JPS62143686A - Stabilized human prourokinase - Google Patents

Abstract

PURPOSE:To improve stability of human prourokinase to enzyme in and out of living body, by forming a human prourokinase-like polypeptide having an amino acid sequence represented by a specific general formula or an amino acid sequence essentially same as the above sequence. CONSTITUTION:A DNA segment coding a polypeptide of formula (Met is methionine; Ser is serine at the 1-site of N-terminal; X is lysine or amino acid at 135-site other than basic amino acid; Y is phenylalanine or acidic amino acid at 157-site; horizontal line is amino acid sequence same as the corresponding part of the amino acid sequence of natural human prourolinase) is prepared beforehand. Escherichia coli transformed with said DNA segment and plasmid is cultured and the objective prourokinase-like polypeptide is separated from cultured bacterial cell.

Description

DETAILED DESCRIPTION OF THE INVENTION [Industrial Application Field] The present invention provides a stabilized toprourokinase-like polypeptide, a DNA segment encoding a human prourokinase-like polypeptide, and a plasmid containing the DNA segment. , an E. coli containing the plasmid, and a method for producing human prourokinase-like polypeptide 1' using this E. coli.

The stabilized human prourokinase of the present invention is stable against various proteolytic enzymes, and therefore can be produced in high yield and purity. Furthermore, when these drugs are administered to humans or animals, they are not easily hydrolyzed by enzymes in the body, so it is expected that the medicinal effects thereof will last for a long time.

On the other hand, when the gene system containing DNA segments 1 to 1 encoding human-prourokinase-like voripeptide of the present invention is used, the polypeptide can be efficiently expressed, and therefore the polypeptide can be produced economically. Ru.

[Conventional technology]

Human urokinase is an enzyme that exists in trace amounts in human urine, and has the effect of activating inactive plasminogen into plasmin, and the generated plasmin can dissolve fibrin. This urokinase consists of two polypeptide chains linked by disulfide bonds. On the other hand, human pro-urokinase is a single-chain polypeptide in which the two polypeptide chains described above are linked by an amide bond, and although this pro-urokinase itself does not have the above-mentioned activity, is converted into the above-mentioned active urokinase by being cleaved.

Urokinase is also referred to as mature urokinase.

Because human urokinase has the above-mentioned effects, it has been used as a thrombolytic therapeutic agent. Since human urokinase is used as an intravenous drug, a highly purified product is required, but it is generally said that urokinase is an unstable enzyme and is easily degraded during the purification process. For example, urokinase produced from human urine has a molecular weight of approximately 54,000.
It consists of a high molecular weight urokinase with a molecular weight of about 33,000 and a low molecular weight urokinase with a molecular weight of about 33,000. This low molecular weight urokinase is produced by the cleavage of the high molecular weight urokinase with a protease. It has been suggested that this cleavage site is a peptide bond between two lysine residues at positions 135 and 136 from the N-terminal serine of the mature polymeric urokinase. Such cleavage occurs not only during the purification process of urokinase from human urine, but also during the purification process of pro-11-1-nerbi produced by recombinant DNA techniques, and even when pro-urokinase is intravenously injected. In this case, it is also expected to be caused by trypsin-like protease contained in plasma.

However, high molecular weight urokinase is considered to be more effective than low molecular weight urokinase in dissolving fibrin in vivo (Reference 1).

Therefore, there is a strong need for a stabilized pro-urokinase and a method for producing the same that yields a stabilized urokinase that has an activity similar to that of natural human polymeric urokinase and is not easily degraded by proteases. However, such a stabilized pro-urokinase by converting amino acids and a method for producing the same are not known.

Human prourokinase was isolated as a single-chain polypeptide with a molecular weight of approximately 54,000 (Reference 2.3).
. Brepic et al., when this prourokinase is administered into the body and converted to urokinase, has stronger thrombolytic activity than when urokinase is directly administered.
It has also been reported that fibrinogen decomposition, which is a side effect, is low (Reference 4), suggesting its potential as a new thrombolytic agent. When prourokinase is administered, this activation is carried out by a small amount of plasmin adsorbed to the thrombus in the area where the thrombus exists.
In other words, prourokinase is activated specifically in blood clots, so it is less susceptible to inhibitors in the blood and is thought to have fewer side effects.

However, this activation occurs very easily, and once prourokinase is activated to urokinase, its degradation proceeds rapidly due to its own enzymatic activity. As a result, the clot-dissolving activity cannot be sustained for a long time in vivo. Additionally, if the above activation occurs during the manufacturing process of pro-urokinase, pro-urokinase is decomposed into high-molecular-weight urokinase, which is further decomposed into low-molecular-weight urokinase, increasing the content of low-molecular-weight urokinase in the product (
Reference 5).

There is therefore a need for a new type of human prourokinase that is relatively difficult to activate and therefore does not have the disadvantages of natural human prourokinase as described above. However, such improved human
Prourokinase is unknown.

By the way, urokinase has conventionally been produced by extracting and purifying human urine. However, this method has problems with the stable supply of human urine, which is a raw material, and cannot necessarily be said to be an industrially superior method. On the other hand, recently, a method for producing urokinase by isolating and subculturing human kidney cells has been developed (Reference 29). However, in this tissue culture method, it has been reported that the production of high-molecular-weight urokinase, which is effective as a therapeutic agent, decreases over time, and the production of low-molecular-weight urokinase increases (Reference 6), which indicates that there is no practical use of urokinase. This cannot necessarily be said to be an ideal manufacturing method.

JP-A-59-51300 discloses a method for producing urokinase using genetic engineering techniques. However, the specific method for confirming the expression of urokinase is
This is a method in which the gene encoding urokinase is linked to the trpE gene to express a fusion protein of trpn and urokinase, and this is cleaved to obtain low-molecular-weight urokinase; direct expression of pro-urokinase has not been confirmed. Furthermore, the expression level of the fusion protein is not shown.

As described above, there is no known method for effectively expressing Prou r:I ginase and producing it economically.

[Problem that the invention seeks to solve]

Therefore, the present invention can be decomposed and transported by various enzymes in vitro and in vivo, and therefore can be easily manufactured as a highly pure product, and when administered in vivo, Stabilized human-prourokinase-like polypeptides that provide greater specificity and improved persistence of thrombolysis, genetic systems for producing the polypeptides, and polypeptides using the genetic systems The present invention provides a method for manufacturing.

[Means for solving problems]

Accordingly, the present invention relates to the formula , or an amino acid other than a basic amino acid, Y is phenylalanine or an acidic amino acid present at position 157, and the solid line part is the same amino acid sequence as the corresponding part of the amino acid sequence of natural human prourokinase, However, if X is lysine, Y is not phenylalanine.)
Provided is a stabilized human prourokinase-like polypeptide having an amino acid sequence represented by, or an amino acid sequence substantially identical thereto.

This invention also provides DNA encoding the stabilized human-prourokinase-like polypeptide described above that is efficiently expressed in E. coli.

The invention further provides a plasmid containing the DNA described above, a control region for the expression of the prourokinase-like polypeptide, and the necessary NA sequences for replication in E. coli.

The invention further provides E. coli transformed with the above plasmid.

This invention further provides a method for producing the human prourokinase-like polypeptide using the E. coli.

[Specific explanation]

A, S' Stabilized Human-Prourokinase Polypeptide The stabilized human-prourokinase-like polypeptide of this invention has the following formula: where Met is an optional methionine, and Set is serine present at position 1 of the N-terminus, X is lysine present at position 135 or an amino acid other than a basic amino acid, Y is phenylalanine or an acidic amino acid present at position 157, and the horizontal line portion is the same amino acid sequence as the corresponding part of the amino acid sequence of natural 1-brouro4-nase, provided that when X is lysine, Y is not phenylalanine, or It has substantially the same amino acid sequence as .

Urokinase is a protein consisting of 410 amino acids, and its amino acid sequence is already known (References 8 and 9). It is known that the plasminogen activator activity of 17-kinase is brought about by a peptide portion consisting of 275 heptad amino acids at its C-terminus, but a peptide consisting only of this portion is It has been pointed out that the affinity is low (Reference 7)
. Peptides consisting only of the active portion are referred to as small urokinases, while urokinases consisting of 410 amino acids are referred to as high molecule urokinases.

As mentioned above, low-molecular-weight urokinase is thought to have low affinity with plasminogen, and therefore urokinase products with a high content of high-molecular-weight urokinase are strongly desired.

Therefore, pro-urokinase, which is a precursor of urokinase, is preferably one that is difficult to be reduced to a low molecular weight. The present inventors set the N-terminal serine of prourokinase at position 1 and changed the lysine located at position 135 to an amino acid other than a basic amino acid.
Cleavage between the two lysines at position (corresponding to the change from high molecular weight urokinase to low molecular weight urokinase in urokinase) is less likely to occur, and the modified polypeptide in which the amino acid is replaced with the natural protein We have discovered the surprising fact that urokinase has similar physiological properties to urokinase (the property that urokinase exhibits activity when activated).

The stabilized prourokinase-like polypeptide of the present invention is characterized in that in the above general formula, X is either lysine or an amino acid other than a basic amino acid; however, if X is lysine, then As explained in detail, Y is not phenylalanine. The amino acids other than the basic amino acids of X may be any neutral or acidic amino acids that do not adversely affect the physiological properties of the target polypeptide, such as alanine, asparagine, aspartic acid, glutamine, glutamic acid, and phenylalanine. , glycine, isoleucine, leucine, methionine, serine, threonine, valine, tryptophan, tyrosine, proline, etc. Specific examples include asparagine or glutamine, which are amides of acidic amino acids; serine or threonine, which are hydroxy amino acids; It can be divided into glutamic acid or aspartic acid, which are acidic amino acids; and isoleucine, leucine, or valine, which are branched-chain neutral amino acids. The present inventors prepared peptides in which lysine at position 135 of human prourokinase was actually replaced with either glutamine, threonine, glutamic acid, or isoleucine, and demonstrated that their resistance to cleavage between positions 135 and 136 and the physiological When we investigated the activity of both polypeptides, we found that 135-1
It was confirmed that it has high resistance to cleavage between position 36 and retains the physiological properties of natural prourokinase. From this fact, it can be concluded that brololytic acid (2
J) Nases were stabilized against various proteases that recognize two basic amino acids and cleave the bond between the two basic amino acids, and that the amino acid at position 135 was used for urokinase activity. It can be reasonably concluded that it does not necessarily have to be lysine.

Prourokinase is 1 with the N-terminal serine at position 1.
Urokinase is activated by cleavage of the peptide bond between lysine 58 and isoleucine 159 by a protease such as plasmin or trypsin. Once activated, urokinase is degraded by its own proteolytic activity, reduced to a low molecular weight, and loses its activity. Therefore, in order to obtain sustained urokinase activity in vivo, it is desirable to suppress the above-mentioned cleavage.

On the other hand, the peptide bond between fulginine at position 156 and phenylalanine at position 157 is cleaved by thrombin and the like, and this cleavage reduces urokinase activity.

The present inventors have demonstrated that by replacing phenylalanine at position 157 with aspartic acid or glutamic acid, which are acidic amino acids, the above-mentioned cleavage by thrombin etc. is inhibited, and furthermore, such a substitution does not cause any loss of physiological properties of natural prourokinase. I discovered the surprising fact that no. This fact suggests that the proteases involved in this cleavage, such as plasmin and trypsin, recognize the positive charge on the side chain of the 158th lysine residue, and instead of amino acids near this, such as phenylalanine at the 157th position, the side chain has a negative charge. This can be rationally explained by considering that the cleavage rate can be reduced by suppressing protease recognition by introducing an acidic amino acid having a .

In the present invention, the following polypeptide was prepared as a specific example of the combination of X and Y.

Symbol -x-N- 1pm Gin Phg pm2 T h r P h eE135
Glu Phe1135
T I e P h epm
3 Lys AspQ135D1
57 G 1 n A s pE135D15
7 G l u A sp The various polypeptides described above are characterized by their sensitivity to trypsin for the effect of substitutions in X and by their sensitivity to plasmin and thrombin for the effect of substitutions in Y, as described in detail below. The susceptibility to

As a result, it was confirmed that all of the above-mentioned substitutions brought about the desired stabilizing effect, and that the original 41-mycotic properties of natural prourokinase were not lost due to these substitutions. Therefore, these facts, combined with the above-mentioned presumed stabilization mechanism, reasonably indicate that polypeptides consisting of all the combinations of X and Y defined above will exhibit the stabilizing effect of the present invention. make an estimate. Therefore, all prourokinase-like polypeptides consisting of a combination of X and Y as defined above are within the scope of the present invention.

The amino acid sequence indicated by the horizontal line in the above general formula is identical to the corresponding portion of the amino acid sequence of natural human prourokinase. cD corresponding to mRNA derived from human kidney as amino acid sequence of natural human prourokinase
Mention may be made of a sequence consisting of 411 amino acids encoded by NA. This amino acid sequence is the fourth
It is shown in Figures 1 to 4-3 by the amino acid symbol consisting of three uppercase letters of alphabento.

In the general formula, (Met)- is N of prourokinase.
- Indicates methionine that may be present on the N-terminal side adjacent to Set at position 1 at the -terminus. According to the production method of the present invention, which will be described in detail later, a polypeptide having a methionine derived from the translation initiation codon at the N-terminus is expressed, and this methionine is removed by an enzyme in the cells of E. coli, resulting in N-terminus. Polypeptides that do not have methionine added to their ends may be obtained. Therefore, the present invention includes both polypeptides with and without this methionine.

