JPH02100685A - Polypeptide secretion expression vector, microorganism transformed with same vector and production of polypeptide by same microorganism - Google Patents

Abstract

PURPOSE:To obtain a desired polypeptide in high productivity and easy separation and purification by producing a desired polypeptide having relatively low molecular weight as a fused protein with a specific penicilase in subjecting the desired peptide to in vitro secretion production using Escherichia coli. CONSTITUTION:DNA coding a desired polypeptide having relatively low molecular weight is coupled to DNA coding penicillinase derived from an alkalophilic Bacillus through DNA coding amino acid sequence specifically recognized by proteinasae having high specificity such as urokinase or DNA coding amino acid sequence specifically recognized by chemical substance such as cyanogen bromide. A microorganism is transformed by a vector in which the resultant coupled DNA is integrated and a fused protein is produced by the transformed microorganism. The resultant fused protein is separated by urokinase or cyanogen bromide to provide the desired polypeptide.

Description

DETAILED DESCRIPTION OF THE INVENTION [Field of Industrial Application] The present invention relates to a vector for exocrine expression of a polypeptide, a microorganism transformed with the vector, and the production of a polypeptide using the microorganism.

[Conventional technology] Methods have already been established for producing various relatively high-molecular polypeptides, including interferon and growth hormone, using host cells such as Escherichia coli, Bacillus subtilis, and yeast, using genetic engineering technology. has been done. In addition, in order to produce relatively low-molecular-weight polypeptides such as α-neoendorphin and somatostatin, the hybrid protein method [Publication of Patent Publication No. 1988-92696] is used, in which the target polypeptide is mixed with E. coli protein ( This has become possible by using a production method (same as fusion protein).

However, compared to the production of high-molecular-weight polypeptides, genetic engineering production techniques for low-molecular-weight polypeptides have a limited number of methods, despite the variety of useful substances they contain. There is. That is,
Conventionally, genes corresponding to useful polypeptides such as α-neoendorphin and somatostatin were inserted near the C-terminus of genes encoding proteins such as β-lactamase, alkaline phosphatase, and β-galactosidase, which exist on E. coli plasmids. The main method used is to transform and grow E. coli, obtain a fusion protein containing these useful polypeptides from the E. coli, and then separate and recover the desired polypeptide.

In this case, the production of proteins such as β-lactamase, alkaline phosphatase, and β-galactosidase, and the characteristics of their products, each have their advantages and disadvantages.
It has not always been possible to efficiently obtain these useful polypeptides in high yields from E. coli transformed with plasmids containing these genes.

For example, when a gene encoding a useful polypeptide is inserted near the β-lactamase gene, the amount of protein produced is generally small. Furthermore, when incorporated near alkaline phosphatase, the enzyme is induced only in low phosphate medium, resulting in poor bacterial growth and a low yield of the target polypeptide per unit culture volume. On the other hand, when it is integrated near the β-galactosidase gene, the yield per unit culture volume is high because the fusion protein is induced in a rich medium by lactose, isopropyl-β-D-thiogalactopyranoside, etc. However, since there are as many as 23 methionine residues in the β-galactosidase in the resulting fusion protein, the number of peptide segments becomes extremely large when cleaved with cyanogen bromide, making purification difficult. In either case, the produced fusion protein is localized in the bacterial intracellular compartment (both periplasm and cytoplasm), and depending on the type of target polypeptide, it may form an inactive inclusion body within the bacterial cell, or In addition, it may be degraded by host bacterial protease and lose its activity.Furthermore, when purifying the fusion protein, it is necessary to remove a large amount of E. coli cell components that are mixed in during bacterial cell destruction, making the purification step complicated and reducing the yield. was often extremely low.

However, if the target polypeptide is produced outside E. coli as a fusion protein with an exocrine protein, such as penicillinase derived from alkalophilic Bacillus Nα170 strain, and the target polypeptide is subsequently easily isolated, Moreover, since there are only two methionine residues in penicillinase, it is easy to separate it from the target polypeptide.
It seems that the above problems can be solved.

[Problem to be solved by the invention]

Therefore, an object of the present invention is to provide a method by which relatively low-molecular useful polypeptides can be obtained more easily. Another object of the present invention is to provide a new vector for carrying out the method and a microorganism carrying the vector.

