KR101814912B1 - A composition for preventing or treating melioidosis comprising nyasol - Google Patents

Abstract

The present invention relates to a composition for preventing or treating melioidosis comprising nyasol as an active ingredient, and more particularly to a composition for preventing or treating melanidosis comprising niacin or a pharmaceutically acceptable salt thereof as an active ingredient, A pharmaceutical composition for therapeutic use, a food composition and a composition for antimicrobial use.
The Niasol of the present invention suppresses the biosynthesis of GDP-6-deoxy-D-heptose of Burkholderia pseudomallei, which is an eubary germ, And exhibits antimicrobial activity. Therefore, it can be very usefully used for the prevention or treatment of ubiquitous diseases caused by the bacteria.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a composition for preventing or treating ovarian cancer,

The present invention relates to a composition for preventing or treating melioidosis comprising nyasol as an active ingredient, and more particularly to a composition for preventing or treating melanidosis comprising niacin or a pharmaceutically acceptable salt thereof as an active ingredient, A pharmaceutical composition for therapeutic use, a food composition and a quasi-drug composition for antimicrobial use.

Meloidosis is a bacterial infection caused by gram-negative bacillus Burkholderia pseudomallei . It occurs mainly in tropical and subtropical regions such as Southeast Asia and northern Australia. The infection pathway is the inhalation of contaminated soil or water, oral ingestion, exposure of skin wounds, and clinical symptoms are characterized by asymptomatic infection, symptoms associated with bacterial sepsis such as skin abscess and necrotizing pneumonia.

Untreated, the mortality rate reaches 55%, but in eastern Asia and northern Australia it is already endemic and 20% of community acquired sepsis and 40% of community acquired pneumonia in northeastern Thailand are caused by ubiquitous Wiersinga, WJ et al., Nature Rev. Microbiol., 2006, 4, 272-282.). Ubi is an endemic disease that does not develop in Korea, but it is very urgent to prepare for Ubi by increasing the number of tourists and construction workers in the tropics.

Currently, antibiotics such as imipenem and ceftazidime are used in the treatment of ubiquitous drugs, but the development of new antibiotics or antibiotic adjuvants is essential because of the frequent occurrence of drug resistant and resistant strains.

On the other hand, lipopolysaccharide (LPS) is a major component of the outer membrane of Gram-negative bacteria, and maintains the structural stability of the bacteria and protects the membrane from external substances. It is also involved in adsorption and induction of immune responses to host cells. LPS is largely composed of lipid A, core oligosaccharide, and O-antigen polysaccharide chain. The nucleus of the oligosaccharide is divided into an inner core and an outer core. The inner core is composed of 3-deoxy-D-mann-oct-2-ulosonic acid (Kdo) Glycero-D-manno-heptose (LD-heptose) unit, and the outer nucleus is composed of additional sugar residues. Since LPS is essential for the survival of bacteria and is conserved in almost all Gram-negative bacteria (Raetz, CRH et al., Annu. Rev. Biochem., 2002, 71, 635-700), LPS is targeted for antibiotic development have.

In recent years, genes involved in the synthesis of heptose, which is a major component of the inner core of LPS, have been identified. It has been reported that inhibition of biosynthesis of hepatos according to mutation of these genes results in loss of bacterial infectivity, sensitivity to drugs, and further death. Specifically, mutations in the hldA and hldD genes involved in the heptose biosynthetic pathway in Burkholderia cenocepacia have been shown to increase susceptibility of the bacterium to antimicrobial peptides and lead to the death of bacteria (Loutet SA et al., J Bacteriol., 2006, 188: 2073-2080.), and that mutations of the HldE protein in Escherichia coli enhance sensitization to novobiocin (McArthur F., J. Bacteriol., 2005, 187, 5292-5300). Therefore, although a substance capable of inhibiting proteins involved in heptose biosynthesis may be developed as a new antibiotic or an antibiotic adjuvant, there is a possibility that an antibiotic that inhibits the heptose biosynthesis of Burkholderia pseudomalai, There is no research on the present.

Heptose, an LPS component of Burkholderia pseudo-Malay, is synthesized through several precursors, typically 6-deoxy-D-manno-heptose-1α- GDP; GDP-6-deoxy-D-heptose) or L-glycero-D-manno-heptose-1? -ADP; ADP- -heptose).

Seven enzymes are involved in the biosynthetic pathway of GDP-6-deoxy-D-heptose (GDP-6-deoxy-D-heptose). In turn, transketolase (TktA), sedoheptulose 7-phosphate isomerase (GmhA), D-glycero-? -D-manno-heptose-7- phosphate kinase (D- D-manno-heptose-7-phosphate kinase (HddA), D-glycero-D-manno-heptose-7-phosphate phosphatase D-manno-heptose-1-phosphate guanosyltransferase (HddC), GDP (D-glycero) It has been found that sugar epimerase / dehydratase (WcbK) and capsular polysaccharide biosynthesis protein (WcbJ) are involved.

In addition, six enzymes are involved in the biosynthetic pathway of ADP-L-β-D-heptose (ADP-L-β-D-heptose). D-glycero-β-D-manno-heptose-7-phosphate kinase / D-glycero-β-D-manno-heptose-1-phosphate adenylate transferase (D-glycero- HdE1, GmhB, cytidyltransferase (HldE2), and ADP-L (D-mannose-1-phosphate adenylyltransferase) (ADP-L-glycero-D-manno-heptose 6-epimerase; HldD). Of these, the TktA, GmhA, and GmhB enzymes share the GDP-6-deoxy-D-heptose biosynthetic pathway.

Under these circumstances, the inventors of the present invention have made extensive efforts to develop antibiotics against ubiquitous bacteria. As a result, it has been found that niasol inhibits the synthesis of GDP-6-deoxy-D-heptose, a precursor of heptose, Known Burke Helderias to destroy his survival by destroying Malay's LPS structure . Accordingly, it has been confirmed that the above-mentioned Niazoles can be effectively used for the prevention or treatment of ubiquitin, thus completing the present invention.

It is an object of the present invention to provide a pharmaceutical composition for preventing or treating melioidosis comprising nyasol or a pharmaceutically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide an ubiquitous improving food composition comprising niazole or a physiologically acceptable salt thereof as an active ingredient.

Another object of the present invention is to provide an antimicrobial composition for an isobacterium containing niacin or a pharmaceutically acceptable salt thereof as an active ingredient.

One aspect of the present invention for achieving the above object is to provide a pharmaceutical composition for preventing or treating melioidosis comprising nyasol or a pharmaceutically acceptable salt thereof as an active ingredient.