The stabilized human prourokinase-like polypeptides of the present invention include polypeptides having the amino acid sequence described in detail in ``-'' as well as polypeptides having substantially the same amino acid sequence. Here, "substantially the same amino acid sequence" means that a small number of amino acids other than X and Y in the above amino acid sequence are replaced with other amino acids or deleted, or "1. It refers to an amino acid sequence in which a small number of amino acids (=J) are added to the sequence, but still provides the physiological properties of brourokinase and the stability that is a feature of the present invention. It is well known by those skilled in the art that even if changes are made to the amino acid sequence in a region that is not involved in the physiological activity, the physiological activity may not be affected. Peptides also fall within the scope of the present invention as long as they retain the characteristics of the present invention.

B. System of Human Prourokinase This invention further relates to a genetic system useful for producing stabilized human prourokinase. Here, the genetic system includes a DNA segment encoding the human prourokinase-like polypeptide of interest, a plasmid containing this DNA segment, and a host into which this plasmid has been introduced.

A representative NA of the present invention includes a codon encoding multiple amino acids at the N-terminus, which is a codon frequently used in E. coli, and a codon encoding the multiple amino acids at the N-terminus and the X and I) NA in which codons other than the codon encoding Y are the same as the codons for the corresponding amino acids in cDNA corresponding to human kidney-derived mRNA are included.

A gene encoding a protein consisting of a large number of amino acids such as human prourokinase is a DNA segment derived from a biological cell that naturally produces the protein, that is, a human cell, such as m-prourokinase encoding a protein.
It is convenient to use cDNA obtained for RNA, and although it is not impossible to synthesize DNA encoding such high molecular weight proteins, it requires a great deal of effort.

On the other hand, in order to effectively express a protein in E. coli, it is considered preferable to use a gene consisting of codons that are frequently used in E. coli, but these conditions are not sufficient for human-derived cDNA. However, in order to obtain DNA that satisfies these conditions, we have no choice but to rely on chemical synthesis.

The present inventors mainly used human-derived cDNA as the gene encoding human pro-urokinase, and in this cDNA, only the codons encoding a few amino acids at the N-terminus of pro-urokinase were isolated with high frequency in E. coli. Synthetic NAT consisting of the codons used: Replacement results in a gene that is efficiently expressed in E. coli.

In selecting the codons for the synthetic NA portion, mR
This prevents the formation of folded structures into N and furthermore, m R
In a preferred embodiment of the expression plasmid of the invention (2B) the S of the metavirocatecase gene (C230) used
It is preferable to select so as to eliminate the complementary structure between the base sequence near the D sequence and the base sequence at the 5' end of the human prourokinase gene, thereby preventing their complementary association. Furthermore, it is preferable to select a codon for serine, which is the first amino acid, so that the next base after the translation initiation codon ATG is A.

In a preferred embodiment of the present invention, a translation initiation codon ATG encoding methionine is provided adjacent to and upstream of the codon for serine, which is the N-terminal amino acid of the coding region designed as described above. Allows direct expression. Furthermore, in a preferred embodiment of the present invention, when I) NA of this coding region is inserted into an expression vector, the SD sequence of the metavirotecase gene used in the preferred expression vector of the present invention and the inserted prourokinase gene ATG of
Adjacent to and upstream of the ATG is the confirmation sequence of the limiting oxygen A1, 5' C(8 TG) 3'3' TGCAG, so that the distance and structure between is identical to that in the natural metapyrotecase gene. (TAC)5.

will be established.

Therefore, in the most preferred embodiment of this invention, within the cDNAO encoding human prourokinase, human
The DNA sequence encoding the N-terminal 6 amino acids of prourokinase and upstream thereof was changed as shown in Figure 1, and in the other coding regions, the DNA sequence of the cDNA (amino acids X or Y, if applicable) was changed. (including mutations to code) are used. In addition, in this area,
A single restriction enzyme site is provided to allow screening for recombinants and substitution with other DNA sequences.

FIG. 5 shows an example of a modified base sequence of the present invention. In this base sequence, codons frequently used in E. coli are used as codons for asparagine, glutamic acid, leucine, histidine, glutamine, and proline. Furthermore, in this base sequence, the leader sequence present in the natural cDNA is removed and replaced with a codon for serine, the first amino acid of human prourokinase, in order to enable direct expression of human prourokinase. Adjacent to it is a translation initiation codon ATG encoding methionine, and an Aat11 site is also provided to enable insertion into an expression plasmid.

In the general formula, when X is an amino acid other than a basic amino acid, a codon encoding the desired amino acid other than the basic amino acid must be used in place of the cDNA codon when X is lysine. Any codon may be used as a substitute for the lysine codon at position 135, as long as it encodes the corresponding amino acid and can be easily expressed in E. coli. For example, when using glutamine as the amino acid at position 135, a codon consisting of CAA may be used. Preferably, codons are used, and when threonine is used, ACA is preferred. Furthermore, for each amino acid, the following codons can be used, for example.

135th amino codon alanine
OCA asparagine
AAC Asparagine # GAC Glutamic Acid GAA Phenylalanine TTC Glycine
GGT Isoleucine ATC Leucine CTG Methionine
ATG Serine AGC Valine GTA Tryptophan TGG Tyrosine
TAC proline
In the CCG general formula, when Y is an acidic amino acid, a codon encoding the acidic amino acid must be used in place of the cDNA coton when Y is phenylalanine. Any codon that can replace the phenylalanine codon at position 157 may be any codon as long as it encodes the corresponding amino acid and can be easily expressed in E. coli. For example, when aspartic acid is used as the amino acid at position 157, a codon consisting of GAT Preferably, a codon is used, and if glutamic acid is used, GAA is preferred.

(2) Plasmid In order to express the human prourokinase-like polypeptide of the present invention, hector which functions in animal cells may be used, but the gene together with the coding region may be used.
Preferably, a plasmid is used which comprises the expression control regions necessary for expression in microorganisms, especially E. coli, and the regions necessary for replication in E. coli. Any system useful for expressing foreign genes in E. coli can be used as the expression control region, for example, tac
, PL, 1acUV5. PR, trp +
A promoter/operator system such as Ipp is used. In particular, the tac promoter/operator system, the PL promoter/operator system and the trp promoter/operator system.
Operator systems are preferred. Further, as the SD sequence, for example, the SD sequence of the metapyrocatechase gene (C230
SD) (Reference 10), 1acSD, etc. can be used.

Examples of plasmids capable of expressing the polypeptide of the present invention include the following.

Boothmy's x ypMUPlp
m Gl n PhepMUT
4Lpm2 Thr Phept
rpUK2(E135) Glu P
heptrpUK2 (1135) lie
PhepMUT4Lpm3
Lys AspptrpHM
2 (Q135D157) Gin
AspptrpLIK2 (E135D157)
Glu ＾5p (3) Boothmi Ku・ru As a host into which the above plasmid is introduced, animal cells and microorganisms such as bacteria and yeast can be used, but it is preferable to use bacteria, especially Escherichia coli. .

The host E. coli of the present invention includes non-intestinal parasitic non-toxic E. coli strains, such as Escherichia coli (Escherichia coli).
Any strain derived from the K-12 strain can be used, such as JM83, JM10.
3.

JM105, RB791. 5M32. N99
, RRl, 匈3110.

χ1776 etc. can be used.

Preparation of C1 gene system One example of the method for producing a gene according to the present invention includes the following steps: +11 Preparing a DNA fragment completely encoding human prourokinase; (2) the polypeptide of human prourokinase; 1
A step of causing a change in the codon encoding the 35th aspartic acid and converting it to a codon encoding an amino acid other than the basic amino acid; (3) a codon encoding the 157th amino acid of the human prourokinase polypeptide; (4) Ligating any two types of DNA fragments prepared in (]), (2), and (3) above to create the desired stable DNA fragment. (5) preparing a DNA fragment encoding a human prourokinase-like polypeptide; and (5) said D encoding a few amino acids at the N-terminus of said polypeptide.
replacing a portion in the NA segment with a DNA fragment that encodes the same amino acid and consists of codons that are easily expressed in E. coli.

Among the steps (11 to (5)) above, step (1) is essential, but steps (2) to (3) are selected depending on the type of the target human-prouro;1-nase-like polypeptide. The order of implementation can be arbitrarily selected. In order to obtain a gene that is efficiently expressed, it is preferable to also perform step (5), and the order of implementation of this step can be arbitrarily selected. I can do it.

The DNA segments of the genetic system of the present invention may of course be produced by total synthetic means. In this case, the Yazui codon expressed in E. supernae can be used in place of the natural codon.

A systematic diagram of the production of various plasmids related to the present invention is shown in FIG. 1, and specific methods are described in Examples and Reference Examples.

D. To express the gene, transform the plasmid prepared as described above into a suitable host, such as E. coli Jl'l 1.03, E. coli W3110, etc., and transform the transformant. in a suitable medium, e.g. 50 μg/
m I! The E. coli may contain ampicillin and is cultured in a medium, and when E. coli grows to a certain amount, for example, to an absorbance of 0.3 to 0.5 at 550 nm, gene expression is induced. This induction varies depending on the type of plasmid promoter used.

For example, when using plasmid pMtlP1pm, E. coli transformed with these plasmids is
℃ and induced by increasing the culture temperature to 42°C. In addition, plasmid pMIJT4L
When pm2, pMtlT41, or pm3 is used, it is induced with isopropyl-β-D-thiogalac I pyranoside (IPTG). Furthermore, plasmid pt
rpUK2 (1135), ptrpLIX2 (E13
5) When using , fltrpLIK2 (Q135D157), or ptrpUK2 (E135D157), add indole acetic acid when the cultured cell concentration reaches a certain value, for example, absorbance at 550 nm of 0.3 to 0.5. It can be induced by

After inducing gene expression in this way, an additional 3 to 1
Incubate for 0 hours. Next, the cells thus cultured are collected, and a cell-free extract containing the polypeptide of interest is obtained according to a conventional method, for example, according to the method specifically described in the Examples below. Next, in some cases, pro-urokinase-like peptides are purified from these extracts by affinity chromatography using a Sepharose column to which an anti-urokinase monoclonal antibody is bound.

In this invention, the extract prepared as described above was tested for enzyme activity, molecular weight, trypsin sensitivity, plasmin sensitivity, and thrombin sensitivity.

(1) Measurement of enzyme activity Synthetic substrate method; Sample 100 tJ (0.2mMS-
2444 (L-pyroglutamyl-glycyl-arginine P-nitroanili F', Ka1, Sweden)
, 0.1 M Tris-11 (J! (pH 7,
5) , 0.01% Tri-ton X-100 at 70
After adding 0 p It and incubating for 30 minutes at 37°C, acetic acid 1007! / to stop the reaction, add 405n
Measure the absorbance at m.

Fibrin plating method (1% bovine fibrinogen (Mile)
Bovine fibrinogen from company S, 95%
A sample of 10 μp was placed subcutaneously on a fibrin plate prepared by adding thrombin to a final concentration of 1 unit/ml in 67 mM phosphate buffer (pH 7.4) containing 0.25% agarose. ”
After incubation for 16 hours at 37°C, the area of the lysis circle is measured and compared with standard urokinase (manufactured by Nippon Soda) to determine the activity.

(2) Measurement of molecular weight The extract sample was prepared under conditions that did not contain 2-mercaptoethanol.
It is determined by separation by DS polyacrylamide gel electrophoresis, then visualization by fibrin autography and comparison with standard samples.

(3) After treating the trypsin-sensitive sample with trypsin, the molecular weight of the product having enzymatic activity in the treated product is measured by the method described in (2) above. This test confirms the stabilization of prourokinase by substitution of the amino acid at position 135.

(4) Measure the enzyme activity of the plasmin-sensitive sample using the fibrin plate method.
0010/mI! , 50mM veronal buffer, 0.1. M NaC7!0.001%Twee
Dilute to a solution containing n80. 100μ of these solutions
Add 1 μg, 2 μg, and 5 μg of plasmin to each sample, incubate at 37°C, collect 10 μg over time, add 5 μg of soybean trypsin inhibitor to stop the reaction, and measure the activity by the synthetic substrate method using S-2444. . Prourokinase is 15 by plasmin
Since it is activated by cleavage between lysine at position 8 and isoleucine at position 159, it is difficult to be degraded by plasmin treatment, which is an indicator of stabilization of the prourokinase-like polypeptide by substitution of the amino acid at position 157.

(5) Measure the enzyme activity of the thrombin-sensitive sample using the fibrin plate method.
04 U, 7 m (!50mM helonal buffer, O, IM Na1l! 0.001% T
Dilute to a solution containing ween 80. These solutions 1
Add 1 unit of thrombin to nN2 and incubate for 30 minutes at 37°C.
Incubate for minutes. Collect 100 μβ and incubate with 1 μg of plasmin at 37°C for 30 minutes for the native enzyme, and at 37°C with 5 μg of plasmin for 60 min for the mutant enzyme.
The activity is measured by the synthetic substrate method using S-2444. The residual activity after thrombin treatment is determined by using the same procedure without adding thrombin as a control.

When the bond between arginine at position 156 and phenylalanine at position 157 is cleaved by thrombin, the activity of urokinase decreases. Therefore, it is clear that the residual activity after thrombin treatment does not decrease.
This means that the prourokinase-like polypeptide was stabilized by the substitution of the amino acid at position 7.

Results +11 Enzyme Activity All samples obtained from E. coli transformed with the plasmid of the present invention showed the desired activity in the enzyme activity measurement described in (1.1) above.