The present inventors improved the DNA sequence corresponding to the C-terminal amino acid sequence of the alkalophilic Bacillus Nα170 strain penicillinase, inserted a restriction enzyme recognition site, and constructed a new vector for exocrine secretion expression. Then, a synthetic NA containing the genetic information of the insulin B chain is inserted into the vector, and after introducing this into E. coli, the penicillinase fusion protein is purified from the culture filtrate, and then the insulin B chain is purified by enzyme treatment or chemical treatment. The present invention has been completed by successfully obtaining it industrially.

[Means to solve the problem]

The present invention provides a penicillinase-encoding DNA base sequence that directly connects a penicillinase-encoding DNA base sequence with a target polypeptide-encoding DNA base sequence to secrete and express the target polypeptide outside the bacterial cell as a penicillinase fusion protein. The present invention relates to a polypeptide secretion expression vector characterized by containing a base sequence.

Furthermore, the present invention relates to a vector characterized by containing a DNA base sequence encoding a fusion polypeptide obtained by directly linking a DNA base sequence encoding penicillinase and a DNA base sequence encoding a target polypeptide.

Furthermore, the present invention relates to a microorganism transformed with a vector containing a DNA base sequence encoding a fusion polypeptide in which a DNA base sequence encoding penicillinase and a DNA base sequence encoding a target polypeptide are directly linked.

Furthermore, the present invention involves culturing a microorganism transformed with a vector containing a DNA base sequence encoding a fusion polypeptide in which a DNA base sequence encoding penicillinase and a DNA base sequence encoding a target polypeptide are directly linked. The present invention relates to a method for producing a polypeptide, which comprises collecting a fusion protein secreted outside the bacterial body.

The present invention will be explained in detail below.

The DNA carrying the genetic information for penicillinase is isolated and purified from the alkalophilic Bacillus Nα170 strain.

As previously reported, the penicillinase gene was cloned into E. coli as a 4.5 kb EcoRI fragment or a 2.4 kbl+ind I fragment using vector pMB9. The obtained recombinant plasmids were named pEAPl and pEAP2, respectively, and it was discovered that penicillinase expressed in Escherichia coli containing these plasmids was produced outside the cells (J
, Bactertol, 156, 949-951 (
1983); Eur, J., Microbiol, Bio.
technol, 18, 339-343 (1983
)) - When producing useful proteins using genetic recombination technology, the most important thing is to secrete the product outside the bacterial body. This is thought to be due to the need to increase production and the need to secrete foreign gene products in order to produce them as molecules with biological functions. Generally, there are not so many types of secreted proteins, and therefore the purification process is simple and is thought to lead to significant cost reductions from an industrial perspective. However, Escherichia coli, which is most commonly used for genetic recombination, does not secrete any products outside the cell. Durham-negative bacteria such as Escherichia coli have a different surface structure compared to Gram-positive bacteria such as Bacillus subtilis, which are known to secrete products well outside the bacterial body. In other words, in Bacillus subtilis, etc., the surface layer of the cell has a two-layered structure consisting of a cytoplasmic membrane and a peptidoglycan layer, whereas in E. coli, etc., there is an outer membrane on the outside of these two layers, and a three-layered structure. . As a result, in E. coli, even if the product is a secretory protein, it is blocked by the outer membrane, accumulates in the gap between the cytoplasmic membrane and the outer membrane (periplasmic space), and is not secreted outside the cell. The development of the penicillinase exocrine system in Escherichia coli discovered by the present inventors has solved the above problems and demonstrated the possibility of using Escherichia coli as a host for extracellular production of useful proteins. It is.

The present inventors have taken advantage of the above-mentioned properties of penicillinase, and when using the penicillinase to produce a target foreign protein as a fusion polypeptide with penicillinase in Escherichia coli, the foreign protein is transformed into a penicillinase fusion protein. We conducted extensive research based on the idea that the target polypeptide could be secreted and produced outside the body, and then the target polypeptide could be easily obtained through enzymatic or chemical treatment. As a result, we succeeded in constructing a new vector (plasmid) that can actually secrete a polypeptide of interest as a penicillinase-fused polypeptide outside the bacterial cell by introducing it into E. coli, and a polypeptide secretion expression vector for this vector. The target polypeptide was successfully produced using this vector.

