JPWO2006100710A1 - Composition for prevention and treatment of severe acute respiratory syndrome - Google Patents

Abstract

According to the present invention, a highly safe composition for preventing or treating severe acute respiratory syndrome can be provided at an early stage. That is, the present invention is a composition for preventing or treating severe acute respiratory syndrome comprising catechins, wherein the ratio of the weight of epigallocatechin gallate to the weight of total catechins in the composition is 0. The composition is characterized by being 3 to 0.8.

Description

  The present invention relates to a composition for preventing or treating severe acute respiratory syndrome, which comprises catechins in a specific ratio range.

  Severe Acute Respiratory Syndrome (SARS) was first discovered in November 2002 in the southern part of the mainland of China, and explosively and massively prevalent in Hong Kong in March 2003. Between November 1, 2002 and June 18, 2003, 8,465 suspected SARS cases were reported from each country to the World Health Organization (WHO), of which 801 were confirmed dead.

SARS, which is a fatal respiratory disease, has been found to be caused by SARS virus (Severe Acquired Respiratory Syndrome-Associated Corona Virus (SARS-CoV)), which is a type of coronavirus. Currently, drugs such as ribavirin, 6-azauridine, pyrazofurin, mycophenolic acid, and glycyrrhizin having anti-replicating action against SARS virus are used for the treatment of SARS (for example, Non-Patent Document 1). reference). Moreover, in the past research, it is thought that glycyrrhizin (for example, refer nonpatent literature 2) which is an active substance extracted from the licorice root of a Chinese medicine has the strongest anti-coronavirus replication action. ing.
Lancet. 2003 Jun 14; 361 (9374): 2045-6 J Chromatogr A.J. 2004 Apr 9; 1033 (1): 183-6

  However, the currently used drugs have problems such as the possibility of causing complications such as hypertension and diabetes. Therefore, it is desired to develop further new drugs capable of effectively treating SARS. .

  In addition, scientists from various countries are actively searching for compounds that can effectively treat SARS using drug screening techniques and the like. However, considering the time required for confirming the safety of the compound, the path to the completion of a new drug that can effectively treat SARS is still far away.

  Therefore, an object of the present invention is to provide a highly safe composition for preventing or treating SARS as early as possible.

  The present inventors searched for a substance having an anti-SARS virus replication action from a natural product and selected a food extract, and obtained a composition containing catechins in a specific ratio range obtained from a green tea extract. Was found to have anti-SARS virus replication action.

That is, the present invention
[1] A composition for preventing or treating severe acute respiratory syndrome comprising catechins, wherein the ratio of the weight of epigallocatechin gallate to the weight of total catechins in the composition is 0.3 to A composition, characterized in that it is 0.8;
[2] The composition according to claim 1, wherein the ratio of the weight of the total ester catechins to the weight of the total catechins in the composition is 0.5 to 0.95; and [3] The composition according to claim 1 or 2, which is a food or a medicine.

  Since the composition of the present invention has an effect of suppressing the growth of SARS virus, the present invention can provide a composition for the prevention and treatment of SARS. In addition, catechins contained in the composition of the present invention have already been confirmed to be safe for food use, and can be prepared from existing natural products such as tea leaves. It is possible to provide a composition for the prevention and treatment of high SARS.

FIG. 1 shows the observation results of pathological changes of SARS-CoV infected Vero E6 cells. FIG. 2 shows the results of immunofluorescence staining of SARS-CoV infected Vero E6 cells. FIG. 3 is an electrophoretic image of an RT-PCR product showing expression of SARS-CoV-derived RNA in SARS-CoV-infected Vero E6 cell culture medium. FIG. 4 is a Western blot image showing the expression of SARS-CoV-derived protein in SARS-CoV-infected Vero E6 cell extract.

  The composition of the present invention contains catechins in a specific ratio range. Specifically, the composition of the present invention is characterized in that the ratio of the weight of epigallocatechin gallate to the weight of the total catechins in the composition is 0.3 to 0.8. Because of this feature, the composition of the present invention has a growth inhibitory effect against SARS virus, and can be used as an effective prophylactic or therapeutic composition against SARS.

  In the present invention, “catechins” refers to at least one compound selected from the group consisting of catechin, epicatechin, gallocatechin, epigallocatechin, catechin gallate, epicatechin gallate, and epigallocatechin gallate. .

  In the present invention, “ester-type catechins” refers to at least one compound selected from the group consisting of catechin gallate, epicatechin gallate, and epigallocatechin gallate.