(2) Plasmid pMtlP1 encoding a pro-urokinase-like polypeptide in which neither the trypsin-sensitive amino acid at position 135 nor the amino acid at position 157 is substituted; it encodes a pro-urokinase-like polypeptide in which only the amino acid at position 135 is substituted Plasmid pMUPI containing the gene
pm, pMUT4Lpm2, ptrpUK2(1
135) and ptrpUK2 (E135); and 1
Plasmid ptrpUK2 (Q135
D157) and ptrptlK2 (El, 35D157
) All of the samples prepared from E. coli transformed with either of these methods showed resistance to trypsin treatment, except for the sample derived from pMUP1.

For example, each of the plasmids ρMUPI and pMUPlpm was transformed into Escherichia coli W3110, and these transformed bacteria were cultured in L-broth at 30°C.
When 0.0 of nm reaches 0.3, increase the culture temperature to 42°C.
The gene was expressed by increasing the

The cultured bacterial cells were collected and a cell-free extraction 1 (dead cell) was prepared.

When the molecular weights of these extracts were estimated by SDS polyacrylamide gel-fibrin autography, the molecular weights of all extracts were approximately 50,000 (lanes 2 and 4 in Figure 13). In addition, when we measured the molecular weight in the same way after treating both sleeve exudates with trypsin, we found that the molecular weight of the extract derived from pMUPl was approximately
Although a product with a molecular weight of about 30,000 was produced, almost no product with a molecular weight of about 30,000 was produced in the extract derived from pMUPIpm (lanes 3 and 5 in Figure 13).

From the above results, pMUP1-derived products are easily reduced in molecular weight by trypsin, whereas pMLIP1
The product of the invention derived from pm &, I l lipsin, L
It is clear that the molecular weight is not reduced.

Similarly, plasmid pMIJT4Lpm2 was transformed into Escherichia coli JM 103, and the transformed bacteria was grown at 37°C in -pros until the absorbance at 7550 nm was approximately 0.
5, IPTG (isopropyl-β-D-thiogalactopyranoside) was added as an inducer to a final concentration of 1 mM, and the cells were further cultured at 37° C. to express the gene. The cultured cells were treated in the same manner as above, and the products were analyzed in the same manner as above.

The results are shown in FIG. In this figure, lane 1 is standard urokinase (1 unit), lane 2 is a crude extract from E. coli transformed with pMUPl treated with trypsin, and lane 3 is a crude extract from E. coli transformed with pMUT4Lpm2. Lane 4 shows the results obtained by treating a crude extract from E. coli transformed with pMLIPlpm with trypsin. As is clear from this result, pMllT
The gene product derived from 4Lpm2 is also difficult to be reduced to a low molecular weight by trypsin.

The products with a molecular weight of about 50,000 and the product with a molecular weight of about 30,000 are considered to correspond to high molecular weight urokinase and low molecular weight urokinase, respectively. The reason why these molecular weights are slightly smaller than that of standard urokinase derived from large urine is presumed to be because addition of sugar chains does not occur within E. coli.

The above result shows that the amino acid sequence is substantially the same as that of human prourokinase, and the 135th lysine from the N-terminal serine is glutamine, threoline, glutamic acid, or isoleucine. It was clearly shown that all of the human prourokinase-like polypeptides substituted with the above showed fibrin degrading activity, i.e., urokinase activity, like natural human prourokinase, and that unlike natural human prourokinase, they were difficult to be degraded by trypsin. ing.

This confirms that the assumption that the peptide bond between the two basic amino acids (lysine) at positions 135 and 136 from the N-terminus of high-molecular urokinase is cleaved by trypsin-like protease to produce low-molecular-weight urokinase is correct. It shows. Furthermore, when the 135th amino acid from the N-terminus is the above-mentioned amino acid, the above-mentioned cleavage by trypsin is unlikely to occur, even if the 135th amino acid is any amino acid other than a basic amino acid. This indicates that the peptide bond between the amino acid at position 1 and the amino acid at position 136 becomes difficult to cleave.

Furthermore, even if the 0 amino acid at position 135 from the N-terminus is lysine as in natural human urokinase, or even if it is the above-mentioned amino acid as in the human urokinase-like polypeptide of the present invention, urokinase activity does not occur. , this 13
This indicates that the amino acid at position 5, O7, is not essential for urokinase activity.

Moreover, it is said that many proteases recognize basic amino acids, so if the 135th amino acid from the N-terminus is an amino acid other than a basic amino acid, it is the same as in the case of the polypeptide specifically disclosed in this specification. It is thought that this result will be achieved.

(3) Plasmid pMUT4Lpm3 containing a gene encoding prourokinase-like polypeptide 1′ in which only the amino acid at position 157 is substituted for plasmin and thrombin susceptibility; and the amino acid at position 135 and 1
Plasmids ptrp [IK2 (Q135D157) and ptrp] containing genes encoding prourokinase-like polypeptides in which both amino acids at position 57 have been substituted.
In all samples prepared from Escherichia coli transformed with either rptlK2 (E135D157), the rate of activation by plasmin was ζ lower than in the case of native prourokinase. An example of this result is shown in the 15th
Shown in the graph of figure.

As is clear from this graph, the prourokinase-like polypeptide of the present invention in which the amino acid at position 157 has been substituted is less likely to be degraded (activated) by plasmin than the natural form.

The residual enzyme activity after thrombin treatment was as follows.

The above results indicate that the prourokinase-like polypeptide in which the amino acid at position 157 is substituted is less likely to be inactivated by thrombin.

As described above, a human prourokinase-like polypeptide in which lysine at position 135 is replaced with an amino acid other than a basic amino acid, a human prourokinase-like polypeptide in which phenylalanine at position 157 is replaced by an acidic amino acid, and these polypeptides. A topurourokinase-like polypeptide in which both amino acids are replaced as described above has the same physiological activity as natural human prourokinase within the range of amino acids defined in this invention. Moreover, it is clear that it is extremely stabilized against proteases such as trypsin, plasmin, and thrombin.

This indicates that the stabilized human-prourokinase-like polypeptides of the present invention are promising as active ingredients in pharmaceuticals such as thrombolytic agents.

Next, the present invention will be explained in more detail with reference to Examples and Reference Examples. However, the scope of the invention is not limited to these Examples.

mRNA by a method using anidine thiocyanate
was prepared.

20 g of kidney tissue, which had been frozen at -80°C, was crushed in liquid nitrogen using a Waring blender, and a 5M guanidine thiocyanate solution (5M guanidine thiocyanate, 0.0
．． 5% N-Lauroyl Sarcosinate Sodium, 2 small amounts M
Sodium tartrate, 0.1M mercaptoethanol, 0
．． Suspended in 1% antifoam A) 80 m/ml. This liquid was homogenized using a Teflon homogenizer and heated at 20 G'
The nucleic acid was sheared using the A syringe needle. 5.7 M CsC
24 ml of the above solution was layered on 1112 m6, and the mixture was heated at 15°C for 24 hours using a Beckman ultracentrifuge 5W280-tar.
After centrifugation at 2500 rpm, Ne ■ Total r? NA was collected.

11 total RNAΔ was dissolved in 2% potassium acetate J1 solution, 2 times the volume of ethanol was added, and after standing at -20°C overnight,
The precipitate was collected and purified by centrifugation.

Poly(Al" RNA was prepared using oligo(dT) cellulose carano, Ri1, according to the method of 8viv et al. (Reference 12).
4n isolated from total RN was prepared by 1Madography.

The yield from 10 g of kidney tissue is approximately 3 mg of total RNA, of which 2-3% is poly(^)l? It was NA.

Example 11: Preparation of cDNA Library (I) Using 40 μg of poly()+RNA obtained in Reference Example 1,
NA synthesis was performed. Oligo (dT)+□-+840μg
Using 40 units of reverse transcriptase as a primer, the first tX was synthesized by reacting at 42°C for 2 hours, the template mRNA was removed by alkaline treatment, and the second strand was synthesized by 1
00 units of E. coli DNA polymerase IM
This was done using the lenow fragment.

The hairpin region was removed using S1 nuclease, and the 3-part double-stranded cDNA was transformed using terminal deoxynucleotidyl transferase.
゛At the end (dC) I. -20 chains combined, approximately 400 ng
(dC) Tail cDNA of .

This was converted into commercially available (dG) tail pBR322 (Pst I
] (manufactured by New England Nuclear) 8
E. coli χ1776 was annealed with 1 (an
Ahan's method (Reference 13) was used to obtain a cDNA library (1) consisting of approximately 2 x 10'' tetracycline-resistant and ampicillin-sensitive transformed bacteria.

For these transformed bacteria, the size of the cDNA Δ insertion fragment was investigated using a rapid isolation method using an alkaline lysis method (Reference 14).

G, J, 5feffens et al. (Reference 8) and Gunz
sn+6', GIn, Pro, Trp to the amino acid sequence of human urokinase reported by ler et al. (Reference 9)
The following 16 types of DNA oligomers consisting of 14 bases complementary to mRNA corresponding to PheI7'' were synthesized by the phosphotriester method.

5'AACC88GGTTGATT 3'AACC
AAGGTTGGTT To CCGGGTTGATT AACCACGGTTGATT A4CCACGGTTGGTT AACCATGGTTGATT A4CCATGGTTGGTT A4CCAAGGCTGATT A4CCAAGGCTGGTT AACCA GGGCTGATT A'ACCAGGGCTGGTT AACCACGGCTGATT 8ACCACGGCTGGTT A4CCATGGCTGATT AACCATGGCTGGTT AACCAGGGTTGGTT These 16 types of DNA oligomers are referred to as UK probe (■).

In addition, as confirmation probes, Met''', Try, As
n.

8 sp, 14 complementary to the mRNA corresponding to Pro”
The following eight types of DNA oligomers consisting of bases were synthesized in the same manner. '5°GGATCAT
TATACAT 3'GGATCGT'TATACA
T GGATCGTTGTACAT GGATCATTGTACAT GGGTCATTATACAT GGGTCGTTATACAT GGGTCGTTGTACAT GGGTCATTGTACAT These eight types of DNA oligomers are referred to as UK probe (■).

20 ng of each of these UK probe ■ and LJ K probe H were mixed at 3000 Ci/mmole''r' r A T using T4 polynucleotide kinase.
The 5' end was radioactively labeled with P and used as a probe for colony hybridization.

An autoclaved nitrocellulose filter (0.45 It m, TYPE T
M-2) (manufactured by Toyo Roshi) was placed, and the transformed bacteria prepared in Example 2 were spread so that about 2000 transformed bacteria colonies grew. After culturing at 37°C for 8 hours, replicas were placed on two nitrocellulose filters, which were further cultured at 37°C for 3 hours. The first nitrocellulose filter was used as a master filter, and the latter two filters were transferred to an LB agar medium containing 15°C g/rnj2 of tetrazycline and 100 μg 7 mn of chloramphenicol, and cultured at 37°C overnight. Next, 0, 5 M NaOH and 1.5 M
Place the filter on Na(j!) for 3 minutes to lyse the colonies and denature the DNA, then add 0.5 M Tris-
11cJ (pl+ 7.6) and 1.5MNa (
Neutralized on J2, the filter was air dried and calcined at 80° C. for 2 hours.

The filters were then washed in 4X SSC at 60°C for 30 min each, followed by 4x SSC, 10x Denhard
t and 50 p g/lnl modified E, coli-D
Prehybridization was performed in NA at 60°C for 1 hour, and 0.1mM ATP and radiolabeled UK probe (approximately 1107 cp/filter) were added and hybridization was performed at 37°C for 16 hours. . After washing 6-8 times at 39°C in aXSSC, the filters were air-dried and searched for transformed bacteria that hybridized with UK probe I by autoradiography. By this method, 2
One candidate clone was obtained. The plasmids of these clones are designated pKYU1 to pKYU21.

The 21 candidate clones obtained were processed in the same manner as above, and U
A clone that hybridized with K probe ■ was obtained. The plasmid in this clone is called pKYU21 (Figure 3).

(21p K Y U 21 Characteristics of plasmid DNA p
KYLI21 plasmid DNA was digested with various restriction enzymes, and the base sequence was determined by the Mayam-Gilbert method (Reference 16) or by the dideoxy chain termination method (Reference 17) after subcloning into Mi3mp8. Comparing this with the known amino acid sequence of urokinase, we found that the cDNA completely contains the coding region of low-molecular-weight urokinase, but about 100 bp of DNA in the 5' end region of the coding region of high-molecular-weight urokinase is missing. was confirmed.

Toyotaka 915. cDNA by primer reaction
Based on the base sequence determined in Reference Example 4 (2), "
DNA consisting of 15 bases complementary to the sequence of mRNA corresponding to Sgr, Asp, Ala, Leu, and Glu93
Oligomer A: 5'' CTG^8GA was synthesized with ATCAG83'' by the phosphotriester method.

Using 100 μg of poly(A)” RNA as a template,
First strand cDNA was synthesized using 100 units of reverse transcriptase with 1 μg of 5'-end 32p-labeled primer based on the method of Garva et al. (Reference 18) or Stewart et al. (Reference 19), followed by E. coli DNA polymerase I Klenow. The second strand was synthesized using 100 units of the fragment. Next, the single-stranded D
NA was digested and a (dC)n chain was added to the 3' end using terminal deoxynucleotidyl transferase. This dC
Tail insert (cDNA) and dG tail vector (
After annealing with E. coli χ177
A cDNA library (II) consisting of approximately 5 x 10' transformants was obtained by transforming 6.

Koukohanmi cDNA Live-1-(n(7)-Reference Example 5
The transformed cells obtained in 1. were treated and hybridized in the same manner as described in Reference Example 4 (II). In this case, the 150 bp Enidata II 5' end-digested end fragment from pKYU21 "'PdCTP (3000C
i/mmole) and radioactively labeled by the nick translation method (Reference 13) was used as a probe. Hybridization was performed at 60°C.