The present invention provides a medicament for inhibiting the activity of HddC (D-glycero-β-D-manno-heptose-1 -phosphate guanosyltransferase), wherein the HddC is GDP-6-deoxy- 6-deoxy-D-heptose). When the activity of HddC is inhibited, the synthesis of GDP-6-deoxy-D-heptose is inhibited. Also, the GDP-6-deoxy-D-heptose is used as a precursor for synthesizing L-glycero-D-mannose-heptose. The L-glycero- It is known that LPS is a major constituent of oligosaccharide nuclei, which is a main component of the outer membrane of LPS.

Therefore, when the activity of HddC is inhibited by the treatment of the Ni sol, the synthesis of GDP-6-deoxy-D-heptose is inhibited. When the synthesis of GDP-6-deoxy- Glycero-D-mannose-heptose is inhibited. When the synthesis of L-glycero-D-mannose-heptose is inhibited, the production of oligosaccharide nuclei of LPS containing the same is inhibited and the nucleus of the oligosaccharide When production is inhibited, the production of LPS is inhibited. If the production of LPS is inhibited, the production of the outer membrane of Gram negative bacteria containing the LPS is inhibited. As a result, proliferation or survival of Gram-negative bacteria is inhibited.

As a result, Niazole can act as an antibiotic for inhibiting the growth or survival of Gram-negative bacteria.

In fact, the present inventors have examined the effect of niazoles on various enzymes involved in the synthesis of GDP-6-deoxy-D- heptose derived from Burkholderia pseudomallei , a gram-negative bacterium As a result, it was confirmed that the action of the HddC enzyme was inhibited by the treatment of the Ni sol, so that GDP-6-deoxy-D-heptose was not synthesized.

It was confirmed that the synthesis of GDP-6-deoxy-D-heptose was inhibited by treating Burkholderia pseudomaliynizole as described above, suggesting that niazole can inhibit the growth or survival of the microorganism As long as niazole can inhibit the growth or survival of the bacterium, the niacin prevents the development of the ubiquitous disease, which is a disease caused by the infection of the bacterium, Can be effective in treating ubiquitin.

Therefore, the above-mentioned Niazoles can be used as an active ingredient of a pharmaceutical composition for preventing or treating ubiquitous diseases.

In addition, the niacin may have antibacterial activity against ubiquitous bacteria.

In the present invention, the antimicrobial activity may be achieved by inhibiting the synthesis of lipopolysaccharide (LPS), and the inhibition of synthesis of LPS may be achieved by inhibiting the synthesis of heptose, The synthesis inhibition of heptose may be accomplished by inhibiting the synthesis of GDP-6-deoxy-D-heptose, and the GDP-6-deoxy-D-heptose Inhibition of the synthesis of GDP-6-deoxy-D-heptose may be achieved by inhibiting the activity of Dd-glycero-β-D-manno-heptose-1-phosphate guanosyltransferase (HddC) It is not limited.

The term "nyasol " of the present invention means a compound called (-) - niazole or cis-hinokiresinol. The pharmaceutical composition for preventing and treating respiratory diseases induced by respiratory syncytial virus (RSV) infection (Korean Patent No. 10-0856335) or skin whitening composition (Korean Patent Laid-Open Publication No. 2015-0085564) It has been known that the therapeutic effect of ubiquitin is not known at all, and it has been clarified by the present inventor for the first time.

The term "ubiquitous bacteria" of the present invention means an infectious bacterium causing ubiquitous bacteria, and Pseudomonas pseudomonas pseudomallei ). The Burkholderia pseudo-Malay is a rod-shaped bacterium with motility that is characteristic of Gram-negative, bipolar, and aerobic. A length of 2 to 5 mu m, and a diameter of 0.4 to 0.8 mu m, and moves itself using the flagella. Can be named in the present specification in combination as "ubysinfecting bacteria" or "ubiquitous bacteria".

The term "melioidosis" of the present invention means a bacterial infectious disease caused by Burkholderia pseudomallei . It is characterized by clinical symptoms related to bacterial sepsis such as asymptomatic, skin abscess, and necrotizing pneumonia, with a mortality rate of 55%.

The term "LPS (lipopolysaccharide) " of the present invention refers to a main component of the outer membrane of Gram-negative bacteria, and maintains the structural stability of the bacteria and protects the membrane from external substances. The structure of the LPS is composed of lipid A, a core oligosaccharide, and an O-antigen polysaccharide chain, and the oligosaccharide nucleus is divided into an inner nucleus and an outer nucleus have.

The term "heptose" of the present invention means a component of the inner core of the LPS.

The term "GDP-6-deoxy-D-heptose" of the present invention refers to 6-deoxy-D-heptose- Refers to a precursor of the heptose, also referred to as D-manno-heptose-1? -GDP; GDP-6-deoxy-D-heptose.

The term "HddC" of the present invention means D-glycero-β-D-manno-heptose-1-phosphate guanosyltransferase (D-glycero-β-D-manno-heptose-1-phosphate guanosyltransferase) And refers to an enzyme involved in the synthesis pathway of GDP-6-deoxy-D-heptose. The specific nucleotide sequence and protein information of the gene encoding the HddC protein is known from NCBI (GenBank: Accession YP_109389.1, CPO29641.1, CRY07523.1, etc.).

The term "pharmaceutically acceptable" of the present invention means to exhibit no toxicity to cells or humans exposed to the composition.

The term "pharmaceutically acceptable salt" of the present invention means a salt of the form that can be used pharmaceutically in the salt in which the cation and the anion are bound by the electrostatic attraction. It may be a metal salt, a salt with an organic base, a salt with an inorganic acid, a salt with an organic acid, a salt with a basic or an acidic amino acid, and the like. For example, the metal salt may be an alkali metal salt (sodium salt, potassium salt, etc.), an alkaline earth metal salt (calcium salt, magnesium salt, barium salt, etc.), an aluminum salt and the like; Examples of salts with organic bases include salts with organic bases such as triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, And the like; The salt with inorganic acid may be a salt with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like; Salts with organic acids may be salts with formic acid, acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like; Salts with basic amino acids may be salts with arginine, lysine, ornithine and the like; The salt with an acidic amino acid may be a salt with aspartic acid, glutamic acid and the like.

The compositions of the present invention include both pharmaceutically acceptable salts of niazoles, as well as possible solvates and hydrates which may be prepared therefrom, and may include all possible stereoisomers. Also, solvates, hydrates and stereoisomers of the above-described niazoles can be prepared using conventional methods.

The pharmaceutical compositions of the present invention may further comprise pharmaceutically acceptable carriers, excipients or diluents conventionally used in the manufacture of pharmaceutical compositions, which may include non-naturally occuring carriers have.

