performed. The obtained PCR product was subjected to agarose gel electrophoresis, and the amplified band was recovered. The collected PCR product was cloned into the pGEM-T vector and transformed into Escherichia coli JM109 strain, and then the base sequence of the insert was confirmed. As a result, the entire gene of Enokitake mushroom methyltransferase enzyme was isolated. The base sequence of the identified enokitake mushroom-derived methyltransferase gene is the base sequence represented by SEQ ID NO: 1 and encodes a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2. FVOMT-5′NdeI: TACATATGTCCAACCCCGACAAGCATACTFVOMT-3′BamHI: TAGGATCCAAGTTTGATAGGCGTACAAGAATCC

[Example 2] <Production of recombinant enokitake-derived methyltransferase enzyme>
A recombinant expression vector incorporating the enokitake mushroom-derived methyltransferase gene isolated in Example 1 was prepared, this recombinant expression vector was introduced into E. coli, and the enokitake mushroom-derived methyltransferase enzyme expressed in E. coli was recovered. .
Specifically, first, the enokitake mushroom-derived methyltransferase gene-containing pGEM-T vector prepared in Example 1 was cleaved with restriction enzymes NdeI and BamHI, and the insert was recovered by agarose electrophoresis. A recombinant expression vector was prepared by cloning this insert into the NdeI and BamHI sites of the pET28a (+) vector (Novagen). This recombinant expression vector was introduced into Escherichia coli BL21 (DE3) strain (Stratagene) to obtain a transformant containing the recombinant expression vector.
The obtained transformant was cultured with shaking in an LB medium at 37 ° C. overnight, and a part thereof was added again to a new LB medium and cultured. O. D. After culturing so that 600 = 0.6, IPTG was added to a final concentration of 1 mM, and further cultured with shaking at 28 ° C. to induce expression of histidine-tagged enzyme protein. The expression-induced E. coli was centrifuged, and the precipitate was suspended in the above Tris buffer. This E. coli suspension was sonicated and centrifuged again. The obtained supernatant (lysate) was electrophoresed with 12% SDS-PAGE. As a result, compared to the case where E. coli before IPTG induction was treated in the same manner and electrophoresed, about 29 kDa was obtained by IPTG treatment. Protein bands in which expression was induced were confirmed.
FIG. 4 shows lysate of E. coli before IPTG treatment (lane 1), lysate of E. coli after IPTG treatment (lane 2), and purified product obtained from lysate of E. coli after IPTG treatment using histidine tag (lane 3). It is an SDS-PAGE electrophoresis image of. In the figure, “M” is a lane in which a molecular weight marker is passed. The band (about 29 kDa) at the position of the arrow in the figure was subjected to image analysis, and the amount of protein was quantified and compared. For the image analysis, Photoshop (manufactured by Adobe Systems) and Scion Image (manufactured by Scion Corporation) software were used. As a result, the amount of the protein of about 29 kDa is 8.4% after IPTG treatment and 25.1% in the purified product after treatment when IPTG treatment is 0%. The protein was confirmed to have a histidine tag whose expression was induced.
When cloned into the NdeI and BamHI sites of the pET28a (+) vector, a vector-derived expressed protein (including a histidine tag) of about 5 kDa is added. The theoretical molecular weight of the enzyme protein calculated from the amino acid sequence of SEQ ID NO: 2 is 24.7 kDa. That is, it was found that the protein of about 29 kDa indicated by the arrow in FIG. 4 matches the estimated molecular weight obtained from the amino acid sequence introduced by the recombinant expression vector, and is a histidine-tagged enokitake mushroom-derived methyltransferase enzyme.

[Example 3] <Enzyme activity of a recombinant enokitake mushroom-derived methyltransferase enzyme>
The IPTG-treated Escherichia coli lysate obtained in Example 2 was used as a crude enzyme solution of the enokitake mushroom-derived methyltransferase enzyme, and the methyltransferase enzyme activity of this crude enzyme solution was examined.
Specifically, 3 ml of an enzyme reaction solution was prepared so as to be 20 mM Tris-HCl (pH 7.5), 2.5 mM MgCl ₂ , 0.25 mM EGCG, 0.5 mM SAM, and 50% crude enzyme solution, This enzyme reaction solution was incubated at 37 ° C. for 16 hours to be reacted. The enzyme reaction solution after the reaction was treated and analyzed in the same manner as in <Screening of methyltransferase enzyme activity> in Example 1, and as a result, epigallocatechin-3-O- (3-O-methyl) gallate, epigallocatechin -3-O- (4-O-methyl) gallate, epigallocatechin-3-O- (3,4-O-dimethyl) gallate, epigallocatechin-3-O- (3,5-O-dimethyl) Formation of gallate and epi (4-O-methyl) gallocatechin-3-O- (3,5-O-dimethyl) gallate could be confirmed.
From these results, it was confirmed that the recombinant enzyme expressed in Escherichia coli in Example 2 had methyltransferase enzyme activity.