Next, the filter was washed 2 to 3 times with 2×SSC at 60° C., air-dried, and clones hybridizing with the above probe were searched for by autoradiography.

Eight positive clones were obtained from approximately 3×10′ clones. Plasmid pPEI-pP in these clones
[Referred to as +. These plasmid DNAs are treated with restriction enzymes.
It was confirmed that plasmid pPE3 (FIG. 2) contained a cDNA insert of approximately 420 bp.

The fragment obtained by digesting the DNA of this plasmid pPE3 with the restriction enzyme PstI was subcloned into M13mp8, and the dideoxy chain termination method (Reference 17)
) determined the base sequence and found that it contains a sufficient length of the coding region at the 5' end of the prourokinase gene, and also contains a 5' untranslated region of 66 bp upstream of the translation initiation codon ATG. Confirmed (Figure 2).

The DNA 51' tc of plasmid pKYL121 containing the complete coding region of small molecule urokinase was injected into restriction enzymes 1 and !, each containing 10 units. Double digested with 1 ml and electroeluted to about 5.7 K
A DNA fragment of b was obtained, and the same plasmid pKY't12 was obtained.
ulII and Nc with 10 units each of the DNA of 1.

66bp D
An NA fragment was obtained. In addition, 10 g of DNA 5/'g of plasmid pPE3 obtained in Reference Example 6 was added to each
Double digestion with 1 unit of Ncol and 1lindTII yielded approximately 1. An IKb DNA fragment was obtained. These three types of DNA fragments were purified and recovered by repeating phenol/chloroform extraction and precipitation with twice the amount of ethanol. These three types of DNA fragments were ligated using 74 DNA ligase, and E. coli χ177G was transformed. The obtained transformant was examined by a rapid isolation method using alkaline lysis method, and a clone having plasmid pKYIJ22 containing the complete gene of prourokinase was obtained. This clone Elisha Cori (Escherichia
Codan) χ1766/pKYL122 was deposited with the Institute of Microbiology, Agency of Industrial Science and Technology on January 11, 1985 as FERMP-8041, and was deposited on January 22, 1986 as '1 to Ti'. ik Koken Jyoyori No. 1g (FERM l1P-7JS') L, -'
C. Transferred to international deposit under the Futahest Treaty.

May the nucleotide sequence of the insert of plasmid pKyu22
It was determined by the am-Gilbert method and the dideoxy chain termination method after subcloning into M13mp8. The results are shown in Figures 1-1 to 4-3. When this result is compared with the base sequence described in literature 20, the codon (AAT)' of the 254th amino acid Asn (ΔAC in the literature), the 360th codon (ΔAC in the literature),
-2 barrier amino acid number), the codon for the amino acid Leu CTG (CTA in the literature), the 365th amino acid fl
lPro's 7 ton CC8 (CCC in the literature), and 36
Codon CAG' for the 6th amino acid Gin (C
AA) were different from each other. AAT is a codon that is difficult to translate in E. coli, but CTG and CA
Both G are said to be easily translated (used frequently) in E. coli, and are advantageous for expression in E. coli. Note that CCC is considered to be slightly more advantageous than -CCA.

The approximately 30 bp structure of the 5° end portion of the natural cDNA encoding pro-urokinase prepared in Reference Example 7 was extracted from Schistomonas and C2.
It was modified to be efficiently expressed in E. coli under the SD sequence of 30 genes.

The following three types of single tA DNA oligomers consisting of 29 bases, 15 bases, and 20 bases were synthesized by the phosphotriester method.

5' CATGAGCAACGAGCTCCACCA
GGTTCCGT 3'3' TGCAGTACT
CGTTGC5'3 “TCGAGGTGGTCC
AAGGCAGe 5'Next, 1 μg of each of these three types of synthetic NA oligomers was heat-treated at 95°C for 2 minutes, and then phosphorylated at the 5' end with T4 polynucleotide kinase, resulting in Seppasok (CIB) Kara, /, v (W
atCrs) and dried, 20 mM
Tris-H(J(al17.6), 10mM
MgC7! Dissolved in 50μβ of solution of z and heated at 95℃ for 2
After heating for a minute, the mixture was slowly cooled to room temperature and annealed by holding at 12° C. overnight to obtain the double-stranded DNA shown below.

5' CATGAGCAACGAGCTC
CACCAGGTTTCCGT 3 '3' TG
CAGTACTCGTTGCTCGAGGTGGTCC
88GGCAGCAAatlI 5atT B
s to I Taq4 while plasmid pKYU22
5 μg of DNA was double-digested with restriction enzymes 2 and 2, and approximately 5.7 Kb of DNA was recovered by electroelution. On the other hand, DNA5 of the same plasmid pKYU22
11 g was double digested with the restriction enzymes Stl and Dan [■] and electroeluted to obtain a DNA fragment of about 400 bp. This was further digested with restriction enzyme-1 and electroeluted to recover a DNA fragment of approximately 260 bp. These two types of DNA fragments were recovered by phenol/chloroform extraction and precipitation with 2x ethanol.

These two types of DNA fragments and the synthetic double-stranded DNA described above
The oligomers were ligated using T4 DNA ligase and E. coli χ1776 was transformed. The transformants were examined by rapid isolation using alkaline lysis, and a clone carrying the plasmid pKMU1 containing the modified prourokinase gene was identified as Escherichia coli (Escherichia coli).
ia coli) Z 1776/pKMIJl was obtained. This plasmid pKMUI was introduced into Escherichia coli (Escherichia coli).
i) χ1776/pKMUl was submitted to the Institute of Microbiology, Agency of Industrial Science and Technology, as part of the Microbiological Research Institute No. 8040 (FERMr'
-8040) Toji7 WiE is serving.

5 μg of plasmid pKMU obtained in Reference Example 9
1 was digested with the restriction enzyme A11'llO unit, treated with calf gastrointestinal phosphatase (CIP), and isolated. On the other hand, 5 μg of plasmid pTcMl was digested with 10 units of the restriction enzyme Hijiri I, and a DNA fragment of about 500 bp was isolated by electroelution.

, = h et al. The DNA fragment of 2 MH was purified and recovered by repeating phenol/chloroform extraction and ethanol precipitation.

Both were ligated using T4 DNA ligase, and E. coli JM
103 was transformed. Transformants were examined by rapid isolation using the alkaline lysis method to obtain clones carrying plasmid pMUTIL in which the tac promoter/operator and C230SD sequences were placed in the positive direction relative to the prourokinase gene.

The aforementioned plasmid pTcMI is a novel plasmid constructed by the inventors and contains the tac promoter/operator, an expression control region consisting of IacSD and C230SD sequences, and the 0230 structural gene. Escherichia coli JM 1 into which this plasmid was introduced
03/pTcM1 was submitted to the Institute of Microbial Technology, Agency of Industrial Science and Technology as Microtechnology Research Institute Submission No. 7779 (PERM P-7779).
It has been deposited as.

In the plasmid pMUTIL, the modified prourokinase gene of the present invention is inserted at an appropriate position downstream of the expression control region '74 consisting of the tac promoter/operator, 1acsD and C230Srl.

Next, 5 μg of plasmid pKK223-3 (References 22-23 and 24) was digested with restriction enzyme Hinc11 [[10 units], and calf gastrointestinal phosphatase (P, L, B
iochemicals).

On the other hand, 18 g of plasmid pMI obtained as above
JTIL was digested with 4 units of the restriction enzyme Dral, and this digested fragment was combined with a 5' end phosphorylated Hindffl linker.
(dCAAGCTTG) 18g using T4 DNA ligase, then 12 units of restriction enzyme Hin
Digested with dIII and 0.15M NaC, i! After making a solution and extracting with equal volumes of phenol/chloroform, double the volume of ethanol was added to precipitate the DNA.
The precipitate was collected at 6000 rpm and 4°C and dried.

This pMUTIL digested fragment and the above pKK223-3
The digested anal fart fragment was ligated with T4 DNA ligase, and Escherichia coli JM 103 was transformed. These transformed bacteria were examined by a rapid isolation method using an alkaline lysis method, and a clone of Escherichia coli JM 103 containing plasmid pMUT2L was determined.
/pMtlT2L was obtained.

This plasmid has the above expression control region upstream of the prourokinase gene, and pKX223 downstream.
It has the transcription terminator (rrnB, T + T I ) of the E. coli paste bosomal gene derived from -3.

In addition, plasmid pKK223-:'lbar'h+ir
It is sold by Macia P L Biochemicals and is easily available.

5 μg of plasmid pMUT2L was digested with 10 units each of restriction enzymes 5 and 3, extracted with phenol/chloroform, precipitated with ethanol, and the recovered DNA was treated with 0.1 mM dGTP.
, dCTP, T4 in the presence of dATP and TTP
The ends were blunted using polymerase and recircularized using T4 DNA ligase. This was transformed into Escherichia coli JM 103, colonies were formed on an LB agar medium containing 50 Mg/m7+ ampicillin, and the plasmid p
Clone Elisha coli containing l'1tlT4L (
Escherichiaco↓” J, Dan 103 /pM
I got UT4L.

Introduction (1) 1) Preparation of single-stranded template DNA (Figure 7) Plasmid pK
1 μg each of YL122 and phage M13pm 8 two-stranded DNA was added to lOmM Tris-11G.
7! (pH 7,5), 7mM Mg (J2.7mM
β-mercaptoethanol and 50 m M NaC
j! in a solution containing 5 units of Pst
Digestion was performed using I for 1 hour at 37°C. Each DNA fragment was recovered by phenol treatment and ethanol precipitation, and after mixing both, 66 m M Tris-I
IC/(pH 7,5), 5mM MITC7! z,
Solution 20 containing 5mM DTT and 1mM ATP
The ligation reaction was carried out at 12°C for 16 hours using 10'O unit of T4 DNA ligase in μp. After the reaction, Escherichia coli JM 103 was transformed using the reaction solution according to the method of Messing et al. (Reference 25), and 0.02% X-ga
1 and 1 mM IPTG and cultured overnight at 37°C. Single-stranded DNA was prepared from white plaques formed by the recombinant.

That is, pick up the white plaque with the tip of a toothpick, and collect the 2XY of 1,5rl+ where Escherichia coli JM 103 is growing.
Suspended in T broth (1.6% Batatotributone, 1% yeast extract and 0.5% NaCj2)
The cells were cultured at 0.degree. C. for 5 hours, and single-stranded recombinant phage DNA was recovered from the culture supernatant by polyethylene glycol precipitation, phenol treatment, and ethanol precipitation.

Using the obtained single-stranded 1)NA as a template, the base sequence was determined by the dideoxy method according to the method of Mesong et al. (Reference 25), and the sequence was confirmed to be cloned into the 81 main domain T)N. As shown in FIG. 7, a coding strand and an anticoding strand were obtained.

2) Double-stranded DNA using oligonucleotide as a primer
Synthesis of A (Figure 8) Using the cloned anticoding strand of the Ichiki Iff DNA obtained as above as a template, a primer was added to the synthetic oligonucleotide: 5'GATGGACAA^8GCCC3''. (As 11, DNA polymerase Klenow
A fragment-based repair reaction was performed. In other words, one mold D
Add 2 pmole of a primer phosphorylated at the 5' end to 0.5 pmole of NA, and add 7mM Tris.
-HCj2 (pH 7,5), 0.1mM
EDTA, 20mM NaCl2 and 7mM
M MgCj! 60°C in 10 μl of a solution containing 2
Incubate for 20 minutes at
Incubated for 0 minutes. Furthermore, dATP, dGTPXdTTP, and dCTP were added to the reaction mixture at 0.5 mM each, 2 units of DNA polymerase old cno++ fragment were added to the total volume of 20 μl, and the mixture was incubated at 23° C. for 20 minutes. Subsequently, lμl of 10mM ATP and 1 unit of T4 DNA ligase were added and incubated overnight at 12°C.

3) Digestion with Sl nuclease The double-stranded DNA obtained as described above was digested with 31 nuclease in order to remove unreacted background 14 DNA. That is, 2 μl of the above reaction solution was mixed with 280 mM NaCl2.4.5
mM ZnCj! z, 30mM Na0Ac (pl
+4~4.5) in 25 μl of reaction solution containing 2
．． Add 3 units of Sl nuclease and incubate at 26°C.
Processed for 0 minutes. After the reaction, 0.25M Tris-H (
The reaction was stopped by adding 10 μl of J (pHs, O).

4) Transformation of E. coli JM 103 E. coli JM 103 was transformed using 10 μl of the reaction mixture according to the method of MesoSing et al. (Reference 25).

5) Search for mutants Regarding the phage plaques obtained as above,
Mutant phages were screened by plaque hybridization using the oligonucleotides (labeled with 32P) used as primers as probes. That is, plaques were transferred from a soft agar medium to a nitrocellulose filter according to the method of Henton-Davis et al. (Reference 26), and baked at 80°C in vacuo for 2 hours. The nitrocellulose filter was soaked in 6X SSC 110X Denhardt solution for 32p.
Hybridization was performed overnight at 23° C. using a primer oligonucleotide labeled with as a probe.

The filters were then washed in 6X SSC at 4° to 6°C and autoradiographed to isolate mutant farsibrakes showing positive signals. From this mutant phage, mutant double-stranded phage DNA (
pml) was obtained.

6) Determination of base sequence of mutant DNA The base sequence was determined by the dideoxy method using the mutant phage DNA as a template, and it was confirmed that a -base substitution mutation had occurred.