Specifically, the pharmaceutical composition may be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral preparations, suppositories and sterilized injection solutions according to a conventional method . In the present invention, the carrier, excipient and diluent which may be contained in the pharmaceutical composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, Calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, which may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups, and the like. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Examples of the suspending agent include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like. Examples of the suppository base include witepsol, macrogol, tween 61, cacao butter, laurin, glycerogelatin and the like.

The term "prophylactic" of the present invention means any act that inhibits or delays the onset of ubiquitin by administration of the composition of the present invention.

The term "treatment" of the present invention means all the actions of the ubiquitous suspect and the symptoms of the onset of the disease by the administration of the composition of the present invention.

In one specific embodiment of the present invention, Niasol inhibits the enzyme activity of HddC (D-glycero-β-D-manno-heptose-1-phosphate guanosyltransferase) expressed in Burkholderia pseudomalay, -Heptose biosynthesis was inhibited (Example 4). This inhibition of GDP-heptose biosynthesis reduces the survival or toxicity of Burkholderia pseudomalies by destroying the structure of LPS, and thus it is possible to use the above-mentioned niazoles as antibiotics or antibiotic adjuvants for treating ubiquitin It is suggestive.

Another aspect relates to a method for preventing or treating an ubiquitous disorder comprising administering to a subject a pharmaceutical composition for the prevention or treatment of melioidosis comprising nyasol or a pharmaceutically acceptable salt thereof as an active ingredient ≪ / RTI >

The definitions of the niazoles, pharmaceutically acceptable salts, ubiquitin, prevention and treatment are as described above.

The term "administering" of the present invention means introducing the desired substance into the subject in a suitable manner.

The term "individual" of the present invention means all animals such as mice, mice, livestock, etc., including humans who have developed or are at low risk. But are not limited to, mammals including humans. In addition, in the present invention, an individual may be excluded from human, but is not limited thereto.

The term "pharmaceutically effective amount " of the present invention means an amount sufficient to treat a disease at a reasonable benefit / risk ratio applicable to medical treatment and not causing side effects, and the effective dose level is determined by the sex, age And other medical fields, including drugs used in combination or concurrently, with respect to body weight, health status, type of disease, severity, activity of the drug, sensitivity to the drug, method of administration, administration time, route of administration, Can be readily determined by those skilled in the art according to well known factors.

Specifically, the composition of the present invention may be administered at a dose of 0.0001 to 100 mg / kg body weight per day, more specifically 0.001 to 100 mg / kg body weight, based on the solid content. The administration may be such that the recommended dose is administered once a day or divided into several doses.

In addition, the composition of the present invention can be administered, specifically, such that the niacin or a pharmaceutically acceptable salt thereof can be administered to an individual at a concentration of 0.01 mM to 1000 mM, more specifically, 0.1 mM to 100 mM. Do not.

In the preventive or therapeutic method of the ubiquitin of the present invention, the administration route and method of administering the composition are not particularly limited, and any route of administration and administration may be used as long as the composition containing the composition can reach the desired site It is possible to follow the method. Specifically, the composition may be administered orally or parenterally through various routes. Non-limiting examples of routes of administration include oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, Intramuscularly or through inhalation or the like.

Another embodiment provides a food composition for improving melioidosis comprising nyasol or a physiologically acceptable salt thereof as an active ingredient.

The definition of the niazoles, ubiquitin and prevention is as described above.

The term "physiologically acceptable salt" of the present invention means a compound which is physiologically acceptable and which, when administered to an organism, is administered to a subject, usually without causing an allergic reaction such as a gastrointestinal disorder, Quot; means that it is commonly used that can exert its effect.

The term "improvement" of the present invention means any action that results in improvement or lowering the cost of administration by administration of the composition of the present invention.

The term "food" of the present invention is intended to encompass all kinds of foods, such as meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, ice creams, Vitamin complex, health functional food, and health food, all of which include foods in a conventional sense.

The above-mentioned functional food is the same term as the food for special health use (FoSHU). In addition to the nutritional supply, the functional food is a medicine that has been processed so that the biological control function is efficiently displayed, . Here, the term "function" means that the structure and function of the human body have a beneficial effect on health uses such as controlling nutrients or physiological actions. The food of the present invention can be prepared by a method commonly used in the art and can be prepared by adding raw materials and ingredients which are conventionally added in the art. The formulations of the food can also be produced without limitation as long as they are formulations recognized as food. The composition for food of the present invention can be manufactured in various formulations, and unlike general pharmaceuticals, it has advantages of being free from side effects that may occur when a food is used as a raw material for a long period of time, and is excellent in portability, Can be ingested as an adjuvant to enhance the effect of the ubiquitin improvement.

The health food refers to a food having an active health promotion or promotion effect compared with a general food, and a health supplement food refers to a food for health assistance. In some cases, the terms health functional foods, health foods, and health supplements are used.

Specifically, the health functional food is a food prepared by adding niacin or a physiologically acceptable salt thereof to food materials such as beverage, tea, spice, gum and confectionery, or encapsulating, pulverizing, It means to have a certain health effect when ingested.

The above-mentioned niacazoles were used as herbal medicine ( Anemarrhena asphodeloides . It is a compound that has been proven safe against living organisms. Therefore, there is no side effect that may occur when taking a long-term use, and since it is possible to ingest it on a daily basis, a high effect can be expected for improvement of the ubiquitin, which is very useful.

The composition may further include a physiologically acceptable carrier. The carrier is not particularly limited and any carrier conventionally used in the art can be used.

In addition, the composition may contain additional ingredients which are commonly used in food compositions and which can improve odor, taste, vision and the like. For example, vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, panthotenic acid and the like. In addition, it may include minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), copper (Cu) It may also include amino acids such as lysine, tryptophan, cysteine, valine, and the like.

In addition, the composition can be used in combination with a preservative (potassium sorbate, sodium benzoate, salicylic acid, sodium dehydroacetate), a disinfectant (such as bleaching powder and highly bleached white powder, sodium hypochlorite), an antioxidant (butylhydroxy anisole (BHA) (Sodium hypophosphate), bleach (sodium sulfite), seasoning (sodium MSG glutamate, etc.), sweeteners (hemicellulose, cyclamate, saccharin, A food additive such as a flavor (vanillin, lactones), a swelling agent (alum, D-tartrate, potassium hydrogen), an emulsifier, a thickening agent (glue), a covering agent, a gum base agent, a foam inhibitor, and food additives. The additives may be selected and used in appropriate amounts depending on the type of food.