[Example 4] <Production of methylated product using crude enzyme solution extracted from mycelium>
Extracted from the mycelium of the enokitake mycelium culture solution in the same manner as in Example 1, and the 60% to 80% ammonium sulfate fraction of the resulting extract was desalted, and the natural form of enokitake mushroom-derived methyltransferase enzyme A crude enzyme solution of the enzyme was used.
Specifically, first, the enokitake mycelium culture solution was filtered to recover the mycelium and lyophilized. The obtained lyophilized product was crushed in a mortar, suspended in the crude enzyme solution, sonicated, and centrifuged to collect the supernatant. To this supernatant, ammonium sulfate was added so as to be 60% saturated, stirred and centrifuged, and the supernatant was collected. Furthermore, ammonium sulfate was added to the collected supernatant so as to be 80% saturation, and the mixture was stirred and centrifuged to obtain a precipitate. The obtained precipitate was dissolved in a crude enzyme solution, and then desalted using PD-10 (manufactured by GE Healthcare Bioscience). This desalted sample was used as a crude enzyme solution of a natural enzyme of enokitake mushroom-derived methyltransferase enzyme.
The methyltransferase activity for various substrates of the obtained crude enzyme solution was confirmed. The composition of the enzyme reaction solution was 20 mM Tris-HCl (pH 7.5), 2.5 mM MgCl ₂ , 0.05 mM substrate, 0.5 mM SAM, 0.04% ascorbic acid, and crude enzyme solution (for a total volume of 3 ml). 0.25 ml), and a total of 3 ml was reacted at 37 ° C. for 6 hours. Substrates include epicatechin-3-O-gallate (ECG), catechin gallate (CG), gallocatechin-3-O-gallate (GCG), caffeic acid, chlorogenic acid, ellagic acid, butein, sulfretin, luteolin, myricetin, Alternatively, rosmarinic acid was used.
The enzyme reaction solution after the reaction was treated in the same manner as in Example 1 <Screening for methyltransferase enzyme activity>, and the methylated product in the enzyme reaction solution was analyzed using LC-MS under the following conditions. Identifications were also made for samples that could be compared with the standard. The HPLC conditions and MS conditions are shown below.
HPLC conditions Column: Inertsil ODS-3, 2.1 × 150 mm (manufactured by GL Science)
Mobile phase A: 0.1 (v / v)% formic acid aqueous solution Mobile phase B: acetonitrile containing 0.1 (v / v)% formic acid Gradient condition (i): 8% solution B (20 minutes) → 25% B Liquid (88 minutes)
Gradient condition (ii): 8% solution B (10 minutes) → 50% solution B (31 minutes)
Flow rate: 0.2 ml / min
Detection: UV280nm
MS condition detector: API3000 (Applied Biosystems)
Ion source: ESI (negative)
Curtain gas: 10
Nebulizer gas: 14
Turbo gas: 6 l / min
Ion spray voltage: -4000V
Ion spray temperature: 500 degrees Cone voltage: -41V

The results of LC-MS analysis are shown in Table 1. As a result, the formation of methylated products was confirmed for all the substrates used. From these results, it was revealed that the enzyme of the present invention can modify a methyl group using various compounds having a hydroxyl group as a substrate.
Moreover, in the compound having a plurality of hydroxyl groups in the compound like ECG, the generation of a plurality of types of methylated products was confirmed, and the dimethylated product was also confirmed. From these results, it was also confirmed that the enzyme of the present invention can independently methylate each of a plurality of hydroxyl groups in a substrate compound.