Using the same recombinant M13 phage single-stranded DNA (in which the anticoding strand of the urokinase gene has been cloned) as used in Example 1 as a template, site-directed mutagenesis was performed using a new oligonucleotide mutagen. Ta. However, the following synthetic oligonucleotide as primer (2): 5'GGA-derived AAGCCCTCC
TCT 3' was used. This 18-base oligonucleotide is complementary to the urokinase gene in the single-stranded template DNA, but the lysine codon ΔΔΔ is replaced by the threonine codon A.
Only one base has changed to CA.

Double-stranded DNA was synthesized in vitro using this oligonucleotide as a primer. That is, template-end strand D N
A 0.5 pmole of primer 2 pmole phosphorylated at the 5' end was added, and 7mM Tris
-H(J! (pH7,5), O,]mM
EDTA, 20mM NaCβ and 7mM
MgCj! 2 in 10 μρ of a solution containing 2 at 60° C. for 20 minutes, followed by incubation at 23° C. for 20 minutes. Additionally, dATP was added to this reaction mixture.
, dGTP, dTTP, and clcTP were added to 0.5mM each, and the total volume was 20μl.
Add 2 units of NA polymerase old enotv fragment,
It was then incubated at 23°C for 20 minutes. Subsequently, 10 mM of ATP, 1 μβ of ATP, and 1 unit of T4 DNA ligase were added, and the mixture was incubated overnight at 12”C.
5) was transformed into E. coli 103. In this way, about 10,000 phage plaques were obtained per 1 μp of the above reaction solution.

The resulting plaques were transferred from a soft agar medium to a cellulose filter according to the method of Henton-Davis et al. (Reference 26), and then baked in vacuo at 80° C. for 2 hours. This nitrocellulose filter is 6 x S
Pipelidization was performed overnight at 37° C. in SC, 10× Denhardtl solution using a 32p-labeled primer oligonucleotide as a probe. The filters were then washed in 6×SSC at 52° C. and autoradiography was performed to isolate mutant phage plaques showing positive signals. From this mutant phage, mutant double-stranded phage DNA (pm2
) was obtained.

The base sequence of the mutant DNA was determined by the dideoxy method using the mutant phage DNA as a template, and it was confirmed that the desired single base substitution mutation had occurred.

Similarly, for example, by using the mutagen oligonucleotide shown in the right column below, a codon encoding the amino acid shown in the left column below can be introduced instead of the 135th amino acid.

” Phosphate and L Phosphate Modified Sumimei 1 Oligonucleotide Alanine 5° GATGGAGC 88 AGC
CC3'Asparagine 5'GATGGAAA
CAAGCCC3 “aspartic acid 5′ G
ATGGAGACAAGCCC3'glutamic acid
5' GATGGAGAAAAGCCCC3゜Phenylalanine 5' GATGGl17Σ Engineering'ko, hehe GCCC3' Glycine 5' GAT
GGAGGTAAGCCC3'isoleucine 5
'GATGGAATCAAGCCC3' leucine
5'GATGGACTGAAGCCCC3'
Methionine 5 “GATGGAATGAAGC
CC3'serine 5'GATGGAA
GC 88 GCCC Hebarin 5'
GATGGAGTAAAGCCC3'Tryptophan 5°GATGGATGGAAGCCCC3'Tyrosine 5'GATGGATACAAGCC
C3' Proline 5' GATGGACC
GAAGCCC3'' Note that instead of the point mutation introduction method using the oligonucleotide primer described above, it is possible to use a method that has a codon for other amino acids, such as glutamine or threonine, in place of the 135th lysine codon, but the other codons have not been changed. Synthesize a DNA fragment that does not contain natural m
Mutations can also be introduced by recombining RNA with the corresponding portion of cDNA.

The mutant phage DNA obtained as described above was transformed into Ps
After excising with tl to obtain a mutated insert and replacing it with the corresponding part of the complete coding region, this coding region is inserted into, for example, an expression vector for E. coli, and this is transformed into E. coli. By culturing, the polypeptide of the present invention can be expressed.

Using pYTUl (Reference 27), which contains the PL promoter and the SD sequence derived from metapyrotechase, as a vector, urokinase cDNA derived from human kidney (in which the codons of multiple amino acids at the N terminus of urokinase are replaced with the above) We created an expression plasmid for
10 μg of plasmid pYTU1 in 10 mM T
ris-IC# (pH 7,4), 7 mM MgC
J2 and 150mM Ha (reaction solution 10 containing J
Digestion in 0 μβ for 2 hours at 37°C using 10 units of slow and 10 units of injection yielded approximately 4.5 Kb of AtII by agarose electrophoresis.
The Petter fragment was isolated.

Meanwhile, 10 μg of plasmid pKMII was added to 10 mM
Tris-HCJ2 (pH 7,4), 7mM
MgC7! The DNA was digested with 10 units of Dral at 37°C for 2 hours in a reaction solution containing z and 60 mM NaCj+, and then ATP was added to 0.66 mM, and 5 slow j linker-DNA (5'GGT
CGACC3') 1 μg and T4 DNA ligase 100
The unit was added and the reaction was carried out overnight at 12°C. next,
DNA fragments were recovered by phenol treatment and ethanol precipitation, and 10mM Tris-HCJ (pH 7,
4) ,7mMMgC#! and 150mM NaCn
The human urokinase gene fragment of about 2.2 Kb was isolated by agarose electrophoresis. Mix 1 μg of each of these two types of DNA fragments and add 66mM Tris.
-HCj! (p)17.4), 7mM Mg1J
! The ligation reaction was carried out overnight at 12° C. using 100 units of T4 DNA ligase in 20 μl of a reaction solution containing 0.66 mM ATP and 10 mM dithiothreitol.

E. coli HB 101 was transformed using this reaction solution,
The formed colonies were screened by rapid isolation using the alkaline lysis method, and clones containing plasmid pMIIPl were obtained. Plasmid DNA was prepared from this bacterium.

Example: Creation of plasmid MUPIII+ (10
) cDNA in which the 135th lysine codon AAA from the N-terminus of urokinase is mutated to glutamine codon CAA
Plasmid pMUP containing mutant M13 phage double-stranded DNA containing the A fragment and the structural gene of prourokinase downstream of the PL promoter and C230SD sequence.
1 was used to create an expression plasmid for E. coli containing the mutated gene.

That is, 10 μg of mutant M13 single-stranded DNA (7B
) was completely digested with Pstl and an approximately 1.2 Kb fragment was isolated.

On the other hand, 10 μg of plasmid pMUPI was partially digested with Pstl, and an approximately 5.4 Kb fragment in which only the approximately 1.2 Kb fragment was removed was isolated.

Each of these was collected by phenol treatment and ethanol precipitation, then mixed, and a ligation reaction was performed overnight at 12°C using T4 DNA ligase, and the reaction mixture was used to transform Escherichia coli JIB 1.01. Colonies were screened by rapid isolation using alkaline lysis to obtain clones containing pMtlPlpm. Escheria coli x 17 into which this plasmid pM[IPlpm was introduced]
76/pMUP1pm was deposited with the Institute of Microbiology, Agency of Industrial Science and Technology on January 11, 1985 as FERMP-No. 8042,
On January 2.2, 1986, the FERM
It was transferred to the international depository under the Butapest Treaty as BP Ptf).

Plasmid pMUPLpm is a representative plasmid of the present invention, and contains a coding region encoding a human prourokinase-like polypeptide at an appropriate position downstream of the PL promoter and C230SD sequence, and in this coding region, the N of the polypeptide is The 6 amino acid codons at the end have been replaced with codons that are easily expressed in E. coli, and the 135th amino acid, lysine codon AAA, has been changed to glutamine codon CAA.

An expression plasmid pMLIT4Lpm2 in which the human prourokinase+ti constructing gene having the above point mutation was inserted downstream of the E. coli tac promoter was prepared as follows.

10, ljg mutant M13 single-stranded DNA (pm
2) was completely digested with Pstl, and an approximately 1.2 Kb fragment was isolated. Meanwhile, 10 μg of plasmid pMUT4
L was partially digested with PstI, and an approximately 4.6 Kb fragment was isolated in which only the approximately 1.2 Kb fragment was removed.

Each of these was collected by phenol treatment and ethanol precipitation, then mixed, ligated overnight at 12°C using T4 DNA ligase, and the reaction mixture was used to transform E. coli HB 101, resulting in the formation of Colonies were screened by rapid isolation using alkaline lysis to obtain a clone containing pMUT4Lpm2. Escherichia coli into which plasmid pMLIT4Lpm2 was introduced
t)-χ1776/ pMIIT4Lpm2 is 198
It was deposited as FERMP Minami No. 8188 (FERMP-Minami No. 8188) at the Institute of Microbial Technology, Agency of Industrial Science and Technology on April 18, 1986, and as FERMP Minami No. 9 on January 22, 1986.
No. 70 (FERM BP72o) under the Budapest Treaty (transferred to the International Deposit).

Plasmid pMUT4Lpm2 is also a representative plasmid of the invention and contains a coding region encoding a human-prourokinase-like polypeptide at an appropriate position downstream of the tac promoter, in which the N of the polypeptide is The codons for the 6 amino acids at the ends are expressed in E. coli and replaced by Yazui codons, and the codon A for lysine, the 135th amino acid, is expressed in E. coli.
AΔ has been changed to the threonine codon ACA.

Plasmid pKYU22 and phage M, 13n+p8
1μg of each two-stranded DNA was added to 10mM Tr.
is-H(J(p)17.5), 7mM MgC#z
, 7mM β-mercaptoethanol and 50mM
5 units of P in 20 μi of a solution containing 1 NaCl
Digested with stl for 1 hour at 37°C. Each DNA fragment was recovered by phenol treatment and ethanol precipitation, and after mixing both, 6.6 m M Tris
-IIC4 (pH 7,5), 5mM MgCj! t,
Solution 20 containing 5mM DTT and 1mM ATP
The ligation reaction was carried out in μβ using 100 units of 74 DNA ligase at 12° C. for 16 hours. After the reaction, Escherichia coli JM103 was transformed using the reaction solution according to the method of Messing et al. (Reference 25), and plated with agar containing 0.02% X-gal and 1 mVIPTG.
-Overnight culture at °C. Single-stranded DNA was prepared from white plaques formed by the recombinant.

Using some of the obtained single-stranded DNA as a template, the base sequence was determined by the dideoxy method according to the method of Messing et al. (Reference 25), and the sequence of the cloned single-stranded DNA was confirmed.

(2) -・C117E-, so - one recombinant M13 phage tl obtained as above
Using NA (in which the anticoding strand of the urokinase gene has been cloned) as a template, site-directed mutagenesis was performed using a new oligonucleotide mutagen. However, as a primer, the following synthetic oligonucleotide 5' GGCCCCGCGATAAG8TT8
3゛ was used. The 18-base oligonucleotide is complementary to the urokinase gene in the single-stranded template DNA, but the phenylalanine codon TTT has been changed by two bases to an aspartate codon GAT.

Two 45 DNAs were synthesized in vitro using this oligonucleotide as a primer. That is, the mold -
Add 2 pmole of a primer whose 5' end was phosphorylated to 0.5 pmole of end-strand DNA, and add 7 mM
Tris-HC4(p)17.5), 0.1
mM EDTA, 20 mM NaC
7! and NH3,1 containing 7 mM MgCA z
Incubation was performed in Opl for 20 minutes at 60°C, followed by 20 minutes at 23°C. Furthermore, dATP, tlGTP, dTTP,
and dCTP to a concentration of 0.5mM, the total volume was 20μl, and DNA polymerase Kle
Two units of now fragment were added and incubated for 20 minutes at 23°C. followed by 10mM ATP
μl and 1 unit of T4 DNA ligase (-, 12
Incubate overnight at °C. The above reaction solution was directly added to Escherichia coli JM 1 according to a method such as meshing (Reference 25).
03 was transformed. In this way, 1 μl of the above reaction solution was added.
Approximately 10,000 phage plaques were obtained per sample.

The obtained plaques were transferred from a soft agar medium to a nitrocellulose filter according to the method of Benton-Davis et al. (Reference 26), and then baked at 80° C. in vacuo for 2 hours. This nitrocellulose filter is 6 x S
SC, 3 probed with 32p-labeled primer oligonucleotide in 10X Denhardt solution.
Hybridization was performed overnight at 7°C. The filters were then washed in 6×SSC at 52° C. and autoradiographed to isolate mutant phage plaques showing positive signals. Mutant double-stranded phage DNA (4m3) was obtained from this mutant phage.

, The base sequence of the mutant DNA is the mutant phage DNA.
The base sequence was determined by the dideoxy method using as a template, and it was confirmed that the desired single base substitution mutation had occurred.

In addition, the following oligonucleotide as a mutagen: 5'G
GCCCCGCGAA88GATT^ Go to 3″,
Codon TTT for the 157th amino acid phenylalanine
can also be replaced with the glutamic acid codon GAA.

An expression plasmid pMUT4Lpm3 in which the human urokinase structural gene having the above point mutation was inserted downstream of the Escherichia coli tac promoter manufactured by T4LylNout was prepared as follows.

10 pg of mutant M13 Niki tl\DNA (4m3) was completely digested with PstI, and an approximately 1.2 Kb fragment was isolated. On the other hand, 10'/J g of plasmid Il1M
IJT411. Partially digested by heating, approximately 1.2 K
A fragment of approximately 4.6 Kb with only the b fragment removed was isolated.