The above-mentioned niacazoles or physiologically acceptable salts thereof can be added intact or used together with other food or food ingredients, and can be suitably used according to conventional methods. The amount of the active ingredient to be mixed can be suitably determined according to its intended use (prevention, health or therapeutic treatment). Generally, the food composition of the present invention may be added in an amount of not more than 50 parts by weight, specifically not more than 20 parts by weight, based on the food or beverage, when the food or drink is prepared. However, in case of long-term ingestion for health and hygiene purposes, the active ingredient may be contained in an amount not exceeding the above range and there is no problem in terms of safety.

As an example of the food composition of the present invention, it can be used as a health beverage composition. In this case, various flavors or natural carbohydrates can be added as an additional ingredient such as ordinary beverages. The above-mentioned natural carbohydrates include monosaccharides such as glucose and fructose; Disaccharides such as maltose, sucrose; Polysaccharides such as dextrin, cyclodextrin; Xylitol, sorbitol, erythritol, and the like. Sweeteners include natural sweeteners such as tau Martin and stevia extract; Synthetic sweetening agents such as saccharin and aspartame, and the like can be used. The ratio of the natural carbohydrate may be generally about 0.01 to 0.04 g, specifically about 0.02 to 0.03 g per 100 mL of the composition of the present invention.

In addition to the above, the health beverage composition may contain various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acid, protective colloid thickener, pH adjuster, stabilizer, Alcohols or carbonating agents, and the like. It may also contain flesh for the production of natural fruit juices, fruit juice drinks, or vegetable drinks. These components may be used independently or in combination. The proportion of such additives is not critical, but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the composition of the present invention.

The food composition of the present invention may be contained at various weight percentages as long as it can exhibit the improvement effect of the ubiquitin. Specifically, the food composition may contain 0.00001 to 100% by weight or 0.01% by weight of the niacin or a physiologically acceptable salt thereof, By weight to 80% by weight.

Another embodiment provides an antimicrobial composition for an eubacteria containing nyasol or a pharmaceutically acceptable salt thereof as an active ingredient.

As described above, when the niazole is treated with ubiquitous bacterium, the activity of the HddC enzyme expressed in the above-mentioned ubiquitous bacterium can be inhibited, and consequently, the growth or survival of the bacterium can be suppressed. Can be used as an active ingredient of a composition for antibacterial use. Herein, the definitions of the above-mentioned niazoles, pharmaceutically acceptable salts and ubiquitous bacteria are as described above.

The term "antibacterial" of the present invention means to kill or inhibit the growth of microorganisms, or reduce toxicity.

The antimicrobial composition of the present invention may be provided in the form of a quasi-drug.

The "quasi-quasi-product" is a fiber, a rubber product or the like used for the purpose of treating, alleviating, treating or preventing a disease of a person or an animal, a substance which does not act directly on the human body, Products similar to or similar to those used in the manufacture of a medicinal product for use in the prevention or treatment of infectious diseases, Machinery, or apparatus, and that is not an apparatus, machine or apparatus of an article used for the purpose of giving pharmacological effects to the structure or function of a person or animal. Specific examples thereof include, but are not limited to, an external preparation for skin, an antibacterial agent, an antiseptic agent, a bactericide, a disinfectant or a detergent.

When niacin or a pharmaceutically acceptable salt thereof is added to a quasi-drug composition for the purpose of antibacterial treatment against ubiquitous bacterium, the niacin or a pharmaceutically acceptable salt thereof may be directly added or used together with other quasi-drug components, And can be appropriately used according to a conventional method. The amount of the active ingredient to be mixed can be appropriately determined depending on the purpose of use.

The external preparation for skin may be manufactured and used in the form of, for example, an ointment, a lotion, a spray, a patch, a cream, a powder, a suspension, a gel or a gel.

The quasi-drug composition of the present invention may be contained in various weight percentages as long as it can exhibit the antibacterial activity of the ubiquitin. Specifically, it is preferable that the niacin or its pharmaceutically acceptable salt is 0.01 to 100% by weight relative to the total weight of the quasi drug composition, 1 to 80% by weight.

The Niasol of the present invention suppresses the biosynthesis of GDP-6-deoxy-D-heptose of Burkholderia pseudomallei, which is an eubary germ, And exhibits antimicrobial activity. Therefore, it can be very usefully used for the prevention or treatment of ubiquitous diseases caused by the bacteria.

Fig. 1 is an image showing the cell membrane and LPS structure of Gram-negative bacteria.
FIG. 2 is a schematic diagram showing a process of biosynthesis of GDP-6-deoxy-D-manno-heptose.
3 is a schematic diagram showing the process of ADP-L-? -D-heptose (ADP-L-? -D-heptose) biosynthesis.
Figure 4 is a chromatogram showing the detection results of the reaction product of TktA, sedoheptulose-7-phosphate.
FIG. 5 is a graph showing the results of detection of D-glycero-D-manno-heptose-1α, D-glycero-D-manno-heptose-1α and 7-bisphosphate as a reaction product of HddA to be.
FIG. 6 is a chromatogram showing the detection result of D-glycero-D-manno-heptose-1? -GDP (D-glycero-D-manno-heptose-1? -GDP) as a reaction product of HddC.
7 shows the results of detection of the reaction product of WcbK, 4-keto-6-deoxy-D-manno-heptose-1? -GDP It is a chromatogram.
8 is a chromatogram showing the results of detection of D-glycero-D-manno-heptose-1β, 7-bisphosphate as a reaction product of HldE1 to be.
FIG. 9 is a chromatogram showing the detection result of D-glycero-D-manno-heptose-1? -ADP, which is the reaction product of HldE2.
Figure 10 shows the results of the reaction of 4-keto-6-deoxy-D-mannose with 4-keto-6-deoxy-D-manno-heptose- -heptose-1? -GDP).
11 shows the results of detection of D-glycero-D-manno-heptose-1? -ADP, which is a reaction product of GmhB / HldE2, Showing the chromatogram.
FIG. 12 is a graph showing the results of detection of D-glycero-D-manno-heptose-1α-GDP as a reaction product of HddC after the treatment with Niazole Grams.

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, the following examples are intended to illustrate the present invention, but the scope of the present invention is not limited thereto.

Example  1. Enzyme protein preparation

And to develop an antibiotic against ubiquitous bacteria by using a substance that destroys the LPS structure of ubiquitous bacteria. Heptose is a constituent of the LPS and is a derivative of GDP-6-deoxy-D-heptose or ADP-L-β-D-heptose as a precursor of heptose (ADP-L-ss-D-heptose), which was used to screen for a substance that inhibits the biosynthesis of the precursor and consequently breaks the LPS structure. The activity of the protein was investigated through in vitro experiments because the culture was difficult due to high pathogenicity.

