JPWO2010082385A1 - Mice transplanted with human hepatocytes - Google Patents

Abstract

Providing mice transplanted with human hepatocytes. A mouse transplanted with human hepatocytes, in which the exogenous thymidine kinase gene or urokinase-type plasminogen activation gene is retained so that it can be expressed specifically in the liver, and the mouse hepatocytes are replaced with human hepatocytes A mouse transplanted with human hepatocytes.

Description

  The present invention relates to a mouse transplanted with human hepatocytes, wherein the thymidine kinase gene is retained so that it can be expressed in the liver, and a guanosine analog and hepatocytes isolated from humans are administered. Furthermore, the present invention relates to a mouse transplanted with human hepatocytes, in which the urokinase-type plasminogen activator gene is retained so that it can be expressed in the liver, and hepatocytes isolated from humans are administered. It relates to NOG mice. Also, a method for producing a mouse transplanted with human hepatocytes, comprising administering a guanosine analog and a hepatocyte isolated from a human to a mouse in which the thymidine kinase gene is expressed so as to be expressed in the liver. The present invention relates to a manufacturing method including: The present invention relates to a method for measuring plasma kinetics of a test substance using these mice, a method for identifying a metabolite of the test substance, and a method for measuring the metabolic rate of the test substance. Furthermore, the present invention relates to a mouse model in which these mice are infected with liver-directed pathogens, and a method for screening drugs and vaccines against liver-directed pathogens using the mouse models.

Several groups have developed immune-tolerant mice that retain human hepatocytes for the purpose of analyzing human-specific hepatitis virus infection, metabolism of administered drugs, or proliferation of the human liver. Has been created. In these mice, human hepatocytes are transplanted into immunodeficient mice in which the transgene of urokinase type plasminogen activator (uPA) is expressed in the liver. It is known that these mice can be infected with human-specific hepatitis virus (Non-patent Documents 1 and 2). In addition, it is known that hepatocytes derived from such mice express an enzyme found in human liver (Non-patent Document 3), and metabolites specific to humans are produced from test substances (Non-patent Document 4). ing.
Even if the replacement rate of human hepatocytes is as low as about 50% and the survival time after transplantation of human hepatocytes is about 50 days, it can be used for certain purposes such as hepatitis virus infection tests as described above. Is known (Patent Documents 1 and 2). On the other hand, for the purpose of measuring, for example, the plasma kinetics and metabolites of human therapeutic drugs, it is necessary to eliminate as much as possible the effects of hepatocytes derived from the host animal. An increase in the substitution rate was demanded. However, since the uPA transgene activates plasminogen, which regulates the activity of matrix metalloproteases important for hepatocyte proliferation, the expression of the uPA transgene itself is sustained and progressive to hepatic stem cells. Causes injury. Therefore, the embryonic lethality of the homozygote of the uPA transgene is as high as 30%, and the transplantation time of hepatocytes is limited to 5 to 17 days of age (Patent Document 1). In order to prevent letting the homozygote obtained after the maintenance of the disease occur, treatment such as transplantation of rat hepatocytes is necessary (Patent Document 2), and maintenance of the strain requires complicated work. The frequency of creating mice with the desired characteristics as well as necessary was also very low. It is also known that there are many side effects such as kidney injury and low reproductive rate. Therefore, as an attempt to promote the growth of the host and increase the replacement rate of human hepatocytes, a drug for defense against attack from human complement is administered to the host mouse (Patent Document 3), or human growth hormone. Attempts have been made to administer (Patent Document 4). Attempts have also been made to increase the replacement rate of human hepatocytes by administering anti-asialo GM1 antibody, which is an antibody that removes mouse NK cells involved in rejection, the day before transplantation of human hepatocytes. It is known that the replacement rate of human hepatocytes in such mice remains at about 70%.
Recently, a chimera mouse having a fumaryl acetoacetate hydrolase (Fah) knockout mouse (Fah ^{− / −} / Rag2 ^{− / −} / II2rg ^{− / −} ) (FRG mouse) as a host has been created (Non-patent Document 4). However, since adenovirus itself does not have species specificity, there is a possibility of injury to human hepatocytes due to its persistence in mice. In fact, the level of human serum albumin in FRG mice is lower than expected from the replacement level of human hepatocytes in FRG mice, and some genes for drug metabolizing enzymes specific for human hepatocytes are FRG Expression at the level expected from the replacement level of human hepatocytes in mice was not observed (Non-patent Document 5).

International Publication No. WO2001067854 Pamphlet International Publication No. WO2001087059 Pamphlet International Publication No. WO2003088081 Pamphlet International Publication No. WO2007004547 Pamphlet

Dandri, M .; et al. J. et al. Hepatol. (2005) 42, 54-60 Tateno, C.I. et al. Am. J. et al. Pathol. (2004) 165, 901-912 Katoh, M .; et al. J. et al. Pharm. Sci. (2007) 96, 428-437 Azuma, H .; et al. Nat. Biotechnol. (2007) 25, 903-910 Shafritz, DA. et al. Nat. Biotechnol. (2007) 25, 871-872 Sandgren, EP. et al. Cell (1991) 66, 245-256.

The present invention has been made in view of such a situation, and the object thereof is a mouse transplanted with human hepatocytes, wherein the thymidine kinase gene is retained in the liver so that it can be expressed, and a guanosine analog, And a mouse administered with hepatocytes isolated from human, a method for producing the mouse, a mouse transplanted with human hepatocytes, and the urokinase-type plasminogen activating gene can be expressed in the liver. NOG mice to which hepatocytes isolated and administered from humans were administered, methods for measuring plasma kinetics of a test substance using these mice, and identifying metabolites of the test substance using the mice A method for measuring a metabolic rate of a test substance using the mouse, a mouse model in which the mice are infected with a liver-directed pathogen, the mouse model, And to provide methods of screening for drugs and vaccines against hepatotropic pathogens using.
The present specification more specifically includes the following inventions;
[1] A mouse in which an exogenous thymidine kinase gene is retained so that it can be expressed specifically in the liver, the mouse hepatocytes are replaced with human hepatocytes, and human hepatocytes are transplanted,
[2] Mice transplanted with human hepatocytes of [1], wherein the liver has the three-dimensional structure or function of human liver,
[3] A mouse into which a human hepatocyte of [1] or [2], wherein the thymidine kinase gene is a human herpes simplex virus type 1-thymidine kinase (HSV-tk) gene,
[4] Mice transplanted with human hepatocytes according to any one of [1] to [3], wherein 75% or more of mouse hepatocytes have been replaced with human hepatocytes,
[5] Mice transplanted with human hepatocytes according to any one of [1] to [3], wherein 80% or more of mouse hepatocytes have been replaced with human hepatocytes,
[6] Mice transplanted with human hepatocytes according to any one of [1] to [3], wherein 90% or more of mouse hepatocytes have been replaced with human hepatocytes,
[7] A mouse into which human hepatocytes of any one of [1] to [3], wherein 95% or more of mouse hepatocytes have been replaced with human hepatocytes,
[8] A mouse into which the human hepatocyte of any one of [1] to [7], wherein the mouse is an immunodeficient mouse,
[9] The immunodeficient mice are NOD / SCID mice, dKO mice lacking RAG-2 and IL-2Rγc (RAG-2 KO, IL-2R ^null ), or NOG (NOD / SCID / γc ^null ) mice [ 8] mouse transplanted with human hepatocytes,
[10] dKO mice lacking RAG-2 and IL-2Rγc are Balb / c dKO mice (RAG-2 KO, IL-2R ^null ) or NOD dKO mice (RAG-2 KO, IL-2R ^null ). A mouse into which a human hepatocyte of [9] is transplanted,
[11] A mouse into which a human hepatocyte of any one of [1] to [10], wherein hepatocytes isolated from humans are human hepatocyte cell lines,
[12] A mouse into which human hepatocytes of [11], wherein the human hepatocyte cell line is HepG2, Hep3B, or HuH-7,
[13] A mouse transplanted with any one of the human hepatocytes of [1] to [10], wherein hepatocytes isolated from humans are primary cultured hepatocytes,
[14] When the thymidine kinase gene is placed under the control of an albumin promoter, LST-1 promoter, α-fetoprotein promoter, or α-TTP promoter, the thymidine kinase gene is retained so that it can be specifically expressed in the liver [ 1] to [13] a mouse transplanted with human hepatocytes of any one of
[15] NOG (NOD) transplanted with human hepatocytes, in which the urokinase-type plasminogen activator gene is retained so that it can be expressed specifically in its liver, and mouse hepatocytes are replaced with human hepatocytes. / SCID / γc ^null ) mutation mouse,
[16] The mouse according to [15], wherein the urokinase type plasminogen activator gene is a mouse urokinase type plasminogen activator gene,
[17] Mice transplanted with human hepatocytes according to [15] or [16], wherein 75% or more of mouse hepatocytes are replaced with human hepatocytes,
[18] Mice transplanted with human hepatocytes according to [15] or [16], wherein 80% or more of mouse hepatocytes are replaced with human hepatocytes,
[19] Mice transplanted with human hepatocytes according to [15] or [16], wherein 90% or more of mouse hepatocytes have been replaced with human hepatocytes,
[20] Mice transplanted with human hepatocytes of [15] or [16], wherein 95% or more of mouse hepatocytes are replaced with human hepatocytes,
[21] A mouse transplanted with a human hepatocyte of any of [15] to [20], wherein the hepatocyte isolated from human is a human hepatocyte cell line,
[22] A mouse into which the human hepatocytes of [21], wherein the human hepatocyte cell line is HepG2, Hep3B, or HuH-7,
[23] A mouse transplanted with any one of the human hepatocytes of [15] to [20], wherein hepatocytes isolated from humans are primary cultured hepatocytes,
[24] The urokinase-type plasminogen activator gene is placed under the control of the albumin promoter, LST-1 promoter, α-fetoprotein promoter, or α-TTP promoter, so that the urokinase-type plasminogen activator gene is A mouse transplanted with any of the human hepatocytes of [15] to [23], which is specifically expressed and retained in the liver,
[25] A mouse having a NOG (NOD / SCID / γc ^null ) mutation transplanted with a human hepatocyte, wherein the hepatocyte of the mouse is replaced with a human hepatocyte,
[26] The mouse according to [24], wherein the urokinase-type plasminogen activator gene and the foreign thymidine kinase gene are retained so that they can be specifically expressed in the liver.
[27] A method for producing a mouse in which human hepatocytes are transplanted and the mouse hepatocytes are replaced with human hepatocytes so that the thymidine kinase gene is retained in the liver so that it can be expressed specifically in the liver. Human hepatocytes are transplanted, comprising administering to the mouse a suicide substrate and hepatocytes isolated from human, damaging the mouse hepatocytes and replacing the mouse hepatocytes with human hepatocytes. Mouse production method,
[28] A method for producing a mouse transplanted with human hepatocytes of [27], wherein the thymidine kinase gene is a human herpes simplex virus type 1-thymidine kinase (HSV-tk) gene,
[29] A method for producing a mouse transplanted with human hepatocytes of [27] or [28], wherein the suicide substrate is a substance that is metabolized to a toxic substance by thymidine kinase,
[30] A method for producing a mouse transplanted with human hepatocytes of [29], wherein the substance to be metabolized is acyclovir or ganciclovir,
[31] A method for producing a mouse transplanted with the human hepatocytes of any of [27] to [30], wherein the mouse is an immunodeficient mouse,
[32] The human hepatocyte of [31], wherein the immunodeficient mouse is a NOD / SCID mouse, a dKO mouse lacking RAG-2 and IL-2Rγc (RAG-2 KO, IL-2R ^null ), or a NOG mouse A method for producing a transplanted mouse,
[33] A method for producing a mouse into which a human hepatocyte of any one of [27] to [32], wherein the hepatocyte isolated from human is a human hepatocyte cell line,
[34] The method according to [33], wherein the human hepatocyte cell line is HepG2, Hep3B, or HuH-7.
[35] A method for producing a mouse into which a human hepatocyte of any one of [27] to [32], wherein hepatocytes isolated from humans are primary cultured hepatocytes,
[36] The thymidine kinase gene is retained under control of an albumin promoter, LST-1 promoter, α-fetoprotein promoter, or α-TTP promoter so that the thymidine kinase gene can be specifically expressed in the liver. A method for producing a mouse transplanted with the human hepatocytes of any one of [27] to [35],
[37] A mouse transplanted with human hepatocytes obtained by any of the methods of [27] to [36],
[38] A method for measuring plasma kinetics of a test substance using the mouse of any one of [1] to [26] and [37],
[39] A method for identifying a metabolite of a test substance using the mouse of any one of [1] to [26] and [37],
[40] A method for identifying a metabolite of a test substance using hepatocytes isolated from the mouse of any one of [1] to [26] and [37],
[41] A method for measuring the metabolic rate of a test substance using the mouse of any one of [1] to [26] and [37],
[42] The following steps:
(I) a step of producing a mouse according to any one of [1] to [26] and [37]; and (ii) a step of inoculating the mouse according to (i) with human HCV;
A method for producing a mouse infected with human hepatitis C virus (HCV), comprising:
[43] A mouse infected with human hepatitis C virus (HCV) produced by the method of [42],
[44] The following steps:
(I) a step of administering human HCV to the mouse of any one of [1] to [26] and [37]; and (ii) human HCV is administered after a sufficient period of time for human HCV replication to occur in the host. Isolating from an infected host;
A method for culturing human hepatitis C virus (HCV),
[45] The following steps:
(I) a step of administering a candidate drug to any one of the mice [1] to [26] and [37]; and (ii) a step of analyzing the effect of the candidate drug on HCV infection, which has not been administered. A reduction in the amount of human HCV infection relative to the amount of infection in a mouse or in a mouse prior to administration of a candidate drug means anti-HCV activity of the drug;
A method for screening a candidate drug having anti-HCV activity,
[46] The method of [45], wherein the candidate agent is administered before infection with human HCV,
[47] The method according to [45] or [46], wherein the candidate drug having anti-HCV activity is an anti-HCV antibody or an HCV-binding fragment thereof,
[48] The following steps:
(I) the step of reconstituting the immunity of the mouse of any one of [1] to [26] and [37];
(Ii) administering a candidate vaccine to the mouse of (i); and (iii) analyzing the effect of the vaccine on HCV infection, in an untreated mouse or in a mouse before the vaccine administration A decrease in the amount of human HCV infectious relative to the amount of infectious means the anti-HCV activity of the vaccine;
A method for screening candidate vaccines having anti-HCV activity for use in active immunotherapy,
[49] The following steps:
(I) the step of reconstituting the immunity of the mouse of any one of [1] to [26] and [37];
(Ii) administering a candidate vaccine for therapeutic vaccination to the mouse of (i); and (iii) analyzing the effect of the vaccine on HCV infection, comprising: A reduction in the amount of human HCV infection relative to the amount of infection in mice prior to vaccine administration means the anti-HCV activity of the vaccine;
Screening a candidate vaccine for therapeutic vaccination having anti-HCV activity, comprising:
[50] A method for searching for hepatic stem cells using the mouse of any one of [1] to [26] and [37], comprising identifying hepatic stem cells from liver tissue engrafted in the mouse,
[51] A method for collecting a cell population containing hepatic stem cells using the mouse of any one of [1] to [26] and [37], wherein the cell population contains hepatic stem cells from liver tissue engrafted in the mouse A method comprising collecting
[52] Human liver tissue reconstructed using the mouse of any one of [1] to [26] and [37],
[53] A mouse in which a thymidine kinase gene and / or a urokinase-type plasminogen activator gene are retained so that they can be expressed in the liver, and human hepatocytes can be engrafted in the liver,
[54] The mouse of [53], wherein the thymidine kinase gene is herpes simplex virus type 1 thymidine kinase,
[55] The mouse of [53] or [54], wherein the mouse is an immunodeficient mouse,
[56] The immunodeficient mouse is a NOD / SCID mouse, a dKO mouse lacking RAG-2 and IL-2Rγc (RAG-2 KO, IL-2R ^null ), or a NOG (NOD / SCID / γc ^null ) mouse. [55] mice and [57] dKO mice deficient in RAG-2 and IL-2Rγc are Balb / c dKO mice (RAG-2 KO, IL-2R ^null ), or NOD dKO mice (RAG-2 KO). IL-2R ^null ), [56] mice,
I will provide a.
This specification includes the contents described in the specification and / or drawings of Japanese Patent Application No. 2009-008097 which is the basis of the priority of the present application.