Each of these was collected by phenol treatment and ethanol precipitation, then mixed, and a ligation reaction was performed overnight at 12°C using T4 DNA ligase. The reaction mixture was used to transform Escherichia coli) I8101, and the formed colonies were transformed. A clone containing pMUT4Lpm3 was obtained by screening by a rapid isolation method using an alkaline lysis method. Escherichia coli introduced with plasmid pMIIT4Lpm3
Z 1776/ pMUT4Lpm 3 in 1985 7
FERMP-8341 was deposited with the Institute of Microbiology, Agency of Industrial Science and Technology on January 11, 1986, and FERMP-8341 was deposited with FERMP-8341 on January 22, 1986.
FERM BP-, P7/) will be transferred to the International Deposit under the Butapest Treaty.

Plasmid pMUT4Lpm3 is a representative plasmid of the present invention, and contains a coding region encoding a human prourokinase-like polypeptide at an appropriate position downstream of the tac promoter, and in this coding region, the N-terminus of the polypeptide is The six amino acid codons have been replaced with codons that are easily expressed in E. coli, and the 157th amino acid, the phenylalanine codon TTT, has been changed to the aspartic acid codon GAT.

5μg
plasmid pKK223-3 and 30 units of 1 mark R
1 and 20 units of Lu in buffer (10mM Tr
is-H(J!, pH 7, 5, 10mM MgCj!
2.50 mM Na(J, 1mM DTT) 10
The reaction was carried out at 37°C in 0 pH for 1 hour. This reaction solution was subjected to 0.7% agarose electrophoresis, and a DNA fragment of about 2600 base pairs containing the ampicillin-resistant gene, replication initiation region, and rrnBT+Tz transcription termination region was recovered by a conventional method.

This fragment and 1 unit of the Flenow fragment were mixed in a buffer solution (50
m M Tris-Cj! pH7, 2, 10mM
g.

504.0.1mM DTT, 808M dNT
Ps) The mixture was reacted in 25 μl at 25° C. for 1 hour, and 1 unit of alkaline phosphatase was added, followed by reaction at 68° C. for 0.5 hour. After phenol treatment, ethanol precipitation was performed, and the precipitate was mixed with 20μ/TE buffer (10mM Tr
is41Cj2 pH 8,0,1mM EDTA).

The DNA fragment thus obtained is designated as (A).

On the other hand, 10°C g of plasmid psTN16, 20 units of -C1al and 20 units of PvuII were mixed in a buffer solution (10mM Tris-Cj! pH 7,5,1
0mM Mgc1g, 50mM NsC711mM D
TT) 100/jβ for 1 hour at 37°C. The reaction mixture was subjected to 0.7% agarose electrophoresis, and a fragment of about 300 base pairs containing the promoter, operator, and liposome binding site of the tryptophan operon was separated using the conventional method (
8B).

This fragment and 1 unit of the Flenow fragment were mixed in buffer (50 m
M Tris-HC# pH7,2, I Om M
Mg5OnO, lmM DTT, 80.17M
dNTPs) 25 pi at 25° C. for 1 hour. After phenol treatment, precipitate with ethanol and transfer the precipitate to 20μ
Dissolved in JTE buffer. The DNA fragment thus obtained was
B).

0.5 μg of DNA fragment (A) and DNA fragment [BaO,
5 μg was added to buffer solution (66mM Tris-Cj! pH
7,6,6,6mM Mgcjl! , , 10mM
The mixture was reacted with 2.5 units of T4 DNA ligase in 20 μl of DTT, 1 mM ATP at 15° C. for 15 hours. This reaction solution was used to transform Escherichia coli strain HB 101, colonies containing the pKKtrp plasmid were screened from ampicillin-resistant bacteria, and the plasmid was isolated by a conventional method.

Scrap■D Plasmid trUK2'''1ujil1
Using the plasmids pKKtrp and pl'1UT4L as materials, we created a plasmid ptrpU in which the human prourokinase gene was inserted downstream of the tryptophan promoter.
I created K2.

i.e. 1ug of pKKtrp and 5 units of EcoR.
I in buffer (10mM Tris-tlcff pt(
T, 5, lomMMg (J'z, 50mM NaC
l! After reacting for 2 hours at 37°C in 50 μl of 1mM DTT), 2 units of alkaline phosphatase were added and the reaction was continued at 6'5°C for 30 minutes. phenol treatment,
DNA was recovered by ethanol precipitation (C).

On the other hand, 10 ug (7)pMUT4L and 20:L
Near (7) EC0RI in the same buffer as above, 10
0. After reaction at 37° C. for 2 hours in UNT, a 640 bp fragment containing the N-terminal portion of the human urokinase gene was isolated by 1.2% agarose gel electrophoresis (CD).

DNA fragments (C) and (D) were added to buffer solution (66mM Tr
is-H(J pH7, 6,6,6mM MgCj!z
, 10mM DTT, 1mM ATP)IO,
T4 DNA ligase (2.5 units) in ci and 12°C.
After reacting for 15 hours with E. coli HB 101 strain,
Colonies containing the ptrpUK1 plasmid were screened from among the ambicillin-resistant bacteria, and the plasmid was isolated by a commercial method. followed by 18g of ptrpUKl
and 5 units of 'Pstl in buffer (I Om M T
ris-HfJ! pl+7.5.10mM MgC6z
, 50mM NaC6, 1mM DTT)50. c.
After reaction for 2 hours at 7°C, DNA was recovered by phenol treatment by adding 2 units of alkaline phosphatase and reacting at 65°C for 130 minutes, and by ethanol precipitation (E).

On the other hand, after reacting 10 μl of pM II T 4 L and 20 units of E in the same buffer as above at 100 μρ for 2 hours at 37°C, the C-terminal portion of the human urokinase gene was analyzed by 0.7% agarose gel electrophoresis. Contains 1.2 kb
CF from which the fragment was isolated).

The DNA fragment (E) and CF) were added to buffer (66mM T
ris-HCJ pl+ 7.6.6.6 mM Mg
C6z, 10mM DTT, 1mMA, TP) 10pl
1 at 12°C with 2.5 units of T4 DNA ligase in a
After 5 hours of reaction, E. coli strain H8101 was transformed, colonies containing the ptrplJK2 plasmid were screened from among the ampicillin-resistant bacteria, and the plasmid was isolated using the PTRP method.

71. Q)'PTR Tsuki Tsuki Man-
Δ Production Using the same method as in Example 1, but using the following synthetic oligonucleotide as a primer: 5'CAGATGGAATAAAGCC3', a DNA in which the lysine codon AAA at position 135 has been mutated to an isoleucine codon to T. A mutant 2-tree chain type phage M13RF (1135) into which the fragment was inserted was obtained.

10 gg of M13RF (r135) was completely digested with Lu1 and an approximately 1.2 kb fragment was isolated. On the other hand, 1
8 g of ptrplJK2 was completely digested with PstT,
A DNA fragment of approximately 3.4 k )) that would serve as a vector was isolated. Each of these was collected by phenol treatment and ethanol precipitation and then mixed, and T4. After overnight reaction at 12°C using DNA ligase, E. coli HB 101 strain was transformed and ampicillin-resistant colonies were extracted with ptr.
Clones containing pUK2(1135) were screened. The specific conditions for this method were the same as those described in Example 4.

E. coli containing this plasmid (
Escherichia col i) W 3110/
ptrptlK2 (1135) was transferred to Deutsche on December 28, 1985 as DS M-3622.
Sammelung von Mikroorgan
ismen to the Budapest Treaty and was deposited internationally.

The lysine codon AAA at position 135 was isolated using the same method as in Example 1 for the plasmid trIJK (E135), but using the following synthetic nucleotide as a primer: 5" GATGGAGA^88GCCT hehe. A mutant double-stranded phage M13RF (, E135) in which a mutated DNA fragment was inserted into the glutamic acid codon GAA was obtained.

Next, plasmid pttpUK2 (E135) was obtained from this M13RF (135) and ptrpUK2 in the same manner as described in Example 10.

E. coli containing this plasmid (
Escherichja colt) W 3110/p
trplJK2 (E135) was released on December 28, 1985.
Deutsche S as DSM-3621
ammelung von Mikroorganis
Deposited in men.

m on l plasmid tr UK2 (Q135D157)
Creation Using the same method as in Example 1, but using the following synthetic nucleotide as a primer: 5' GATGGACA88GCCC to lysine codon A'A at position 135 to glutamine codon CA, A. A mutant double-stranded phage into which a mutated DNA fragment was inserted was obtained.

Single phage DNA was then obtained from this phage in the same manner as described in Example 1, and in the same manner as above, except that the following synthetic oligonucleotide was used as a primer: 5' GGCCCCGC凋^AG8TT 8) By mutating the phenylalanine codon TTT at position 157 to aspartic acid codon GAT, the lysine codon AAA at position 135 is mutated to glutamine codon CAA, and the phenylalanine codon at position 157 A mutant double-stranded phage M13RF (formerly 35I) 15'7) was obtained in which a DNA fragment in which the codon TTT of was mutated to the codon GAT of aspartic acid was inserted.

Next, this M13RF (Q135D157) and p
ptlK2 ([11350157) was obtained from trpUK2 in the same manner as described in Example 10.

E. coli containing this plasmid (
Escherichia coli) W 3110/p
trpUK2 (01350157) was released on December 1985.
On the 28th of May, Deuts as DSM-3623
che Sammelung von Mikroor
Deposited with ganismen.

Real side LL plate plasmid tr 1IX2 (E135D
157) Similar to Example 12, but using the following synthetic nucleotide to mutate the lysine codon at position 135 to the glutamic acid codon GAA: 5'' GATGGAG 8888 GC hehehe 3' , a mutant double-domain phage old 3RF into which a DNA fragment was inserted in which the lysine codon AAA at position 135 was mutated to the glutamic acid codon GAA, and the phenylalanine codon TTT at position 157 was mutated to the aspartic acid codon GAT. (r!1350157) was obtained.

Next, this M13RF (E135rl157) and t
trpHK2 (E135D157) was obtained from r p II K 2 in the same manner as described in Example 10.

E. coli containing this plasmid (
fischerichia colt) W 3110/
ptrpUK2 (E1350157) was released in 1985
On February 28th, Deut as DSM-3624
Sammelung von Mikroo
Deposited at rganismen.

Plasmid pMtlP1 obtained in Example 3 and plasmid pMIJP1pm obtained in Example 4 were inoculated into Escherichia coli W3.
110 according to a conventional method, and the resulting transformed bacteria were cultured at 30°C in 5 ml of Shiichi Pross.
When the absorbance at r+m reached approximately 0.3, the temperature of the culture solution was raised to 42° C. and cultured for an additional 3 hours to express the urokinase gene.

Escherichia coli W3110 cells were collected from 5 ml of the above-mentioned culture solution from Nijihei 1, and mixed with 7.5M guanidine hydrochloride and 0.05M Tris-H.
(J (pH 7,5)) and allowed to stand at room temperature for 90 minutes. Next, this suspension was centrifuged at 1100 Orp for 10 minutes, and the supernatant was 1M guanidine hydrochloride, 0. .05M Tris'HCA (pH
7,5), diluted to 5 ml of a solution containing 2mM reducing agent glutathione and 0.2mM oxidized glutathione, and partially incubated at room temperature. Next, add this to 10
mM Tris-H(J (pF17.4) and 0.
4 M NaCj! Dialyzed for 4 hours at 4°C against 100 times the volume of a container containing 10 mM Tris
Dialysis was performed for 2 hours against 100 volumes of a solution containing -IIC4 (pH 7.4) and 0.1 M Mail.

Trypsin was added to a portion of the crude extract thus obtained to give a concentration of 30 Mg/mβ, and the mixture was incubated at 37° C. for 1 hour. As a control, water was added instead of trypsin and incubated in the same manner.

These were electrophoresed in gels containing 12.5% polyacrylamide and 0.1% SDS according to the method of Lemley et al. Next, the gel was diluted with 2.5% Trit
After soaking in onX-100 and incubating at room temperature for 1 hour, it was layered on a fibrin agar plate and incubated at 37°C for about 1 or 2 hours, and the molecular weight was estimated from the position of the dissolution zone on the fibrin agar plate. For comparison, standard urokinase derived from human urine was also run.

In Figure 13, lane 1 is standard urokinase (1 unit), lane 2 is a crude extract from E. coli transformed with pMUPl, and lane 3 is a crude extract from E. coli transformed with pMUPl treated with trypsin. Lane 4 is a crude extract from E. coli transformed with pMUPlpm, and Lane 5 is a crude extract from E. coli transformed with pMUPlpm.
FIG. 3 is an electrophoretogram of an extract from E. coli transformed with Plpm and treated with trypsin. FIG.

As is clear from this figure, the molecular weight of the transgenic product derived from pMIIPI is approximately 50,000, but a portion of it was reduced to a molecular weight of approximately 30,000 by trypsin treatment. On the other hand,
The molecular weight of the gene product derived from pMUPlpm was also approximately 50,000, but it was not reduced in molecular weight by trypsin treatment. The molecular weights of these products, approximately 50,000 and 30,000, are slightly lower than the molecular weights of human urine-derived high-molecular urokinase, which is approximately 50,000, and the low-molecular weight urokinase, which is approximately 33,000, respectively. This seems to be because the addition of sugar chains does not occur in this case.

Implementation 15 Expression layer of pro-urokinase polypeptide The plasmid pMUT4Lpm2 obtained in Example 5 was transformed into Escherichia coli JM 103 according to the conventional method, and the resulting transformed bacteria was heated to 37°C in 5 ml of L-broth. When the absorbance at 550 nm reached approximately 0.5, IPTG (isopropyl-β-D-thiogalactopyranoside) was added to a final concentration of 1. Expression was induced by adding it to a concentration of mM, and the urokinase gene was expressed by further culturing at 37°C for 3 hours.

Crude extracts were prepared by processing 5 ml of the above culture in a manner similar to that described in Example 15, and a portion was treated with trypsin.