Specifically, as shown in FIG. 2, TktA, GmhA, HldE1, HddA, GmhB, HldE2, HddC, HldD, The WcbK protein was isolated and purified according to the methods of Examples 1-1 to 1-3 below. However, GmhB was used for the assay because of its low enzyme activity in in vitro experiments and Burkholderia thailandensis GmhB, which has very high sequence homology with Burkholderia pseudomalys for high enzyme activity.

Example  1-1. gene Cloning  process

Primers were designed for ligation-independent cloning (LIC) and synthesized via Genotex (Korea). The sequences of the primers designed for amplification of each gene are listed in Table 1 below.

gene Forward primer Reverse primer TktA 5'-GGCGGTGGTGGCGGCATGACGACTTCGTCTCCCGCCTCC-3 '(SEQ ID NO: 1) 5'-
GTTCTTCTCCTTTGCGCCCCTACGCGAGC ACCGCCTTCG-3 '(SEQ ID NO: 2) GmhA 5'-GGCGGTGGTGGCGGCATGGAGAATCGCGAATTGACGTACAT-3 '(SEQ ID NO: 3) 5'-GTTCTTCTCCTTTGCGCCCCTACTGCTTCCCGAAAATGGAGTGCT-3 '(SEQ ID NO: 4) HddA 5'-GGCGGTGGTGGCGGCATGAATCCGACAATCAT TCGCGC-3 '(SEQ ID NO: 5) 5'-GTTCTTCTCCTTTGCGCCCCTAATTCGCGATT CTCCATGCCTGC-3 '(SEQ ID NO: 6) GmhB 5'-GGCGGTGGTGGCGGCATGCCGACCAGTCCCAGCAAA-3 '(SEQ ID NO: 7) 5'-GTTCTTCTCCTTTGCGCCCCTACTCGTGTTCTTTGGAAAGGAAATCGA -3 '(SEQ ID NO: 8) HddC 5'-GGCGGTGGTGGCGGCATGAGAGAAGCGATCATCTTGGCCG-3 '(SEQ ID NO: 9) 5'-GTTCTTCTCCTTTGCGCCCCTACTTGCAGATTCCGGAAAGCTC-3 '(SEQ ID NO: 10) WcbK 5 '-GGCGGTGGTGGCGGCATGGCAAAGCGTGTTTTGATTACGG-3' (SEQ ID NO: 11) 5'-GTTCTTCTCCTTTGCGCCCCTATCGGGTCAAGAACTTCTCGCCG-3 '(SEQ ID NO: 12) HldE1 5'-GGCGGTGGTGGCGGCATGTCGCGCGAGCAGATCGC-3 '(SEQ ID NO: 13) 5'-GTTCTTCTCCTTTGCGCCCCTAATGAAACAGTTCGTCGTACTCGACGG-3 '(SEQ ID NO: 14) HldE2 5'-GGCGGTGGTGGCGGCATGCCCGCTTCGTTCGAACG-3 '(SEQ ID NO: 15) 5'-GTTCTTCTCCTTTGCGCCCCTAGCGCGACTGCGCGCG-3 '(SEQ ID NO: 16) HldD 5'-GGCGGTGGTGGCGGCATGACCCTCATCGTTACCGGCG-3 '(SEQ ID NO: 17) 5'-GTTCTTCTCCTTTGCGCCCCTACAGCTGGCCGAACAGCCAAC-3 '(SEQ ID NO: 18)

All genes except GmhB used 200 ng of genomic DNA of Burkholderia pseudomalayus as template and 109 ng of genomic DNA of Burkholderia tylorandensis as template. 1 μl of template DNA, 1 μl each of forward and reverse primers at a concentration of 50 μM, 50 μl of 2X PrimeSTAR GC buffer (Takara), 8 μl of 2.5 mM dNTP mix (Takara, Japan), PrimeSTAR HS DNA polymerase Takara, Japan) was subjected to polymerase chain reaction (PCR) using a total of 100 mu l of the reaction mixture.

The polymerase chain reaction was repeated 30 times at 98 ° C for 10 seconds and at 68 ° C for 1 minute / Kb, and then left at 4 ° C for 3 minutes. Thereafter, 1.2% agarose gel electrophoresis was performed to confirm the product of the amplified polymerase chain reaction, and the gene was separated and purified from the gel using Expin TM Gel SV Kit (Gel DNA Extraction Kit) of JEOL.

For insertion of the amplified gene, the LIC expression vector pB2 vector, which is a derivative of the pET21a vector (Novagen, USA), was digested with SmaI, a restriction enzyme of New England Biolabs (NEB), and then T4 DNA polymerase (New England Biolab, USA) for 30 min at 37 ° C and then for 20 min at 70 ° C. To insert the amplified gene into the vector, 1 mM dTTP was added instead of 1 mM dATP in the same protocol as the pB2 vector. 50 ng of the amplified gene and 50 ng of the pB2 vector were amplified with 3 '→ 5' exonuclease activity of the T4 DNA polymerase to generate a complementary protruding end (LIC site) After incubation at room temperature for 30 minutes, it was transformed into E. coli (DH5?) By heat shock method. The recombinant plasmids obtained from the transformed Escherichia coli (DH5α) were isolated and purified using a DNA spin kit (Plasmid DNA purification kit) from Intron, and then transformed into E. coli (BL21 (DE3) / pSJS1244) for protein expression.

Example  1-2. Protein expression and cell Crushed  Preparation course

The recombinant E. coli transformed according to Example 1-1 was inoculated on Luria-Bertani (LB) agar plate containing 150 / / ml ampicillin, and several colonies were selected and 150 / / ml ampicillin Were inoculated into 10 mL of LB and incubated overnight. Then, 0.85 mL of culture medium and 0.15 mL of glycerol were mixed to prepare a cell stock and stored at -80 ° C. The cell stock was inoculated in 5 mL of LB medium and incubated overnight. Then, the cells were diluted in 1000 mL of fresh LB medium and the OD600 value was adjusted to 0.6 to 0.8 at 37 ° C., 1 mM IPTG (isopropyl β-D-1-thiogalactopyranoside ) To induce the expression of the cloned protein. Expression of TktA, HddC, and WcbK proteins was induced at 25 ° C for 16 hours, and expression of GmhA, HddA, and GmhB proteins was induced at 37 ° C for 3 hours. Thereafter, the cell pellet obtained by centrifugation at 6500 rpm for 10 minutes at 4 ° C was resuspended in 25 ml of a buffer consisting of 50 mM Tris-HCl pH 8.0, 100 mM NaCl, 10 mM imidazole, 1 mM PMSF and 10 mg / . The cell suspension was disrupted by ultrasonic treatment using Digital Sonifier 450 (Branson Ultrasonics Co., Danbury, Connecticut, USA) and centrifuged at 4 ° C for 30 minutes at 15000 rpm to obtain a supernatant containing the protein.