FIG. 1 is a diagram showing the structure of a herpes simplex virus type 1 thymidine kinase (UL23 or HSVtk) gene expression unit.
FIG. 2 is a diagram showing a restriction map and structure of the transgene of the TK-NOG mouse, and the position of the probe used in the examples.
FIG. 3 is a diagram showing the human albumin concentration in the serum of TK-NOG mice transplanted with human hepatocytes.
FIG. 4 is a diagram showing proteins in the serum of TK-NOG mice transplanted with human hepatocytes.
FIG. 5 is a view showing mRNA expressed in the liver of a TK-NOG mouse transplanted with human hepatocytes.
FIG. 6 shows the results of histology and immunohistochemical staining of the liver of TK-NOG mice transplanted with human hepatocytes.
FIG. 7 is a diagram showing carboxyfluorescein (CF) excretion into the capillary bile duct (BC) in the liver of TK-NOG mice transplanted with human hepatocytes administered with CFDA.
FIG. 8 shows liver h-CK8 / of two different TK-NOG mice obtained 52 days after transplantation of human hepatocytes in the liver of TK-NOG mice transplanted with CFDA and receiving human hepatocytes. It is a figure which shows the result of 18 immunohistochemical staining.
FIG. 9 is a diagram showing the amount of CF secreted into feces in TK-NOG mice transplanted with human hepatocytes administered with CFDA.
FIG. 10 shows the presence of bile CF metabolites in TK-NOG mice transplanted with human hepatocytes administered with CFDA.
FIG. 11 is a diagram showing analysis results of bile mice and human transferrin in TK-NOG mice transplanted with human hepatocytes administered with CFDA.
FIG. 12 is a diagram showing immunohistochemical staining of H & E and glutamine synthetase (GS) in liver sections obtained from TK-NOG mice transplanted with human hepatocytes.
FIG. 13 is a diagram showing the position of the HSVtk expression unit on the chromosome.
FIG. 14 is a diagram showing the results of molecular analysis of the TK-NOG mouse transgene.
FIG. 15 shows the results of RT-PCR analysis of HSVtk transgene expression.
FIG. 16 shows the activities of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in ganciclovir (GCV) -administered TK-NOG mice (Tg HSVtk) and non-transgenic NOG mice (NTg). .
FIG. 17 is a diagram showing the liver of a ganciclovir (GCV) -administered TK-NOG mouse (Tg HSVtk).
FIG. 18 is a diagram showing the serum human albumin concentration of TK-NOG mice to which GCV was administered and human hepatocytes were transplanted.
FIG. 19 is a diagram showing the correlation between human serum albumin concentration and substitution index (RI) in TK-NOG mice transplanted with human hepatocytes administered with GCV.
FIG. 20 is a diagram showing human gene expression in TK-NOG mice to which human hepatocytes were transplanted and repopulated with GCV-administered human hepatocytes.
FIG. 21 is a diagram showing the results of renal histopathological analysis in TK-NOG mice to which human hepatocytes were transplanted and repopulated with GCV administered human hepatocytes.
FIG. 22 is a diagram showing the results of double immunostaining of mouse albumin and human albumin staining of the liver of a TK-NOG mouse in which human hepatocytes have been transplanted and human hepatocytes have repopulated.
FIG. 23 is a diagram showing the results of microdissection of clonally proliferating human hepatocyte colonies in TK-NOG mice in which human hepatocytes were transplanted and human hepatocytes re-proliferated.
FIG. 24 is a diagram showing the results of PCR analysis for distinguishing between human and mouse hepatocytes.
FIG. 25 is a diagram showing the structure of a urokinase-type plasminogen activator (uPA) gene expression unit.
FIG. 26 is a diagram showing a restriction map and structure of the transgene of uPA-NOG mouse, and the position of the probe used in the example.
FIG. 27 shows the results of RT-PCR analysis of uPA transgene expression.
FIG. 28 shows the activity of serum alanine aminotransferase (ALT) in hemizygous (Tg / +) and homozygous (Tg / Tg) transgenic uPA-NOG mice.
FIG. 29 is a diagram showing a macroscopic image and a hepatocyte damage image of the liver of a homozygous transgenic uPA-NOG mouse (Tg / Tg). The scale bar in FIG. 29 is 100 μm. P indicates the portal tract and C indicates the central vein.
FIG. 30 is a diagram showing the results of molecular analysis by Southern blotting of a uPA transgene introduced into a uPA-NOG mouse.
FIG. 31 is a graph showing liver macroscopic images of hemizygous transgenic uPA-NOG mice (Tg / +) and homozygous transgenic uPA-NOG mice (Tg / Tg1) transplanted with human hepatocytes.
FIG. 32 is a graph showing changes in serum human albumin concentration and changes in body weight of uPA-NOG mice.
FIG. 33 shows immunoblotting analysis of sera from hemizygous (Tg / +) and homozygous (Tg / Tg1 and 2) transgenic uPA-NOG mice transplanted with mouse serum, human serum, and human hepatocytes. It is a figure which shows the result.
FIG. 34 shows the results of histology and immunohistochemical staining of homozygous (Tg / Tg1 and 2) transgenic uPA-NOG mouse liver transplanted with human hepatocytes.
FIG. 35 represents the metabolism of Debrisoquin and S-Warfarine in the mouse body with a humanized liver.
FIG. 36 represents detection of human proliferating hepatocytes expressing Ki-67 antigen in mice with humanized liver.
FIG. 37 shows engraftment of human hepatocytes stained with human cytokeratin 8/18 antibody in TK-Balb / c dKO mice and NOD dKO mice.