The polypeptide secretion expression vector of the present invention has a DNA base sequence encoding benicillinase designed to be able to directly link a DNA base sequence encoding a target polypeptide. Therefore, in this vector, a DNA base sequence encoding a target polypeptide can be directly linked to the DNA base sequence encoding penicillinase, and the expression vector thus obtained can be introduced into E. coli and transformed. By culturing the E. coli, the target polypeptide can be secreted and produced as a penicillinase-fused polypeptide outside the bacterial cell.

The technology for producing the vector of the present invention will be described in detail below.

The DNA base sequence encoding penicillinase, which is an essential component of the vector of the present invention, is derived from alkalophilic Bacillus N.
It can be used derived from α170 strain. The penicillinase has an amino acid sequence shown in the following formula (1).

uLeuG l yTh rThrG l nPheV
a lserThr I leserserVa I
G 1 nA1aSerG 1nLys Va IG
luG In I 1eVa I I 1eLysA
snG l uThrG lyThrI1eSerI
IeSerG1nLeuAsnLysAsnVaITr
pValHisThrG1uLeuG1yTyrPhe
AsnG1yGluA1aValProSerAsnG
1yLeuVa ILeuAsn Th rSerLy
sG 1 yLeuVa l LeuVa IA s
pSerSerTrpA spAsnLysLeuTh
rLysG 1 uLeu I 1eG l uMe
tVa IG 1uLys Lys PheG In
Lys ArgVa IThrAspVa I I l
e I 1eThrH isA la HisA 1a
As pArg I 1eG I yG ly I 1
eThrA laLeuLysG 1uArgG ly
I1eLys A laH isserThrA 1
aLeuThrA IaG 1uLeuA 1aLys
LysSerGlyTyrG1uG1uProLeuG
1yAspLeuG1nThrVa lThrAsnL
euLysPheGlyAsnThrLysVaIG1
uThrPheTyrProGIyLysG IyH
isTh rG 1uAs pAsn I 1 eVa
I Va ITrpLeuProG lnTyrGI
nI IeLeuA1aGIyG1yCysLeuVa
lLysserA1aG1uA1aLysAsnLeu
GlyAsnVaIA1aAspA IaTyrVa
IAsnGluTrpSerThrSer I 1eG
1 uAs nMe tLeuLys ArgTyr
ArgAsn I IeAsn LeuVa IVa
IProG 1yH isG lyLysVa IG
lyAs pLysG 1yLeuLeu L However, the amino acids numbered -1"-30 correspond to the signal peptide that is cleaved during secretion.

Further, the DNA base sequence encoding the penicillinase is shown in the following formula (2).

ATGAAAAAAGAATACGTTGTTAAAAG
TAGGATTATGTGTAAGTTT8CTAGG
AACAACTCAATTTGTTAGCACGATT
TCTTCTGTACAAGCTTCAC88AAGG
TAGAGCAAATAGTAATCAAAATGA
GACGGGAACCATTTCAATATCTCAG
TTAAACAAGAATGTATGGGTTCATA
CGGAGTTAGGTTATTTTTAATGGAGA
AGCAGTTCCTTCGAACGGTCTAGTT
CTTAATACTTCTAAAGGGCTAGTAC
TTGTTGATTCTTCTTGGGATAACAA
ATTAACGAAGGAACTAATAGAAATG
GTAGAAAAG AA TTTCAG
CGCGTA A CAGATGTCATTA TT
A CA CA TGCGCACGCTGATCGA
ATTGGCGGA A TAACAGCGTTGAA
AGA A AGAGGCATTAAAGCGCAT
AGTACAGCATTAACCGCAGAACTAG
CAAAAGAAAAGTGGATATGA A GA
GCCACTTGGAG ATTACA A AC
A GTTACGA8TTTGAAGTTTGGCAA
TACAAAAGTAGAAACGTTCTATCCA
GGGAAAGGACATACAGAAGATAATA
TTGTTGTTTGGTTGCCACAAT8TCA
AATTTTAGCTGGAGGCTGTTTAGTA
AAATCTGCGGAAGCTAAAATTTAG
GAAATGTTGCGGATGCGTACGTAAA
TGAATGGTCCACATCGATTGAGAAT
ATGCTGAAGCGATATAGAAATATAA
ATTTGGTAGTACCTGGTCACGGGAA
AGTAGGAGACAAGGGATTACTTTTA
CATACATTGGATTTATTAAAA (2
) Furthermore, the DNA base sequence encoding penicillinase carried by the vector of the present invention is preferably located near the 3' side of the above-mentioned specific DNA base sequence, that is, near the side to which the target polypeptide is linked. is part 10
DNA within a base or within 10 bases further
A restriction enzyme recognition sequence is included in this added portion by adding a sequence.