[Example 5] <Examination of reaction time>
A crude enzyme solution of a natural enzyme of enokitake mushroom-derived methyltransferase used in Example 4 (hereinafter referred to as a natural enzyme) and a recombinant enzyme solution purified with a histidine tag of an enokitake mushroom-derived methyltransferase enzyme used in Example 2 (hereinafter referred to as “enzyme mushroom-derived methyltransferase”). , The reaction time of the enzyme reaction was examined.
The composition of the enzyme reaction solution was 20 mM phosphate buffer (pH 7.0), 2.5 mM MgCl ₂ , 0.05 mM EGCG, 0.5 mM SAM, 0.04% ascorbic acid, and each crude enzyme solution (total volume 30 ml). 2.5 ml), and a total volume of 30 ml was reacted at 37 ° C. 5 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 60 minutes, 2 hours, 4 hours, 6 hours, 8 hours from the start of the reaction After 24 hours, 1 ml of the enzyme reaction solution was collected. These enzyme reaction solutions were treated in the same manner as in Example 1 <Screening of methyltransferase enzyme activity>, and methylated products in the enzyme reaction solution were analyzed under the following HPLC conditions.
Column: Inertsil ODS-3, 2.1 × 150 mm (manufactured by GL Science)
Mobile phase A: 0.1 (v / v)% formic acid aqueous solution Mobile phase B: acetonitrile containing 0.1 (v / v)% formic acid Gradient condition: 10% solution B (10 minutes) → 16% solution B (50 Minutes)
Flow rate: 0.2 ml / min
Detection: UV280nm
The concentration of EGCG methylated product in the enzyme reaction solution collected after each reaction time is shown in FIGS. 5A and 5B. FIG. 5A shows the result of the natural enzyme, and FIG. 5B shows the result of the recombinant enzyme. As a result, the production of EGCG methylated product showed the highest value 8 hours after the start of the reaction with the natural enzyme and 20 minutes after the recombinant enzyme.

[Example 6] <Examination of optimum pH>
The optimum pH in the enzyme reaction of the natural enzyme and the recombinant enzyme used in Example 5 was examined.
The composition of the enzyme reaction solution was as follows: 20 mM various buffers, 2.5 mM MgCl ₂ , 0.05 mM EGCG, 0.5 mM SAM, 0.04% ascorbic acid, and each crude enzyme solution (0. 25 ml). The buffers used were acetate buffer (pH 3.0 to 5.5), phosphate buffer (pH 6.0 to 7.0), and Tris-HCl (pH 7.5 to 10). A total amount of 3 ml of the prepared enzyme reaction solution was reacted at 37 ° C. The reaction time was 6 hours for the natural enzyme and 10 minutes for the recombinant enzyme. These enzyme reaction solutions were treated in the same manner as in Example 1 <Screening of methyltransferase enzyme activity>, and methylated products in the enzyme reaction solution were analyzed.
FIG. 6 shows the EGCG methylated product concentration in the enzyme reaction solution at each pH. As a result, the production of EGCG methylated product was confirmed at pH 6.5 to 8.5 for the natural enzyme and at pH 6 or more for the recombinant enzyme.

[Example 7] <Examination of optimum temperature>
The optimum temperature in the enzyme reaction of the natural enzyme and the recombinant enzyme used in Example 5 was examined.
The composition of the enzyme reaction solution was 20 mM phosphate buffer (pH 7.0), 2.5 mM MgCl ₂ , 0.05 mM EGCG, 0.5 mM SAM, 0.04% ascorbic acid, and each crude enzyme solution (total volume 3 ml 0.25 ml), and a total volume of 3 ml was reacted at 4, 10, 20, 30, 37, 42, 50, or 60 ° C., respectively. The reaction time was 6 hours for the natural enzyme and 10 minutes for the recombinant enzyme. These enzyme reaction solutions were treated in the same manner as in Example 1 <Screening of methyltransferase enzyme activity>, and methylated products in the enzyme reaction solution were analyzed.
FIG. 7 shows the concentration of EGCG methylated product in the enzyme reaction solution at each temperature. As a result, synthesis of EGCG methylated product was confirmed at 10 to 50 ° C. with the natural enzyme and at all temperatures performed with the recombinant enzyme. Among them, good enzyme activity was confirmed at 30 to 42 ° C. for both enzymes.