Hereinafter, the present invention will be described in detail.
The thymidine kinase disclosed in the present invention originally has an enzyme activity for phosphorylating thymidine to synthesize thymidylate in vivo, but it is a rate-limiting step in normal cells and is hardly detected. Therefore, a suicide substrate that is toxic by being metabolized by thymidine kinase is introduced with a transgene of thymidine kinase and exhibits cytotoxicity only to cells having thymidine kinase activity. Used as a selective therapeutic agent. As such a suicide substrate, a guanosine analog can be preferably used. More preferable examples of such guanosine analogs include ganciclovir (GCV) and acyclovir, which are widely used as antiviral agents.
For example, ganciclovir is phosphorylated by thymidine kinase, an enzyme inherent in the virus, and finally activated ganciclovir-triphosphate by endogenous enzymes guanylate kinase and thymidine kinase in human cells. Is metabolized. Active ganciclovir-triphosphate inhibits DNA polymerase by competitively antagonizing deoxyguanosine-triphosphate (dGTP), a substrate for viral DNA polymerase. Therefore, only viral replication in infected cells infected with the virus is inhibited. By the same mechanism, it has been clarified that in lymphocytes introduced with the HSV-tk transgene, ganciclovir is activated and DNA synthesis is inhibited, thereby selectively killing the cells. Yes.
In the present invention, an exogenous thymidine kinase gene is introduced so as to be specifically expressed in the mouse liver. The biological species from which the thymidine kinase gene used in the present invention is derived may be a human or mammal, and may be a prokaryotic cell or a virus, and is not limited to the biological species from which it is derived. In the present invention, human herpes simplex virus type 1-thymidine kinase (HSV-tk) is preferably exemplified as a thymidine kinase used as a specific embodiment of thymidine kinase. For example, when ganciclovir is administered to a plurality of cell groups, only cells expressing the HSV-tk gene are killed. For this reason, the HSV-tk gene is generally called a “suicide gene”. In the present invention, the HSV-tk gene refers to, for example, a gene represented by the polynucleotide sequence represented by SEQ ID NO: 1, but is not limited thereto.
It is known that there are a plurality of codons encoding one amino acid. Accordingly, for example, any polynucleotide sequence can be used for the mouse of the present invention as long as it encodes an amino acid sequence encoded by the polynucleotide sequence shown in SEQ ID NO: 1 or an enzyme active portion thereof. Generally, when the amino acid sequence of a polypeptide having an enzymatic activity such as thymidine kinase is slightly changed, that is, one or more amino acids in the amino acid sequence are substituted or deleted, or one or more amino acids are It is a well-known fact that the enzyme activity of the polypeptide may be maintained even when added. For example, a variant may contain conservatively substituted sequences, meaning that certain amino acid residues may be replaced by residues with similar physicochemical characteristics. Yes. Non-limiting examples of conservative substitutions include substitution between aliphatic group-containing amino acid residues such as substitution between Ile, Val, Leu or Ala, or polar group-containing amino acid residues such as substitution between Lys and Arg. Substitution between groups is included. Therefore, for example, a DNA encoding a mutant of thymidine kinase having such a modification in the amino acid sequence encoded by the polynucleotide sequence shown in SEQ ID NO: 1 or an enzyme active portion thereof and having the enzyme activity of thymidine kinase Can also be used for the mouse of the present invention.
Mutations resulting from addition, deletion or substitution of amino acids can be performed by, for example, site-directed mutagenesis (for example, Nucleic Acid Research, Vol. 10, No. 20, p. 6487-), which is a well-known technique, in DNA encoding the same. 6500, 1982). As used herein, “one or more amino acids” refers to a number of amino acids that can be added, deleted or substituted by site-directed mutagenesis, preferably 1 or several, more preferably 1 to 5 More preferably, 1 to 4, more preferably 1 to 3, and still more preferably 1 or 2. Site-directed mutagenesis can be performed, for example, using synthetic oligonucleotide primers complementary to the single-stranded phage DNA to be mutated, as well as the specific mismatch that is the desired mutation, as follows. That is, host cells are transformed with double-stranded DNA synthesized as a complementary strand by phage using the synthetic oligonucleotide as a primer. Transformed bacterial cultures are seeded on agar and plaques are formed from single cells containing phage. Theoretically, 50% of new colonies contain phage with mutations as single strands and the remaining 50% have the original sequence. The obtained plaque is hybridized with a synthetic probe labeled by kinase treatment at a temperature at which it hybridizes with DNA having the desired mutation and does not hybridize with DNA having the original strand. The DNA is then recovered from the plaque that hybridizes to the probe.
In addition to the above-mentioned site-directed mutagenesis, a gene is treated with a mutagen as a method for substituting, deleting, or inserting one or more amino acids that do not lose its activity in the amino acid sequence of the enzyme. A method and a method of selectively cleaving a gene, then removing, adding or replacing selected nucleotides, and then ligating are also preferable.
In addition, a biologically active thymidine kinase that hybridizes under conditions of mild or severe stringency to, for example, a polynucleotide sequence encoding thymidine kinase described in SEQ ID NO: 1 disclosed herein. Isolated DNA and RNA encoding can also be used in the mouse of the present invention. Conditions for hybridization with mild stringency are described in, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2 ed. Vol. 1, pp. 1.101-104, Cold Spring Harbor Laboratory Press, (1989). As defined by Sambrook et al., Mild stringency conditions include 5 × SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0) pre-wash solution and about 55 ° C., 5 ×. SSC, overnight hybridization conditions. Severe stringency conditions include higher temperature hybridization and washing. At that time, the temperature and the salt concentration of the cleaning solution can be appropriately adjusted according to various factors such as the length of the probe. For example, a condition in a range of 5 × SSC or less and 20 ° C. or more is preferable.
Furthermore, when calculated using the polynucleotide sequence encoding thymidine kinase set forth in SEQ ID NO: 1 and BLAST, etc. (eg, using default or default parameters), at least 80% or more, preferably 90% In addition, isolated DNA and RNA that encodes biologically active thymidine kinase having an identity of 95% or more, more preferably 97% or more, and more preferably 97% or more are also used for the mouse of the present invention. can do.
“Thymidine kinase gene is retained so that it can be expressed in the liver of a mouse” means that the thymidine kinase gene is contained in a mouse hepatocyte and expressed in the cell.
In order to allow the thymidine kinase gene of the present invention to be expressed in the liver of a mouse, a regulatory gene functioning in the liver can be appropriately used. As the regulatory gene, a regulatory gene of a gene encoding a protein functioning in hepatocytes is preferably used. Here, “regulatory gene” refers to a sequence on DNA that acts to increase or decrease gene transcription efficiency, and includes a promoter, an enhancer, an upstream activation sequence, a silencer, an upstream repression sequence, an attenuator, and the like. It is not limited to these. The biological species from which the regulatory gene is derived is not limited to a specific biological species. In order to allow more appropriate expression in the liver of the mouse, a regulatory gene derived from the mouse can be preferably used.
The promoter is not particularly limited as long as the thymidine kinase gene is a promoter expressed in the liver. Examples include albumin promoter, organic anion transporter LST-1 promoter, α-fetoprotein promoter, α-tocopherol transport protein (α-TTP) gene promoter, and the like.
The expression mechanism of genes that are expressed specifically in the liver (gene promoter analysis) has been studied very well. That is, cells such as ubiquitous transcription regulatory factor binding sites, liver-specific transcription factor binding sites abundantly present in the liver, and hormones, etc., in the 5 ′ upstream region of the transcription start point of the gene specifically expressed in the liver It is known that upstream activation sequences that respond to external stimuli are packed in a relatively narrow region. Preferred examples of such transcription factors include HNF-1, HNF-3, HNF-4, HNF-6, C / EBP, DBP and the like. In the present invention, since the thymidine kinase gene is retained so that it can be expressed in the mouse liver, the thymidine kinase gene is linked to an upstream activation sequence that functions in the mouse liver.
Therefore, for example, a certain region of the above-mentioned albumin promoter, organic anion transporter LST-1 promoter, α-fetoprotein promoter, α-tocopherol transport protein (α-TTP) gene promoter region is used for the above-mentioned linkage. An upstream activation sequence that binds a liver-specific transcription factor potentially contained by can be used. In another embodiment, a liver-specific upstream activation sequence whose sequence has already been identified can be suitably incorporated as a foreign gene by gene recombination techniques.
Further, it has been clarified that enhancers that increase the level of transcription from a promoter exist not only in the upstream activation sequence but also downstream from the transcription start point. For example, in a transgenic mouse having a human angiotensinogen gene having a total length of 14 kb including the 5 ′ upstream 1.3 kb and 3 ′ downstream regions, high expression of the gene is observed in the liver. Furthermore, in HepG2 cells derived from human liver cancer, it was confirmed that an enhancer was present in a 3.8 kb DNA fragment downstream from the transcription start site of the gene. In the present invention, such an enhancer can also be suitably used to express the thymidine kinase gene in a liver-specific manner.
Furthermore, in the present invention, a 3 ′ untranslated sequence containing a poly A addition signal can also be suitably used for expressing the thymidine kinase gene in a liver-specific manner.
In the present invention, since the thymidine kinase gene is retained so that it can be expressed in the mouse liver, the thymidine kinase gene is linked to an upstream activation sequence that functions in the mouse liver. Furthermore, a 3 ′ untranslated sequence including an enhancer and a poly A addition signal can be suitably linked appropriately. An integrated vector that adjusts the gene expression unit for holding the thymidine kinase gene so that it can be expressed in the liver of the host is inserted by inserting the gene group thus linked into a vector containing a marker gene such as a drug resistance gene. Produced.
A transgenic mouse into which a gene expression unit prepared from the integration vector has been introduced can be produced. For example, transgenic mice can be suitably produced according to known methods (Proc. Natl. Acad. Sci. USA (1980) 77, 7380-4).
Specifically, a gene expression unit prepared so that the target thymidine kinase gene can be expressed in the liver of a host is introduced into a totipotent cell of a mouse. Suitable examples of totipotent cells into which the gene is introduced include fertilized eggs and early embryos, and cultured cells such as ES cells having multipotency. For example, by mating a normal male mouse with a female mouse to which an ovulation inducing agent has been administered, fertilized eggs into which the gene expression unit can be introduced can be suitably recovered. Generally, a gene expression unit is introduced into a mouse fertilized egg by microinjection into the male pronucleus. After in vitro culture of fertilized egg cells, cells that are considered to have successfully introduced the gene expression unit are screened. The screened cells are transplanted into the surrogate mother's oviduct, and then a transgenic chimeric mouse is born. As a surrogate mother, a female who has been pseudopregnant by mating with a male whose vagina has been cut is usually used.
A target transgenic mouse can be produced by selecting an individual into which a transgene has been incorporated into a somatic cell and a germ cell from the obtained individual. More specifically, it can be produced by the method described in the examples described later.
Usually, when human hepatocytes are transplanted into mice, human hepatocytes are rejected due to an immune response to the transplantation of xenogeneic cells. Therefore, in the present invention, xenogeneic cell transplantation is performed as a mouse transplanted with human hepatocytes. An immunodeficient mouse in which the immune response to is inactivated can be preferably used. Such an immunodeficient mouse can also be preferably produced by irradiating the whole body with X-rays. In addition, it may be a mouse that is preferably genetically deficient in its immune function. Examples of immunodeficient animals include mice obtained by administering asialo GM1 antibody or TMβ1 to generally available nude mice or SCID mice, and X-irradiated mice.
In the present invention, preferred examples of immunodeficient mice whose genetic immune function is deficient include NOD / SCID mice and Rag2 knockout mice that do not have T cells or B cells. In addition, knockout animals obtained by multiplying these NOD / SCID mice and Rag2 knockout mice with IL-2Rγ knockout (hereinafter referred to as dKO (double knockout) animals) can also be suitably used. For example, dKO mice (Rag2 KO, IL-2R ^null ) can be used. In the present invention, a dKO mouse having a genetic background of Balb / c is referred to as a Balb / c dKO mouse, and a dKO mouse having a genetic background of NOD is referred to as a NOD dKO mouse. Furthermore, in order to exclude the influence by immune cells such as NK cells observed in the mouse, in addition to the embodiment in which the Asialo GM1 antibody is administered to the SCID mouse as described above, it is used in the present invention. Another suitable mouse is a NOD / SCID / γc ^null (NOD / Shi-scid, IL-2RγKO mouse, which is a mouse derived from a NOD / SCID mouse and knocking out a common γ chain of IL-2 receptor. The NOG mouse is also referred to as “NOG mouse” (registered trademark) (Japanese Patent No. 3753321). Since the presence of lymphocytes is not observed in the NOG mouse, the NOG mouse does not show NK activity and is deficient in tree cell function.
As a mouse in which the thymidine kinase gene of the present invention is retained so that it can be expressed in its liver, a gene designed to retain the target thymidine kinase gene so that it can be expressed in the liver of the host is contained in the fertilized egg of the immunodeficient mouse. Preferred examples include transgenic mice resulting from the introduction. In addition, from the offspring born as a result of mating with the transgenic mouse resulting from the introduction of the gene into a fertilized egg of an inbred strain of the mouse and the mouse that is not deficient in immune function, An immunodeficient mouse selected to retain the traits of the immunodeficient mouse and to retain the target thymidine kinase gene so that it can be expressed in the liver of the host can also be suitably used. Furthermore, from the offspring born as a result of mating with the transgenic mouse resulting from the introduction of the gene into the fertilized egg of the mouse that is an inbred strain of the mouse and the mouse that is partially deficient in immune function, An immunodeficient mouse selected to retain the traits of the immunodeficient mouse and to retain the target thymidine kinase gene so that it can be expressed in the liver of the host can also be suitably used. More specifically, from the offspring born as a result of mating with the NOD / SCID transgenic mouse resulting from the introduction of the gene into fertilized eggs of NOG mice and NOD / SCID mice, the characteristics of NOG mice are retained, and Mice selected as those in which the target thymidine kinase gene is expressed and retained in the liver of the host, TK-NOG mice and Balb / cA dKO mice (RAG-2 KO, IL-2R ^null ) are crossed, and further Balb TK-Balb / cA dKO mice (HSV-Tk (+), SCID wild, RAG-2 KO, IL-2R ^null ), or TK-NOG mice and NOD produced by repeated mating with / cA dKO mice dKO mice ^{(RAG-2 KO, IL-} 2R null) crossed the further N TK-NOD dKO mice made by repeating mating and D dKO mice (HSV-Tk (+), SCID wild, RAG-2 KO, IL-2R null) or the like may be mentioned as preferred examples. In the present invention, a mouse selected to retain the trait of the NOG mouse and to retain the target thymidine kinase gene so that it can be expressed in the liver of the host is referred to as a TK-NOG mouse.
As a result of administration of the guanosine analog to a mouse in which the thymidine kinase gene of the present invention is retained so that it can be expressed in the liver, the guanosine analog is metabolized into a toxic substance in the hepatocyte of the mouse. Liver injury occurs in mice. Ganciclovir mentioned as a suitable example of the guanosine analog is metabolized to ganciclovir-triphosphate in mouse hepatocytes and causes liver injury in the mouse. The administration method of the guanosine analog to the mouse can be freely selected. For example, intravenous, intramuscular, subcutaneous, intradermal, intraperitoneal, or even application on the skin can be selected as appropriate. In addition to being administered into the mouse body by these usual routes, it can also be administered into the mouse body by mixing during feeding. The dose of the guanosine analog is not limited, but is 0.1 to 10 mg / Kg body weight, preferably 0.5 to 1.5 mg / Kg body weight.
In addition to the above, in addition to the administration of ganciclovir, carbon tetrachloride, D-galactosamine, pyrrolodine can be used as a method for causing liver injury in mice in which the thymidine kinase gene of the present invention is expressed and retained in the liver. A treatment with a known liver injury inducer such as alkaloid or 2-acetylaminofluorene and a surgical treatment such as surgical hepatectomy are also preferred. Furthermore, in another aspect, administration of an anti-mouse Fas antibody to the mouse can cause liver injury in the mouse. The anti-mouse Fas antibody does not bind to Fas antigen expressed in human hepatocytes, but binds to Fas antigen expressed in mouse hepatocytes, thereby specifically causing apoptosis in mouse hepatocytes.
In addition to the above, a mouse having a NOG mutation in which the urokinase-type plasminogen activator gene is retained in the liver so that it can be expressed in place of the thymidine kinase gene of the present invention is also preferably used. That is, a transgenic mouse resulting from introduction of a gene expression unit prepared to hold the urokinase-type plasminogen activator gene so that it can be expressed in the liver of the host into a totipotent cell of a mouse having the NOG mutation is preferred. Used for. As the urokinase-type plasminogen activator gene, for example, the polynucleotide sequence encoding the mouse urokinase-type plasminogen activator described in SEQ ID NO: 47 can be used. In producing the gene expression unit, a method similar to the method using the thymidine kinase gene is preferably used.
Furthermore, a mouse having a NOG mutation in which both a thymidine kinase gene and a urokinase-type plasminogen activator gene are retained so that they can be expressed in the liver is also preferably used. It is possible to optimize the engraftment of human hepatocytes administered by appropriately selecting when liver injury is caused by the action of thymidine kinase and when liver injury is caused by the action of urokinase-type plasminogen activator it can.
For example, the mouse is appropriately combined with a mouse having a thymidine kinase gene retained in an expressible manner in the liver and a mouse having a NOG mutation in which a urokinase-type plasminogen activator gene is retained in the liver. It can be suitably obtained by breeding and selecting a progeny mouse having both a thymidine kinase gene and a urokinase-type plasminogen activator gene that can be bred and expressed in the liver and has a NOG mutation. In addition, for example, a gene expression unit prepared because the urokinase-type plasminogen activator gene is retained so that it can be expressed in the liver of the host is used in a mouse in which the thymidine kinase gene is retained so that it can be expressed in the liver of the host. It can also be produced by operations such as introduction into totipotent cells.
By causing liver injury in the mouse as described above, human hepatocytes transplanted into the mouse are engrafted in the liver of the mouse instead of the hepatocyte of the mouse causing the liver injury. Contrary to the death of mouse hepatocytes, the proliferation of human hepatocytes engrafted in the mouse liver results in the production of chimeric mice in which the number of human hepatocytes exceeds a certain level. As the chimeric mouse, 50% or more, preferably 70% or more, more preferably 75% or more, further preferably 80% or more, more preferably 90% or more, particularly preferably 95% or more of the mouse liver is human. Preferred examples include mice occupied by the hepatocytes. The proportion occupied by human hepatocytes, as suitably shown in the examples, is a method of calculating from a stained image of an antibody recognizing a marker specific to human and mouse hepatocytes, human serum albumin, etc. A method for calculating from a quantitative value of a serum marker is known. Furthermore, the liver of the chimeric mouse after the test can be confirmed by anatomical examination by a known method to confirm a more accurate replacement rate. The cell replacement rate is called RI (Replacement Index). As a specific aspect in which the replacement rate of human hepatocytes in the present invention is determined, in the examples of the present invention, it is determined by the ratio occupied by human cytokeratin CK8 / 18 positive hepatocytes in the sections of tissue immunostaining. Embodiments are described.
In the present invention, as a method for transplanting human hepatocytes into mice, in addition to a method for transplanting to the liver via the mouse spleen, a method for transplanting directly from the portal vein can be appropriately employed. It may also be transplanted intraperitoneally or intravenously. The number of human hepatocytes transplanted at a time can be appropriately selected from 1 to 2 million (2 × 10 ⁶ ) cells.
The hepatocytes of the present invention include normal hepatocytes, primary hepatocytes, preferably established hepatocytes maintained (including culture, passage, storage) in the presence of serum (eg, fetal bovine serum). It can be suitably used. As human hepatocytes to be used for transplantation, hepatocytes derived from any kind of cells can be suitably used as long as they are human hepatocytes and cells in human liver. When normal hepatocytes are used, hepatocytes obtained from the liver tissue of the subject can be suitably used. As a method for collecting liver tissue, in addition to excision during surgery, a biopsy (biopsy) which is a known method is preferably used. Liver biopsy is a method in which a thin, long needle is inserted directly into the liver from the surface of the skin and the liver tissue is collected. Usually, the site where the needle is punctured is the space between the right lower chest. The puncture part is sterilized after the safety of the puncture part is confirmed using an ultrasonic examination apparatus before surgery. Furthermore, from the skin to the surface of the liver is the target of anesthesia, and the puncture needle is punctured after the skin at the puncture site is made a small incision. Furthermore, commercially available frozen human hepatocytes can also be used.
When primary hepatocytes are used, a cell suspension in which hepatocytes from the collected liver or liver tissue are dispersed in ice-cooled Hanks solution using a known technique such as a perfusion method or an infiltration method is used. It is isolated as appropriate by fractionation by centrifugation or the like. The obtained hepatocytes are cultured for 24 hours at 37 ° C. in the presence of 5% CO _{2 in} a medium such as Williams'E with appropriate addition of bovine serum. Furthermore, cells that have been cultured for about one week by replacing the medium with ASF104 medium (Ajinomoto) etc. every 3 days can be used. Cell culture factors such as HGF and EGF can be added to the medium, and the culture matrix, three-dimensional culture, and the like can be modified as appropriate.
When the established hepatocytes are used, the type of hepatocytes is not particularly limited. For example, SSP-25, RBE, HepG2, TGBC50TKB, HuH-6, HuH-7, ETK-1, Het- 1A, PLC / PRF / 5, Hep3B, SK-HEP-1, C3A, THLE-2, THLE-3, HepG2 / 2.2.1, SNU-398, SNU-449, SNU-182, SNU-475, SNU-387, SNU-423, FL62891, DMS153 and the like are preferable. These cells can be obtained from the American Type Culture Collection (ATCC; address 12301 Parklawn Drive, Rockville Maryland 20852, United States of America). For example, Hep3B and HepG2 are registered in the ATCC with registration numbers of HB-8064 and HB-8065, respectively, and HuH-7 is registered in the JCRB cell bank with a registration number of JCRB0403.
The guanosine analog and human hepatocytes may be administered to the mouse simultaneously or separately. For example, guanosine analog may be administered into the abdominal cavity of a mouse simultaneously with transplantation of human hepatocytes from the spleen or vein.
Replacing mouse hepatocytes with human hepatocytes is called human hepatocytes or liver repopulation, and mice with human hepatocytes replaced with human hepatocytes are human hepatocyte reconstructed chimeric mice. Or it is called human liver reconstructed chimeric mouse. A liver in which hepatocytes are replaced with human hepatocytes is referred to as a humanized liver.
The present invention also includes human liver tissue reconstructed in the above mice. The liver tissue has a three-dimensional structure or function of human liver, and 75% or more, preferably 80% or more, more preferably 90% or more of mouse hepatocytes are replaced with human hepatocytes. Have been rebuilt.
These chimeric mice having human hepatocytes are used for administration of a test substance about 60 days after transplantation of human hepatocytes, for example. As the test substance, for example, a drug candidate substance is preferably exemplified. Preferred examples of the drug candidate substance include substances that are in the process of drug development and that require prediction of drug interaction in humans. Such a substance can be a main ingredient for the medicinal effect of a pharmaceutical product, or can be a composition containing the main ingredient. The dosage of the drug candidate substance varies depending on the type of the disease targeted by the substance, the type of substance composition, the administration route, etc., but can be appropriately selected from the range of about 0.1 mg / kg body weight to 2000 mg / kg body weight. . The administration route can be appropriately selected from oral, subcutaneous, intravenous or intraperitoneal administration depending on the type of drug candidate substance and its suitable dosage form.
The degree of metabolism of a test substance, such as a drug candidate substance in the liver of a chimeric mouse, and the metabolite are determined by appropriately measuring and identifying the concentration of the drug candidate substance in mouse plasma by standard methods in the art such as chromatographic methods. Can be done. Further, the measurement can be performed by time-lapse measurement measured at one or a plurality of time points appropriately selected from about 30 minutes to about 24 hours after administration of the candidate substance.
Then, depending on the concentration of the drug candidate substance in plasma and the concentration of the substance metabolized by the drug metabolizing enzyme in the liver, whether the drug candidate substance is easily metabolized by, for example, a CYP2D6, CYP2C9, or CYP2C19 deficient It can be determined whether the substance is difficult to do.
Human drug-metabolizing enzymes are CYP1A1, CYP1A2, CYP1B1, CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C10, CYP2C18, CYP2C3, CYP2A3, CYP2C3, CYP2E3, CYP2E3 For example, the indicator compounds metabolized by CYP1A2 are caffeine, CYP2C9 is tolbutamide, CYP2D6 is dextromethorphan, CYP2C19 is omeprazole, CYP3A4 is erythromycin, and the like.
After the drug candidate substance is administered to the chimeric mouse of the present invention, a mixture of these indicator compounds is administered, and the drug candidate substance promotes the activity of each enzyme by measuring the plasma concentration of each compound over time. It can be determined whether the substance is a substance that inhibits or a substance that inhibits. For example, when a drug candidate substance is administered, if the caffeine metabolism is promoted and the plasma concentration is decreased, the drug candidate substance can be determined to be a substance that specifically promotes the activity of CYP1A2.
That is, how a drug administered to a human using the mouse of the present invention is metabolized in the human liver, and what kind of metabolite is generated, that is, the plasma dynamics of the drug, identification of the metabolite, metabolism Evaluation of speed etc. can be performed. It is possible to screen for drugs that are appropriate to be administered to a person from the perspective of metabolism, and to predict the appropriate pharmaceutical dose to be administered to a person. Moreover, it can be used for researches such as proliferation and regeneration of human liver.
Another object of the present invention is to provide a mouse model that is susceptible to infection with a hepatotropic pathogen such as human HCV by a normal infection route. That is, the present invention shows that the mouse model is susceptible to infection with liver-directed pathogens such as HCV by a normal infection route, and the amount of virus can be equal to that of humans infected with liver-directed pathogens such as HCV over the long term. Provide an animal model that consistently and stably infects. Another advantage of using such a mouse is that it is not necessary to obtain or handle infected cells of liver-directed pathogens such as HCV when creating a mouse model. Therefore, in the present invention, it is not necessary to obtain hepatocytes from a human donor infected with a liver-directed pathogen such as HCV, and it is not necessary to culture and infect human hepatocytes in vitro.
The mouse of the present invention can be infected with liver-directed pathogens such as HCV, particularly liver-directed pathogens having a host range limited to primates (eg, humans). Depending on the nature of the pathogen, a chronically infected mouse host can be maintained for weeks to months. For example, if the liver-directed pathogen is HCV, the present mouse is chronically infected with HCV (eg, chronic infection) and active HCV infection is at least about 5 weeks, usually at least about 14 to about 20 weeks. Or longer, up to about 35 weeks or longer, or the life of the host mouse.
The viral load on the infected host (mouse) can be similar to the viral load on the infected person (human). For example, if the pathogen is HCV, the host mouse will have a concentration of about 10 ³ to about 10 ⁴ to about 10 ⁶ virus particles per ml of serum, usually about 10 ³ to about 10 ⁷ virus particles per ml of serum. Can maintain infection. The viral load in the infected host is substantially consistent over time, chronic and stable, e.g. the number of virus particles that can be isolated from the serum of an infected untreated host is Does not fluctuate significantly during the sampling period, eg once stable infection is established in the host, usually within about 2 to 4 weeks after infection, 1 mL of serum contains a large number of HCV virus particles at the first sampling The HCV-infected host of the present invention is positive for HCV infection at the next sampling and generally contains a large amount of HCV particles equal to or equivalent to 1 mL of serum. Usually, since the viral load of the infected host does not vary greatly, the action of the candidate antiviral substance can be evaluated.
In certain embodiments, the mouse model of the present invention is used to identify agents that ameliorate symptoms caused by viral hepatitis, more specifically HCV infection, and / or more directly, infectious virus Affects the pathogenic mechanism. For example, it suppresses viral infection, reduces viral replication, or otherwise disrupts the viral growth cycle. In general, a candidate agent is administered to a mouse model of the invention and the effect of the candidate agent is compared to a control (eg, an agent with known anti-HCV action (eg, IFN against uninfected mice). -Evaluate to HCV-infected mice administered α). For example, the candidate drug can be administered to the HCV-infected mouse of the present invention, and the viral load of the mouse before administration and / or the viral load of the mouse during non-administered HCV infection as a control and the viral load of the administered mouse (for example, Comparison can be made by measuring RT-PCR with serum samples. In general, if a detectable decrease or significant decrease in the amount of virus is observed in an infected mouse after administration of a candidate drug, it means that the target drug has an antiviral effect.
Candidate agents can be administered in any of a number of desired ways and / or in a manner suitable for drug delivery. For example, the candidate agent is suitably administered by injection (eg, intravenous injection, intramuscular injection, subcutaneous injection, or direct injection into tissue to achieve the desired effect), oral administration, or any other desirable method. Can be done. In vivo screening methods typically involve several animals and various doses and concentrations of candidate drugs (from non-drug administration to drug doses that can be successfully delivered to animals) Methods of drug delivery by various dosage forms and routes. The drugs can be administered alone, and can be administered in combination with two or more drugs, especially when the combined administration of the drugs produces a synergistic effect.
Candidate agents to be screened include synthetic molecules, natural molecules, or recombinantly produced molecules (eg, low molecular weight molecules; drugs: peptides; antibodies (antigen-binding antibody fragments, eg, those that provide passive immunity) Or other immunotherapeutic agents: endogenous factors (such as polypeptides and plant extracts) contained in eukaryotic cells or prokaryotic cells are preferably used. Of particular importance is a screening assay for drugs with low toxicity to human cells.
Candidate drug activity can be assessed in a variety of ways. For example, when a host animal is infected with a liver-directed pathogen such as HCV (eg HCV), the action of the drug is related to the presence or absence of the pathogen in the serum sample (eg titer in viral load) or the presence of the pathogen. It can be evaluated by examining a marker to be detected (for example, a protein specific to a pathogen or a nucleic acid encoding the same). Methods that are well known in the art can be adopted as methods for quantitatively and qualitatively detecting and evaluating the presence or absence and severity of viral infection. In some embodiments, the activity of a drug against HCV infection can be assessed by examining the presence of virus in serum samples and / or tissue sections (eg, RT-PCR in the case of HCV). In another embodiment, the activity of a drug against viral infection can be evaluated by examining the presence or absence of viral nucleic acid (for example, HCV RNA) in serum samples. For example, RNA of HCV is generated by, for example, detection of (−) strand RNA (HCV replication intermediate) by reverse transcriptase polymerase chain reaction (RT-PCR), competitive RT-PCR, RT-PCR, or treatment. It can be detected by sequencing the viral RNA to detect mutations / shifts (quasispecies evolution) on the viral genome. Or / and any quantitative or qualitative change in the amount of virus particles contained in the tissue section is directly demonstrated by performing the in situ RT-PCR hybridization using the host liver as a biopsy target. Can be done. Alternatively, and / or after euthanizing the host, histological examination of the liver for signs of infection and / or toxicity caused by the drug can also be suitably used.
In addition, by using the animal model of the present invention, screening of candidate vaccines can be carried out for the ability to prevent or improve infection by liver-directed pathogens. In general, a “vaccine” refers to a substance that, when administered, facilitates the host to initiate an immune response against a target pathogen. The humoral, cellular, or humoral / cellular immune response elicited as a result of vaccine administration can facilitate the suppression of infection by pathogens for vaccine development. In the present invention, liver-directed pathogens (eg, bacterial pathogens, viral pathogens, or parasitic pathogens, particularly viral pathogens such as HCV, for example) are inhibited from being replicated in the liver and / or infected by liver-directed pathogens. Of particular importance are prophylactic vaccines that elicit protective immune responses. Also of interest in the present invention are therapeutic vaccines that provide protection against infection by liver-directed pathogens by supplying passive immunity or specific active immunity (eg, anti-HCV immunoglobulins) that are rapidly promoted.
In this aspect of the invention, the immune system of an immunodeficient mouse is, for example, a stem cell, peripheral blood mononuclear cell (PBMC), blood cord cell, hematopoietic cell, or other suitable human origin that provides the animal with a human immune system. It can be reconstituted with cells. Methods for isolating human immune cells, and reconstitution of the immune system of immunodeficient mice (eg, mice with a human immune system) are well known in the art (eg, Nature 335: 256-59; Proc. Natl. Acad. Sci. USA 93 (25): 14720-25 may be referred to as appropriate). In one embodiment, the human immune cells are obtained from the same donor from which the human hepatocytes used in generating the mice according to the present invention were obtained. In another aspect, human immune cells can be introduced into a host by methods well known in the art (eg, intraperitoneal injection).
Effective vaccines can be screened by methods similar to those described above. That is, the candidate vaccine is administered to the chimeric animal before inoculation with the liver-directed pathogen. Candidate vaccines are usually administered by a single bolus administration (eg, intraperitoneal injection, or intramuscular injection, topical or oral administration) followed by one or more boosters. Induction of an immune response can be assessed by examining antigen-specific B and T cell responses in a manner well known in the art. Next, a liver-directed pathogen is administered to the immunized animal. Usually, administration is carried out on several immunized mice while increasing the titer of the pathogen. The progression of infection is then observed in immunized and non-immunized control mice, and the severity of infection (eg, assessing the titer of existing pathogens or functioning of human hepatocytes as described above). Evaluated by examining the parameters). Vaccine candidates that result in a significant reduction in pathogen infection that occurs after administration of the candidate vaccine and / or a significant reduction in disease severity are considered effective vaccines.
Furthermore, another object of the present invention is to provide a mouse model that can be used for the search, detection, and identification of cells that can become the liver in the future used for cell transplantation treatment, for example, hepatic stem cells. . Hepatic stem cells may be differentiated into hepatocytes in the future, and the number of generations necessary for differentiation into hepatocytes is not particularly specified. That is, the present invention performs transsplenic portal vein transplantation of primary isolated cells obtained from human liver tissue to a mouse model, and is used for cell transplantation treatment such as human hepatic stem cells from engrafted liver tissue. Also provided are methods for searching for or further identifying cells that can become liver. Furthermore, a cell population containing cells that can become a future liver used for cell transplantation treatment such as human hepatic stem cells can be collected from the engrafted liver tissue. The present invention also provides a method for collecting a cell population containing cells that can be used as a liver in the future used for cell transplantation treatment such as hepatic stem cells. Instead of transsplenic portal transplantation, orthotopic transplantation can also be used as appropriate. Stem cells cultured under appropriate conditions in vitro instead of primary isolated cells and induced to differentiate into hepatocytes can be used as appropriate for this purpose. A method for inducing differentiation into hepatocytes using such stem cells is described in, for example, Gastroenterology (2009) 136, 990-999. In order to search for and identify hepatic stem cells from liver tissues using proliferation as an index, tissue immunostaining is performed using antigens that recognize markers for detecting hepatocytes and / or antibodies that recognize proliferating cells. It can be carried out. A marker for detecting hepatocytes can be appropriately selected from albumin, tyrosine aminotransferase, glucose-6-phosphate, coagulation factor (CF) VII, asialoglycoprotein receptor, cytokeratin 8/18, and the like. As a cell proliferation marker, it can be appropriately selected from Ki-67 antigen, 5-bromo-2′-deoxyuridine uptake ability, PCNA and the like. A cell population containing human hepatic hepatocytes can be obtained by using these markers, and hepatocytes expressing such markers are appropriately isolated using FACSCalibur (Nippon Becton Dickinson Co., Ltd.) Isolated hepatic stem cells can be appropriately used for cell transplantation treatment and the like.
EXAMPLES Hereinafter, the present invention will be described in more detail and specifically with reference to examples. However, the present invention is not construed as being limited by the following examples.

