JPS6181789A - Dna and its use - Google Patents

Abstract

PURPOSE:To obtain DNA capable of carrying out easily insertion of DNA to code protein and its excision, wherein DNA contains a range to code a promoter and a signal peptide of neutral protease gene and is deficient in a specific range. CONSTITUTION:DNA containing a range to code a promoter and a signal pep tide of neutral protease gene, and partially or totally deficient in a range to code neutral protease from 3' end side. The range to code the signal peptide of neutral protease is a polynucleotide to code a peptide shown by the formula as an amino acid sequence. So long as the polynucleotide has function as signal peptide, even if amino acids constituting it may be inserted, excised, or converted into other amino acids, polynucleotide to code the peptide may be used as a range to code the signal peptide.

Description

[Detailed description of the invention] (Industrial application field) The present invention relates to novel DNA and its uses.

(Prior Art) To date, much of the recombinant DNA research has focused on Escherichia coli (E, c
Many heterologous genes have already been expressed in E. coli. However, in this method, the expressed gene product accumulates within the bacterial body. In the process of obtaining the desired gene product in pure form, not only does it take a great deal of time and effort to extract the desired product from the bacterial cells and purify it from the extract. It is extremely difficult to obtain the desired substance in its pure form.

Bacteria of the genus Bacillus have long been used industrially as producing bacteria for various extracellular enzymes.
The DNA regions encoding the promoters and signal peptides of these exoenzyme genes were cloned,
Connect the structural gene of the target protein downstream,
It is thought that if this is introduced into Bacillus subtilis, it will be possible to secrete the target protein as a gene product to the outside of the bacterium.

In Bacillus bacteria, secreted proteins are synthesized as precursors with a signal peptide consisting of approximately 20 to 30 amino acid residues at the amino terminus, and this portion is then cleaved by signal peptidase to form the mature protein. It is believed that Already Ba
cillus amyloliquefa-cien
+3 α-amylase gene [engineering, PBLvaet
al: Gene, 22*229 (1983
)).

Beninlinase gene of Bacillus licheniformis (3, Chang, et al.
Molecular Cloning and G
ene Regu'1ation 1nBacil
li, Academic Press 659
Page, 1982), Bacillus 5ub
tilis α-amylase gene (H, Yamaza
ki at al, ,T,Bacteriol,'
.

156.327 (1983)) was cloned,
Secretion of heterologous proteins using these signal peptides has been reported. On the other hand, B, amylolique
fa-ciena acalytic protease gene has also been cloned and its nucleotide sequence has been reported (J.
.

A, Wel, 1s et al, Nucleic
Ac1ds Res, 1L7911 (1983)
). Also, B, amyloliquefaci −
It has been reported that the neutral protease gene of ena has also been recently cloned, and its base sequence was determined by Noboru Tomioka et al.
As a result, it was revealed that the gene did not code for neutral propase [Yoshio Furuya: Proceedings of the 1st Next Generation Maternity Fundamental Technology Symposium, p. 223, 1983].

(Problems to be Solved by the Invention) In the conventionally reported method of expressing a target protein using the signal peptide-encoding region of the extracellular enzyme gene of Bacillus, the signal peptide is If there is no suitable restriction enzyme B recognition site near the 3' end of the coding region, it not only takes a great deal of time and effort to ligate the DNA encoding the target protein, but also the target protein itself. It was difficult to express it directly.

Furthermore, even in the cultivation of microorganisms that carry plasmids that have incorporated DNA encoding a target protein, in many cases the cultivation time required until the protein is expressed is long, and shortening of the cultivation time has been desired.

(Means for Solving the Problems) The present inventors B.
A DNA 't-cloned which has a restriction enzyme cleavage map different from that known from S and contains a neutral propase gene, and this DNA was ligated into a vector to create B
They discovered that it was possible to breed an excellent neutral protease-producing bacterium by introducing the signal peptide into a bacterium of the genus Acillus, and realized that it was possible to construct a useful secretion vector by utilizing the region encoding this signal peptide. The present invention was completed.

That is, the present invention contains a promoter and a region encoding a signal peptide of a neutral protease gene, and provides a DNA that is partially or completely deleted from the 3' end of the neutral protease encoding region 1t (DNA and uses thereof). .

The DNA containing the region encoding the signal peptide of the neutral protease gene may be any microorganism that produces neutral protease, such as B.
B that produces neutral proteases such as Efaciena
Examples include bacteria of the genus Acillus.

The promoter may be any promoter as long as it functions as a promoter within the Bacillus genus.
Examples include promoters obtained from Gram-positive bacteria such as the genus Ylococcua and the genus Bacillus.

Preferably, promoters obtained from Bacillus genus bacteria are mentioned, and examples of the Bacillus genus bacteria include B.
, aubtilis s Bacillus pumi
Lua.

B, amyloliquefaaiena, etc., and promoters known per se (eg, veg, promoter).

spol promoter, SPO2 promoter) may be used.

Only one promoter may be used, or a plurality of promoters may be connected in series.

The DNA encoding the signal peptide of the above-mentioned prosator and neutral protease genes can be obtained from the chromosomal DNA of the above-mentioned microorganism.

Preparation of chromosomal DNA from bacterial cells is known per se;
For example, the method of Love et al.
inEnZ7molOg)' I fi! LL, 342
(1979)).

DNA containing the neutral protease gene from chromosomal DNA
The host-vector system for cloning the fragment may be any system as long as it is inserted into the vector and the presence of the neutral protease gene on the friend chromosomal DNA fragment can be recognized by HM, and preferably a Bacillus subtilis host-vector system. The system can be mentioned.

DNA containing the neutral protease gene using a vector
When cloning a fragment, for example, the vector is cleaved using a restriction enzyme, and then the vector is cleaved using a DNA ligase.
) HA fragment and use it to perform e.g.
A neutral protease producing strain may be selected by transforming a neutral protease non-producing strain or a low producing strain of S. llus 5ubtilie. When a vector has a drug resistance gene and further has an insertion inactivation site on the gene, sensitivity to the drug can be used as an indicator for selection by inserting a DNA fragment 't- into the site. Specifically, the vector is plasmid pBTMi19. Examples include pUB110.

Extracellular neutral protease producing strains can be selected, for example, as strains that form a halo around colonies on an agar medium containing 1% casein. Examples of neutral protease low producing strains include B, 5ubtilie +
A 274? (The B
acillus Genetic 5tock C
enter:Catalog of 5train
s, 2nd edition (1982)). Transformation methods themselves are well known, such as the protoplast method (S., Chang & N., Cohen:
Mo1. Gen, Genet, l 68
+111 (1979)) and Competent Method CD.

Dubnau & R.D., Abelson,
J, Mo1. Biol.

209 (ill)), etc. can be used. A plasmid is extracted from the cells of the obtained transformed strain, and after cutting it with a restriction enzyme, for example, agarose gel/
DNA containing inserted neutral protease particles can be isolated by electrophoresis. These series of basic operations are well known and are described in the literature (Methods in Encyclopedia
Zymology + 68 (1979) + Mo
1ecular Cloning (1982).