These were electrophoresed in gels containing 10% polyacrylamide and 0.1% SDS according to the method of Lemley et al. Next, the gel was treated with 2.5% Triton
After soaking in X-100 and incubating for 1 hour at room temperature, it was overlaid on a fibrin agar plate and incubated at 37°C for about 2 hours.
The molecular weight was estimated from the position of the melting zone on the fibrin agar plate. For comparison, standard urokinase derived from human urine and the trypsin-treated product obtained in Example 15 were also run.

The results are shown in FIG. 14. During this period, lane 1
is standard urokinase (l units), lane 2 is pMt.
Crude extract from E. coli transformed with lPl was treated with trypsin, lane 3 is pMUT4Lpm
Lane 4 is an electrophoretogram of a crude extract from E. coli transformed with pMUPlpm treated with trypsin.

As is clear from this figure, the gene products derived from pMUT41 and pm2 are also unlikely to be reduced in molecular weight by trypsin treatment, similar to the gene products derived from pMUPlpm. The molecular weight of these products is approximately 50,000 and approximately 30,000, which is the molecular weight of human urine-derived polymer urokinase, which is approximately 50,000.
, 40,000 and the molecular weight of low-molecular-weight urokinase, which is approximately 33,000, is probably due to the fact that addition of tit does not occur in E. coli.

Expression of prouronase-like polypeptide (in disaster relief)
3) The plasmid pMUT4Lpm3 obtained in Example 7 was transformed into Escherichia coli JM 103 according to a conventional method, and the resulting transformed bacteria was cultured at 37°C in 5 ml of Shiichi broth, and the absorbance at 550 nm was approximately 0. When the temperature reached .5, expression was induced by adding IPTG (isopropyl-β-D-thiogalactopyranoside) to a final concentration of 1 mM, and the cells were incubated for an additional 3 hours at 37°C. As a result, the urokinase gene was expressed.

Escherichia coli JM 103 cells were collected from 5 ml of the above culture solution and mixed with 7.5 M guanidine hydrochloride and 0.05 M
Solution containing Tris-HCIl (pH 7,5)9.
The suspension was suspended in 5 ml Il and left at room temperature for 90 minutes. Next, this suspension was centrifuged for 10 minutes at 100OrpIrl, and the supernatant was mixed with 1M guanidine hydrochloride and 0.05M Tr.
is4(Cj2 (p+(7,5)), diluted in 5 ml of a solution containing 2 mM reduced glutathione and 0.2 mM oxidized glutathione and incubated in part at room temperature. This was then incubated with 10 mM Tris-11
Dialysis was performed at 4° C. for 4 hours against 100 times the volume of a solution containing cJ (pH 7,4) and 0.4 M NaCl, and further dialyzed with 10 mM Tris-HCl (pH 7,4
) and 0.1 M Na (J!) for 2 hours against 100 times the volume of the solution. The crude extract thus obtained was subjected to affinity chromatography using a Sepharose column to which an anti-urokinase monoclonal antibody was bound. Mutant (pm 3 ) prourokinase was purified by this method.

Plasmid ptrpH obtained according to Examples 12 and 13 of Prourokinase Soft Polypeptide n Satochi
K 2==(mouth 135D157) and ptrpUK 2
(E135.D157) was transformed into Escherichia coli W3110 according to a conventional method, and the resulting transformed bacteria was transformed with 5mp I,
- IAA (indole acetic acid) when incubated in broth at 37°C and the absorbance at 550 nm is approximately 0.5.
Expression was induced by adding the following to a final concentration of 50 μg/ml, and the urokinase gene was expressed by further culturing at 37°C for 3 hours.

Among the above culture solutions, ptrpUK 2 (mouth 1350
5m71 derived from the mutant ((157)) was extracted and purified by the same method as described in Example 19, and the mutant ((1
1350157) A prourokinase-like polypeptide was obtained. A portion of it was treated with trypsin as follows. The enzyme activity of the sample was measured using the synthetic substrate method, and 10QIU
/m4) Lis-HCl buffer (50mM) (pl
+7.4), 0.15M salt and 0.1% Trito
It was diluted into a solution containing nX-100. 50μp of this solution
against 1■/m7! , 2rrg/ml and 3. mgl
3 μl of trypsin aqueous solution was added, and the mixture was incubated at 37° C. for 60 minutes. Then 5■/mI! The reaction was stopped by adding 5 μl of an aqueous solution of soybean trypsin inhibitor. As a control, water was added instead of trypsin and treated in the same way.

These were then mixed with 0.1% according to the method of Lemley et al.
After electrophoresis in a 10%-26% polyacrylamide continuous gradient gel containing SDS, the gel was run 2.
It was immersed in 5% Triton X-100 and incubated at room temperature for one hour, layered on a fibrin agar plate, incubated at 37°C for 2 hours, and the molecular weight was estimated from the position of the dissolution zone on the fibrin agar plate. For comparison, natural prourokinase-like polypeptide and mutant (Ni1135 ) Similar treatment was performed for pro-urokinase-like polypeptide. These results are shown in FIG. In this figure, lanes 1, 2.3
and 4 are natural prourokinase-like polypeptides derived from pl'ltlP 1 at 0°1.2 and 3, respectively.
■/m7! This is during electrophoresis after treatment with an aqueous trypsin solution. Lanes 5, 6, 7 and 8 are pMUPl
FIG. 2 is an electrophoretogram of a mutant (Q 135) prourokinase-like polypeptide derived from pm which was similarly treated with trypsin. Lanes 9, 10° 11 and 12 are ptrp
Mutant derived from uK 2 (Q135D157) (0
135D157) This is an electrophoretogram of a prourokinase-like polypeptide similarly treated with trypsin.

As is clear from this figure, the molecular weight of the native prourokinase-like polypeptide derived from pMUP I is approximately 50,000, but it was reduced to a molecular weight of 30,000 by trypsin. On the other hand, pM mouth Plpm and ptrpUK 2 (Q1
The mutant prourokinase-like polypeptide derived from [35T]157) was not reduced in molecular weight by trypsin treatment.

Moxibustion Consideration ■ Top Plasmid YTUI, Institute of Microbial Technology, Agency of Industrial Science and Technology, Microbiological Research Institute No. 77
Elisha Cori HB 101/p, HT 3, deposited as No. 76 (FER1'1Plt7?76)
The pHT3 plasmid was obtained using a conventional method.

pi (5 μg of T3 plasmid and 115 U of Bam) in buffer (10 m M Tris-HCj! pH 8,0,
7mM MgCj22.100mM NaC11, 2m
The reaction was carried out for 3 hours in 20 μβ (Mβ-mercaptoethanol). After ethanol precipitation, the precipitate was soaked in a buffer solution (50rn
M Tris-11 (J! pH 7, 2, 10mM
Mg (1 g, 0.] m, M DTT, 80 p
MdNTP) 201! The mixture was reacted with Klonow fragment 1'-7 at 22° C. for 0.5 hour. After the phenol treatment, ethanol precipitation was performed. The precipitate was mixed with a buffer solution (10mM Tris-11 (J pH 7,5,7m
Mg (4460mM NaCl, 7mM β-mercaptoethanol) in 20μβ was reacted with 1120 units at 37°C for 3 hours. After ethanol precipitation, the precipitate was mixed with a buffer solution (66 m M Tris-11 (j! p
H7,6,6,6mMMgC7! ,,10mM DD
The mixture was reacted with 2.8 units of ligase in 20 μl of T, 1 mM ATP at 15° C. for 200 hours. Elisha coli H8161 strain was transformed using this reaction product. Among the ampicillin-resistant transformants, a bacterium containing the pHT31 plasmid as shown in FIG. 18 was isolated.

Additionally, the pH731 plasmid was obtained using conventional methods.

pl (10 μg of T31 plasmid was added to buffer (10 m M
Tris-HC7! pH7, 5, 7mM Mg(J
! , , 5 Qm M NaCl, 7 mM β-mercaptoethanol) was reacted with 20 units of Aatn at 37° C. for 3 hours. After ethanol precipitation,
The precipitate was added to buffer solution (67mM Tris-HCA' p
l+ 8.8.6.7 m M MgCI! 210m
M β-mercaptoethanol, 6.7mMIEDT
A, 16.6rnM (NH3)zsOa, 33
0 pM dCTP) 2 in 0μβ, T4D
The mixture was reacted with 2.8 units of NA polymerase at 37°C for 15 minutes. After phenol treatment and ethanol precipitation, the precipitate was mixed with a buffer solution (10mM Tris-HCl2
pH17,5,7mMgC7! z, 150mM,
NaCj! , 0.2mM EDTA, 7mM β-
The mixture was reacted with 20 units of Σ1 in 20 μρ of mercaptoethanol at 37° C. for 3 hours. 1 of this DNA reaction solution
．． Approximately 3000 base pairs of D containing the ampicillin resistance gene and replication initiation region were subjected to 2% agarose gel electrophoresis.
NA fragments were recovered by conventional means. This DNA fragment is referred to as DNA fragment (A).

On the other hand, 10 μg of pHT31 plasmid was added to buffer solution (100 μg).
mM Tris-HCj! pH 7, 5,7mM h
C7! The reaction mixture was reacted with EcoR130 units in 20 μβ (Mg-mercaptoethanol) at 37°C for 3 hours. After ethanol precipitation, the precipitate was diluted with buffer solution (67mM
Tris-FICII pH 8, 8, 6, 7mM Mg
C42z, 10mM β-mercaptoethanol,
6.7mM EDTA, 16.6mM (Nu mountain s
o,,330. IJM dcTP) in 20μβ, T4
The mixture was reacted with 2.8 units of DNA polymerase at 37°C for 15 minutes. After phenol treatment and ethanol precipitation, the precipitate was dissolved in a buffer solution (10mM Tris-IC1pH
7,5,7mM MgCNz, 150mM NaCj!
z, 0.2mM EDTA, 7mM β-
The mixture was reacted with Σa1120 units in 20 μl of mercaptoethanol at 37° C. for 3 hours. This DNA reaction solution was subjected to 1.2% agarose gel electrophoresis, and a DNA fragment of approximately 2100 base pairs containing clts and PL promoter/operator was recovered. This DNA fragment is
Fragment Fragment C color. DNA fragment (A) 0.5μg and D
0.5 μg of NA fragment (B) was added to buffer solution (66mM Tr
is-HCj! pH7,6,6,6mM MgCj
! zlomM DTT, 1mM ATP) 20μ
The mixture was reacted with 2.5 units of T4 DNA ligase at 15°C for 15 hours. This reaction solution was used to transform Elisha coli HBIOI strain, and colonies having the pYTU1 plasmid shown in FIG. 11 were screened from ampicillin-resistant bacteria, and the plasmid was isolated by conventional means.

literature (1) M, Samama 1M, Castil, 0. Matsuo.

M, Holler and 1. R, Risinen (19112)
! - Thrombensis hemostasis (Thromb, l
(2) E. Reich et al., Journal of Biological Chemistry (J, Biol, Chem,) 25 mutual? 262-7268 (1982).

(3) S., S., Hussein, ■, Darewheich, B.;

Lipinski Thrombosis hemostasis (Throm)
b, I (aentostasis) 46+l] (19
81).

(4) V, Brewich, R, Pannell, S, Ruy, Journal of Clinical Investigation (J, Cl1n, Invest,) 73+ 1731
-1739 (1984).

(5) C, Fran, L, S, Hall, G, H, Barlow 1.1. E,) Libby, Biochimica et Bio
physicaActa)496.384-400(1
977).

(6) G, H, Parlow, European Urokinase Symposium (1!ur, l1rokinase
Symp, ) (1981) p 1-5° (7) T, Suyama et al., Med, Postgradua
te, 15+547 (1977).

(8) G., J., Steffens et al., Hosobeseilers.
The Physiological Chemistry (Hoppe-5
eyler's Z, Physiol, Chem,
)+363+1043 (19B2).

(9) Gai, Ganzler et al., supra, 1055 (19
82).

(10) Specification of Japanese Patent Application No. 59-97106.

(11) J, M, Chillgain et al., Biochemistry 18.5294 (1
979).

(12) H. Aviv et al., Proceedings of the
The National Academy of Sciences Op the United States (Proc. Nat.
l, 8 cad, sci, U, s, A,) 69.140
8 (1977).

(13) T. maniatis, etc., Molecular Cloning (Molecular Cloning) Cold
Spring) 1 Arbor Lab, New York (1982), p. 254.

(14) 11. c, Hirnboim et al., Nucleic Ac1ds Research
es, ), 7°1513 (1979).

(15) M., Grunstein et al., Proceedings op the National Academy.

Of Sciences of the United Stake (Proc, Natl, Acad, Sci Ll, S
,A,).

Mutual, 396H1975).

(16) A. Maxam et al., Methods in Enzymology
, 65.499 (1980).

(17) J. Messing, New York Acids Lisa, -ch (tlucleic Ac1ds Re5
-)+9.

309 (1981).

(18) - Le, Agarwal et al., Journal of Biological Chemistry (J, 11io+, Chew
,) Sword 6.1023 (1981).

(19) A. G. Stephut et al., New York.
Nucleic Ac1ds Re
s, ), dan.

6597, (1983).

(20) Unexamined Japanese Patent Application, 1983-51300゜ (21) T, Ikemura et al., Co1d Spring
llarborSymp, Quart, Biol
, 47. 1087 (1983).

(22) J, Prousius et al., Plasmid (Pla
smid) 6, 112 (1981).

(23) J. Prousius, Gene
27°151 (1984).

(24) J. Prousius, Gene 27
．． 161 (1984).