Generation of TK-NOG mouse and analysis of its function Method This example was carried out by the following method.
(1) Production of transgenic mice A herpes simplex virus type 1 thymidine kinase (UL23 or HSVtk) gene expression unit was constructed as shown in FIG. First, a 42 nucleotide polylinker (GATCCAAGCTTATGCAGGTCGACCCGGGCATGCGAATTTCTCGA: SEQ ID NO: 2) was introduced into the Bam HI-Xho I site (pBSII / linker) of pBlueScript II (pBSII; Promega). The HSVtk gene was amplified by PCR at an annealing temperature of 62 ° C. using the following primers:
The amplified product was then cloned into the Nhe I-Sal I site (pCI-TK) of the pCI plasmid (Promega). The human growth hormone (hGH) 3 ′ flanking region was amplified by PCR using the following primers at an annealing temperature of 60 ° C.
The amplified product was then cloned into the Sma I-EcoR I site (pBSII / linker / hGH) of the pBSII / linker plasmid. 2,345-bp Not I-BamHI fragment and pCI-TK of mouse albumin enhancer / promoter derived from plasmid p2335A-1 (Pinkert, CA et al. Genes Dev. 1,268-276 (1987)) The 1,456-bp Hind III-Sal I fragment of the chimeric intron / HSVtk was cloned into the corresponding site of the pBSII / linker / hGH plasmid (pmAlbEPintUL23GH; GenBank accession number AB453181). The pmAlbEPintUL23GH plasmid DNA was digested with Not I and KpnI, and a 4,4-kb fragment containing no vector portion was prepared as an HSVtk expression unit. This expression unit was microinjected into fertilized eggs of NOD / Shi mice by a known method. Offspring with the transgene were identified by PCR using the HTKF1 forward primer 5'-CACGTCTTTATCCTGGGATACG-3 '(SEQ ID NO: 7) and hGHR1 reverse primer 5'-CACTGGAGTGCAACTTCCA-3' (SEQ ID NO: 8) (annealing temperature 63). ° C). Genomic DNA extracted from the tail tissue was amplified in a 20 μl reaction mixture at 94 ° C. for 2 minutes, 94 ° C. for 30 seconds 30 cycles, 63 ° C. for 30 seconds, 72 ° C. for 30 seconds, and 72 ° C. for 3 minutes. The transgene DNA was identified as an amplification product band of 236 bp on the agarose gel. Female transgenic mice were treated with male NOD. An individual having a mutation of scid and IL2Rg ^null was obtained by mating with Cg-Prkdc ^scid I12rg ^tm1Sug / ShiJic (NOG). The scid and IL2Rg ^null gene mutations were genotyped by PCR (Maruyama, C. et al. Exp. Anim. 51, 391-393 (2002): Ito, M. et al. Blood 100, 3175-3182 (2002). )). The official strain name of the produced mouse is NOD. Cg-Prkdc ^scid Il2rg ^tm1Sug Tg (Alb-UL23) 7-2 / ShiJic is referred to as TK-NOG.
(2) Fluorescence in situ hybridization analysis The position of the transgene in the chromosome was determined by the fluorescence in situ hybridization (FISH) method. Nine metaphase cells obtained from spleen cells collected from TK-NOG mice and activated with mitogen were analyzed using biotin 16dUTP-labeled pCI-TK plasmid. Biotin-labeled DNA was visualized with avidin FITC (Vector Laboratories), and the cells were counterstained with propidium iodide (Sigma-Aldrich Chemie GmbH). Observations were made using a Leica Q550 cytogenic workstation. Chromosomes with a fluorescent signal were identified by the G banding standard.
(3) Southern blot analysis Genomic DNA samples were obtained by digesting kidneys of 12-week-old TK-NOG mice and non-transgenic mice with proteinase K overnight and extracting with phenol: chloroform: ethanol. Blots of genomic DNA digested with restriction enzymes Bam HI, Bgl II, Xba I and Not I plus Kpn I were electrophoresed on a 0.6% agarose gel and transferred to a positively charged nylon membrane (F. Hoffmann-La Roche) A membrane was obtained. Hybridization of the membrane was performed using a DIG-labeled probe prepared using PCR DIG Probe Synthesis Kit (F. Hoffmann-La Roche). The primers used were the following sequences:
It was what had.
The positions recognized by the respective probes are shown in FIG.
(4) Detection of HSVtk transcript by RT-PCR Total RNA using 65-day-old TK-NOG mouse liver, kidney, spleen, lung, brain, skeletal muscle and testicles using RNeasy Mini kit (Qiagen KK) was gotten. RT-PCR was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems). HSptk ring temperature detection using pCIspF forward primer 5′-GAGGCACTGGGGCAGGTGTCC-3 ′ (SEQ ID NO: 13) and HTKR1 reverse primer 5′-GTAAGTCCATCGCTCGGGTAC-3 ′ (SEQ ID NO: 14) 68 ° C). 479 bp glyceraldehyde d-phospho glycase aldehyde d-hose glycealdehyde d-hose glycealdehyde d-hose glyceraldehyde d-phosphorase 3 h (SEQ ID NO: 15) and G3PDHR reverse primer 5'-GAAGGCCATGCCCAGTGAGCTT-3 '(SEQ ID NO: 16) amplified with G3PDHF forward primer 5'-TCACCCATCTTCCAGAGCGAGA-3' (SEQ ID NO: 15) Was used as an internal standard (annealing temperature 65 ° C.).
(5) Induction of liver injury Ganciclovir (GCV) sodium (Denosine-IV; Mitsubishi Tanbe Pharma) or vesicle (saline) was administered intraperitoneally twice a day using a 26 gauge needle . GCV dissolved in water or saline was filter sterilized prior to its administration. All mice were monitored daily. The degree of liver injury was examined by biochemical serologic test values and pathological analysis. One week after GCV administration, peripheral blood was collected from the inferior vena cava for analysis of ALT and AST, and clinical chemistry analysis was performed by FUJI DRI-CHEM7000 (Fujifilm). In addition, tissue fixed and paraffin embedded in 4% (v / v) phosphate buffered formalin was stained with hemotoxylin and eosin (H & E).
(6) Transplantation of human hepatocytes and human colon cancer cells Three lots of commercially available frozen human hepatocytes (Lonza Walkersville) were used as donor cells. The age of the donor was 4-7 years. Transplantation was performed in the following general manner. GCV (0.5-1.5 mg / kg) was administered intraperitoneally to 6-8 week old adult TK-NOG recipient mice 5 and 3 days before transplantation. Cell number and viability were measured using a hemocytometer by trypan blue exclusion. Transplanted into the spleen using a Hamilton syringe 40μl of Hank's Balanced Solution (HBSS) or William's medium 1~2 × 10 ⁶ viable hepatocytes that were suspended in E is attached an injection needle of 26 gauge . As a control, 1 × 10 ⁴ human colon cancer cell line HCT116 (American Type Culture Collection; ATCC) was transplanted into the spleen of non-transgenic NOG mice.
(7) Measurement of human albumin A small amount of blood was collected every other week from the fundus venous plexus using a plastic capillary. The collected blood was diluted 500 to 30000 times with TBS (Tris-buffered saline) containing 1% bovine serum albumin and 0.05% Tween 20 (BSA), and the human albumin concentration was diluted with human albumin ELISA Quantification Kit (Bethyl Laboratories). The threshold concentration was ˜3 × 10 ³ ng / ml.
(8) Immunoblotting After dilution serum and bile samples (dilution ratio: 3 to 3000 times) are dissolved in SDS sample buffer containing 5% β-mercaptoethanol and subjected to SDS-PAGE, Hybond-ECL membrane (GE Healthcare Bio -Sciences). The transferred membrane is a polyclonal goat anti-mouse albumin antibody (A90-234A; Bethyl Laboratories), polyclonal goat anti-human albumin antibody (A80-229A; Bethyl Laboratories), polyclonal goat anti-mouse transferrin antibody (I-20; Santa Cruz Biotechnology) Polyclonal rabbit anti-human transferrin antibody (H-65; Santa Cruz Biotechnology), polyclonal mouse anti-complement C3 antibody (A01; Abnova), polyclonal goat anti-human complement C3 antibody (D-19; Santa Cruz Biotechnology) and polyclonal goat Anti-ceruloplasmin 3 antibody (H-60; Santa Cruz Bio The membrane after incubation with technology and washed, with horseradish peroxidase labeled secondary antibody for 60 minutes with goat IgG (Bethyl Laboratories), mouse IgG (GE Healthcare Bio-Sciences) or rabbit IgG (GE Healthcare Bio-Sciences). Incubated. Next, color development using ECL Western Detection System (GE Healthcare Bio-Sciences) and Hyperfilm ECL (GE Healthcare Bio-Sciences) was detected.
(9) RT-PCR of human hepatocyte specific gene expression
Total RNA was isolated using the RNeasy mini kit (Qiagen KK). Complementary DNA was synthesized using High Capacity cDNA Reverse Transcription kit (Applied Biosystems) and random primers. Mouse Gpdh, albumin (Alb), human GAPDH, ALB, tyrosine aminotransferase (TAT), transthyretin (TTR), capillary-specific organic anion transporter ATP binding cassette, subfamily C (CFTR / MRP), member 2 ( ABCC2; MRP2), bile salt transport pump ATP binding cassette, subfamily C (MDR / TAP), member 11 (ABCB11), bilirubin UDP glucuronosyltransferase (UGT1A1) and cytochrome P450 family (CYP1A1, CYP1A2, CYP2C19, CYP2C19 The expression of CYP2D6 and CYP3A4) genes was analyzed by RT-PCR. Table 1 shows the primer information (target gene, sequence) used, annealing temperature, amplification product size, and the like.
(10) Histology and immunohistochemical staining Formalin-fixed liver and kidney were embedded in paraffin, and 5 μm sections thereof were prepared. Some of the sections were immersed in a target retrieval solution (0.1 M citrate buffer, pH 6.0; 1 mM EDTA, pH 9.0), subjected to autoclaving for 10 minutes, and then placed at room temperature for 20 minutes. Monoclonal mouse anti-human CK8 / 18 antibody (clone 5D3; Novocastra Laboratories), monoclonal mouse anti-human HLA-class I-A, B, C antibodies (clone EMR8-5; Hokudo), polyclonal goat anti-human albumin antibody (Bethyl Laboratories) A polyclonal rabbit anti-human GLUL antibody (Sigma-Aldrich) was used as the primary antibody. For bright field immunohistochemical staining, goat, rabbit and mouse Ig were labeled with amino acid polymer / peroxidase complex labeled antibodies (Histofine Simple Stain Mouse MAX PO (G, R, and M); Nichirei Bioscience) and Diaminobenzidine (DAB; Dojindo). Laboratories) substrate (0.2 mg / ml 3,3′-diaminobenzidine tetrahydrochloride, 0.05 M Tris-HCl, pH 7.6, and 0.005% H ₂ O ₂ ). Sections were counterstained with hematoxylin. Periodic acid-Schiff (PAS) staining kit (Muto Pure Chemicals) was used for visualization of glycogen. Images were taken using an upright microscope Axio Imager (Carl Zeiss) equipped with AxioCam HRm and AxioCam MRc5 CCD cameras (Carl Zeiss). The replacement index (RI), which is the percentage of donor human hepatocytes in the recipient liver, was expressed as the percentage of the area occupied by human CK8 / 18 positive hepatocytes in the total area in the immunohistochemically stained section. Livers used to make frozen sections were embedded in OCT compounds (Sakura Finechemicals), frozen in liquid nitrogen and sectioned at a thickness of 5-10 μm. Biotinylated polyclonal goat anti-human albumin antibody labeled with FluoReporter Mini-Biotin-XX Protein Labeling Kit (Invitrogen), Alexa Fluor 594-labeled streptavidin (Invitrogen) and FITC-labeled polyclonal goat anti-mouse albumin antibody (A90-234F; Laboratories) were used for immunofluorescence staining.
(11) Laser microdissection analysis (LCM)
Serial frozen tissue sections (10 μm) were fixed with ethanol, then the ethanol concentration in the fixative was reduced stepwise, and finally the sections were immersed in DNase and RNase free water. Next, immunohistochemical staining of the sections was performed using a monoclonal mouse anti-human CK8 / 18 antibody (clone; 5D3; Novocastra Laboratories). The positive and negative stained areas of anti-human CK8 / 18 antibody in the sectioned tissue were mapped for LCM using a microscope. Each region was captured and captured using an AutoPix LCM system (Molecular Devices). Genomic DNA was extracted using TPMK buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl ₂ , and 40 μg / ml proteinase K). Incubation was overnight at 55 ° C, and proteinase K was inactivated by heat treatment of the sample at 95 ° C for 5 minutes. Part of the buffer was used as the template DNA for genomic PCR to distinguish human and mouse hepatocytes. The human and mouse β-actin genes have the following sequences:
Was amplified by PCR using a primer having an annealing temperature of 60 ° C.
This primer set amplified not only human β-actin but also mouse β-actin gene (245 bp and 271 bp, respectively). A control plasmid (pBSII-hm / β-ACT) was prepared by inserting corresponding sequences from human and mouse DNA into the Sma I and HindIII sites of the pBSII vector, respectively.
(12) Bile excretion test using 5-carboxyfluorescein diacetate Carboxyfluorescein (CF) is an organic anion excreted from various cells via Mrp2. The ester precursor of this dye, 5-carboxyfluorescein diacetate (5-CFDA, 0.5 nmol; Sigma-Aldrich) was administered by intravenous injection from the tail. Ten minutes after 5-CFDA administration, the liver was perfused with 50 nmol / L5-CFDA solution for 3 minutes, and the liver was embedded in OCT compound and frozen in liquid nitrogen. This reagent easily penetrates into hepatocytes due to its easy fat solubility, is hydrolyzed by esterase, forms CF (water-soluble fluorescent substrate), and is then excreted in bile.
Serial frozen sections 10 μm thick were prepared and air dried. The fluorescence signal of CF was observed and photographed using an upright microscope Axio Imager (Carl Zeiss) equipped with AxioCam HRm and AxioCam MRc5 CCD cameras (Carl Zeiss). After taking a fluorescence micrograph, the tissue section was fixed with ethanol, the ethanol concentration of the fixing solution was reduced stepwise, and the section was finally immersed in water containing no DNase and RNase. Immunohistochemical staining was then performed using monoclonal mouse anti-human MRP2 antibody (Clone M2 III-6; Millipore), Histofine Simple Stain Mouse MAX PO (M) (Nichirei Bioscience) and DAB substrate. Sections were counterstained with hematoxylin. Other tissue sections were fixed with 4% paraformaldehyde solution, monoclonal goat anti-human HLA-class I-A, B, C antibodies (clone EMR8-5; Hokudo) and Texas Red labeled streptavidin- (GE Healthcare Bio-Sciences). Was used for immunofluorescence staining. Other tissue sections were stained with hemotoxylin and eosin (H & E). Bile and fecal samples collected from humanized liver NOG mouse # 2-11-5 with a very high degree of substitution and humanized liver NOG # 48-L5 with a very low degree of humanization are 0.1 M Tris-HCl (pH 8.0). ) And the fluorescence was measured using a Molecular Dynamics BioLumin 960 spectrophotometer (GE Healthcare Bio-Sciences). Fluorescent images were obtained using a Molecular Dynamics FluoroImager 595 (GE Healthcare Bio-Sciences). The CF concentration in the fecal sample was calculated based on the known concentration of CF in 0.1 M Tris-HCl (pH 8.0) and normalized by the wet weight of the sample.
2. The results were as follows.
(1) Human hepatocyte transplantation to TK-NOG mice Human albumin in the serum of TK-NOG mice was measured by ELISA at the timing shown in FIG. 3 after human hepatocyte transplantation. The results are shown in FIG. Black circles, black triangles, and black squares show the results of assays performed using mice # 12-14, # 6-6-10, and # 2-4-7, respectively.
Proteins in the serum of 3 TK-NOG mice were measured by immunoblotting at 70, 44 and 41 days after human hepatocyte transplantation. Mouse and human sera were used as positive and negative controls. The results are shown in FIG.
MRNA expressed in the livers of the control and 3 TK-NOG mice was measured by RT-PCR at 70, 44 and 41 days after human hepatocyte transplantation. Mouse and human liver RNA were used as control samples. The results are shown in FIG.
The results of histology and immunohistochemical staining of the liver of TK-NOG mice, obtained 70, 44, and 41 days after human hepatocyte transplantation, respectively, are shown. Serial sections were stained with H & E, h-CK8 / 18, HLA, h-albumin and PAS. The results are shown in FIG. FIG. 6 shows # 12-14 (70 days), # 6-6-10 (44 days) and # 2-4-7 (41 days) HE staining (A, C and E, respectively) and anti-human. The results of CK8 / 18 antibody staining (B, D and F, respectively) are shown. G to K indicate serial sections stained with H & E, h-CK8 / 18, HLA, h-albumin and PAS.
(2) Anatomical and functional analysis of humanized liver FIG. 7 shows carboxyfluorescein (CF) excretion into the capillary bile duct (BC). TK-NOG mice (A, B, C and D) 42 days after human hepatocyte transplantation or NOG mice 21 days after transplantation of human colon cancer cell lines (HCT-116, E, F, G and H) 5-CFDA was administered and liver was obtained. Serial sections of livers of control NOG mice transplanted with TK-NOG with reconstructed human liver or colon cancer were prepared, and the presence of fluorescent metabolites was observed. In TK-NOG mice in which the human liver is reconstructed, 5-CFDA metabolite (CF) is found in a beehive form on the lobule of the human hepatocyte colony, and its excretion into the bile duct (BC) is observed. confirmed. In contrast, this beehive pattern was not observed at all in the HCT-116 colon cancer growth foci. Other sections were subjected to H & E staining, HLA and human-MRP2 staining.
FIG. 8 shows the results of human CK8 / 18 immunohistochemical staining of two different human liver reconstructed TK-NOG mouse livers obtained 52 days after transplantation of human hepatocytes. The liver of # 2-11-5 mice was almost completely replaced with human hepatocytes (RI> 90%), but with # 48-L5, the mouse liver was only partially replaced with human hepatocytes. (RI-20%). After administration of 5-CFDA, fecal CF excretion was measured for two reconstructed TK-NOG mice. FIG. 9 shows the result.
FIG. 10 shows a fluorescence image of the metabolite CF in the bile of almost completely humanized # 2-11-5 TK-NOG mice collected 10 hours after administration of 5-CFDA.
FIG. 11 shows the analysis result of mouse and human transferrin in bile in humanized TK-NOG mouse # 2-11-5. As shown in FIG. 11, human transferrin was found in bile derived from almost completely humanized # 2-11-5 mice, but not in control NOG mice.
FIG. 12 shows H & E (A and C) and glutamine synthase (GS) of liver sections obtained from TK-NOG mice 6 weeks (A and B) or 16 weeks (C and D) after human hepatocyte transplantation. (B and D) shows immunohistological staining. As shown in FIG. 12, GS expression was not observed in the central venous region in the human hepatocyte nest 6 weeks after transplantation. In contrast, GS expression was observed around the central vein in human hepatocyte nests of TK-NOG mouse liver after 16 weeks of transplantation. The inset in FIG. 12B shows the control NOG (mouse) stained with anti-GS antibody, and the inset in FIG. 12D shows the staining results in human liver. P indicates the portal tract and C indicates the central vein.
(3) Characterization of HSVtk transgenic NOG mice The transgene structure of HSVtk is the 3 of human growth hormone gene along with mouse albumin enhancer / promoter (Alb En / Pro), chimeric intron, HSVtk cDNA, and polyadenylation signal (hGHpA). It consists of '-UTR. FIG. 1 shows the structure. Arrowheads indicate the position and orientation of the primers used to detect transgene-specific transcripts. The tip of each arrow represents the 3 ′ end of the oligonucleotide. In the NOG strain, the number of offspring obtained by microinjecting a gene fragment is extremely small due to a defect in DNA rearrangement caused by a scid mutation. Therefore, first, HSVtk-gene transgenic mice were established in the NOD / Shi line (HSVtk-transgenic; line 7-2). Genetic background of NOG mice were NOD / Shi system itself, since scid the ^{IL2RG null} mutation is the only difference, then, by mating with NOG system, to possess scid and ^{IL2RG null} mutation, severe immunodeficiency NOG-Tg (Alb-UL23) 7-2 / ShiJic (formally NOD.Cg-Prkdc ^scid Il2rg ^tm1Sug Tg (Alb-UL23) 7-2 / ShiJic, abridged name: TK-NOG for short) Called). Male transgenic mice carrying the HSVtk gene are generally known to become infertile, and male TK-NOG mice were also infertile.
FIG. 13 shows the position on the chromosome of the HSVtk expression unit into which the gene has been introduced. As shown in FIG. 13, TK-NOG mice had an HSVtk expression unit at the chromosome 1G locus.
FIG. 14 shows the results of molecular analysis of the HSVtk transgene introduced into TK-NOG mice. Genomic DNA samples from non-transgenic NOG mouse kidney (N) and TK-NOG mouse kidney (T) were analyzed for Bam HI (Ba), Not I and Kpn I (NK), Bgl II (Bg) for Southern blot analysis. , And Xba I (Xb).
FIG. 2 shows a restriction map and structure of the transgene of the TK-NOG mouse. The cloning vector (shaded box indicates the cloning vector) was integrated into the mouse genome in a head-to-tail tandem array structure (black box indicates the transcriptional segment) sandwiched between two HSVtk transgenes. HSVtk expression unit without vector (Not I-Kpn If fragment) was microinjected, but a small amount of vector cleaved with Not I-Kpn I restriction enzyme may be mixed, and HSVtk expression unit is head It is considered that the vector was connected in tandem with the -to-tail structure. The asterisk indicates the position recognized by the probe labeled with DIG (*; 5 ′ probe, **; 3 ′ probe).
FIG. 15 shows the results of analysis of HSVtk transgene expression by RT-PCR. Detection of the HSVtk transgene was performed using primers that specifically recognize the sequence of the correctly spliced chimeric intron. Non-transgenic NOG mouse liver (nLi), TK-NOG mouse liver (Li), kidney (Ki), spleen (Sp), lung (Lu), brain (Br), skeletal muscle (Sm) Testicle (Te). Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as an internal standard.
FIG. 16 shows the activities of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) in ganciclovir (GCV) -administered TK-NOG mice (Tg HSVtk) and non-transgenic NOG mice (NTg). . As shown in FIG. 16, administration of “Prodrug” GCV in TK-NOG mice resulted in moderate dose-dependent hepatocellular injury. A cytotoxic image is shown in FIG.
FIG. 17A shows an H & E-stained image of the liver of a TK-NOG mouse administered with PBS as a negative control for ganciclovir administration.
FIGS. 17B-D show H & E stained images of TK-NOG mouse liver after 1.5 mg / kg GCV administration (FIG. 17B), 50 mg / kg GCV administration (FIG. 17C), and 50 mg / kg GCV administration (FIG. 17D). The results of H & E staining of non-transgenic NOG mouse livers of FIG. GCV (dose, mgGCV / kg body weight) was administered twice every other day, and blood samples and tissue samples were collected after 14 days. GCV-treated transgenic mouse livers showed hepatocyte megalocytosis, severe to moderate cytoplasmic vacuolar degeneration and focal cell death. However, no clear cell or tissue injury was observed in most other tissues except the testis. The scale bar in FIG. 17 is 200 μm. P indicates the portal tract and C indicates the central vein.
(4) Transplantation of human hepatocytes into TK-NOG mice and liver reconstruction FIG. 18 shows serum human albumin concentrations in TK-NOG mice to which GCV was administered at various concentrations and human hepatocytes were transplanted. As shown in FIG. 18, the human serum albumin concentration in the group administered with 1.5 mg GCV was significantly higher than the group administered with 5 mg / kg GCV (P = 0.0404, Mann-Whitney U- test). There was no significant difference in serum human albumin concentration between the 0.5 mg / kg and 1.5 mg / kg GCV administration groups.
FIG. 19 shows the correlation between human serum albumin concentration and substitution index (RI). As shown in FIG. 19, the RI value and human serum albumin concentration were strongly correlated (R ² = 0.9043).
FIG. 20 shows human gene expression in TK-NOG mouse liver reconstructed with human hepatocytes. Human and mouse mRNA were used as positive and negative controls, respectively.
FIG. 21 shows the results of histopathological analysis of kidneys collected from mice transplanted with human hepatocytes. As shown in FIG. 21, kidney failure was not observed by H & E and PAS staining of kidneys (A and B) of TK-NOG mice with reconstructed liver and kidneys (C and D) of non-transgenic NOG mice. It was. The bar is 100 μm.
Figures 22 to 24 show that the liver of reconstructed TK-NOG mice is not due to cell fusion.
FIG. 22 shows the results of double immunofluorescence staining of mouse albumin (green) and human albumin (red). As shown in FIG. 22, human albumin was negative in almost all mouse albumin positive hepatocytes, and mouse albumin was negative in most human albumin positive hepatocytes. Mouse albumin positive hepatocytes were found scattered in human hepatocyte colonies. Human albumin positive hepatocytes are shown in white in FIG. 22B, and black shows mouse albumin positive hepatocytes.
FIG. 23 shows the results of capturing clonal proliferating human hepatocyte colonies by the laser microdissection method. The anti-human CK8 / 18-stained frozen section is shown before (A) and after (B) capture by the laser microdissection method. The dashed lines in FIG. 23A indicate the boundaries of the capture region consisting of human and non-human targets (I and II in FIG. 23B).
FIG. 24 shows the results of PCR analysis performed to distinguish whether the hepatocytes captured by the laser microdissection method are human or mouse. The primer set used amplified not only human β-actin but also mouse β-actin gene in the same manner, and products of different sizes were obtained (245 bp and 271 bp, respectively). From the human CK8 / 18 positive colony (FIG. 23A), only the human β-actin amplicon of the 245-bp band was detected. Conversely, from the human CK8 / 18 negative region (FIG. 23B), the mouse β-actin amplicon of the 271 bp band was detected. Only were detected (FIG. 24, lane “region II”). Mouse and human DNA were used as control samples. A plasmid containing both mouse and human DNA target sequences was also used as a control.
When the production of human serum albumin after ganciclovir (GCV) administration and human hepatocyte transplantation was monitored, it was found that an amount of GCV of 0.5 to 1.5 mg / kg was optimal for transplantation of human hepatocytes. Although all 60 recipients differed in degree, human serum albumin was first detected in test recipients within 4 weeks after transplantation and gradually increased to reach a maximum concentration of 11.5 mg / ml several weeks later. (FIG. 3). The transplanted human hepatocytes were completely integrated into the liver structure of the recipient mouse (FIG. 6). The substitution index (RI) (ratio of the area occupied by CK8 / 18 positive hepatocytes in immunohistochemically stained sections) was strongly correlated with the measured human serum albumin concentration (R ² = 0.9043) (FIG. 19). In mice where the human serum albumin concentration is> 1 mg / ml, RI> 10%. Based on this, 63% (38/60) livers of transplant recipients repopulated more than 10% human hepatocytes within 12 weeks (FIG. 3). Eleven cases were highly regrowth (RI> 40%, human serum> 4 mg / ml), and five cases were even more highly regrowth (RI> 80%, human serum> 8 mg / ml). In this example, frozen hepatocytes were used for transplantation only once (the continuous transplantation method in which human hepatocytes were isolated from engrafted TK-NOG mice and transplanted again was not performed. Nevertheless, high levels of human hepatocyte regrowth were observed in the livers of TK-NOG mice.
Three TK-NOG mice with human hepatocytes reconstituted to different extents (10%, 30% and 85% RI) were used for detailed analysis of liver histology, RNA and DNA, and serum proteins. Analysis was performed. By immunoblot analysis, several different human proteins (albumin, transferrin, complement C3 and ceruloplasmin) were detected in the sera of these mice (FIG. 3). Interesting is the presence of the 105 kDa human C3α ′ chain, indicating that the C3 precursor protein was processed by the C4b-C2a complex (C3 convertase). In uPA transgenic mice, it is thought that an increase in serum concentration of human C3 contributes to the onset of renal failure, and this is suppressed by administration of immunosuppressants (Tateno, C. et al. Am. J. et al.). Pathol.165, 901-912 (2004)). Surprisingly, however, TK-NOG mice do not develop renal failure and do not require immunosuppressants. Multiple human mRNAs present in mature hepatocytes were also expressed in large amounts in the liver of TK-NOG mice (FIG. 5). In addition, expression of human mRNAs of multiple drug metabolizing enzymes (UGT1A1, CYP1A1, CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A4) and transporters ABCC2; MRP2, ABCB11; MDR / TAP) was confirmed in the liver of TK-NOG mice. (FIG. 20). In hematoxylin and eosin stained sections, human (CK8 / 18 positive) hepatocytes were clearly distinguished from mouse hepatocytes by size and whitish cytoplasm (Azuma, H. et al. Nat. Biotechnol. 25, 903-910 (2007). Muleman, P. et al. Hepatology 41, 847-856 (2005)) (FIG. 6). Human CK8 / 18 positive hepatocytes were also stained with HLA or human specific albumin antibody. This indicates that the human CK8 / 18 positive hepatocytes are not those of the mouse but are definitely human hepatocytes (FIG. 6). Glycogen accumulation was only seen in the cytoplasm of human hepatocytes. The reconstructed liver may have been caused by the fusion of human and mouse hepatocytes. However, human and mouse cell fusion was denied by the results of PCR analysis of the genome in tissues captured by immunofluorescence double staining and laser microdissection using antibodies specific for human or mouse albumin. It was.
Most human hepatocytes were present as small growth foci that grew clonally in host liver tissue within 6 weeks after transplantation (FIG. 6). To assess whether the reconstructed TK-NOG liver biliary or capillary network is functional, the biliary excretion test is a fluorescent metabolic marker, 5-carboxylfocein diacetate (5-CFDA) Was done using. 5-CFDA easily enters hepatocytes due to its lipophilicity, where it is metabolized to water-soluble fluorescent metabolite (CF) by esterase (Mor-Cohen, R. et al. J. Biol. Chem. 276, 36923). -36930 (2001)), Mrp2, an organic anion transporter, is excreted in bile. 15 minutes after 5-CFDA administration, the 5-CFDA metabolite is rapidly observed as a beehive structure on the leaflet, showing that the metabolite CF is excreted into the capillary (BC) (FIG. 7). This beehive pattern was also present in the region stained with human-specific anti-HLA and anti-MRP2 antibodies (FIG. 7). In contrast, human colon cancer growth foci formed in the liver of non-transgenic NOG mice transplanted with a human colon cancer cell line (HCT-116) were positive by human-specific anti-HLA staining but CF excretion. The beehive structure which shows was not recognized. Furthermore, anti-human MRP2 antibody was also negative in human colon cancer growth foci (FIG. 7). It was then examined whether the liver or bile duct system was functioning, i.e., bile collected through the common bile duct into the gallbladder and excreted from the duodenum into the intestine. In order to show that 90% or more of the liver is excreted by human hepatocytes, TK-NOG mice (Fig. 8), in which more than 90% of the liver is composed of human hepatocytes, excrete 5-CFDA metabolite (water soluble CF) It was investigated. Although no fluorescence derived from CF was observed in the feces until 6 hours after 5-CFDA administration, the peak reached after 7 hours (FIG. 9). The signal in the feces was eliminated within 10 hours after 5-CFDA administration, but a slight metabolite of 5-CFDA was detected in the bile of this mouse (FIG. 10). Furthermore, human bile protein (transferrin) was detected in the same bile sample (FIG. 11). Since 90% or more of hepatocytes in the mouse liver are replaced with human hepatocytes, it is considered that CF excreted in the intestinal tract of this mouse was substantially metabolized and excreted by human hepatocytes. These data indicate that the hepatobiliary system is normally constructed anatomically and that the foreign body excretion function is also working normally. Therefore, it is considered that the human liver reconstructed TK-NOG mouse has a biological function in which metabolites such as drugs circulate in the intestinal liver.
It was necessary to determine whether the liver reconstructed in TK-NOG mice had the three-dimensional structural characteristics of mature human liver. Therefore, the expression pattern of an enzyme (glutamine synthase (GS)) with different distribution characteristics in the hepatic lobule was examined, and the lobule structure formed in the reconstructed liver showed physiological functions (central vein region and portal vein region). It was evaluated whether it reflects the expression of enzymes induced by nutrient or oxygen concentration gradients. Usually, GS is expressed in hepatocytes in the immediate vicinity of the central venous region (Smith, DDJ et al. Proc. Natl. Acad. Sci. USA 85, 160-164 (1988)). No expression of GS was observed in hepatic lobule containing human hepatocytes 6 weeks after transplantation, suggesting functional immaturity at this point (6 weeks after transplantation) (FIG. 12). In contrast, GS expression was observed around the central vein in the reconstructed liver 16 weeks after transplantation (FIG. 12). The liver reconstructed with human hepatocytes expresses many liver-specific human genes, secretes human serum proteins, and partially forms a biliary network, but matures in physiological liver function Six weeks after transplantation was insufficient for conversion. It took 8-12 weeks for the liver to be reconstructed by heterologous human hepatocytes and to form more mature human liver structures. This result shows that in the study of autologous liver transplantation using mice (Braun, KM et al. Nat. Med. 6, 320-326 (2000)), 8 weeks after transplantation when substantial reconstitution occurred. Is consistent with the report that
These characteristics indicate that the human liver reconstituted in TK-NOG mice is a mature “human liver organ”. A novel TK-NOG platform having a three-dimensional structure such as the biliary network and functional lobule structure (site specific enzyme expression in the lobule), which is a characteristic of the mature liver, is a known uPA transgenic used for transplantation of human liver. Overcoming the limitations of mice and Fah knockout mice. The functions of mature liver, such as hepatobiliary network and functional lobule structure, can never be reproduced in in vitro experiments such as primary cultured hepatocytes without 3D structure (between cells). Humanized liver reconstructed in TK-NOG mice is a preferred platform for drug metabolism and liver research.