Co1d Spring 1 (arbor La
boratory).

The base sequence of DliA, which includes the neutral protease gene, can be determined using the dideoxynucleotide synthetic chain termination method (Proc).
, Natl, Acad, Sci, , USA
+74+5463 (1977) ), Maxa
m-G11bert method (A, M, Maxam &
W, G11bert: Proc, Natl.

Acad, Sci, USA, 74. 560(
1977)). The location of the neutral protease gene in the DNA was determined and eDiAO
fJ (amino acid sequence translated from the base sequence and the amino acid sequence of known neutral proteases (P, I, Levy
et al: Proc, Natl, Acad,
Sci, USA, γ214341 (197
The decision can be made by comparing 5)). Also, DN
The presence of a neutral protease gene in A can also be confirmed by determining the amino acid sequence of mature neutral protease produced by a host transformed with a plasmid containing the DNA.

The region encoding the signal peptide of neutral protease has the amino acid sequence Met'-Gly-Leu-Gly-]J7R-r,y
s-ILeu-8er-Val-Ala-Val-A
], a-Ala-8er-Phe-Met-8er-L
eu-Thr-Engineering 1e-8er-Leu-Pro-Gl
y-Van-Gln-X [wherein, X is Ala or Al
This is a polynucleotide encoding a peptide represented by a-Alat-]. The polynucleotide may have any codon as long as it needs a peptide having the above amino acid sequence and can function. As long as it retains its function as a signal peptide, even if the amino acids constituting it are inserted or deleted, the polynucleotides encoding those peptides can be used as signal peptides. It may also be used as a coding area.

A DNA that contains a region encoding the signal peptide of the neutral protease gene and is partially or completely missing from the 3' end of the region encoding the neutral protease is a DNA containing the neutral protease gene. It can be obtained by complete or partial digestion with restriction enzymes.

Alternatively, DNA containing the neutral protease gene may be cleaved with a restriction enzyme to subclon a smaller NA fragment containing the neutral protease gene, followed by complete or partial digestion with a restriction enzyme, for example.

Subcloning involves cloning small NA fragments onto a vector, following the same method as cloning the neutral protease gene, and the transformants then divide casein around the colony. It can be confirmed that the intermediate protease gene has been cloned by using the formation of the halo shown as an indicator. The vector used is a Bacillus subtilis vector such as pBTMl19. p
Examples include UB+IO, pPL603, and the like.

Furthermore, the DNA containing the region encoding the signal peptide of the neutral protease gene can be obtained by a method known per se, for example, the triester method (Proc).

Natl, Acad, Sci,, USA, Ll
, 5765 (1978)).

Dl with promoter activity using chromosomal DNAt-
As a vector (promoter cloning vector) used when cloning the iA fragment, for example, a chromosomal DMA fragment of B. mucus fusion is inserted into the restriction enzyme cleavage site, and it is known that a promoter is present in the fragment. Any plasmid can be used as long as it can perform this, for example, a plasmid with a partial deletion of the promoter and the 几 gene. Specifically, plasmid pPL603 (pBTM126)C! −
Bacteriol,, 146, 1162 (1
981)) etc.

A DNA fragment having promoter activity is obtained by preparing a plasmid from a bacterial cell into which a chromosomal DNA fragment has been inserted and transforming it with a friend vector by a method known per se. It can be isolated using methods known per se, such as acrylamide gel electrophoresis and agarose gel/L/'Ft pneumatosis. In addition, isolated D
The base sequence of the NA fragment can be determined using methods known per se, such as the dideoxynucleotide synthetic chain termination method (mentioned above), Ma:ca
It can be determined using the n-Gilbert method [mentioned above].

A DNA fragment having tfc1 promoter activity can be obtained using methods known per se, such as Trieste! It can also be chemically synthesized using a method.

The DNA containing the region encoding the signal peptide of the neutral protease gene obtained above and the DNA fragment having promoter activity are ligated by a method known per se, and by inserting this into a pfusmid, the promoter and the signal of the neutral protease gene are combined. Vectors can be constructed that have regions encoding peptides. Also, the region encoding the signal peptide of the neutral protease gene? A vector having a promoter and a region encoding the signal peptide of the neutral protease gene can also be constructed by inserting one of the containing DH)@ fragment and the DHAIIlf fragment having promoter activity into a vector into which the other has been inserted. When a neutral protease promoter is used as a promoter, the region encoding the signal peptide of bromotate neutral protease may be used for vector construction without being cleaved.

The protein of interest is a promoter necessary for transcription initiation,
A DNA in which a gene encoding the target protein is linked downstream of the liposome binding site (SD sequence) and the region that encodes the signal peptide of the neutral protease gene.
It can be obtained by transforming Bacillus kite with A and culturing the resulting transformed strain.

Above SDf&! Any sequence may be used as long as it functions in Bacillus subtilis, and some of its sequences are already known (T, R, etc.).

McLaughlin et al: 4T, Bio
l, Chem, 256+11283 (1981
), C, P, Moran Ir, et al: M
o1. Gen, Genetics, i8L 339
(1982), l.

Therefore, oligonucleotides containing the Sn2 sequence can be isolated from chromosomal DNA or chemically synthesized by a method known per se, the Trieste ρ method (QU), which encodes the promoter and signal peptide of the neutral protease gene. The desired expression vector can be constructed by inserting the expression vector downstream of the promoter in a vector having a region for the expression.

The position to link the gene encoding the protein of interest is, for example, immediately after the region encoding the signal peptide of the neutral protease gene, immediately before the region encoding the mature neutral protease, or in the middle of the ligation. Examples include locations within the sex grotease gene. In order to obtain the target protein, II encoding the target protein must be used.
It is preferable to link it immediately after the region encoding Signa μ Venya of the NAe intermediate protease gene or immediately before the region encoding mature neutral protease of neutral protease. The region encoding the mature neutral protease starts immediately after the region encoding the signal peptide of the neutral protease (starting at position 917 in the base sequence sequence in Figure 6, and at position 63 in the base sequence sequence in Figure 1). The base sequence in the region immediately before the region leading to the eyes) is linked downstream of the signal peptide T-encoding region and maintains the secretion function.9 If a nucleotide is inserted or deleted, change it to another nucleotide. may be done.

It is preferable that the gene used for expression has an intervening sequence and a known base sequence, and any gene such as a gene isolated from a chromosome, complementary DNA obtained from mRNA, a chemically synthesized gene, a semi-synthetic gene, etc. It may be something. Specifically, hepatitis B virus (HBV,
) surface antigen gene, HB'7 core antigen gene, immunoglobulin ga butsu.

Examples include the human growth homomon gene, interleukin-2 gene, immune interferon gene, etc., and a combination of all or a portion of these genes may be used.

Furthermore, when constructing an expression plasmid by inserting these genes into an expression vector, they may be ligated to an appropriate synthetic oligonucleotide eitz, if necessary.