Example  1-3. Protein separation process

Separation of all proteins was performed using the AKTA Explorer system (GE Healthcare, USA). First, affinity chromatography using a His-trap HP column (GE Healthcare, USA) was performed using a histidine tag (His tag), and a buffer having the following composition was used:

1. His trap binding buffer: 50 mM pH 8.0 Tris, 0.1 M NaCl and 0.01 M Imidazole

2. His trap wash buffer: 50 mM pH 8.0 Tris, 0.3 M NaCl and 0.01 M Imidazole

3. His trap elution buffer: 50 mM pH 8.0 Tris, 0.1 M NaCl and 0.5 M Imidazole.

Subsequently, all proteins except HddC protein were separated by ion exchange chromatography using a Hi-Trap Heparin column (GE healthcare, USA) and separated using the respective adsorption buffer and elution buffer. Table 2 summarizes the composition of the buffer and the concentration of NaCl eluted from each protein when NaCl is linearly gradient-gradiented from 0 M to 1 M,

protein Adsorption buffer composition Elution buffer composition Upon elution
Concentration of NaCl TktA 20 mM Tris-HCl pH 8.0 20 mM Tris-HCl pH 8.0 and 1 M NaCl 0.3 M GmhA 20 mM Tris-HCl pH 8.0 20 mM Tris-HCl pH 8.0 and 1 M NaCl 0.4 M HddC 20 mM Tris-HCl pH 8.5 20 mM Tris-HCl pH 8.5 and 1 M NaCl 0.4 M GmhB 20 mM Tris-HCl pH 8.0 20 mM Tris-HCl pH 8.0 and 1 M NaCl 0.37 M WcbK 20 mM Tris-HCl pH 8.5 20 mM Tris-HCl pH 8.5 and 1 M NaCl 0.26 M HldE1 20 mM Tris-HCl pH 7.5 20 mM Tris-HCl pH 7.5 and 1 M NaCl 0.3 M HldE2 20 mM Tris-HCl pH 8.5 20 mM Tris-HCl pH 8.5 and 1 M NaCl 0.16 M HldD 20 mM Tris-HCl pH 8.0 20 mM Tris-HCl pH 8.0 and 1 M NaCl 0.44 M

On the other hand, the HddC protein was separated by heparin chromatography using a Hi-Trap Heparin column (GE healthcare, USA) and chromatographed with 20 mM Tris-HCl pH 8.0 buffer. As a result, Protein was purified. All of the proteins separated by the above method were confirmed to have size and purity using an SDS-PAGE gel.

Through the above process, TktA, GmhA, and GmhA which are involved in biosynthesis of a precursor of heptose (GDP-6-deoxy-D-heptose or ADP-L-ss-D-heptose) HldE1, HddA, GmhB, HldE2, HddC, HldD and WcbK proteins were all prepared.

Example  2. Enzyme Activity Analysis

In order to confirm whether the proteins involved in the biosynthesis of GDP-6-deoxy-D-heptose or ADP-L-β-D-heptose prepared in Example 1 exhibited normal activity, To 2-2.

Example  2-1. GDP-6- Deoxy -D- Heptose Biosynthetic pathway  Enzyme activity assay

The activity of the enzyme involved in the GDP-6-deoxy-D-heptose biosynthetic pathway was analyzed by liquid chromatography / mass spectrometry (LC-MS) according to the method of Examples 2-1-1 to 2-1-4 Respectively. Liquid chromatography and mass spectrometry were performed on an Agilent 1200 HPLC system (Agilent, Santa Clara, Calif., USA) and Agilent 6220 Accurate-Mass TOF Hunter Data Acquisition software (version B.03.01), and the results were analyzed using Agilent Mass Hunter Qualitative Analysis software (version B.03.01).

Example  2-1-1. TktA  Activity analysis

TktA was combined with 5 mM CaCl ₂ and 1 mM thiamine pyrophosphate as a cofactor to give a final concentration of 2.5 mg / ml. The reaction substrate fructose-6-phosphate (F6P ) And ribose-5-phosphate (R5P) were adjusted to a final concentration of 50 mM and 25 mM, respectively, and 50 μl of a reaction mixture was prepared by adjusting the pH to 50 mM Tris pH 7.5 Hereinafter " TktA reaction mixture ").

After reacting the TktA reaction mixture overnight at 37 ° C., a sample for LC-MS analysis was prepared by the following procedure. The precipitate was removed by centrifugation at 10,000 rpm at 25 DEG C for 10 minutes, and 20 mu l of the supernatant was diluted 1000 times and filtered using a 0.22 mu m syringe filter (Millipore, USA). The reaction products contained in the sample were analyzed using a liquid chromatography / mass spectrometer.

As a result, as shown in FIG. 4, it was confirmed that a peak of the reaction product of TktA, sedoheptulose-7-phosphate (mw 290.04, m / z 289.03) Was found to exhibit normal activity.

Example  2-1-2. GmhA  And HddA  Activity analysis

D-glycero-D-manno-heptose-7-phosphate, which is a reaction product of GmhA, has the same molecular weight as Sedoheptulose-7-phosphate, Since it is an isomer, mass peaks can not be distinguished, and the enzyme activities of HddA were also confirmed.

Specifically, in the TktA reaction mixture, GmhA and its cofactor MgCl ₂ And ZnCl _{2 were added} to final concentrations of 0.6 mg / ml, 10 mM and 0.1 mM, respectively. Then, for the activity of HddA, HddA and cofactors such as MnCl ₂ and KCl were added to the reaction mixture to give the final concentration of 1.5 mg / ml, 1 mM and 25 mM, respectively. The reaction substrate ATP was added to the final concentration of 30 mM (Hereinafter referred to as 'GmhA / HddA reaction mixture').

The GmhA / HddA reaction mixture was reacted overnight at 37 ° C and analyzed for LC-MS by the same procedure as the TktA reaction mixture.

As a result, as shown in FIG. 5, D-glycero-D-manno-heptose-1α, 7-bisphosphate, which is a reaction product of HddA, (mw 370.01, m / z 368.99) peaks were detected, indicating that the GmhA and HddA enzymes exhibited normal activity.

Example  2-1-3. GmhB  And HddC's  Activity analysis

D-glycero-D-manno-heptose-1? -Phosphate, which is the product of GmhB, has the same molecular weight as Sedoheptulose-7-phosphate, The reaction was further treated.

GmhB / HddC reaction mixture was added to the final concentration of 0.6 mg / ml and 0.07 mg / ml, and the reaction substrate, GTP, was added to a final concentration of 15 mM (hereinafter referred to as 'GmhB / HddC reaction mixture').