1. Production of uPA-NOG mouse and analysis of its function Method This example was carried out by the following method.
(1) Production of transgenic mice A mouse urokinase-type plasminogen activator (Plau or uPA) gene expression unit was constructed as shown in FIG. First the mouse uPA gene has the following primers:
Was amplified by PCR at an annealing temperature of 60 ° C. The herpes simplex virus type 1 thymidine kinase gene portion is removed by double digestion of the herpes simplex virus type 1 thymidine kinase gene expression plasmid (pmAlbEPintUL23GH) described in Example 1 with the restriction enzymes Nhe I and Sal I. Thereafter, a plasmid (pmAlbEPintPlauGH; GenBank accession number AB453180) in which the mouse uPA gene (SEQ ID NO: 47) treated with the same enzyme at the corresponding site was cloned was obtained. The pmAlbEPintPlauGH plasmid DNA was digested with Not I and Kpn I, and a 4.6-kb fragment without the vector portion was prepared as a uPA expression unit. The expression unit was microinjected into fertilized eggs of NOD / Shi mice by a known method. Offspring with the transgene were identified by PCR using the MuPAF1 forward primer 5′-AGTGTATGCAGCCCCCACTACTATG-3 ′ (SEQ ID NO: 50) and hGHR1 reverse primer 5′-CACTGGAGTGCAACTACTCA-3 ′ (SEQ ID NO: 8) (annealing temperature 63). ° C). Genomic DNA extracted from the tail tissue was amplified in a 20 μl reaction mixture at 94 ° C. for 2 minutes, 94 ° C. for 30 seconds 35 cycles, 63 ° C. for 20 seconds, 68 ° C. for 60 seconds, and 68 ° C. for 3 minutes. The transgene DNA was identified as an amplification product band of 383 bp on the agarose gel. Female transgenic mice were treated with male NOD. An individual having a mutation of scid and IL2Rg ^null was obtained by mating with Cg-Prkdc ^scid I12rg ^tm1Sug / ShiJic (NOG). The scid and IL2Rg ^null gene mutations were genotyped by PCR (Maruyama, C. et al. Exp. Anim. 51, 391-393 (2002): Ito, M. et al. Blood 100, 3175-3182 (2002). )). The official strain name of the produced mouse is NOD. Cg-Prkdc ^scid Il2rg ^tm1Sug Tg (Alb-Plau) 11-4 / ShiJic is referred to as uPA-NOG.
(2) Detection of transgene (mouse uPA cDNA) transcript by RT-PCR Total RNA was obtained from the liver, kidney and spleen of 29-week-old uPA-NOG mice using RNeasy Mini kit (Qiagen KK). It was. RT-PCR was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems). pCIspF forward primer 5′-GAGGCACTGGGGAGGTGTCC-3 ′ (SEQ ID NO: 13) and MuPAR reverse primer 5′-AGGGCCGACTTTGGTATCAGTG-3 ′ (sequence number 51) (Annealing temperature 65 ° C.). 479 bp glyceraldehyde d-phospho glycase aldehyde d-hose glycealdehyde d-hose glycealdehyde d-hose glyceraldehyde d-phosphorase 3 h (SEQ ID NO: 15) and G3PDHR reverse primer 5'-GAAGGCCATGCCCAGTGAGCTT-3 '(SEQ ID NO: 16) amplified with G3PDHF forward primer 5'-TCACCCATCTTCCAGAGCGAGA-3' (SEQ ID NO: 15) Was used as an internal standard (annealing temperature 65 ° C.).
(3) Spontaneous liver injury The degree of liver injury was examined by biochemical serum test (variation of alanine aminotransferase aminotransferase (ALT) value) by FUJI DRI-CHEM7000 (Fujifilm).
(4) Southern blot analysis Genomic DNA samples were obtained by digesting the liver and kidney of 8-week-old uPA-NOG mice and non-transgenic mice with proteinase overnight, followed by phenol: chloroform: ethanol extraction. Genomic DNA digested with restriction enzymes XbaI, XhoI, BglII and BamHI was electrophoresed on a 0.6% agarose gel and transferred to a positively charged nylon membrane (F. Hoffmann-La Roche). Hybridization was performed using a DIG-labeled probe prepared using PCR DIG Probe Synthesis Kit (F. Hoffmann-La Roche). The primers used were the following sequences:
It was what had. The position recognized by the probe is indicated by * in FIG.
(5) Transplantation of human hepatocytes Using commercially available frozen human hepatocytes (Lonza Walkersville) as donor cells, transplantation was performed by the following general method. Six-week-old adult hemizygous and homozygous uPA-NOG mice were used as recipients. Cell number and viability were measured using a hemocytometer by trypan blue exclusion. Transplanted into the spleen using a Hamilton syringe 40μl of Hank's Balanced Solution (HBSS) or William's medium 1~2 × 10 ⁶ viable hepatocytes that were suspended in E is attached an injection needle of 26 gauge .
(6) Measurement of human albumin A small amount of blood was collected every other week from the fundus venous plexus using a plastic capillary. The collected blood was diluted 500 to 30000 times with TBS (Tris-buffered saline) containing 1% bovine serum albumin and 0.05% Tween 20 (BSA), and the human albumin concentration was diluted with human albumin ELISA Quantification Kit (Bethyl Laboratories). The threshold concentration was ˜3 × 10 ³ ng / ml.
(7) Immunoblotting After a diluted serum sample (dilution ratio: 2000 times) was dissolved in an SDS sample buffer containing 5% β mercaptoethanol and subjected to SDS-PAGE, it was applied to a Hybond-ECL membrane (GE Healthcare Bio-Sciences). It was transcribed. The transferred membrane was incubated with a biotin-labeled polyclonal goat anti-mouse albumin antibody (A90-234A; Bethyl Laboratories) and a biotin-labeled polyclonal goat anti-human albumin antibody (A80-229A; Bethyl Laboratories). Incubated with horseradish peroxidase (HRP) labeled streptavidin (GE Healthcare Bio-Sciences) for 60 minutes. Biotin labeling was performed by the FluoReporter Mini-Biotin-XX Protein Labeling Kit (Invitrogen Corp., CA, USA), and ECL Western Detection System (GE Healthcare Bio-Sciences) and GE Healthcare Bio-Sciences. Was detected.
(8) Histology and immunohistochemical staining Formalin-fixed tissue is embedded in paraffin, 5 μm sections are prepared, hematoxylin and eosin staining (H & E), and polyclonal goat anti-human albumin antibody (Bethyl Laboratories) as primary antibody Immunohistochemical staining was performed. Goat Ig is an amino acid polymer / peroxidase complex labeled antibody (Histofine Simple Stain Mouse MAX PO (G); Nichirei Bioscience) and diaminobenzidine (DAB) substrate (0.2 mg / ml 3,3'-diaminobenzidine , 0.05 M Tris-HCl, pH 7.6 and 0.005% H ₂ O ₂ ) and counterstained with hematoxylin.
2. The results were as follows.
(1) Characterization of uPA transgenic NOG mice The transgene structure of uPA, together with mouse albumin enhancer / promoter (Alb En / Pro), chimeric intron, mouse uPA cDNA, and polyadenylation signal (hGHpA) It consists of 3'-UTR. FIG. 25 shows the structure. Arrowheads indicate the position and orientation of the primers used to detect transgene-specific transcripts. The tip of each arrow represents the 3 ′ end of the oligonucleotide. In the NOG strain, the number of offspring obtained by microinjecting a gene fragment is extremely small due to a defect in DNA rearrangement caused by a scid mutation. Therefore, first, a uPA-gene transgenic mouse was established in the NOD / Shi line (uPA-transgenic; line 11-4). Genetic background of NOG mice were NOD / Shi system itself, since scid the ^{IL2RG null} mutation is the only difference, then, by mating with NOG system, to possess scid and ^{IL2RG null} mutation, severe immunodeficiency NOG-Tg (Alb-Plau) 11-4 / ShiJic (formally NOD.Cg-Prkdc ^scid Il2rg ^tm1Sug Tg (Alb-Plau) 11-4 / ShiJic, abbreviated name: uPA-NOG for short) Called). The uPA transgenic embryonic lethality as observed in the prior art was not observed in homozygous transgenic uPA-NOG mice, and surprisingly, uPA-NOG mice could be maintained in that homozygous line. .
FIG. 27 shows the results of analysis of uPA transgene expression by RT-PCR. The uPA transgene was detected using primers that specifically recognize the sequence of the correctly spliced chimeric intron. Liver (Liver), kidney (Kidney), spleen of non-transgenic NOG mouse (Wild), hemizygous transgenic uPA-NOG mouse (Tg / +), homozygous transgenic uPA-NOG mouse (Tg / Tg) (Splen) was detected and its expression was confirmed in the livers of hemizygous and homozygous transgenic uPA-NOG mice. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as an internal standard.
FIG. 28 is a diagram showing the activity of a liver injury marker / serum alanine aminotransferase (ALT) in hemizygous transgenic uPA-NOG mice (Tg / +) and homozygous transgenic uPA-NOG mice (Tg / Tg). It is. The liver injury marker value in hemizygous transgenic uPA-NOG mice (Tg / +) was not significantly different from the value of non-transgenic NOG mice (Wild) indicated by dotted lines. On the other hand, ALT activity in homozygous transgenic uPA-NOG mice (Tg / Tg) is higher than that of hemizygous transgenic uPA-NOG mice (Tg / +) and non-transgenic NOG mice (Wild) after 6 weeks of age. A significant increase was observed and continued to last up to 14 weeks.
Homozygous transgenic uPA-NOG mice (Tg / Tg) liver images (FIG. 29A) and hepatocellular injury images (FIGS. 29B and C) are shown in FIG. In the non-patent document 6 of the uPA transgenic mouse, white degeneration of the liver itself has been reported, but surprisingly, in the uPA-NOG mouse of the present invention, even in the liver of a 6-week-old homozygous mouse (Tg / Tg). There were no gross abnormalities. FIG. 29B shows an H & E-stained image of the liver of a 6-week-old homozygous mouse (Tg / Tg). Degenerative lesions of hepatocytes and eosin eosinophils were observed mainly in the central venous region. In the 16-week-old homozygous type, hepatocyte megalocytosis accompanied by an increase in eosinophils was markedly observed (FIG. 29C).
FIG. 30 shows the results of molecular analysis by Southern blotting of the uPA transgene introduced into uPA-NOG mice. Genomic DNA samples from non-transgenic NOG mouse kidney (Kid. (W)) and uPA-NOG mouse kidney (Kid. (Tg)) and uPA-NOG mouse liver (Liv. (Tg)) for Southern blot analysis. Digested with Xba I and Xho I (FIG. 30 left). The 4.6-kb uPA expression unit (Cont.) Used for gene transfer was used as a positive control. The transgene deletion in the liver was reported in the non-patent document 6 of the uPA transgenic mouse, but surprisingly, the transgene deletion in the liver was not observed in the uPA-NOG mouse of the present invention. Genomic DNA samples from non-transgenic NOG mouse kidney (Wild) and uPA-NOG mouse kidney (Tg) were digested with Bgl II and Bam HI for Southern blot analysis (FIG. 30 right). Analysis revealed that uPA-NOG mice possess at least 3 copies of uPA expression units.
FIG. 26 shows a restriction map and structure of the transgene of uPA-NOG mice. The cleavage sites by Xba I (Xb), Bgl II (Bg), Bam HI (Ba) and Xho I (Xh) are shown. The asterisk indicates the position recognized by the probe labeled with DIG.
(2) Transplantation of human hepatocytes into uPA-NOG mice and liver reconstruction FIG. 31 shows hemizygous transgenic uPA-NOG mice (Tg / +) transplanted with human hepatocytes (FIG. 31A) and homozygous type. The liver macroscopic image of a transgenic uPA-NOG mouse (Tg / Tg1) (FIG. 31B) is shown. Surprisingly, even after 10 weeks from the transplantation of human hepatocytes, the white degeneration reported in Non-Patent Document 6 was not observed.
FIG. 32 shows changes in serum human albumin concentration (FIG. 32A) and body weight changes (FIG. 32B) of uPA-NOG mice. Serum human albumin concentration in hemizygous transgenic uPA-NOG mice (Tg / +) is the same level as that of non-transgenic NOG mice (Wild) indicated by dotted lines, and human hepatocyte engraftment was not confirmed It was. On the other hand, the serum human albumin concentration in homozygous transgenic uPA-NOG mice (Tg / Tg1 and 2) increased from about 4 weeks after transplantation of human hepatocytes, and the serum human albumin concentration was 1 mg in 2 of the 2 transplanted cases. / Ml or more, that is, the replacement rate with human hepatocytes was 10-15%. One patient continued to rise and the serum human albumin concentration reached 6.5 mg / ml. The growth of homozygous transgenic uPA-NOG mice (Tg / Tg1 and 2) transplanted with human hepatocytes was good. The results of analyzing these mouse sera by immunoblotting are shown in FIG. Mouse and human sera were used as positive and negative controls. With the anti-human albumin antibody, a 65 kDa band was observed only in homozygous transgenic uPA-NOG mice (Tg / Tg1 and 2) transplanted with human hepatocytes and human serum. In the anti-mouse albumin antibody, a band of 65 kDa was observed except for human serum.
FIG. 34 shows the results of immunostaining and H & E staining of anti-human albumin antibodies of homozygous transgenic uPA-NOG mice (Tg / Tg1 and 2) 10 weeks after transplantation of human hepatocytes. Serum human albumin concentration in Tg / Tg1 homozygous transgenic uPA-NOG mice reached 1.8 mg / ml, and in anti-human albumin antibody staining, about 20% of the sections were human hepatocytes (FIG. 34A). On the other hand, in anti-human albumin antibody staining of Tg / Tg2 homozygous transgenic uPA-NOG mice whose serum human albumin concentration reached 6.5 mg / ml, about 80% of the sections were human hepatocytes (FIG. 34B). ). In the Tg / Tg1 homozygous transgenic uPA-NOG mouse, it was observed that the anti-human albumin antibody staining positive part (FIG. 34C) was transparent in H & E staining (FIG. 34D). The above observation is consistent with the reports of Non-Patent Documents 2 and 4 that glycogen granules accumulated in human hepatocytes become transparent by H & E staining.