When transforming Bacillus bacteria with the plasmid obtained in this way, there is no need to particularly limit the host, such as B. eubtilis BGSCIAi.

BGSCIA274 (The Bacillus
GeneticStock Genter: Ca
Talog of 5 trains.

2nd edition (1982)) etc.
Examples include bacteria of the genus Cillus, and among these, low protease producing strains or non-protease producing strains are preferred.

The medium used for culturing the resulting transformed strain is one in which the transformed strain grows and the target protein is extracted outside the bacterial cells. It can be anything as long as it can be produced.

Examples of the return element contained in the medium include glucose, sucrose, glycerin, starch, dextrin, molasses, and organic acids. Nitrogen sources contained in the medium include casein, peptone, meat extract, yeast extract, casamino acid [manufactured by Difco (USA)], N
Z-Amine A [Forganic nitrogen sources such as Kufudo Co., Ltd. (USA), Soy Heen Mi-μ, fallen raw powder, and inorganic nitrogen sources such as ammonium sulfate, ammonium chloride, and ammonium nitrate are used. In addition, inorganic salts such as psium salts, magnesium salts, potassium salts, sodium salts, phosphates, manganese salts, iron salts, and cobalt salts are added to the medium as necessary. Furthermore, when using a strain that exhibits nutritional requirements, nutritional substances necessary for its growth may be added to the medium. Examples of the nutritional substances include amino acids, vitamins, nucleobases, and the like.

Furthermore, if necessary, an antifoaming agent (eg, soybean oil, food oil, etc.) may be added to the medium.

If necessary for culture, antibiotics such as clohumophenic acid may be added to the culture medium.

The culture temperature is usually about 15°C to 42°C1, more preferably about 24°C to 37°C9, and the pH of the medium is
is the initial p-plane; about 5.0 to 9.0, more preferably about 6.5 to 7.5.

The culture time is usually about 3 to 72 hours, more preferably about 5 to 48 hours.

The target protein is obtained by removing the bacterial cells by a method known per se, such as centrifugation, and then obtaining the protein Wg, which is known per se.
It can be purified according to the preparation method.

The present invention further relates to a novel promoter derived from Bacillus.

It is known that in Bacillus/L/7-genus bacteria, different RNA polymerases work and different promoter regions are recognized by these RNA polymerases depending on the growth period of the cells (Nature, 302.800 (1983)). .

That is, RNA polymerase in the trophoblast (e.g.
It is known that the promoter regions recognized by RNA polymerase (Eσ55) and RNA polymerase in sporulating cells (eg, Eσ, Eσ) are different.

The present inventors conducted extensive research into the expression mechanism of the neutral protease gene, and as a result, discovered that the promoter for expressing the neutral protease gene (neutral protease promoter) had excellent properties, and completed the present invention. Next.

That is, in the present invention, the 135 region is TTGCAG.

-10 area is TATTA'l" (Iσ),
-35 area is AGTTTT, -10 area is GAGATT
OCT (Eσ) or -35 region is AA'
rTC.

-10 area is TAG'l'TT? A'l'A(Iσ
) Deriru Promoter is provided.

Promoters are, for example, B, amylolique
It can be obtained from the chromosome of a bacterium of the genus Bacillus that produces neutral proteases such as fac-ens.

Alternatively, it may be chemically synthesized using a method known per se.

The desired protein can be obtained by transforming Bacillus bacteria with DNA in which a gene encoding the desired protein is linked downstream of the promoter of the present invention and culturing the recombinant. For extracellular production of the target protein, a DNA in which a region encoding the signal peptide gold of the neutral protease gene is inserted between the promoter gene may be used.

It is sufficient that a promoter has at least one recognition site for RNA polymerase, but in order to function as a promoter even in different growth periods (e.g., vegetative cells, spore-forming cells), it is necessary to have at least one recognition site for RNA polymerase in the promoter. More preferred are promoters with sites.

(Functions and Effects) When the DNA of the present invention is used, the target protein is produced outside the bacterial cells, so purification of the target protein is easier than extraction from the bacterial cells.

In addition, in the neutral protease gene, there is a restriction enzyme recognition site near the 3' end of the region encoding the signal peptide and near the end of the region encoding the mature protease. DN encoding the protein of interest
Insertion of A and inserted 7'? , DMA can be cut out relatively easily.

Furthermore, if the DNAt of the present invention is used, a shorter culture time is sufficient for producing the target protein.

(Example) The present invention will be explained in more detail with reference to Reference Examples and Examples below, but the present invention should not be limited to these.

Reference Example 1 Construction of Cloning Vector pBTM119 Cloning vector pBTM119 was constructed using the method described in JP-A-59-55897.

1) Preparation of drug-resistant plasmids Entrusted to the Institute for Fermentation Research (IFO) with number 1]i'0-
Chloramphenicol-resistant Staphylocovcanu echtermidis (5ta) deposited as 14208
phylococcus epidermidis
) rs50aO in 1% tryptone (Difco, USA)
.

0.5% yeast extract j0.5% sodium chloride.

80 in a test tube containing 5 sl of L medium consisting of pH 7.2.
The cells were cultured at 18°C for 18 hours. Obtained culture solution 20 y
xl (4 test tubes) was separated by centrifugation, and the bacterial cells were diluted to 10mM.
After washing with EDTA, pH 8-0, 21t I'
BL-1 lytic enzyme solution (IMfi/me, 10
The mixture was suspended in mMEDTA, pH 8, 0)K, and kept at 37°C for ao minutes. 4d of 0.2N sodium hydroxide containing 1% sodium furyl sulfate was added, mixed, and left at 0°C for 5 minutes. Add 6 zl of 3M sodium acetate (pH
4, 8) was added, mixed, left at 0°C for 60 minutes, and then centrifuged. Twice the amount of cold ethanol was added to the supernatant, left at -20°C overnight, and centrifuged. Precipitate 0.4
Dissolved in 0.4% Sarcosil of zl, 2-4m? T of
gsg buffer (aOmM) Lis-HCl buffer pH 8.0,
50mM sodium chloride, 5mM EDTA), 0.8
After adding zl of 5M sodium chloride and 13xt of cold ethanol, the mixture was left at -20°C for one hour and centrifuged. The precipitate was dissolved in 0-4ml of TP2 buffer (10mM).
Dissolved in hydrochloric acid buffer pH 8-0, 1mM EDTA),
Crude pfusmid was prepared by dialysis against the same buffer.

Chloramphenicol resistant S, epidermid
Bacillus 5ubtilis by protopfust removal using isFS50aO crude goufsmid.
IB-1-168 (IFO-14144) was transformed, and a transformant strain resistant to chloramphenicol (growth at 12.5 μg chloramphenicol/ml) was isolated. In this way, this plasmid
It has become clear that this plasmid can be used as a vector for the genus Bacillus since it can be propagated in Bacillus jii and its gene can be expressed in Bacillus jii. Therefore, among the transformed strains, those showing chloramphenicol resistance were selected as B-5ubtiliaT2.
I named it a and selected it.