This is essential for directly linking the DNA base sequence encoding the penicillinase and the DNA base sequence encoding the target polypeptide. However, the enzyme that recognizes this restriction enzyme recognition sequence may be any known restriction enzyme, but preferably one that recognizes a base sequence of 5 or more bases. The DNA base sequence can be changed arbitrarily.

For example, if a six-base sequence of AGATCT is linked to the 3' side of the DNA base sequence encoding penicillinase, this six-base sequence will be recognized and cleaved by BglII. Therefore, when using this as a linking point between the DNA base sequence encoding penicillinase and the target polypeptide, the 3' side of this six base sequence corresponds to an amino acid sequence recognized by a highly specific proteolytic enzyme such as urokinase. The DNA base sequence of the target polypeptide can be linked via a DNA base sequence that corresponds to a DNA base sequence that corresponds to an amino acid that is specifically recognized by a chemical substance such as cyanogen bromide. However, the reason for adding DNA base sequences corresponding to recognition amino acid sequences such as urokinase and cyanogen bromide is that these enzymes and chemicals are used when isolating the target polypeptide from the purified benicillinase fusion protein. be.

Therefore, a specific example of a DNA base sequence encoding penicillinase which is a component of the vector of the present invention is the above-mentioned 6
It has a DNA base sequence shown in the following formula (3) to which a base sequence has been added.

ATGAAA88GAATACGTTGTTA88AG
TAGGATTATGTGTAAGTTTACTAGG
AAC88CTCAATTTGTTAGCACGATT
TCTTCTGTACAAGCTTCACAAAAGG
TAGAGC88ATAGTAATC88888TGA
GACGGGAACCATTTCAATATCTCAG
TTAAACAAAG88TGTATGGGTTCATA
CGGAGTTAGGTTATTTTTAATGGAGA
AGCAGTTCCTTCGAACGGTCTAGTT
CTTAATACTTCTAAAGGGCTAGTAC
TTGTTGATTCTTCTTGGGATAACAA
ATTAACGAAGGAACTAATAGAAATG
GTAGAAA8GA88TTTCAGAAGCGCG
TAACAGATGTCATTATTACACATGC
GCACGCTGATCGAATTGGCGG88TA
ACAGCGTTGAAAGAAAGAGGC8TTA
AAGCGCATAGTACAGCATTAACCGC
AGAACTAGCAAAGAA88GTGGATAT
GAAGAGCCACTTGGAGATTTAC88A
CAGTTACGA8TTTGAAGTTTGGCAA
TAC88AAGTAGA88CGTTCTATCCA
GGGAAAGGACATACAGAAGATAATA
TTGTTGTTTGGTTGCCACAATATCA
AATTTTAGCTGGAGGCTGTTTAGTA
AAATCTGCGGAAGCTAAAATTTAG
GAAATGTTGCGGATGCGTACGTAAA
TGAATGGTCCACATCGATTGAGAAT
ATGCTGAAGCGATATAGAAATATAA
ATTTGGTAGTACCTGGTCACGGGAA
AGTAGGAGACAAGGGATTACTTT In the present invention, the DNA base sequence encoding the penicillinase or the base sequence containing the same can be obtained by restriction using various conventionally known methods, such as a microorganism containing the same, a plasmid isolated therefrom, and preferably, for example, from pEAP82, etc. It can be easily produced by a method of cutting and isolating using an enzyme or the like, a method of chemical synthesis according to the DNA base sequence, a combination of these methods, etc. Furthermore, the means for linking or bonding the DNA base sequence encoding the penicillinase with the DNA base sequence encoding the target polypeptide can be carried out by various conventionally known methods, such as an enzymatic reaction using T4 DNA ligase or the like.