Evaluation of drug pharmacokinetics, metabolite identification, metabolic rate, etc. Metabolic test of Debrisoquin (DB) or S-Warfarine (WF) in vivo in mice with humanized liver Chimeric mice in which 50% or more of the liver was replaced by human hepatocytes (hu-Liver: human albumin concentration in blood) Is 4.5 mg / mL or more), DB (Research Biochemicals International) is forcibly administered orally at a dose of 2.0 mg / kg, or WF (Wako Pure Chemical Industries, Ltd.) is at a capacity of 30 mg / kg. It was administered intraperitoneally. At 0, 0.5, 1, 2, 4, 7 and 24 hours after administration of DB or WF, 40 μl blood samples were collected by orbital blood collection, and plasma was separated from the blood by centrifugation.
2. Determination of DB, 4-hydroxy DB (4-OH DB), WF and 7-hydroxy WF (7-OH WF) by LC-MS / MS Plasma concentrations of DB and 4-OH DB were measured by the following method. It was. Distilled water (150 μL) was added to mouse plasma (5 μL), and 20 μl of an ethanol solution of 20 nM imipramine, which is an internal standard substance, was mixed, followed by solid phase extraction. After washing with 5% methanol, elution was performed with a 2-propanol / acetonitrile mixture. The eluate was quantified by LC-MS / MS. The observed ions were m / z 176 and 134 for DB, m / z 192 and 132 for 4-OH DB, and m / z 281 and 86 for the internal standard.
Plasma concentrations of WF and 7-OH WF were measured by the following method. Distilled water (150 μL) was added to 5 μL of mouse plasma, and 20 μL of 50 nM 2-benzylphenol ethanol solution as an internal standard substance was mixed, followed by solid phase extraction. After washing with 5% methanol, elution was performed with a 2-propanol / acetonitrile mixture. The eluate was quantified by LC-MS / MS as described above.
3. Pharmacokinetic analysis Plasma area under drug concentration (AUC) was calculated from plasma concentrations of DB, 4-OH DB, WF and 7-OH WF using analysis software WInNonlin. Statistical analysis was performed using the SAS program. The blood concentrations of debrisoquin after the lapse of the specified time and its metabolite 4′-hydroxydebrisoquin by CYP2D6 are shown in FIGS. 35A and 35B, respectively. There was no difference in blood concentration of Debrisoquin between the control NOG and hu-Liver (Fig. 35A), but 4'-hydroxydebrisoquin was higher in hu-Liver than NOG at any time. Detected by concentration (Figure 35B). The calculated AUC value was significantly higher in hu-Liver than NOG (FIG. 35C). Similarly, when warfarin was administered, the AUC value of its metabolite 7-hydroxywarfarin by CYP2C9 was higher in hu-Liver than in the control (FIG. 35D). Metabolic reactions by CYP2D6 and CYP2C9 are known to be difficult to proceed in mice, and each metabolite of Debrisoquin and Warfarin was detected in hu-Liver in greater amounts compared to controls. The results suggest that human hepatocytes engrafted in chimeric mice retain their functionality in the mouse body and contribute to these metabolic reactions.