This B, 5ubtilis T 2 a was added to L medium for 2 hours.
8℃.

The cells were cultured for 16 hours. 500g obtained? The cells collected by centrifuging the culture solution were mixed with 60xt of TES buffer containing 25% sucrose and 12ml of 0.25M EDTA.
A 5M9/chip lysozyme solution with pH 8,0,16M1 and a 0.8yrl 5IQ/ml ribonuclease A solution were added and incubated at 37°C for 30 minutes. Add another 8 wl of 10% 0% sodium lauryl,
It was kept warm at 7°C for 15 minutes. Next, 20xl of 5M sodium chloride was added, and the mixture was left to stand at 0°C for 3 hours, followed by centrifugation. Add 2 volumes of cold ethanol to the supernatant and -20
It was left overnight at ℃. The precipitate obtained by centrifugation was
9 g of cesium chloride and 0-25 ttl of aOW dissolved in TES buffer containing 0.4% Sarkosil
/xi After adding the ethidium bromide solution, it was incubated at 20°C for 3 minutes using a Beckman ultracentrifuge (rotor 50Ti).
Centrifugation was performed at 8,000 rpm for 48 hours. The plasmid band detected by ultraviolet irradiation was taken, a cesium chloride-ethidium bromide solution (specific gravity) = 1.6 was added to it, and the plasmid band was centrifuged again at 38,000 rpm for 48 hours. After removing ethidium bromide by butanol extraction and dialysis with TI buffer, chloramphenicol-resistant plasmid p
BTMlOa was %.

It was found from the absorbance at 260 nm that about 75 μg of plasmid was obtained.

11) Construction of cloning vector 4.5μg +7) pBTMloa with restriction enzyme HpaI
Complete digestion was carried out at 37°C for 60 minutes. On the other hand, 6.75
μg of pUBl 10 (J-8cheer-Abra
mowitz etal, Plasmid, 6.67
(1981)] with the restriction enzyme HpaII at 37°C for 1
I spent time. Both reaction solutions were heat-treated at 66° C. for 15 minutes to stop the reaction, and ethanol precipitation was performed. Both precipitates were each dissolved in 35 μl of water and mixed, and reacted at 11° C. for 81 hours in the presence of 66 nmol of adenosine tasonic acid and 10 units of T4 DNA ligase to perform ethanol precipitation. Dissolve the precipitate in 50 ttl of TE buffer,
B, eubtilia JB-
1-168 was transformed. B. aubilis Ta 9 was selected from among the transformants showing resistance to both kanamycin and furotumphenicol, and the composite plasmid pBTM119 ( 209 μg) t-obtained. The molecular weight of plasmid pB'l''1119 is approximately 3.2
It's 5 megadaltons, and its restriction enzyme cleavage map is! @1
It was as shown in the figure.

Reference example 2 Dermotor cloning vector II-pBTM 12
Construction of 6. Plasmid pBTM126 was constructed using the method of Williams et al. (T-Bacteriol, 146.1162
(1981), 1 as follows. Mrs. Foundation Fermentation Research Institute) Obtained B-pumilus N C
8600 (Eng.FO--12089)YoshiDNAt-
The DNA (6.5 μg) was cleaved by reacting with 40 units of restriction enzyme EaoR at 37'C for 1 hour, and then heated at 68°C for 15 minutes to perform ethanol precipitation.

On the other hand, plasmid pUB110 (2.0 μg) was cleaved by reacting with 20 units of restriction enzyme EcoRI at 37°C for 1 hour, and then heated at 68°C for 15 minutes to perform ethanol precipitation. Dissolve both precipitates in water, mix, and add 6
A reaction solution (100 μl) containing 0 nmole of ATP, 10 units of T4DNjl gauze (manufactured by Takara Shuzo Co., Ltd.) and ligase buffer was incubated at 11° C. for 30 hours to perform ethanol precipitation. B, 5ubtilis M was dissolved in TE buffer (50 μl), and 25 μl was used to
Engineering 114 (Gene, 2 soil, 25℃ M198a),
Transformation of 1 was performed. A cibrasmid was prepared from a chloramphenifol-resistant transformant, and the plasmid was transformed into pB.
It was named TM124. Next, plasmid pBTM 12
4 (2-5 μg) with 14 units of restriction enzyme 2 days tI
and 87℃.

The mixture was reacted for 1 hour, cut, and heated at 68°C for 15 minutes, followed by ethanol precipitation. Dissolve the precipitate in water, 66 nmole LvATP, 10-L=7 T4D
NA! A reaction solution (100 μl) containing J gauze (manufactured by Takara Shuzo) and ligase buffer was kept at 11° C. for 24 hours to perform ethanol precipitation.

The precipitate was dissolved in TE buffer and B-5ubtilis
M engineering 114 was transformed, a plasmid was prepared from the kanamycin-resistant transformant, and the plasmid was transformed into pBT.
It was named M125. This plasmid is Derasumi l'pB
TM124 flotum phenicol acetyl trans 7 efuse (cAT) J gene promoter site (Ps
tI fragment) has fallen off.

Next, plasmid pBTM 125 (2.5 μg) was cleaved by reacting with 18 units of restriction enzyme BamHI and 15 units of restriction enzyme Bgl II at 37°C for 1 hour, heat-treated at 68°C for 15 minutes, and then ethanol. I did the sinking. After dissolving the precipitate in water, 66 nmol
Reaction solution containing AI'P of e, T 4 DNA ligase (manufactured by Takara Shuzo) and ligase buffer (10
0 Itl) at 11° C. for 28 hours, and used to transform E-5ubtilia Ml 114. A plasmid was prepared from the kanamycin-resistant transformant and named pBTM126.

Example 1 Cloning of the neutral protease gene B, amyl
oliquefaciens (I FO-14141
)
mentation, 0saka.

ResearchCommunicationsA
ll (1988)), well-known person 1k (Me
thods in Enzymology, 68,
Chromosomal DNA was prepared according to A42 (1979)). The chromosomal DNA was 8-8 μgt-86 units of restriction enzyme Bgl II and 87°C.

The DNA was reacted for 50 minutes, cut, heat-treated at 65° C. for 15 minutes, and then ethanol was added to precipitate the DNA. On the other hand, the cloning vector pB'r prepared in Reference Example 1
M119 (2.9 μg) was added to 30:L of restriction enzyme B.
JML, 0.5 by reacting with glII at 87°C for 50 minutes.
Add Unit's alkaline 7 male 71 tase and heat to 65°C.
After incubating for 30 minutes, phenol extraction, ether extraction, and ethanol precipitation were performed. Both precipitates were dissolved in water and mixed, and 66 nmole of ATP, 28 units of T4 DNA ligase (Takarashu!i) and ligase buffer were added to the reaction solution (100 μl), which was kept at 11°C for 32 hours. Ethanol precipitation was performed. The precipitate was dissolved in TE buffer and used to incubate B, 5ubtilis IA27.
4 transformations were performed. A CP agar medium (yeast extract 0.2%, 1 ton 1% 1 salt 0.2%, casein 1%, agar 1.5%, p
Bacteriol-.

q, 82 (1974')], and a single plasmid from one strain was transformed into pBTM12.
I named it 7. The tree plasmid is plasmid pBTM11.
B at the Bgl II site of 9, amyloliquef
A BglII fragment (a, 9 Kb) containing the neutral protease gene of ac-1ens (IFO-1414i) was inserted (see Fig. 2, 8).