The vector of the present invention containing the DNA base sequence encoding penicillinase obtained as described above combines the DNA base sequence with the kil gene region of the pMB9 plasmid into the alkalophilic Bacillus no. Exocellular secretion vector characterized by containing in the downstream region of the promoter (Ex promoter) derived from strain 170 DNA [Publication Patent Publication No. 1983-2
99823. this DNA
An example of a source vector suitable for incorporating a base sequence is the above-mentioned plasmid pEAP82.

DN encoding benicillinase to the above origin vector
The operation for introducing the A base sequence can be carried out in accordance with the operations conventionally used when incorporating this type of foreign gene into a vector. Examples of this are as described above.

Furthermore, the polypeptide secretion and expression vector containing the DNA base sequence encoding the penicillinase of the present invention obtained as described above can be used to actually introduce the polypeptide into a host cell and secrete and express the target polypeptide outside the bacterial cell. Of course, it is necessary to introduce a DNA base sequence encoding the target polypeptide into the target polypeptide, as well as transcriptional and translational regulatory factors such as a promoter ribosome binding site, a translation stop signal, and a transcription termination factor. etc. must be included. Each of these factors may already be contained in the origin vector, and in this case, the origin vector, for example, the penicillinase regulatory factor derived from pEAP82, can be used as is. Without being limited thereto, it is also possible to use these regulatory factors contained in various DNAs derived from other conventionally known microorganisms or viruses. Examples include E. coli lactose operon, tryptophan operon, promoters such as PL of λ phage, promoters such as the SD sequence of β-galactosidase, rrnB of E. coli, t of λ phage, etc.
Examples include transcription termination factors such as Ll. Also, TAA is used as a translation stop signal.

Three types of base sequences, TAG and TGA, can be used. Furthermore, the above-mentioned regulatory elements can be extracted from DNA containing them according to conventional methods, and then the necessary elements can be introduced into an appropriate vector according to conventional methods.

A specific example of the vector of the present invention that stores the above-mentioned regulatory factors and penicillinase is pEAP82.
An example is pEAP85, which was constructed using the origin vector. This plasmid pEAP85 has a DNA base sequence encoding the penicillinase signal peptide and mature protein following the penicillinase promoter and ribosome binding site, and the 3' end of this base sequence has B
It has a glII restriction enzyme recognition sequence. Further downstream thereof, it contains a transcription termination factor derived from rrnB. Its characteristics, together with its manufacturing procedure, are the first
As shown in the figure. From FIG. 1, pEAP85 is characterized by the illustrated restriction enzyme cleavage map. Furthermore, the size of PF p EA P 85 is approximately 5.1 kb as determined by 160% agarose gel electrophoresis. E. coli HB harboring this plasmid pEAP85
The IOI has been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry, under the designation (HB 101 (pEAP85)) and as Fiber Science and Technology Research Institute No. 10266 (FERM P-10266).

A DNA base sequence that includes the various regulatory factors mentioned above and codes for penicillinase, and a DNA base sequence that corresponds to an amino acid sequence recognized by a highly specific protease such as urokinase, or a DNA base sequence that encodes penicillinase. The polypeptide secretion expression vector of the present invention, which has a DNA base sequence encoding a target polypeptide linked via a DNA base sequence corresponding to an amino acid specifically recognized by a chemical substance, can be prepared in the same manner as the vector of the present invention described above. The present invention also provides a vector for secreting and expressing a polypeptide as a penicillinase fusion protein outside of the bacterial cell.

Examples of the above polypeptides include insulin,
Examples include hormones and growth factors such as calcitonin, epidermal cell growth promoting factor, somatostatin, GIP, R-MSA, thymosin β4, and growth hormone releasing factor. The DNA base sequences encoding these various polypeptides may be extracted and isolated from their originating cells, etc., according to conventional methods, or may be chemically synthesized according to the amino acid sequences of these polypeptides.