  Further, in the present invention, “total catechins” refers to all catechins contained in the composition. Moreover, “total ester type catechins” refers to all ester type catechins contained in the composition.

  In the present invention, the content ratio of each catechin in the composition is analyzed using an Agilent 1100 series liquid chromatograph (Agilent 1100 series).

  In the composition of the present invention, it is necessary that the ratio of the weight of epigallocatechin gallate to the weight of the total catechins in the composition is 0.3 to 0.8 from the viewpoint of the growth inhibitory effect against SARS virus. 0.5 to 0.7 is preferable. The ratio of the weight of the total ester catechins to the weight of the total catechins in the composition is preferably 0.5 to 0.95, and more preferably 0.6 to 0.8.

  From the same viewpoint as described above, the composition of the present invention preferably has a total catechin content of 30% by weight or more, and more preferably 50% by weight or more.

  The composition of the present invention can be obtained by extraction from a natural product containing catechins as described below, but is not limited thereto, and the obtained composition is the specific of the present invention. It is sufficient that catechins are contained within the ratio range. For example, the composition of the present invention can be obtained by blending each catechin so as to be in a specific ratio range of the present invention using each catechin product already marketed as a product.

  The natural product containing catechins used in the present invention is not particularly limited as long as it contains catechins, and examples thereof include tea leaves.

  Examples of tea leaves include green tea leaves, oolong tea leaves, black tea leaves, and the like. When using tea leaves, the tea leaves may be used as they are, or may be used after being pulverized.

  Extraction of catechins from natural products can be performed according to conventional techniques in the art. As an extraction method, for example, a method of extracting tea leaves or crushed tea leaves with water, hot water, monohydric alcohol such as methanol, ethanol, propanol or polyhydric alcohols such as glycerin, tea leaves or crushed tea leaves, etc. And a fraction obtained by adding a solvent such as ethyl acetate or acetone to a fraction extracted using a monohydric alcohol such as water, hot water, methanol, ethanol or propanol or a polyhydric alcohol such as glycerin. .

  Moreover, about the catechin obtained as mentioned above, each catechin can be isolate | separated and refine | purified, for example using a polar resin column. Furthermore, by blending the above-described refined products of each catechin, the content ratio of epigallocatechin gallate and ester-type catechins containing the same can be adjusted as desired, and the specific ratio of the present invention A composition having catechins in a range can be obtained.

  The composition of the present invention obtained as described above can be used alone as it is for the purpose of preventing or treating SARS, but can also be used in the form of food or medicine. The food in the present invention includes food additives and the like.

  The composition of the present invention as a food is, for example, each catechin such that the food after manufacture contains catechins in a specific ratio range according to the present invention with respect to the types of food listed below. Can be blended and manufactured.

  Examples of the food used in the present invention include solid foods such as dried foods and supplements, and liquid foods such as soft drinks, mineral water, taste drinks, and alcoholic drinks. Examples of solid foods include tablets, mousses, jelly, frozen desserts, strawberries, chocolates, crackers, cakes, breads, noodles, gums, snacks, and other livestock products such as hams and sausages, marine products such as salmon Is mentioned. Examples of liquid foods include teas such as green tea, oolong tea, black tea, herbal tea, concentrated fruit juice, concentrated reduced juice, straight juice, fruit mixed juice, fruit juice with fruit juice, fruit juice drink, fruit / vegetable mixed juice, Examples include vegetable juice, carbonated drinks, soft drinks, milk drinks, lactic acid bacteria drinks, coffee drinks, sake, beer, wine, cocktails, shochu and whiskey.

  The composition of the present invention as a pharmaceutical has a specific ratio in the present invention after the production with respect to a known organic or inorganic carrier, excipient, binder, stabilizer, etc. suitable for oral administration. Each catechin can be blended and produced so as to contain catechins in a range.

  The form of the pharmaceutical may be any of solution, suspension, powder, solid molding, etc. The dosage form is tablet, capsule, powder, granule, drink, injection, patch, suppository. And inhalants.

  As described above, the composition of the present invention can be administered to mammals including humans for the purpose of preventing or treating SARS alone or in the form of food or pharmaceuticals.

  The dose of the composition of the present invention for obtaining the desired effect of the present invention is usually preferably 1 to 100 mg / kg body weight per day, more preferably 5 to 50 mg / kg body weight per day. However, the dose in the present invention is not limited to such a range, and so as to obtain the desired effect of the present invention, species difference, sex, age, individual difference, presence / absence of SARS infection, symptom, desired In consideration of the degree of effect, etc., the dose may be set appropriately in a specific manner. Similarly, the administration timing, administration period, and the like of the composition of the present invention can be appropriately set individually and appropriately.