In addition, B containing the present defusmid pBTM127.

5ubtilis IA 274/pBTMl 2
7 has been deposited with the Fermentation Research Foundation J% as IFO-14+306.

Example 2 Production of neutral protease, amyloliquefaciena (I F
O-14141), B-5u carrying pBTM119
btilis IA 274 (B, aubtilis
lA274/pBTM 119 ] and pBTM
B holding 127, 5ubtilis IA 2
74 (B, 5ubtilie lA274/pBTM
127] with 0.2% yeast extract and 1% peptone.

48 gl consisting of 10-2% NaC and 1% casein
Cultured with shaking at 28°C for 24 hours and 48 hours in a 200xl Erlenmeyer flask containing CP medium (pH 7:3).
In addition, Bacillus amyloliquefa
In cases other than ciens, 5 μg/ml furotumphenicol was added to the medium. The resulting culture solution was centrifuged, and the supernatant was dialyzed against water for 1 day to prepare an enzyme solution. Protease activity was determined by the method of Miyata et al.
Agric, Biol, Chem-, 34, a 10
(1970), :1 at pH 7 and 10, and the results are shown in Table 1.

Table 1 Extracellular protease activity of various bacterial strains As shown in Table 1, B. 5ubtilis lA274/pBT
Ml 27 is R-amyloliquefaciene
(Engineering FO14141) showed more than 10 times higher neutral grotease production ability.

Next, B, Enbtilis IA 274/pBTM
From the supernatant of the culture solution obtained by mass culturing 127, neutral Protea-cera ammonium sulfate fraction, DEAE cellulose cuff chromatography and 5ephadex G-100
Depending on gel filtration! purified to a single product.

2% trichloroacetic acid was added to this specimen, which was dialyzed against water and then freeze-dried to obtain a powder.

The obtained powder was subjected to the Haas method (Methods 1n).
After performing performic acid oxidation according to Enz-11, 197 (1967), this was carried out using a gas phase protein sequencer (Model 470A manufactured by Applied Biosystems).

Automated Edman decomposition method (Iwanag
a et al-: Eur, J., Biochem.
, 8.

189 (1969)':I was applied to analyze the N-terminal amino acid sequence. Phenylthiohydantoin amino acid was identified and quantified by high performance liquid chromatography using Microvac 5P-ODS Cafum (manufactured by Parian, USA). The resulting N-terminal amino acid sequence (residues 1 to 13) is shown in the formula below.

The above sequence is P, L. Levy et al. (Proc-Natl
-Acad-8ci-USA, 72.4841 (19
Bacillus 5u reported by 75))
The amino acid sequence completely matched the amino acid sequence of the neutral protease of S. bti1is.

From the above results, it was revealed that the gene cloned in Example 1 was a neutral protease.

Example 3 Subcloning of neutral protease gene Plasmid pBTM127 (80 μg) obtained in Example 1 was cleaved by reacting with restriction enzyme BgllI (200 units) at 87°C for 1 hour, and then subjected to 0.7% agarose gel electrophoresis. , the gel of the lower molecular weight band was removed). The DNA in this gel was extracted using electrophoretic elution method (Gene Manipulation Manicoal, edited by Yasutaka Takagi, Kodan Pillar Scientific Co., Ltd.)
(1982), approximately 10 ftg of BgllI was recovered.
A fragment (a, 9Kb) was obtained.

The obtained BglII fragment (3 μg) was added to Restriction Enzyme Co. m1M.
(6 units) at 37°C for 1 hour.
l II - Hlnd m , about 0.8 Kb), fragment B (Hind II - Hlnd 1 [, about 1. I Kb)
and C fragment (Hind ffl-Bgl I [, approximately 1°9 Kb), and ethanol precipitation was performed. On the other hand, Grasmid pBTM126 (1 μg) was reacted and cleaved with restriction enzyme H1nd N (5 units) at 37° C. for 1 hour, followed by ethanol precipitation. Both precipitates were dissolved in water, and 100 nmole of ATP,
8.4 units of T4DNA! The reaction solution (100μ!) containing j gauze (manufactured by Zenshuzo) and ligase buffer was kept at 11°C for 24 hours, and B.
Transformation of IA274 was performed. Kanamycin resistance.

As a result of preparing plasmids from chloramphenicol-sensitive transformants, two types of plasmids were obtained, and they were called pBTM508 (6-2 Kb) and pBTM5, respectively.
15 (7°7Kb). Grasmid pBTM5
15 is a fragment in which the A fragment and the C fragment were inserted in the Hindi site of plasmid pBTM126 in opposite directions,
Plasmid pBTM508 is Grasmid pB'l'M1
The B fragment was inserted into the HindllI site of 26 (see Figure 8). When the halo-forming ability of these grasmid-retaining strains was examined on CP medium plates, the pBTM515-retaining strain showed halo-retaining acid ability;
The BTM508 retaining strain did not exhibit halo retaining acid ability.

Next, Grasmid pBTM127 (1 μg) was added to EaoR (3 units)). pUB110 (1 μg) was incubated at 87°C with EaoRX (a unit) and Bam, H (5 units).

After reacting for 1 hour and cutting, it was incubated at 65°C for 10
The reaction was stopped by heating for a minute, and ethanol precipitation was performed in each case. Both precipitates were dissolved in water, mixed, and 100%
A reaction solution (100 μg) containing nmole of ATP, 8-4 units of T4 DNA ligase (manufactured by Zenshuzo), and ligase buffer was incubated at 11°C for 24 hours, and used to transform B-5ubtilis IA274. . Select a halo-forming strain from among the kanamycin-resistant transformants and transform the plasmid into pB'L'M 52 B
It was named. This pfusmid is a plasmid pUB110.
Plasmid pBTM in the EcoRI-BamHI site of
127'Eco R1-BglII fragment was inserted (see Figure 4). fx o? Knee OE
The coRI-BgllI fragment is the BglI fragment of pBTM127.
[It consists of one of the B fragments and the C fragment.

From the above results, the neutral protease gene is identified by C fragment (1
, 9Kb).

pBTM515 (100 μg) was digested with the restriction enzyme Bgl I [
(200 units) and Hindl [(200 units) were reacted at 37°C for 1 hour, then subjected to 1% agarose gel electrophoresis.
When A was recovered by electrophoretic elution method (Gene Manipulation Manual, edited by Yasushi Takagi, Kodansha), about 10 μg of C fragment was obtained.

FIG. 5 shows a restriction enzyme cleavage map of the C fragment.

Note that B holds plasmid pBTM515.