[Example 8] <Production of methylated green tea containing natural enzyme (crude enzyme solution extracted from mycelium)>
Using the natural enzyme used in Example 5, methyltransferase activity for green tea extract was confirmed.
The composition of the enzyme reaction solution was 20 mM Tris-HCl (pH 7.5), 2.5 mM MgCl ₂ , 0.01% green tea extract, 0.5 mM SAM, 0.04% ascorbic acid, and each crude enzyme solution (total amount) The total amount of 3 ml was reacted at 37 ° C. for 6 hours. The green tea extract used was a green tea extract powder (Shanghai Yuwei Biotechnology Development Co., Ltd.) dissolved in a 50% aqueous dimethyl sulfoxide solution. These enzyme reaction solutions were treated in the same manner as in Example 1 <Screening of methyltransferase enzyme activity> to analyze the composition of green tea catechins contained in the ethyl acetate extract extracted from the enzyme reaction solution. As a blank, a reaction solution in which water was added instead of the crude enzyme solution was treated in the same manner, and the composition of green tea catechins was analyzed.
FIG. 8 is a diagram showing the composition of green tea catechins, both natural-type enzyme-treated and blank. Note that EGC is an abbreviation for epigallocatechin. As a result, the composition ratio of EGCG3 ″ Me and ECG3 ″ Me, which are hardly contained in the blank, is increased, and the enzyme of the present invention can increase the methylated catechin content in the green tea extract. Became clear.
[Example 9]
<Production of methylated product using recombinant enokitake methyltransferase enzyme>
Using the recombinant enzyme produced in Example 2, methyltransferase activity against various substrates was confirmed.
The composition of the enzyme reaction solution was 20 mM phosphate buffer (pH 6.5), 2.5 mM MgCl ₂ , 0.05 mM substrate, 0.5 mM SAM, 0.04% ascorbic acid, and enzyme solution (for a total volume of 3 ml). 0.1 ml), and a total volume of 3 ml was reacted at 37 ° C. for 30 minutes. As the substrate, epicatechin-3-O-gallate (ECG), catechin gallate (CG), gallocatechin-3-O-gallate (GCG), epicatechin (EC), catechin (C), epigallocatechin (EGC) , Gallocatechin (GC), chromanin, delphinidin, delphinidin 3-O-glucoside, procyanidin B2 (PB2), caffeic acid, chlorogenic acid, rosmarinic acid, caffeic acid phenethyl ester, gallic acid, ellagic acid, strictinine, quercetin, isoquercitrin , Rutin, myricetin, butein, sulfretin, luteolin and eriodictyol were used.
After the reaction, 70 μl of 1N HCl and 5 ml of ethyl acetate were added to 3 ml of the enzyme reaction solution, and the mixture was stirred and centrifuged to remove the intermediate layer containing the enzyme, and the organic layer or the aqueous layer was recovered. The organic layer was solidified with nitrogen, then dissolved in a 1% ascorbic acid-containing 50% DMSO aqueous solution, the aqueous layer was lyophilized, dissolved in a 1% ascorbic acid aqueous solution, and analyzed using LC-MS under the following conditions. . The HPLC conditions and MS conditions are shown below.
HPLC condition column: Inertsil ODS-3, 2.1 × 150 mm (manufactured by GL Science)
Mobile phase A: 0.1 (v / v)% formic acid aqueous solution Mobile phase B: acetonitrile gradient containing 0.1 (v / v)% formic acid (i):
8% B solution (10 minutes) → 50% B solution (21 minutes) → 50% B solution (30 minutes)
Flow rate: 0.2 ml / min
Detection: UV280nm
MS condition detector: QSTAR ELITE (Applied Biosystems)
Ion source: ESI negative (* Measured with only anthocyanin positive)
Curtain gas: 30
Ion source gas 1:50
Ion source gas 2:50
Ion spray voltage: -4500V (+ 5500V)
Ion spray temperature: 450 ° C
Declustering potential: -30V (+ 30V)
Focus potential: -250 (250V)
Declustering potential: -15V (+ 15V)

The results of LC-MS analysis are shown in Table 2. The formation of methylated products was confirmed for all the substrates used. From these results, it was revealed that the recombinant enzyme of the present invention can modify a methyl group using various compounds having a hydroxyl group as a substrate.
In addition, in a compound having a plurality of hydroxyl groups such as ECG, it was confirmed that a plurality of types of methylated products including trimethylated products were generated. From these results, it was also confirmed that the enzyme of the present invention can independently methylate a plurality of hydroxyl groups in the compound.