As a result, as shown in FIG. 6, the GmhB / HddC reaction mixture was reacted overnight at 37 ° C, and as a result, the reaction product of HddC, D-glycero- D-manno-heptose-1? -GDP) (mw 635.09, m / z 634.08) peaks were detected, indicating that GmhB and HddC enzymes exhibited normal activity.

Example  2-1-4. WcbK's  Activity analysis

To confirm the activity of WcbK, WcbK was added to the GmhB / HddC reaction mixture at a concentration of 0.6 mg / ml, and reacted overnight at 37 ° C to prepare an LC-MS sample.

As a result, as shown in FIG. 7, the reaction product 4-keto-6-deoxy-D-manno-heptose- GDP) (mw 617.08, m / z 616.07) peaks were detected, indicating that the WcbK enzyme showed normal activity.

Example  2-2. ADP-L- [beta] -D- Heptose Biosynthetic pathway  Enzyme activity assay

The activity of the enzymes involved in the ADP-L-β-D-heptose biosynthetic pathway using a liquid chromatography / mass spectrometer (LC-MS) was determined by the method of Examples 2-2-1 to 2-2-2 Respectively.

Example  2-2-1. TktA , GmhA  And HldE1's  Activity analysis

The enzymatic activity of TktA was confirmed by the method according to Example 2-1. To confirm the enzymatic activity of GmhA and HldE1, the composition of the GmhA / HddA reaction mixture of Example 2-1 was used, but HldE1 was substituted for HddA (Hereinafter referred to as 'GmhA / HldE1 reaction mixture') at a final concentration of 0.3 mg / ml.

As shown in FIG. 8, the GmhA / HldE1 reaction mixture was reacted overnight at 37 ° C. As a result, the reaction product of HldE1, D-glycero-D-manno-heptose-1β and 7-bis- D-manno-heptose-1?, 7-bisphosphate) (mw 370.01, m / z 368.99) peaks were detected and GmhA and HldE1 enzymes showed normal activity.

Example  2-2-2. GmhB  And HldE2  Activity analysis

In order to confirm the enzymatic activity of GmhB and HldE2, HldE2 was added to a final concentration of 0.3 mg / ml instead of HddC (hereinafter referred to as' GmhB / HldE2 reaction Mixed solution ').

As shown in FIG. 9, the reaction mixture of GmhB / HldE2 was reacted overnight at 37 ° C. As a result, the reaction product of HldE2, D-glycero-D-mannose -heptose-1? -ADP) (mw 619.093, m / z 618.086) peaks were detected, indicating that the GmhB and HldE2 enzymes showed normal activity.

Through the above process, it was confirmed that the proteins involved in the biosynthesis of GDP-6-deoxy-D-heptose or ADP-L-β-D-heptose showed normal activities.

Example  3. Inhibitor candidate screening process

Proteins prepared in Examples 1 and 2 were used to search for an antibiotic candidate substance of the eubarybid microorganism which targets the heptose biosynthetic pathway and consequently destroys the LPS structure.

Specifically, a screening method using the enzymatic activity of a protein involved in the biosynthesis of GDP-6-deoxy-D-heptose or ADP-L-ss-D-heptose has been developed. First, a mixed solution containing all the enzymes and cofactors necessary for the heptose biosynthesis process was mass-produced in the composition shown in Table 3 below. 50 ㎕ each of them was dispensed, and about 100 natural compound candidates were added to a final concentration of 1 mM and left at room temperature for 5 minutes. The heptose biosynthesis reaction was induced by adding the reaction substrate as described in Table 3 below to the mixed solution containing the candidate substance, the enzyme and the cofactor, and reacting overnight at 37 ° C.

Thereafter, whether or not the candidate product was inhibited by the heptose biosynthesis process was determined by analyzing whether the final product GDP-6-deoxy-D-heptose or ADP-L-? -D-heptose was detected, Table 4 summarizes the results.

As a result, as shown in Table 4, it was confirmed that the compound of codename EA270E-20-17-K1, nyasol, inhibited the GDP-heptose biosynthesis process. As shown in FIG. 10, treatment of EA270E-20-17-K1 revealed that 4-keto-6-deoxy-D-mannose-heptose-1? -GDP (mw 617.08, m / z 616.07) It was confirmed that it strongly inhibited the GDP-heptose biosynthesis process. As a result, it was found that the above-mentioned Niazoles could destroy the LPS structure of the ubiquitous bacterium.

Example 4. Confirmation of action mechanism of nyasol

Example 4-1. Separation of Niazoles

Niazole, which was confirmed to be a material that can be used as an antibiotic against ubiquitous bacterium by inhibiting the GDP-heptose biosynthesis process through Example 3, was prepared as follows.

Specifically, the above-mentioned niacazoles are anemarrhena asphodeloides Bunge) extracts. Extraction of the dried bristles and extraction of the solvent with ethyl acetate from the solvent fractionation using silica gel column chromatography.

First, 20 kg of dry gum herbal medicine purchased from Omni Hub.com (Korea) was added to 20 L of 100% methanol using a reflux condenser and extracted for 24 hours. The above procedure was repeated 3 times or more, and the supernatant was concentrated under reduced pressure to obtain 4 kg of the extract. The above extract was suspended in 1 L of distilled water, and then 1 L of hexane was added thereto to dissolve it. The hexane layer was separated and vacuum-dried. The above procedure was repeated ten times to obtain a hexane fraction. To the remaining aqueous layer was added 1 L of ethyl acetate, and the ethyl acetate layer was separated and vacuum dried. This procedure was repeated 10 times to give an ethyl acetate fraction. The ethyl acetate fraction obtained was 75 g. The ethyl acetate fraction was subjected to silica gel column chromatography eluting with a hexane: ethyl acetate mixed solvent (50: 1 - > 1: 1, v / v) to obtain 25 fractions (F1 to F25). Fraction 8 (F8, 10 g) in the obtained fractions was subjected to silica gel column chromatography using a mixed solvent of chloroform and methanol (100: 1 - > 10: 1) as a mobile phase. Five small fractions F8-1 to F8 -5). The obtained third fraction (F8-3, 10g) was further subjected to silica gel column chromatography eluting with a chloroform: methanol mixed solvent (100: 1 to 10: 1), and 5 small fractions (F8-3-1, The obtained third fraction (F8-3-3) was purified by silica gel column chromatography using a hexane: ethyl acetate mixed solvent (50: 1 - > 10: 1 v / v) (2.0 g) was isolated by filtration.

Then, the analysis was the spectroscopic data (IR, Mass, ¹ H- NMR, ¹³ C-NMR, specific rotation), separated by confirming the structure of the compound obtained compound was found to jolim California. The spectroscopic results are summarized below.