5ubtilis lA274 (Bacillus
5ubtilie lA274/pBTM515) has been deposited with the Fermentation Research Institute as IB'0-14377, and was also transferred to the Microbial Technology Research Institute, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (E'R Engineering) based on the Butabest Treaty.
'ERMBP-622.

Example 4 A part of the base sequence of the C fragment obtained in Example a was subjected to dideoxynucleotide synthetic chain termination method and Maxam-Gil
Determined using 'bort &. BglII of C fragment
The base sequence and translated amino acid sequence from the site side are shown in FIG. This sequence contains Eσ5 as a promoter.
-35 areas recognized by 5 (TTGCAG)
and -10 region ('I'ATTA'l').

-35 region recognized by Eσ37 (AGTTT
T ) and −10 region (GAGATTGCT) and Eσ
185 areas expected to be recognized by 32 (AA
TTC) and -10 region (TAGT'l'TTATA) are found.

In addition, the BglII-8au a Al fragment (5aOb
The fact that p) (4:tS5 figure #see) has promoter activity means that the promoter cloning vector pFTB2
This could be confirmed by using 8H Koumura et al., Japanese Agricultural Chemistry Society 1981 Conference Abstracts, p. 28), so it is expected that the above promoter is functioning. Furthermore, an SD region and an open frame are present downstream of the promoter, and the 1st methionine to 27th or 28th alanine seems to be the signal peptide of the neutral protease. The amino acid sequence after the 222nd alanine is a neutral protease (
P-L-Levy et al., Proc-Natl, Aca
d-8cla, 72°4341 (1975)), but it is completely identical to the N-terminal amino acid sequence of the neutral protease shown in Example 8. As a result,
It was predicted that approximately 200 peptides of unknown function existed between the sequence believed to be a signal peptide and the mature protein.

Next, the nucleotide sequence and translated nine amino acid sequence of the C fragment from Hlnd ffi CyHF1lj are shown in Figure @7. The tree amino acid sequence completely matched the C-terminal amino acid sequence of neutral protease shown in the above-mentioned literature.

Example 5 Bglm-old, ndN fragment (1,9
10 μg of Kb) was treated with restriction enzyme Ace (50-t)
It was reacted with 37° C. for 1 hour and cut. Add this reaction solution to 1
．． 2% agarose gel electrophoresis, 1.7 Kb H
The band of lndu-Ace fragment was cut out, separated, electrophoresed and eluted, and then extracted with phenol.

Ether extraction and ethanol precipitation were performed and 8 μg of H
lndl[-AccI fragment was obtained. The base sequence of this fragment was determined using the Maxam-Gilbert method (Proc-Natl).
-Acad.

5ci-, 74, 560 (1977)), it was revealed that a region encoding approximately 80 amino acids from the C-terminus of the structural gene for neutral protease was deleted.

Example 6 The restriction enzyme cleavage site GCAT of sph I is located near the DNA encoding the amino terminus of the mature protein of neutral protease.
GC exists (see Figure 6).

Therefore, Grasmid pTEX101, in which a neutral protease gene lacking this mature protein coding region was inserted into Grasmid pUB110, was constructed using the following method.

BglI [-8
The phI fragment (0.9 Kb) and the BamHI-8phI fragment (4, aKb) isolated from pUBllo were added to T4DN.
A is ligated by the action of ligase, and B.

Transformation of S. 5ubtilis lA274 was performed. Grasmids were prepared from kanamycin-resistant transformants,
It was named p'rExtot (see Figure 8).

Example 7 Human immune interferon-secreting pfusmid pBTM15
Construction of C1a-P containing the human immune interferon gene that was isolated from the deonamide pH engineering Ttrp2101 (see European Patent Application Publication No. 0103898).
stI fragment (1.0aKb) with restriction enzyme B st k
The gel was cut with T (New England BioLabs) and subjected to agarose gel electrophoresis.
A 900 bp BetNI fragment was isolated by electrophoretic elution. This BatN engineering fragment (2μf) was combined with oligonucleotide CCTG'f'TACTGCC (266nf) synthesized by triester loss (described above) and then phosphorylated.
) and TGGCAGTAACAGGCATG (a
77nf) and an additional 100 nmole of ATP.
, ligase buffer and 2000 units of T4 DNA
Ligase (New England BioLabs
) was added to the reaction solution (50 μl), which was then kept warm at 11° C. for 24 hours to perform ethanol precipitation. Dissolve the precipitate in water and add 50
Unit's restriction enzyme SphI (New England
BioLabs) at 7°C for 16 hours, then 5e
Excess oligonucleotides obtained by gel filtration with Pharose 4B (1-5xtl) were removed, and ethanol precipitation was performed.

On the other hand, pTEXl 01 (0,6fi
After cleaving t) with 5phI of 2 and 2) at 37°C for 1 hour, 0.06 unit of E. coli alkaline phosphatase was added, and the mixture was incubated at 87°C for 30 minutes to perform ethanol precipitation.

After dissolving both of the above precipitates in water, they were mixed, and 100%
nmole ATP, ligase buffer and 400 nmoles
Unit T4 DNA ligase (NewEngland)
BioLabe) was added to the reaction solution (50 μl).
Incubate at 1°C for 24 hours, B, 5ubtilis I
A274-derived B, eubtilis MH4
01 (met-, his-, npr-) was transformed. Plasmids were prepared from the kanamycin-resistant recombinant, and the grasmid in which the human immune interferon gene was inserted in the same direction as the neutral protease promoter was named pBTM150, and the grasmid in which the human immune interferon gene was inserted in the opposite direction was named pB'I'M151 (No. (See Figure 9).

B. eubtilis MH401 has been deposited as FO-14374 at the Foundation Fermentation Research Institute, and FERMBP-62 has been deposited with the Microbial Technology Research FFR (FRr), Agency of Industrial Science and Technology, Ministry of International Trade and Industry based on the Budapest Treaty.
It has been deposited as No. 1.

Example 8 Secretory expression of human immune interferon gene Grasmid pTEX101. pBTM150 and pBTM151
B, retaining Eubtilis M H401 in peptone (Dirco) 1%, yeast extract 0.5%.

HaCl, 6%) was inoculated into a test tube containing 5 ml of L medium, incubated at 28°C for 16 hours with shaking, and the culture solution was
．． 5 ytl was added to grain heart infusion medium (Di) containing 1% casein and 5 μ'l/yst kanamain.
rco) was transferred to a 200 g/capacity Erlenmeyer flask containing 40 ml, and cultured at 37°C for 8 o'clock. Culture solution (10
μl) was centrifuged to obtain a supernatant. On the other hand, the bacterial cells were washed three times with IMKCI and frozen with dry ice-ethanol. Add 0-9xl of a OmMTri to frozen bacterial cells.
s-HCI (pH 8,0)-50mM NaCl-5mM
EDTA O-1mM phenylmethylnulfonyl 77ide and 0.1g/10 let/d lysozyme solution were added and suspended, kept at 37°C for 20 minutes, and then further sonicated with ultrasonic a (Kaiyo Denki) for 19 minutes. -5KHz,
Processed for 10 seconds. This treatment solution was heated at 9000 rpm for 2
The mixture was centrifuged for 0 minutes, and the resulting mixture was used as a bacterial cell extract.