The DNA base sequences of these polypeptides and the DNA base sequences of penicillinase can be linked, for example, by adding the DNA base sequences of these polypeptides to the polypeptide secretion expression vector of the present invention that carries the DNA base sequences of penicillinase. Introduction can be carried out by utilizing an enzymatic reaction using a restriction enzyme or, for example, an enzymatic reaction using T4 ligase according to the method described above. Further, after chemically synthesizing the DNA base sequence of a fusion polypeptide of the above-mentioned polypeptide and penicillinase in advance, this DNA base sequence is introduced in the same manner as the introduction of the DNA base sequence of the above-mentioned penicillinase,
This can also be done by introducing it into an extracellular secretion vector.

In this way, a polypeptide secretion expression vector of the present invention carrying a DNA base sequence encoding a fusion polypeptide can be obtained. This has a promoter and a ribosome binding site in front of the DNA base sequence encoding the above-mentioned fusion polypeptide, and a translation stop signal immediately after the DNA base sequence of the target polypeptide that constitutes the above-mentioned base sequence. , by introducing it into a suitable host cell,
The cells can be transformed to secrete the polypeptide.

Preferred specific examples of the polypeptide secretion expression vector include p85h08 and p85h09. Within these plasmids p 85 h
08 has a DNA base sequence encoding the promoter and ribosome binding site of penicillinase, the signal peptide and mature protein of penicillinase, and has an amino acid sequence (Glu-Gly- D corresponding to Arg)
NA base sequence, insulin B chain (target polypeptide)
It has a DNA base sequence in which the DNA base sequence and its translation stop signal are arranged exactly in this order. The arrangement is as shown in Table 3 in Examples below. E. coli HBIOI carrying this plasmid p85h08 has been designated as (HB 101 (p85h08)) by the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry, and has been designated as Microbiological Research Institute No. 10264 (pgR?1p-102).
64).

Furthermore, p85h09 shares the DNA base sequence encoding the promoter and ribosome binding site of penicillinase, the signal peptide of penicillinase, and the mature protein with p85h08; It is characterized by having a DNA base sequence corresponding to an amino acid (Met) that is specifically recognized by a chemical substance, in this case cyanogen bromide, at the connection point with the DNA base sequence of the target polypeptide.

The arrangement is as shown in Table 5 in Examples below.

E. coli H harboring this plasmid p85h09
B101 is designated by the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (HB 101 (p85h09)), and is designated by the Microbiological Research Institute No. 10265 (FERM P-1026).
It has been deposited as 5).

The polypeptide secretory expression vector of the present invention can be introduced into host cells by various known methods, and the strain of E. coli used as the host cell is not particularly limited. Among these, H8101 strain derived from Escherichia coli strain 12 is particularly preferred.

A specific example of the method for introducing the vector into the host cell is, for example, a method in which the host cell is treated at low temperature in an aqueous solution containing calcium chloride, and the vector is added to the solution (J, Bacteriol, 119.1072). (1
974) ) can be exemplified.

When cells transformed by introducing the vector of the present invention as described above are cultured, a precursor type fusion polypeptide is produced within the cells, and then the mature fusion polypeptide is accumulated in the periplasm, and the culture is continued. As a result, the present fusion polypeptide is secreted and produced outside the bacterial cell. That is,
First, mRNA is produced from the gene encoding the fusion polypeptide in the vector by the action of transcriptional regulatory factors in the vector and various factors in the host cell. Then, mRN
A precursor type fusion polypeptide is produced from A by the action of translational regulatory factors and various factors in the host cell. Further, the precursor produced here is secreted into the periplasm by the action of a signal peptide, and at the same time, the signal peptide is separated from the precursor by the action of a signal peptidase, resulting in a mature fusion polypeptide. Furthermore, the kil gene present in the vector is activated by Ex dibromo, and as a result, the permeability of the outer membrane of E. coli increases, and the mature fusion polypeptide accumulated in the periplasm is secreted and produced outside the cell.

The penicillinase fusion polypeptide thus secreted and produced has penicillinase activity and can be easily separated and purified using this activity as an indicator.

As this separation and purification operation, for example, a method of subjecting the culture supernatant to ion exchange chromatography after dialysis can be adopted. The purified penicillinase fusion polypeptide is further degraded by urokinase or cyanogen bromide, and the target polypeptide can be easily recovered by high performance liquid chromatography or the like.

The present invention will be explained in more detail below with reference to Examples.