The suppliers of the reagents used in Examples 1 to 9 are as follows.
Difco Potato Dextrose Ager: Nippon Becton Dickinson peptone: Nippon Becton Dickinson Yeast Extract: Nippon Becton Dickinson EGCG: Theavigo, DSM Nutrition Japan

LC / MS / MS: Thermo Fisher Scientific

Epicatechin-3-O-gallate (ECG): Funakoshicatechin gallate (CG): Funakoshigallocatechin-3-O-gallate (GCG): Funakoshicaffeic acid: Sigmamacrogogenic acid: Funakoshierugic acid: Funakoshibutein: Funakosisul Fretin: Funacosyltheolin: Funakoshimiricetin: Funakoshirosmarinic acid: Funakoshi

Epicatechin (EC): Funakoshicatechin (C): Funakoshi epigallocatechin (EGC): Funakoshigallocatechin (GC): Funacocyclomannin: Funakoshidelphinidin: Funakoshidelphinidin 3-O-glucoside: Funakoshiprocyanidin B2 (PB2): Funakoshiprocyanidin B2 (PB2) Caffeic acid phenethyl ester: Funakoshi gallic acid: Funakoshi tricutinine: Funakoshi quercetin: Funakoshi isoquercitrin: Funakosyltin: Funakoshieriodithiol: Funakoshi

  The polypeptide encoded by the gene of the present invention is a novel methyltransferase enzyme that can be applied to foods and drinks using compounds having a hydroxyl structure such as various polyphenols as substrates, and is advantageous for industrial production. Various methylated compounds, especially methylated polyphenols, can exhibit better absorbability and stability in the living body than the unmethylated products, and various non-methylated products have various properties. Functionality can be greatly improved. For this reason, the polypeptide encoded by the gene of the present invention can be used in the field of manufacturing various products such as foods and drinks, pharmaceuticals, quasi drugs, and cosmetics.

Claims (14)

  A gene comprising a polynucleotide selected from any of the following (a) to (c): (A) A polynucleotide comprising the base sequence represented by SEQ ID NO: 1. (B) a polynucleotide that hybridizes under stringent conditions with a polynucleotide comprising a base sequence complementary to the base sequence represented by SEQ ID NO: 1 and encodes a polypeptide having methyltransferase enzyme activity. (C) A polynucleotide having a polynucleotide comprising a nucleotide sequence having a homology of 64% or more with the nucleotide sequence represented by SEQ ID NO: 1 and encoding a polypeptide having methyltransferase enzyme activity.   A gene encoding a polypeptide selected from any of the following (a) to (c). (A) A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2. (B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity. (C) A polypeptide having 62% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity.   A polypeptide selected from any of the following (a) to (c). (A) A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2. (B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity. (C) A polypeptide having 62% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity.   A recombinant expression vector comprising the gene according to claim 1 or 2.   A transformant comprising the recombinant expression vector according to claim 4.   The transformant according to claim 5, which is a microorganism.   The transformant according to claim 5, which is a plant cell, a plant tissue, or a plant.   A method for producing a methyltransferase enzyme, comprising culturing the transformant according to any one of claims 5 to 7, and purifying a polypeptide having methyltransferase enzyme activity from the obtained culture.   A method for methylating a hydroxyl group in a compound using a methyltransferase enzyme, wherein the methyltransferase enzyme is cultured from the transformant according to any one of claims 5 to 7 and purified from the obtained culture. A method for producing a methylated product, which is a polypeptide selected from any of the following (a) to (c ′): (A) A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2. (B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity. (C ′) A polypeptide derived from basidiomycetes having 50% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity.   A method for purifying a methylated product, comprising purifying the methylated product from a transformed plant comprising the recombinant expression vector according to claim 4.   A methylated polyphenol-containing composition purified from a transformed plant comprising the recombinant expression vector according to claim 4.   A method for producing a methylated polyphenol, characterized in that a hydroxyl group in a polyphenol is methylated using a methyltransferase enzyme extracted from a basidiomycete.   A method for producing a methyltransferase enzyme, wherein a polypeptide selected from any of the following (a) to (c) is extracted from a basidiomycete and purified. (A) A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2. (B) A polypeptide comprising an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity. (C ′) a polypeptide having 50% or more homology with the amino acid sequence represented by SEQ ID NO: 2 and having methyltransferase enzyme activity.   A method for producing a methyltransferase enzyme, comprising extracting and purifying a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 2 from Enokitake (Flamulina velutipes).