Human immune interferon activity in the culture supernatant and bacterial cell extract obtained above was measured using F L 5indbis system (F
Antiviral activity against the virus 5indbi8 polarized to L cells was measured [Akiko Konagae et al.

Protein nucleic acid enzyme, 25. a55 (1981)).

At this time, as a control, an international standard product of human immune interferon (Gf2 a-901-5aO: 4000
IU/g/) was used.

In the strain carrying plasmid pB'I'M 15G, it was observed that 105 U/l of human immune interferon was produced in the medium, but no human immune interferon activity was detected in the bacterial cell extract. Ta. In addition, for bacteria carrying plasmid pTIX101 in which the human immune interferon gene has not been integrated and plasmid pBTM151 in which the human immune interferon gene has been inserted in the opposite direction to the neutral protease promoter, both the culture supernatant and the bacterial cell extract K contain human immune interferon. No activity was observed. From the above results, pBTM1
It was revealed that the human immune interferon gene was secreted and expressed in 50.

Example 9 Benicillinase secretion plasmid plasmid pB
BglI [−
8au8AI fragment (approximately 5aObp) is pl'TB28
Plasmid pT inserted into the BamH engineering site of 1
RIO (see Figure 14) was cut with EcoRI and about 5
a The EcoRI fragment of Obp was isolated 14i. This fragment was cut with the restriction enzyme HaeI to create an EcoRI-HaellI fragment (approximately a 40 bp
) was converted into AAA. This fragment has an Xho linker (CCTC
GAGG) were ligated using T4 DNA ligase.

On the other hand, plasmid pMB9 (F, Bolivar
Plasmid pEN 1 (Bacillus llcheniformie benicillinase gene) was incorporated into Bacillus llcheniformie gene 2, 75 (1977)).
(Obtained from Professor Yasuto Oshio, Osaka University) (See Figure 'g610) F) Sac knee Pst engineering fragment (8.5Kb)
I did it. This fragment contains the latter half of the signal peptide of benicillinase and the region encoding the mature protein, and the Pst I site corresponds to the vicinity of the middle of the region encoding the signal peptide. Therefore, the above 5acI-Ps
The tI fragment was digested with 5 units of nuclease BALalCBe.
thesda Re5earch Laborator
ies) for 15 seconds at room temperature, and then treated with XhoI linker (CCTCGAGG) (New Engl.
and BioLabs) and T4DNA! J
Connect with gauze and Escherichia col+
:JA 221 (obtained from Professor Taiji Osaka University) was transformed. The size of the Bglll-Xho fragment in the plasmid of the recombinant that showed tetracycline resistance was measured by polyacrylamide gel electrophoresis, and several clones in which most of the region encoding the signal peptide seemed to have been deleted were identified. Obtained. The nucleotide sequences of these clones were determined by the digoxynucleotide synthetic chain termination method. One of the clones, plasmid pEN
X374 (8, aKb) has Ser-Arg-A at the 5″ end of the DNA encoding the mature protein of heninlyse.
It became clear that the nucleotide encoding la wo was bound (see Figures 10.11 and 12). Next, pUllo was cut with restriction enzymes 5phI and EcoRI, and subjected to agarose-sedge A/electrophoresis and electrophoretic elution. A large 5phI-EcoR fragment (3°5
Kb) was isolated (see Figure 14).

EcoRI containing the region encoding the promoter and signal peptide of the neutral grotease gene obtained above
-XhoI fragment (a40bp, 0-5 μl.

XhoI-8phI fragment of pEHXa74 (1,9
Kb.

B, 5ubtilis lA2
Among the obtained kanamycin-resistant recombinants, one of the plasmids containing all the fragments was named pTEX201 (5-7Kb) (gI
(See figure J14).

Example 10 Secretory expression of benicillinase gene B-5ubtilis lA274 carrying Grasmid pUB 110 and pTIX201 was cultured in L medium containing 1% casein at 87°C for 24 hours under shaking, and the benicillinase activity in the culture was measured by the micro-iodine method. [Kenji Okonogi et al., Chemotherapy 25, 94 (1
977)]. The Grasmid pTEX201 strain produced benicillinase in the culture supernatant at 2.1'x10' units/l culture solution, whereas the p17B 110 strain, which does not contain the benicillinase gene, produced almost no penicillinase. From the above results, it was revealed that benicillinase was secreted and produced outside the bacterial cells in the strain carrying the plasmid p'l'EX201.

Note that B holds plasmid pTEX201.

aubtilis lA274 (Bacillus 5
ubtilis lA274/pTE)C201) was deposited with the Foundation I Human Fermentation Research Institute as IFO-14a75, and was also deposited with the Ministry of International Trade and Industry, Agency of Industrial Science and Technology, Microbial Technology Research Flr (FRI) under the Budapest Treaty.
It has been deposited as No. 619.

Example 11 Construction of veninlinase secretion plasmid p'I'EX202 5! Sac knee pst of pEMl was prepared in a similar manner to Example 9.
After treating the I fragment with 13ALal, the XhoI linker
were ligated to obtain grasmid pEMX 60 e.

In conograsmid pEH1606, pEHXa 74
Compared to the case of , 40 more nucleotides were deleted from the 5'' m part of the region encoding the mature protein of benicillinase (see Figures 11 and 18).

The XhoI-Bphl fragment (1, LKb) containing the region encoding the mature protein of sibenicillinase was isolated from Grasmid pEN1606, and this 2 μf was added to 100 μF of Sl nuclease (Betheeda Reaearc).
h Laboratories) at 16°C for 11 hours, and 'I'4DNA! 8phI linker with J gauze
(GGCATGCC) was connected. The obtained sph
I fragment (4,9 Kb) was inserted into the 5ph1 site of pTEXl01 and inserted into the benicillinase secretion vector p'rgx2.
02 (see Figure 15).

Example 12 B-5ubti carrying secretion expression plasmid pTEX202 of benicillinase gene
lisI A 274 (Bacillus 5ubt
itis lA274/p'! 'EX202) 1%
The cells were cultured in a shaking jar at 28° C. for 16 hours in L medium containing casein. The obtained culture solution was centrifuged, and the benicillinase activity of the supernatant was measured using the microiodine method (described above).
An activity of 5.0 x 103 units/l culture solution was observed.

In addition, Bacillus aubtilis IA
274/p'l'KX202 is I
It has been deposited as FERM BP-620 with the Microbial Research Institute (FRI), Agency of Industrial Science and Technology, Ministry of International Trade and Industry under the Butapest Treaty.