  The administration method of the composition of the present invention is not particularly limited, but is preferably oral administration.

  The catechins contained in the composition of the present invention have already been shown to have high safety, and are already widely used as food additives for foods taken by humans. Therefore, the composition of the present invention can be used safely and effectively for the purpose of preventing or treating SARS.

  The present invention will be described below with reference to examples, but the scope of the present invention is not limited thereto.

Example 1: Preparation of a catechins-containing composition and measurement of the content of each catechin in the composition From a green tea extract obtained by extracting green tea leaves with hot water, a technique for removing caffeine known in the art 6-142405, JP-A-7-16057), caffeine was removed to obtain a green tea extract mainly composed of catechins. Furthermore, the catechins-containing composition (composition) of the present invention is obtained by separating and purifying each catechin using a polar resin column and blending the purified product so as to be within the specific ratio range of the present invention. A to F) were obtained.

  1 mg of each of the obtained compositions A to F was dissolved in 1 ml of an eluent (25% methanol, 74.9% deionized water (MilliQ, 18.2 MΩ), 0.1% formic acid (v / v)). (1 mg / ml) and filtered through a 0.45 μm filter to obtain a sample for component ratio analysis. 1 μl of the obtained sample was added to an Agilent 1100 series liquid chromatograph (Agilent 1100 series) equipped with a column (Eclipse XDB-C8 5 μm, 4.6 × 150 mm), and the eluent was flowed at a flow rate of 0.5 ml / min. For 30 minutes at 40 ° C. By comparing the obtained analysis chart with the standard product of each catechin, the content ratio of each catechin in each composition was measured.

  The results are shown in Tables 1 and 2 below. Table 1 shows each catechin content (% by weight, per composition dry weight) in the compositions A to F. Table 2 shows the ratio of the content of each ester type catechin to the total amount of catechins in the compositions A to F (weight of each ester type catechin / weight of total catechin).

Test Example 1: In vivo SARS-CoV growth inhibitory action test Infecting cynomolgus monkeys pre-administered with the composition of the present invention with SARS-CoV, the composition of the present invention inhibits SARS-CoV growth in the body. Investigated about.

  Six cynomolgus monkeys were prepared. For 3 animals, the catechins-containing composition of the present invention prepared by the method described in Example 1 was orally administered daily at a dose of 50 mg / kg body weight for 2 weeks to form a test group. The other 3 animals did not receive the composition and served as a control group. Two weeks after the start of oral administration, SARS-CoV virus isolated from SARS patients, cultured, isolated and concentrated in green monkey kidney-derived Vero E6 cells was administered intranasally / tracheally to both test and control cynomolgus monkeys. . Cynomolgus monkeys were housed one by one in a negative pressure cabinet, and changes in symptoms were observed daily. Samples were collected regularly, and after death, they were dissected and examined for pathological findings.

  As a result, in the control group, SARS virus was detected in the nose and pharynx from 2 days after infection. In addition, 2 out of 3 animals in the control group developed diffuse lesions in the alveoli and died 3 days after infection. The remaining one developed diffuse damage to the alveoli starting 4 days after infection and died 5 days later. On the other hand, in the test group, SARS-CoV was detected in the nose and pharynx in 1 out of 3 animals and died 10 days after the infection, but SARS-CoV was not detected in the other 2 animals in the test group. There was not.

  From the above results, it was revealed that SARS-CoV infection can be suppressed by oral administration of the composition of the present invention, and the effectiveness of the composition of the present invention in anti-SARS virus growth was confirmed.

Test Example 2: SARS-CoV growth inhibitory action test in vitro

  In vitro SARS-CoV growth inhibitory action of the composition of the present invention was examined by infecting cultured cells pre-added with the composition of the present invention with SARS-CoV.

i) Observation of cytopathological changes 4 × 10 ⁴ green monkey kidney cells (Vero E6: American Type Culture Collection; provided by ATCC) were seeded in 48-well cell culture dishes and incubated under CO ₂ gas phase . Subsequently, the catechins-containing composition of the present invention prepared by the method described in Example 1 was added to the medium at concentrations of 780 μg / ml, 390 μg ml, and 195 μg / ml, respectively, and these were designated as test groups 1 to 3, respectively. Moreover, the thing which does not add a catechin containing composition was made into the control group. One hour after the addition of the composition, Vero E6 cells were infected with SARS-CoV (Hong Kong strain, provided by Taipei Disease Control Bureau, Taiwan) at a 0.1 virus superinfection (MOI).