(25) J, Methods in Enzymology (1,983), Methods in Rnzy
mology) 101+20-78° (26) W, D, Benton, R8 Hat Davis (1977
), Science, 196 1
80° (27) Specification i1@59-274478.

(28) S. Mizusawa et al.
+Proc, Natl.

8cad, Sci, Ij S, A, 80
358 (1983).

(29) Paul Paulaen Hung JP-A 1986-15
8799 specification.

(30) U, K, Lemley, Neich + -(N
ature) 227°680 (1980).

[Brief explanation of drawings]

FIG. 1 is a phylogenetic diagram of plasmids related to the present invention. FIG. 2 shows the restriction enzyme map of plasmid pPE3. Figure 3 shows plasmid pPE3 and plasmid pKYt1.
Figure 2 shows the construction of plasmid pKYU22 from 21. Figures 4-1 to 4-3 show the base sequence of cDNA from natural mRNA containing the entire coding region of human pro-5 urokinase. Figure 5 shows the construction of plasmid pKMU1 from plasmid pKYU22 and synthetic NA oligomers. Figure 6 shows the process of creating plasmid pM[IT4[, etc.] from plasmid pl (Flu 1 and plasmid pTcM1). Figure 7 shows plasmid pKYt122 and phage M1.
Figure 3 shows the production of single-stranded phage DNA with a 1200 bp insert from 3p m 8 RF DNA. FIG. 8 schematically shows a method for forming a point mutation to the amino acid codon at position 135 using a primer. FIG. 9 shows the construction of plasmid pMUP1 from plasmids pYTU 1 and pKMU 1. Figure 10 shows mutant phage M13 two-stranded DNA (p
ml) and plasmid pM [plasmid p from IPl
The production of MLIP1pm is shown. Figure 11 shows plasmids psTN16 and pKK223-
Figure 3 shows the construction of plasmid pKKtrp from 3. Figure 12 shows plasmids pKKtrp and pMUT4Lp.
Figure 2 shows the production of plasmid ptrPUK2 from ml. Figures 13, 14, and 16 show fibrin autographs of urokinase expressed in E. coli. Figure 15 shows the natural prourokinase and the mutant of the present invention (
pm3) is a graph comparing activation by plasmin with prourokinase. Figure 17 shows plasmid pyT from plasmid pH73.
The preparation of u 1 is shown. Figure 2 PIIE 'INIR'l'llRILIEGLtJ
ASN GLN PROTRI' Pl(E MAAI
A IIE TYRARGMH Engineering S ARG GLY
GI, Y 5ERVAI n stop TYRVAL 1B8
~'AC8CCGG GGG GGCTCr GTCA
CCTACGTGCAA GGG GAG g MG
TIT GAG GIG GAA 7VICTGCCT
GO: C'ICG a TAT Me GAT CCC
to CGCACTACTACGGC'ICT GAA G
TCAce ACX:: Transformation into AAAX1776 TTG CTCGAG GTG GTCCAA GGC
AGCB Bean I 5 Figure Yaru jl 1 bleaching Lu Ya plasmin treatment time (+) 0-0 natural gloulokinase (plasmin concentration 10μ
g/ml) -- Mutant (pMUT4L pm3) prourokinase (plasmin concentration 10 μg/m/!)
muum mutant (pMUT4Lμη3) prourokinase (plasmin concentration 20 μg/m) sono-gut mutant (pML
JT4Lpr'n3) Prourokinase (plasmin level 50 μg/rn1.) Salary 15 Figure 1 2 3 4 56 7 8.9 101112・-
0←30 16th country procedural amendment (voluntary) April 24, 1986. Michibe Uga, Commissioner of the Japan Patent Office1, Indication of the case, Patent Application No. 012984 of 19882, Name of the invention: Stabilized human protein 1: I urokinase 3, Relationship with the amended person case Patent application Person/' Name Name of Sagami Central Chemical Research Institute Foundation (220,> Name of Central 4Y1 Co., Ltd. (531) Name of Hodogaya Chemical Industry Co., Ltd. (430)
Nippon Soda Co., Ltd. 4, Agent address: 8-10-5 Toranomon-chome, Minato-ku, Tokyo 105
Subject of amendment (1) “Detailed Description of the Invention” column of the specification. (2) "Brief explanation of drawings" column in the specification. (3) Drawings. 6. Contents of amendment (1) ■ The following statement is added between page 149, line 15 and line 16 of the specification. ``In addition, when the prourokinase-like polypeptide in which the amino acid at position 157 has been substituted according to the present invention is administered in vivo, it takes a considerable amount of time to become activated.
Moreover, since the effect is long-lasting, it is also promising as a prophylactic agent against thrombus formation. J ■ Add the following statement between the 4th and 5th lines of page 106 of the same. The culture solution containing the urokinase gene product obtained in Example 20 was extracted and purified by the same method as described in Example 19, and the mutant (0135015
7) Prourokinase-like polypeptide was obtained. Then, human normal plasma was injected with 1 mutant (Q135D157) prourokinase-like polypeptide (0,2■/m j!).
79 volumes were added and incubated at 37°C. After 0.2 and 5 hours, aliquots were taken and diluted 50 times. Then, 16 μl of the same was diluted with 0.0 μl according to the method of Lemley et al.
After electrophoresis in a 10%-26% polyacrylamide continuous gradient gel containing 1% SD,
The gel was immersed in 2.5% Triton estimated. For comparison, the natural prourokinase-like polypeptide and mutant (Q135) obtained by extracting and purifying the culture solution obtained in Example 14 by the same method as described in Example 19 were prepared. Similar treatment was performed for prourokinase-like polypeptide. These results are shown in FIG. In this figure, lanes 1.2 and 3 are electrophoretograms of the native prourokinase-like polypeptide derived from pMUP 1 incubated in plasma for 0.2 and 5 hours, respectively. lane 4゜5
and 6 are mutants derived from pMUP l pm (013
5) This is an electrophoretogram of a pro-urokinase-like polypeptide treated in the same manner. Also, lanes 7°8 and 9 are pt.
FIG. 2 is an electrophoretogram of a mutant (Q1351) 157) pro-urokinase-like polypeptide derived from rpUK 2 (formerly 3511157) treated in the same manner. As is clear from this figure, the native prourokinase-like polypeptide and the mutant (Q135) prourokinase-like polypeptide form macromolecular complexes with plasma components.
The dissolution zone at this position has been reduced to the original 50. On the other hand, the mutant (Q135D157) prourokinase-like polypeptide did not form a macromolecular complex in plasma, and no decrease in the lysis zone was observed. J(2) The following statement is added next to page 115, line 16 of the specification. "Figure 18 is an electropherogram showing the formation of a complex between the prourokinase-like polypeptide of the present invention and normal human plasma components, showing the lysis zone on fibrin agar." (3) ) Add attached Figure 18. 7. List of attached documents (1) Figure 18 1 copy - 8f 0 to 20 ""' ○ Otsu・ -nin 50 to 1□gxpmm-...O Figure 18

Claims (1)

[Claims] 1. The following general formula; ▲ Numerical formulas, chemical formulas, tables, etc. , X is lysine present at position 135 or an amino acid other than a basic amino acid, Y is phenylalanine or an acidic amino acid present at position 157, and the horizontal line corresponds to the amino acid sequence of natural human prourokinase. (provided that when X is lysine, Y is not phenylalanine), or a stabilized human having an amino acid sequence substantially identical thereto. - Prourokinase-like polypeptide. 2. X is alanine, asparagine, aspartic acid, glutamine, glutamic acid, phenylalanine, glycine, isoleucine, leucine, methionine, serine,
2. The polypeptide of claim 1, which is a natural amino acid selected from the group consisting of threonine, valine, tryptophan, tyrosine and proline. 3. The polypeptide according to claim 1, wherein said X is an amide of an acidic amino acid selected from the group consisting of asparagine and glutamine. 4. The polypeptide according to claim 1, wherein said X is a hydroxyamino acid selected from the group consisting of serine and threonine. 5. The polypeptide according to claim 1, wherein said X is an acidic amino acid selected from the group consisting of glutamic acid and aspartic acid. 6. The polypeptide according to claim 1, wherein said X is a branched chain neutral amino acid selected from the group consisting of isoleucine, leucine, and valine. 7. The polypeptide according to claim 1, wherein Y is aspartic acid or glutamic acid. 8. The polypeptide according to claim 1, wherein said X is glutamine and said Y is phenylalanine. 9. The polypeptide according to claim 1, wherein said X is threonine and said Y is phenylalanine. 10. The polypeptide according to claim 1, wherein said X is glutamic acid and said Y is phenylalanine. 11. The polypeptide according to claim 1, wherein the X is isoleucine and the Y is phenylalanine. 12. The polypeptide according to claim 1, wherein said X is lysine and said Y is aspartic acid. 13. The polypeptide of claim 1, wherein X is glutamic acid and Y is aspartic acid. 14. The polypeptide of claim 1, wherein X is glutamine and Y is aspartic acid. 15. The polypeptide according to claim 1, wherein the amino acid sequence of the natural human prourokinase is an amino acid sequence encoded by cDNA corresponding to mRNA derived from human kidney. 16. The following general formula: ▲ There are mathematical formulas, chemical formulas, tables, etc. ▼ (In the formula, Met is methionine present in some cases, Ser is serine present at the 1st position of the N-terminus, and X is 135 lysine present at position 157 or an amino acid other than a basic amino acid, Y is phenylalanine or an acidic amino acid present at position 157, and the horizontally lined portion is an amino acid identical to the corresponding portion of the amino acid sequence of natural human prourokinase. (provided that when X is lysine, Y is not phenylalanine), or a DNA encoding a human prourokinase-like polypeptide having an amino acid sequence substantially identical thereto. segment. 17. Codons encoding multiple amino acids at the N-terminus are frequently used codons in E. coli, and codons other than the codons encoding the multiple amino acids at the N-terminus and X and Y mR derived from human kidney
17. A DNA segment according to claim 16, which is identical to the codon for the corresponding amino acid in the cDNA corresponding to NA. 18. The DNA segment according to claim 16, wherein the codon encoding the plurality of amino acids at the N-terminus consists of the following codon: 19. The DNA segment according to claim 17, wherein the codons frequently used in E. coli are selected so as not to constitute an inverted repeat sequence in the N-terminal coding region. 20. If X is glutamine, this is the codon CAA
If X is threonine, this is coded by the codon ACA; if X is glutamic acid, this is coded by the codon GAA; if X is isoleucine, this is coded by the codon A
TA; if Y is aspartic acid, this is coded by the codon GAT; and if Y is glutamic acid, this is coded by the codon GAA. DNA segment. 21. The following general formula: ▲Mathematical formulas, chemical formulas, tables, etc.▼ (In the formula, Met is methionine present in some cases, Ser is serine present at the 1st position of the N-terminus, and X is 135 lysine present at position 157 or an amino acid other than a basic amino acid, Y is phenylalanine or an acidic amino acid present at position 157, and the horizontally lined portion is an amino acid identical to the corresponding portion of the amino acid sequence of natural human prourokinase. (provided that when X is lysine, Y is not phenylalanine), or a DNA encoding a human prourokinase-like polypeptide having an amino acid sequence substantially identical thereto. A plasmid containing a segment, a control region for expression of said prourokinase-like polypeptide, and the necessary DNA sequences for replication in E. coli. 22, the tac promoter/operator, trp promoter/operator, or P_L promoter/operator as the control region for the expression, as well as Pseudomonas putida
S of the metapyrocatechase gene (C230) derived from a)
22. The plasmid of claim 21, which contains the D sequence and is capable of expressing a prourokinase-like polypeptide in E. coli. 23. Multiple amino acids at the N-terminus of the prourokinase-like polypeptide are encoded by codons that are frequently used in E. coli, and this codon is
At the NA level, the metapyrocatechase gene (C2
23. The plasmid according to claim 22, wherein the nucleotide sequence near the SD sequence of 30) and the nucleotide sequence at the 5' end of the prourokinase gene are selected so as not to have a complementary structure. 24. The following general formula: ▲ There are mathematical formulas, chemical formulas, tables, etc. ▼ (In the formula, Met is methionine present in some cases, Ser is serine present at the 1st position of the N-terminus, and X is 135 lysine present at position 157 or an amino acid other than a basic amino acid, Y is phenylalanine or an acidic amino acid present at position 157, and the horizontally lined portion is an amino acid identical to the corresponding portion of the amino acid sequence of natural human prourokinase. (provided that when X is lysine, Y is not phenylalanine), or a DNA encoding a human prourokinase-like polypeptide having an amino acid sequence substantially identical thereto. E. coli into which a plasmid containing a segment, a control region for expression of the prourokinase-like polypeptide, and a base sequence necessary for replication in E. coli has been introduced. 25. The following general formula: ▲ There are mathematical formulas, chemical formulas, tables, etc. ▼ (In the formula, Met is methionine present in some cases, Ser is serine present at the 1st position of the N-terminus, and X is 135 lysine present at position 157 or an amino acid other than a basic amino acid, Y is phenylalanine or an acidic amino acid present at position 157, and the horizontally lined portion is an amino acid identical to the corresponding portion of the amino acid sequence of natural human prourokinase. (provided that when X is lysine, Y is not phenylalanine), or a method for producing a human prourokinase-like polypeptide having an amino acid sequence substantially identical thereto. a plasmid containing a coding DNA segment encoding the pro-urokinase-like polypeptide, an expression control region necessary for expressing the pro-urokinase-like polypeptide in E. coli, and a region necessary for replicating in E. coli; A method characterized by culturing Escherichia coli transformed by and collecting prourokinase-like polypeptide from the cultured cells.