[Brief explanation of drawings]

Figure 1 shows the restriction enzyme cleavage map of Grasmid pBTM119, and Figure ¥J2 shows the restriction enzyme cleavage map of Grasmid pBTM12γ. Figure 8 shows 1 fusmid pB'l'M5 Q 8 and pB
The construction diagram of 'I'M515 is shown, and Figure 4 shows the plasmid p
A construction diagram of BTM52a is shown. Figure 85 shows B, amyloliquefaciene (
2 shows a restriction enzyme map of a DNA fragment (C fragment obtained in Example 3) containing the neutral grotease gene obtained from IFO-14141). Bg is BgIII, T is TaqI I 8a is 5acI
I, Ha is Haell[, 5tiSau a A Eng, A
is AceI, Be is BclI, and ■ is Hlnd I[
shows. Figure 6 is B, amyloliquefaciena
The 5-side nucleotide sequence of the I) NA fragment (C fragment obtained in Example 3) containing the neutral grotease gene obtained from (IFO-14141) and the amino acid sequence translated from this sequence are shown. Figure 7 shows the 8'-side nucleotide sequence and the amino acid sequence translated from the sequence, and TAA indicates a stop codon. Figure 8 shows the construction diagram of Grasmid pTEX101, n
prA represents the neutral protease gene, and nprA'' represents the neutral protease gene lacking the mature protein coding region. Figure 9 shows the construction diagram of plasmid pBTM150.
trp-p is the trigt 7 anglo soter, XFH-
1 represents the human immune interferon gene. No. 10 [1] shows the schematic diagram of plasmid pEliXa 74. @Figure 11 shows the 5-terminal partial nucleotide sequence and N-terminal partial amino acid sequence of the beninlinase gene, and Figure 12 shows the nucleotide sequence near the 51-terminus of the benicirinase gene contained in plasmid pEHXa 74 and the amino acid encoded by it. The sequence is shown and Figure 18 shows the plasmid pENX6.
Figure 14 shows the nucleotide sequence near the 5'' end of the beninlinase gene contained in 06 and the amino acid sequence encoded by it. Figure 14 shows the construction of plasmid pTEX201,
Figure 5 shows the construction diagram of plasmid pTEX202.
ACCGAT GAT CTC80Leu Ile
Asp Gln Thr Thr Thr Asp Asp L
eu545 GTCGTA MCGGT GTG
CCT GTG AAA GAC98Val Vat
Asn Gly Val Pro Val Lys A
sp599 TCCAACMCGTCTAT GC
G An MCGGT116 Ser Asn As
n Val Tyr Ala Ile Asn Gly
653 ACG GCA MCAGCAAA AA
A TrA TCT GCA134 Thr Ala
Asn Ser Lys Lys Leu Ser
Ala707 GCG ATCGGCAAA TCA
CCT GAA GCCGTr152 Ala F
le Gly Lys Ser Pro Glu Al
a Va1761 MA GCCGAG CTG A
AA GCA GCA GCCACA170 Lys
Ala Glu Leu Lys Ala Ala
Ala Thr815 GAT GTA ACCAT
CCGCTACATCGM CCG188 Asp
Val Thr Ile Arg Tyr Ile G
lu Pr. (Part 2) GGCTACAAG CACTrCCGT TAT G
TG CCTGly Tyr Lys His Phe
Arg Tyr Val Pr. GAA TrA AACAACGAT GTr TCC
GCCAAAGlu Leu Asn Asn Asp
Val Ser Ala LysN■CAG GCG
CTG GAT CAT GCT TAT AAAA
sn Gln Ala Lel, rAsp His A
la Tyr LysTCT AACGGA ACCG
TT GCA MCAAAA AACSer Asn
Gly Thr Val Ala Asn
Lys AsnAAA GACGGCAAA TA
CCGCCTCGCCTATLys Asp Gly
Lys Tyr Arg Leu Ala TyrGA
A CCT GCA MCTGG GAA GTA A
CCG-Glu Pro Ala Asn Trp
Glu Val Thr ValFigure 6 859 GAT GCG GAA ACA GGA
AAA ATCCTG AAA206 Asp Al
a Glu Thr Gly Lys Ile Leu
Lys923 ACA ACCGGA ACA G
GT ACG ACT CTT AM224 Thr
Thr Gly Thr Thr Gly Thr Thr
Leu Lys977 TCT GM AGCGGC
MA TAT GTG CTG CGC242Ser
Glu Ser Gly Lys Tyr Val L
eu Arg (Part 3) GAT C sp ATATTCAAACGGAGGGAGACGATTT
TG ATGMet 5tl AAG GCT GCA GCA GTG TTG C
TT TTCLys Ala Ala Ala Val
Leu Leu PheAAT CM ACG AA
T GCCTCG CAA CCTAsn Gln T
hr Asn Ala Ser Gln Pr. xo-L TCG AGG GCCTCG CAA CCTSer
Arg Ala Ser Gln Pr. Figure 11 Lys Leu Trp Phe Ser Thr L
eu Lys Leu Lys Figure 12 Figure 13 Procedure Amendment (Voluntary) July 1, 1980

Claims (1)

[Scope of Claims] 1) A DNA containing a promoter and a region encoding a signal peptide of a neutral protease gene, and partially or completely lacking the region encoding a neutral protease from its 3' end. 2) The DNA according to claim 1, wherein the signal peptide contains a peptide represented by the amino acid sequence [there is an amino acid sequence]. 3) D4) -35 region of the promoter is TTGCAG and -10 region is TAT according to claim 1 or 2, wherein the promoter is a neutral protease promoter.
The DNA according to any one of claims 1 to 3, which is a polynucleotide that is TAT. 5) The -35 region of the promoter is AGTTTT, -10
The DNA according to any one of claims 1 to 3, which is a polynucleotide whose region is GAGATTGCT. 6) The DN according to claims 1 to 3, which is a polynucleotide in which the -35 region of the promoter is AATTC and the -10 region is TAGTTTTATA.7) The polynucleotide according to claims 4, 5 and 6 is The DNA according to any one of claims 1 to 6, which coexists in a polynucleotide chain of 100 bases or less. 8) The 5' side of the polynucleotide chain within 100 bases is A.
DN according to claim 7, which contains a polynucleotide starting with ATTC and 3' ending with TATTAT
A. 9) The polynucleotide chain is AATTCAGCCGCGGAGTCTAGTTTTTA
TATTGCAGAATGCGAGATTGCTGGT
The DNA according to claim 8, which contains a polynucleotide that is TTATTAT. 10) From upstream, sequentially (1) promoter, (2) DNA encoding the signal peptide of neutral protease,
The DNA according to claim 1, which contains (3) a DNA partially or completely lacking the region encoding neutral protease from the 3' end, and (4) a DNA encoding a protein other than neutral protease. 11) A Bacillus bacterium containing a DNA that contains a promoter and a region encoding the signal peptide of a neutral protease gene, and partially or completely lacks the region encoding a neutral protease from the 3' end. 12) From upstream, sequentially (1) promoter, (2) DNA encoding the signal peptide of neutral protease,
(3) DNA lacking part or all of the region encoding neutral protease from the 3'end; and (4) DNA containing DNA encoding a protein other than neutral protease.
A method for producing the protein, which comprises culturing a Bacillus bacterium that retains A.