1. Detection of proliferating cells (hepatic stem cells, hepatic progenitor cells, etc.) in donor cells Transplantation of normal human hepatocytes Commercially frozen human hepatocytes were used as donor cells, and transplantation was performed by the following general method. In TK-NOG mice, 6-8 week old adults were used as recipients and GCV (0.5-1.5 mg / kg) was administered intraperitoneally 5 and 3 days before transplantation. In uPA-NOG, 6-week-old adult homozygotes were used as recipients. 40 μl Hank's Balanced Solution (HBSS) or William's medium E 1-2 × 10 ⁶ hepatocytes were transplanted into the spleen using a Hamilton syringe with a 26 gauge needle.
2. Detection of proliferating human cells Formalin-fixed livers were embedded in paraffin and 5 μm sections thereof were prepared. The sections were immersed in a target retrieval solution (0.1 M citrate buffer, pH 6.0; 1 mM EDTA, pH 9.0), subjected to autoclaving for 10 minutes, and then placed at room temperature for 20 minutes. Monoclonal mouse anti-human Ki-67antigen antibody (clone MIB-1; Dako) was used as the primary antibody. For bright field immunohistochemical staining, mouse Ig was treated with amino acid polymer / peroxidase complex-labeled antibody (Histofine Simple Stain Mouse MAX PO (M); Nichirei Bioscience) and diaminobenzidine (DAB; Dojindo Laboratories) substrate (0.2 mg / ml). 3,3′-diaminobenzidine tetrahydrochloride, 0.05M Tris-HCl, pH 7.6, and 0.005% H ₂ O ₂ ). Sections were counterstained with hematoxylin.
3. Detection of human proliferative hepatocytes in mice with humanized liver FIG. 36 shows the results of immunostaining human normal hepatocytes engrafted in the liver of TK-NOG and uPA-NOG mice with a cell proliferation marker (MIB-1). It was shown to. Although the Ki-67 antigen has many unclear points in terms of function, it is said that the expression level increases in the S phase and becomes maximum in the M phase. Therefore, the cells in which the expression of Ki-67 antigen was observed indicate that they are in the cell cycle. In FIG. 36A, many cell proliferation marker (anti-human Ki-67 antigen) positive cells were observed in human hepatocyte colonies formed in the TK-NOG mouse liver. In addition, cell proliferation marker positive cells were also observed in human hepatocyte colonies formed in uPA-NOG mouse liver (FIG. 36B).
Commercially available human normal hepatocytes (cells in which the liver is dispersed by enzyme treatment) include all cell populations in the liver. In both cases where these cells were transplanted as donor cells into TK-NOG and uPA-NOG mice, human hepatocyte colonies were formed in the liver. Furthermore, human-specific cell proliferation marker staining positive cells were observed in human hepatocyte colonies. This indicates that there are hepatocytes or hepatic progenitor cells and hepatic stem cells having the ability to divide and proliferate in donor cells. By using the mouse of the present invention, hepatic progenitor cells and hepatic cells in donor cells can be easily used. The presence of stem cells can be evaluated.