  Forty-eight hours after infection, pathological changes (CPE) of Vero E6 cells were observed using a phase contrast microscope (Nikon R). As shown in FIG. 1, in the test groups 1 to 3, Vero E6 cells remained attached to the bottom of the culture dish as usual and were not accompanied by morphological changes. On the other hand, in the control group, it was observed that Vero E6 cells floated in the culture medium and all were killed.

ii) Expression analysis of SARS virus protein by immunofluorescence analysis In the same manner as above, Vero E6 cells in test groups 1 to 3 and control group were prepared, and 1 hour after the addition of the composition, SARS-CoV was added to 0.1M. O. Infected with I.

  Cells were harvested 48 hours after infection, cells were fixed with 10% formaldehyde and a half-mix of methyl alcohol and acetone, and then antiserum obtained from a convalescent SARS patient was used to Immunofluorescence staining for SARS virus antigens was performed.

  Fluorescence emitted from intracellular SARS virus antigen was observed using an inverted fluorescence laser microscope (ZeissR). As shown in FIG. 2, all the Vero E6 cells in the control group showed fluorescence of SARS virus antigen, whereas the cells in test groups 1 to 3 treated with the catechins-containing composition of the present invention showed fluorescence. There wasn't.

iii) Analysis of SARS virus mRNA expression by RT-PCR In the same manner as above, Vero E6 cells in test groups 1 to 3 and control group were prepared, and 1 hour after the addition of the composition, SARS-CoV was added to 0.1M. O. Infected with I.

Cell culture fluid was collected 48 hours after infection, and viral RNA was isolated from this cell culture fluid using QIAampRVIRALRNA MINI Kit (Qiagen). RT-PCR was performed using 1 μl of viral RNA using the Qiagen® One Step RT-PCR Kit. As a SARS virus-specific primer during RT-PCR, a 5 ′ primer:
CTAACATGCCTTAGGATAATGG, and 3 ′ primer:
CAGGTAAGCGTAAAACTCATC was used. The reaction conditions for RT-PCR are as follows: First, the reaction was carried out at 50 ° C. for 30 minutes as a reverse transcription reaction. Next, the reaction at 95 ° C. for 15 minutes was performed for 1 cycle, the reaction at 94 ° C. for 30 seconds, the reaction at 50 ° C. for 30 seconds, the reaction at 72 ° C. for 15 minutes for 25 cycles, and the reaction at 72 ° C. for 10 minutes for 1 cycle.

  As a result of analyzing the product after RT-PCR reaction by 2% agarose gel electrophoresis, as shown in FIG. 3, a band was confirmed at a position of 368 bp in the control group. On the other hand, in the test groups 1 to 3, no band could be confirmed.

iv) Analysis of SARS virus protein expression by Western blotting In the same manner as above, Vero E6 cells in test groups 1 to 3 and control group were prepared, and 1 hour after the addition of the composition, SARS-CoV was added to 0.1M. O. Infected with I.

  Cell extracts were collected 48 hours after infection. 10 μg of the protein obtained from the cell extract was electrophoresed and then transferred onto a nylon membrane. Western blotting was performed using SARS patient-derived antiserum in the recovery phase, and the signal was observed by X-ray.

  As a result, as shown in FIG. 4, signals indicating the presence of SARS virus spike protein (S) and nucleocapsid protein (NP) were confirmed in the control group, whereas in the test groups 1 to 3, the signal was It was not confirmed.

  From the result of i), it was revealed that the catechins-containing composition of the present invention has an effect of effectively suppressing a cytopathological change caused by SARS virus infection. Moreover, the effect was confirmed also from molecular biology by the result of ii) -iv). As described above, it was also revealed in in vitro experiments that the composition of the present invention can effectively suppress SARS infection in cells.

  According to the present invention, it is possible to provide a highly safe composition for the prevention and treatment of SARS, which has an effect of suppressing the growth of SARS virus.

  SEQ ID NO: 1 is the sequence of the 5 'primer for SARS viral RNA.

  SEQ ID NO: 2 is the sequence of the 3 'primer for SARS viral RNA.

Claims (3)

  A composition for preventing or treating severe acute respiratory syndrome comprising catechins, wherein the ratio of the weight of epigallocatechin gallate to the weight of total catechins in the composition is 0.3 to 0.8. A composition, characterized in that   Furthermore, the ratio of the weight of the total ester type catechins with respect to the weight of the total catechins in the said composition is 0.5-0.95, The composition of Claim 1 characterized by the above-mentioned.   The composition of Claim 1 or 2 which is a foodstuff or a pharmaceutical.

Images