C ₁₇ H ₁₆ O ₂ . [?] ²⁰ _D = -75.3 ( c 0.5, MeOH)

IR _max 3369, 1609, 1511, 1460, 1033, 918 cm ^-1

UV _max (log ε)) 207 nm (4.47), 257 nm (4.09)

^{1 H-NMR (400 MHz,} CDCl 3) δ: 7.18 (2H, d, J = 8.4 Hz, H-2 'and H-6'), 7.11 (2H, d, J = 8.8 Hz, H-2 ''andH-6'') , 6.80 (2H, d, J = 8.8 Hz, H-3' and H-5 '), 6.78 (1H, d, J = 8.4 Hz, H-3''and H- 5 ''), 6.53 (1H , d, J = 11.2Hz, H-1), 6.05 (1H, ddd, J = 16.8, 11.2, 6.4 Hz, H-4), 5.70 (1H, t, J = 11.6 , 10 Hz, H-2), 5.13-5.18 (2H, m, H-5), 4.51 (1H, dd, J = 6, 10 Hz, H-3);

^{13 C NMR (100 MHz, CDCl} 3) δ: 128.8 (C-1), 131.9 (C-2), 47.0 (C-3), 140.9 (C-4), 115.2 (C-5), 130.1 (C 1 '), 130.2 (C-2' and 6 '), 115.3 (C-3' and 5 '), 154.7 'and 6''), 115.6 (C-3''and5''), 154.2 (C-4'')

LREIMS m / z (% rel.) 252 ([M] ⁺ , 100), 237 (25), 158 (54), 145 (50), 131 (22), 107 (58).

Example 4-2. Identification of target protein of Niazoles

In order to discover a target protein to which Niazole (codename: EA270E-20-17-K1) acts in the GDP-heptose biosynthetic process, the TktA, GmhA / HddA, GmhB / HddC, and WcbK reaction mixtures of Example 2 Each 1 mM of Niazol was added to confirm the enzyme activity.

As a result, as shown in Fig. 11, the reaction product of the enzyme in the GmhB / HldE2 reaction mixture, which is an ADP-heptose biosynthesis pathway, D-glycero-D-mannose-heptose-1? -ADP (mw 619.093, m / z 618.086) peaks were detected.

As shown in FIG. 12, D-glycero-D-mannose-heptose-1? -GDP (mw 635.09, m / z), which is the reaction product of the enzyme in the GmhB / HddC reaction mixture, 634.08) was not detected.

From the above results, it can be seen that the target protein on which the niaczol acts is HddC, It was confirmed that the HddC enzyme activity of Burkholderia sp. Malay was inhibited and inhibited the GDP-heptose biosynthesis process. As such inhibition of the GDP-heptose biosynthesis process leads to structural destruction of LPS, niazoles can be useful as antibiotics or antibiotic adjuvants for treating ubiquitously by reducing the survival or toxicity of Burkholderia pseudomalai And it was found.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> Ewha University - Industry Collaboration Foundation <120> A composition for preventing or treating melioidosis comprising          nyasol <130> KPA160021-KR <160> 18 <170> KoPatentin 3.0 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for TktA <400> 1 ggcggtggtg gcggcatgac gacttcgtct cccgcctcc 39 <210> 2 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for TktA <400> 2 gttcttctcc tttgcgcccc tacgcgagca ccgccttcg 39 <210> 3 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GmhA <400> 3 ggcggtggtg gcggcatgga gaatcgcgaa ttgacgtaca t 41 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GmhA <400> 4 gttcttctcc tttgcgcccc tactgcttcc cgaaaatgga gtgct 45 <210> 5 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for HddA <400> 5 ggcggtggtg gcggcatgaa tccgacaatc attcgcgc 38 <210> 6 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for HddA <400> 6 gttcttctcc tttgcgcccc taattcgcga ttctccatgc ctgc 44 <210> 7 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for GmhB <400> 7 ggcggtggtg gcggcatgcc gaccagtccc agcaaa 36 <210> 8 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for GmhB <400> 8 gttcttctcc tttgcgcccc tactcgtgtt ctttggaaag gaaatcga 48 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for HddC <400> 9 ggcggtggtg gcggcatgag agaagcgatc atcttggccg 40 <210> 10 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for HddC <400> 10 gttcttctcc tttgcgcccc tacttgcaga ttccggaaag ctc 43 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for WcbK <400> 11 ggcggtggtg gcggcatggc aaagcgtgtt ttgattacgg 40 <210> 12 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for WcbK <400> 12 gttcttctcc tttgcgcccc tatcgggtca agaacttctc gccg 44 <210> 13 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for HldE1 <400> 13 gcggtggtg gcggcatgtc gcgcgagcag atcgc 35 <210> 14 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for HldE1 <400> 14 gttcttctcc tttgcgcccc taatgaaaca gttcgtcgta ctcgacgg 48 <210> 15 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for HldE2 <400> 15 ggcggtggtg gcggcatgcc cgcttcgttc gaacg 35 <210> 16 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for HldE2 <400> 16 gttcttctcc tttgcgcccc tagcgcgact gcgcgcg 37 <210> 17 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for HldD <400> 17 ggcggtggtg gcggcatgac cctcatcgtt accggcg 37 <210> 18 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for HldD <400> 18 gttcttctcc tttgcgcccc tacagctggc cgaacagcca ac 42

Claims (8)

A pharmaceutical composition for preventing or treating melioidosis comprising nyasol or a pharmaceutically acceptable salt thereof as an active ingredient.
2. The pharmaceutical composition according to claim 1, wherein the niacin has an antibacterial activity against an eubacteria.
3. The pharmaceutical composition according to claim 2, wherein the antimicrobial activity is achieved by inhibiting the synthesis of an aliphatic lipopolysaccharide (LPS).
4. The pharmaceutical composition according to claim 3, wherein the inhibition of synthesis of LPS is achieved by inhibiting synthesis of heptose.
5. The pharmaceutical composition according to claim 4, wherein the synthesis inhibition of heptose is achieved by inhibiting the synthesis of GDP-6-deoxy-D-heptose. .
6. The method according to claim 5, wherein the inhibition of the synthesis of GDP-6-deoxy-D-heptose is achieved by adding D-glycero-β-D-manno-heptose-1-phosphate &lt; / RTI &gt; guanosyltransferase) enzyme.
A food composition for improving melioidosis comprising nyasol or a physiologically acceptable salt thereof as an active ingredient.
The use of nyasol or a pharmaceutically acceptable salt thereof as an active ingredient for the preparation of Quasi-drug composition for antimicrobial use.

Images