1. Production of human liver reconstructed chimeric mouse using TK-Balb / c dKO mouse and TK-NOD dKO mouse Preparation of TK-Balb / c dKO mice TK-Balb / c dKO mice and F1 generation mice obtained as a result of crossing TK-NOG mice with Balb / cA dKO mice (RAG-2 KO, IL-2R ^null ) , By repeated mating with Balb / cA dKO mice. In the process of backcrossing with Balb / cA dKO mice, the HSV-Tk, SCID, RAG-2, and IL-2R genes of the litter mice are examined, and the genetic background is Balb / c. TK-Balb / c dKO mice (HSV-Tk (+), SCID wild, RAG-2 KO, IL-2R ^null ) were obtained.
2. Preparation of TK-NOD dKO mice TK-dKO mice are crosses between F1 generation mice obtained by mating TK-NOG mice and NOD dKO mice (RAG-2 KO, IL-2R ^null ) and NOD dKO mice. It was produced by repeating. In the process of backcrossing with NOD dKO mice, the HSV-Tk, SCID, RAG-2 and IL-2R genes of the offspring mice are examined, and the genetic background is NOD. TK-NOD dKO mice (HSV- Tk (+), SCID wild, RAG-2 KO, IL-2R ^null ) were obtained. The following sequences as primers for HSV-tk genotyping:
The following sequences as primers for scid genotyping:
The following sequences as primers for RAG2 / IL-2R genotyping:
The following sequences as primers for IL-2R genotyping:
Was used in the PCR reaction according to the method used in the PCR described in Example 1.
3. Production of human liver reconstructed chimeric mouse using TK-Balb / c dKO mouse and TK-NOD dKO mouse A human liver chimeric mouse was produced according to the method of TK-NOG mouse. GCV was administered twice a day at 5 mg / kg intraperitoneally in TK-Balb / c dKO mice and TK-NOD dKO mice. On the third day after the second GCV administration, human hepatocytes suspended in HBSS were transplanted from the mouse spleen using a Hamilton syringe equipped with a 26G needle. Based on the follow-up of blood GPT values, no significant weight loss was observed in mice with liver injury despite high liver injury being monitored. Individuals with confirmed human albumin in the blood were euthanized and their livers collected. From the collected liver, a paraffin-embedded tissue section was prepared, and the section was subjected to immunohistochemical staining with an anti-human cytokeratin 8/18 antibody. FIGS. 37A and 37B show images of immunohistochemical staining with anti-human cytokeratin 8/18 antibody in the livers of TK-Balb / c dKO mice and NOD dKO mice transplanted with human hepatocytes, respectively. Engraftment of human hepatocytes stained with human cytokeratin 8/18 antibody in TK-Balb / c dKO mice and NOD dKO mice was confirmed.

The mouse of the present invention is a mouse in which liver cells are replaced with human liver cells, and has the structure or function of human liver. Using the mouse of the present invention, it is possible to analyze the infection of human-specific hepatitis virus, the metabolism of administered drugs, or the growth of human liver.
The mouse transplanted with the human hepatocytes of the present invention can exhibit the function of the human liver, and can evaluate the ease of metabolism of the drug in the human liver.

SEQ ID NOs: 2-46, 48-63 Primers All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety.
[Sequence Listing]

Claims (57)

  A mouse transplanted with human hepatocytes, wherein the exogenous thymidine kinase gene is retained so that it can be expressed specifically in the liver, and the mouse hepatocytes are replaced with human hepatocytes.   The mouse transplanted with human hepatocytes according to claim 1, wherein the liver has a three-dimensional structure or function of human liver.   The mouse transplanted with human hepatocytes according to claim 1 or 2, wherein the thymidine kinase gene is human herpes simplex virus type 1-thymidine kinase (HSV-tk) gene.   The mouse transplanted with the human hepatocytes according to any one of claims 1 to 3, wherein 75% or more of the mouse hepatocytes are replaced with human hepatocytes.   The mouse transplanted with the human hepatocytes according to any one of claims 1 to 3, wherein 80% or more of the mouse hepatocytes are replaced with human hepatocytes.   The mouse transplanted with the human hepatocyte according to any one of claims 1 to 3, wherein 90% or more of the mouse hepatocyte is replaced with a human hepatocyte.   The mouse transplanted with human hepatocytes according to any one of claims 1 to 3, wherein 95% or more of mouse hepatocytes have been replaced with human hepatocytes.   The mouse transplanted with human hepatocytes according to any one of claims 1 to 7, wherein the mouse is an immunodeficient mouse. 9. The immunodeficient mouse is a NOD / SCID mouse, a dKO mouse lacking RAG-2 and IL-2Rγc (RAG-2 KO, IL-2R ^null ), or a NOG (NOD / SCID / γc ^null ) mouse. Mice transplanted with the described human hepatocytes. The dKO mouse deficient in RAG-2 and IL-2Rγc is a Balb / c dKO mouse (RAG-2 KO, IL-2R ^null ) or a NOD dKO mouse (RAG-2 KO, IL-2R ^null ). A mouse transplanted with the human hepatocytes according to 9.   The mouse transplanted with the human hepatocyte according to any one of claims 1 to 10, wherein the hepatocyte isolated from human is a human hepatocyte cell line.   The mouse transplanted with human hepatocytes according to claim 11, wherein the human hepatocyte cell line is HepG2, Hep3B, or HuH-7.   The mouse transplanted with human hepatocytes according to any one of claims 1 to 10, wherein hepatocytes isolated from humans are primary cultured hepatocytes.   The thymidine kinase gene is retained under control of an albumin promoter, LST-1 promoter, α-fetoprotein promoter, or α-TTP promoter so that the thymidine kinase gene can be specifically expressed in the liver. 14. A mouse transplanted with the human hepatocytes according to any one of items 13. NOG (NOD / SCID / mice with γc ^null ) mutation.   The mouse according to claim 15, wherein the urokinase-type plasminogen activator gene is a mouse urokinase-type plasminogen activator gene.   The mouse transplanted with human hepatocytes according to claim 15 or 16, wherein 75% or more of mouse hepatocytes are replaced with human hepatocytes.   The mouse transplanted with human hepatocytes according to claim 15 or 16, wherein 80% or more of mouse hepatocytes have been replaced with human hepatocytes.   The mouse transplanted with human hepatocytes according to claim 15 or 16, wherein 90% or more of mouse hepatocytes are replaced with human hepatocytes.   The mouse transplanted with human hepatocytes according to claim 15 or 16, wherein 95% or more of mouse hepatocytes are replaced with human hepatocytes.   The mouse transplanted with the human hepatocyte according to any one of claims 15 to 20, wherein the hepatocyte isolated from human is a human hepatocyte cell line.   The mouse transplanted with human hepatocytes according to claim 21, wherein the human hepatocyte cell line is HepG2, Hep3B, or HuH-7.   21. A mouse transplanted with human hepatocytes according to any one of claims 15 to 20, wherein hepatocytes isolated from humans are primary cultured hepatocytes.   The urokinase-type plasminogen activator gene is located in the liver by being placed under the control of the albumin promoter, LST-1 promoter, α-fetoprotein promoter, or α-TTP promoter. 24. A mouse transplanted with the human hepatocytes according to any one of claims 15 to 23, wherein the mouse is maintained so that expression is possible. A mouse having a NOG (NOD / SCID / γc ^null ) mutation transplanted with human hepatocytes, in which mouse hepatocytes are replaced with human hepatocytes.   26. The mouse according to claim 25, wherein the urokinase-type plasminogen activator gene and the foreign thymidine kinase gene are retained so that they can be specifically expressed in the liver.   A method for producing a mouse in which human hepatocytes are transplanted and the mouse hepatocytes are replaced with human hepatocytes, wherein the thymidine kinase gene is introduced into the mouse so that it can be expressed specifically in the liver. Administration of a suicide substrate and hepatocytes isolated from a human to the mouse, damaging the mouse hepatocyte and replacing the mouse hepatocyte with a human hepatocyte. Manufacturing method.   28. The method for producing a mouse transplanted with human hepatocytes according to claim 27, wherein the thymidine kinase gene is human herpes simplex virus type 1-thymidine kinase (HSV-tk) gene.   29. The method for producing a mouse transplanted with human hepatocytes according to claim 27 or 28, wherein the suicide substrate is a substance that is metabolized to a toxic substance by thymidine kinase.   30. The method for producing a mouse transplanted with human hepatocytes according to claim 29, wherein the substance to be metabolized is acyclovir or ganciclovir.   The method for producing a mouse transplanted with human hepatocytes according to any one of claims 27 to 30, wherein the mouse is an immunodeficient mouse. 32. The human hepatocyte according to claim 31, wherein the immunodeficient mouse is a NOD / SCID mouse, a dKO mouse deficient in RAG-2 and IL-2Rγc (RAG-2 KO, IL-2R ^null ), or a NOG mouse. Method for producing a mouse.   The method for producing a mouse transplanted with human hepatocytes according to any one of claims 27 to 32, wherein the hepatocytes isolated from humans are human hepatocyte cell lines.   34. The method of claim 33, wherein the human hepatocyte cell line is HepG2, Hep3B, or HuH-7.   33. The method for producing a mouse transplanted with human hepatocytes according to any one of claims 27 to 32, wherein hepatocytes isolated from humans are primary cultured hepatocytes.   The thymidine kinase gene is placed under the control of an albumin promoter, LST-1 promoter, α-fetoprotein promoter, or α-TTP promoter, so that the thymidine kinase gene is specifically expressed and retained in the liver. 36. A method for producing a mouse transplanted with the human hepatocytes according to any one of claims 27 to 35.   37. A mouse transplanted with human hepatocytes obtained by the method according to any one of claims 27 to 36.   38. A method for measuring plasma dynamics of a test substance using the mouse according to any one of claims 1 to 26 and 37.   A method for identifying a metabolite of a test substance using the mouse according to any one of claims 1 to 26 and 37.   A method for identifying a metabolite of a test substance using hepatocytes isolated from the mouse according to any one of claims 1 to 26 and 37.   A method for measuring the metabolic rate of a test substance using the mouse according to any one of claims 1 to 26 and 37. The following steps:
(I) producing the mouse according to any one of claims 1 to 26 and 37; and (ii) inoculating the mouse according to (i) with human HCV;
A method for producing a mouse infected with human hepatitis C virus (HCV).   43. A mouse infected with human hepatitis C virus (HCV) produced by the method of claim 42. The following steps:
(I) a step of administering human HCV to the mouse according to any one of claims 1 to 26 and 37; and (ii) human HCV after a sufficient period of time for human HCV replication to occur in the host. Isolating from an infected host;
A method for culturing human hepatitis C virus (HCV). The following steps:
(I) administering a candidate drug to the mouse according to any one of claims 1 to 26 and 37; and (ii) analyzing the effect of the candidate drug on HCV infection, which has not been administered. A reduction in the amount of human HCV infection relative to the amount of infection in a mouse or in a mouse prior to administration of a candidate drug means the anti-HCV activity of the drug;
A method for screening a candidate drug having anti-HCV activity.   46. The method of claim 45, wherein the candidate agent is administered prior to infection with human HCV.   47. The method according to claim 45 or 46, wherein the candidate agent having anti-HCV activity is an anti-HCV antibody or an HCV-binding fragment thereof. The following steps:
(I) reconstituting the immunity of the mouse according to any one of claims 1 to 26 and 37;
(Ii) administering a candidate vaccine to the mouse according to (i); and (iii) analyzing the effect of the vaccine on HCV infection, to an untreated mouse or before the vaccine administration A reduction in the amount of human HCV infection relative to the amount of infection in a mouse means the anti-HCV activity of the vaccine;
A candidate vaccine having anti-HCV activity for use in active immunotherapy. The following steps:
(I) reconstituting the immunity of the mouse according to any one of claims 1 to 26 and 37;
(Ii) administering a candidate vaccine for therapeutic vaccination to the mouse according to (i); and (iii) analyzing the effect of the vaccine on HCV infection, which is for an untreated mouse, Or a reduction in the amount of human HCV infection relative to the amount of infection in mice prior to administration of the vaccine means the anti-HCV activity of the vaccine;
Screening a candidate vaccine for therapeutic vaccination having anti-HCV activity.   A method for searching for hepatic stem cells using the mouse according to any one of claims 1 to 26 and 37, comprising identifying hepatic stem cells from liver tissue engrafted in the mouse.   A method for collecting a cell population containing hepatic stem cells using the mouse according to any one of claims 1 to 26 and 37, wherein the cell population containing hepatic stem cells is collected from liver tissue engrafted in the mouse. A method involving that.   38. Human liver tissue reconstructed using the mouse according to any one of claims 1 to 26 and 37.   A mouse in which a thymidine kinase gene and / or a urokinase-type plasminogen activator gene are retained so that they can be expressed in the liver, and human hepatocytes can be engrafted in the liver.   54. The mouse of claim 53, wherein the thymidine kinase gene is herpes simplex virus type 1 thymidine kinase.   The mouse according to claim 53 or 54, wherein the mouse is an immunodeficient mouse. 56. The immunodeficient mouse is a NOD / SCID mouse, a dKO mouse lacking RAG-2 and IL-2Rγc (RAG-2 KO, IL-2R ^null ), or a NOG (NOD / SCID / γc ^null ) mouse. The mouse described. The dKO mouse deficient in RAG-2 and IL-2Rγc is a Balb / c dKO mouse (RAG-2 KO, IL-2R ^null ) or a NOD dKO mouse (RAG-2 KO, IL-2R ^null ), Item 56. The mouse according to item 56.