Example 1 Construction of vector pEAP85 for secretory expression of penicillinase fusion polypeptide
Bamtl [linker (manufactured by Toyobo Co., Ltd., BAH-80
1) 1 μg was mixed and a ligation reaction was performed at 16° C. using DNA ligase derived from T4 phage (Takara Shuzo Co., Ltd., 2011A). Next, this reaction solution was mixed with E. coli HBIOI.
Mix with 200 μl of competent cells and leave at 0°C for 1 hour. Furthermore, the mixture was heated at 42° C. for 170 seconds to perform transformation. The obtained transformant was inoculated into 3 ml of Shiichi broth, and after culturing at 37°C for 3 hours, the culture solution was diluted with 20μ
g/mQ of chloramphenicol (Sigma, C
-0378) on an LB agar plate, and colonies showing chloramphenicol resistance were selected. A transformant strain containing a plasmid in which the old ncII site that existed downstream of the penicillinase gene in pEAP82 was converted to a BamHI site was obtained from the selected colonies.

A plasmid was prepared from this transformed strain by the alkaline-3DS method, and this plasmid was named pEAP83.

■ On the other hand, transfer pEAP821μg to restriction enzyme CIa.
After complete decomposition with I (manufactured by Takara Shuzo Co., Ltd., 1034B) and EcoRII (manufactured by Nino Bon Gene Co., Ltd., 315-00882), it was subjected to 6% polyacrylamide gel electrophoresis, and after staining with ethidium bromide, C1a consisting of approximately 50 base pairs
The I-EcoRII DNA fragment was cut out and extracted.

■ D corresponding to the C-terminal amino acid sequence of penicillinase
For the synthesis of oligonucleotides containing an NA base sequence, an 8glll site, and a translation stop signal, each of the four oligonucleotides having the following base sequences was converted into AB
Synthesis was performed using an automatic DNA synthesizer model 380B system manufactured by T Company.

<b (5') CCTGGTCACGGGAAA
GTAGGAGACAAGGGATTACTTTTTAC
ATACATTGGATTTATTAAAAAAGATC
(3”) <2>(5') TTAAGAAAACT
GCAGA 88 TACAAGCCCGCC to ATGA
GCGGGCTTTTTTTTG (3') <3> (
5') GATCCAAAAAAAGCCCGCT
CATTAGGCGGGCTTGTATTTCTGCA
GTTTCTTAAGATCTTTTTAA (3”)
<4>(5') CCAATGTAT to TA 8
GTAAAAGTAATCCCTTGTCTCCTAC
TTTCCCGTG 8 to 3') The 5' end of each of the above oligonucleotides was phosphorylated using T4 polynucleotide kinase (manufactured by Toyobo Co., Ltd., PNK-104).

■ 10 μg of plasmid pEAP83 obtained in above
-104) and subjected to 1.0% agarose gel electrophoresis, and after ethidium bromide staining, approximately 4°25
A kilobase pair DNA fragment was excised, and this fragment was electrically recovered using a DNA cell (manufactured by Daiichi Kagaku Co., Ltd., DNA-0001).

■ Combine approximately 1 μg each of the DNA fragment obtained in (■) above and the phosphorylated oligonucleotide prepared in (■) above,
A binding reaction was performed using T4 DNA ligase to obtain p107107C1al-B consisting of 163 base pairs shown in Table 1 below.
a DNA fragment was obtained.

(Margins below this page) Table 1 CIaI C1aI-EcoRII fragment ■ DNA fragment obtained in above ■ and p107 obtained in above ■
1 μg of each DNA fragment was combined and subjected to a ligation reaction using T4 DNA ligase. After the reaction, E. coli 88101
A plasmid was isolated from the resulting transformant strain showing chloramphenicol resistance and ampicillin resistance, and a plasmid pEAP84 having a BglII site in the DNA base sequence corresponding to the C-terminal side of the penicillinase structural gene was transformed. Obtained.

■ On the other hand, plasmid pK containing the rrnB transcription termination factor
K223-3 (manufactured by Pharmacia, 27-4935-0
1) Cut 10 μg with the restriction enzyme Htnc11, and add the BamHI linker using the same procedure as in step ① above.
were combined. Next, this was completely digested with restriction enzymes PstI (manufactured by Toyobo Co., Ltd., PST-107) and BamHI, and subjected to 6% polyacrylamide gel electrophoresis.
Pstl containing the 75 kilobase pair rrnB transcription terminator
-BamHI DNA fragment was cut out and extracted.

■ Transfer 1 μg of plasmid pEAP84 obtained in ■ above to P
After cleavage with stI and BamH, 0.75 kilobase pairs of Pstl-Ba containing the rrnB transcription termination factor obtained in step ① above were obtained.
The mHI DNA fragments were mixed and subjected to a ligation reaction using T4 DNA ligase. After the reaction, Escherichia coli strain H8101 was transformed, and a plasmid was isolated from the resulting transformant strain showing chloramphenicol resistance and ampicillin resistance, and a 0.75 kilobase pair of PstI was added downstream of the penicillinase structural gene. - Plasmid pEAP85 into which the BamHI DNA fragment was inserted was obtained.

An outline of the series of operations is shown in FIG.

The obtained pEAP85 had a size of 5.1 kilobase pairs as a result of 1.0% agarose gel electrophoresis,
The DNA base sequence was determined using the M13 method (Messing.

J, In Th1rd C1eveland Sym
p08iumon? Iacromolecules:
Recombinant DNA + I)p,
143-153. Edited by A, Wal
ton, (1981) 8msterdam:
As a result of analysis by Elsevier, ), it was confirmed that the DNA base sequence had been inserted as expected.

The pEAP85 was designated as (HB 101 (p EA P85)) by the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry.
0266).

Example 2 Construction of a secretory expression vector having a DNA base sequence encoding a penicillinase-insulin B chain fusion polypeptide (A) DNA encoding a fusion polypeptide in which penicillinase and insulin B chain are connected via a urokinase-recognizing amino acid sequence Construction of a secretory expression vector p85h08 having the nucleotide sequence■ The nucleotide sequence of the insulin B chain was first determined by referring to the review by Hirose and Itakura [Pharmacia Review No. 3, pp. 4957 (1980)]. DNA encoding a chain
An oligo obtained by adding a DNA base sequence encoding a restriction enzyme recognition site and a urokinase recognition amino acid sequence (Glu-Gly-^rg) before the base sequence, and adding a stop codon and a restriction enzyme recognition site after that. For nucleotide synthesis, four types of oligonucleotides having the following base sequences were each synthesized using an automatic DNA synthesizer model 380B system manufactured by ABI.

<5>(5') GATCTGAAGGTCGT
TTCGTC88TCAGCACCTTTGTGGTT
hehe CACCTCGTTGAAGCCTTGTAC(3
”)<6>(5') CTTGTTTGCGGT
GAACGTGGTTTCTTCTACACTCCTA
AGACTTAATAA (3”) <7>(5')
GATCTTATTAAGTCTTAGGAGTG
TAGAAG88ACCACGTTCACCGCAAA
CAAGGTACAAGGCT (3')<8>
(5') TCAACGAGGTGAGAACCAC
AAAGGTGCTGATTGACGAAACGACC
TTCA (3”) above oligonucleotide <6>
The 5' ends of <8> and <8> were each phosphorylated using T4 polynucleotide kinase (manufactured by Toyobo Co., Ltd., pNK-xo4), and approximately 1 μg of each of <5> to <8> was combined and combined with T4 DNA ligase. The binding reaction is carried out, and the following second
UKIN-BBglI [
A DNA fragment was obtained.

Table 2 UKIN-B ■ 1 μg of pEAP85 obtained in Example 1 was incubated with restriction enzyme 3
Table ＞Genetic Code [Universa
l]erLeuLeuGlyThrThrGInPhe
ValSerThrlleSerSe8snGIuTh
rGIyThrIIeSerI1eSerGlnLeu
AsnLysAsnValTrpVal}lisThr
GluLeuG1yTyrPheAsnGlyGluA
IaValProSerAsnG1yLeuValLe
uAsnThrSerLysGlyLeuVaILeu
ValAspSerSerTrpAspAsnLys
LeuThrLysG1uLeuIIeGluMetV
alG1uLysLysPheGlnLyBgllI
UKIN-BBgll [N
This was mixed with 1 μg of A fragment and subjected to a ligation reaction using T4 DNA ligase. After the reaction, E. coli HBIOI strain was transformed, and a plasmid was isolated from the resulting transformant strain showing chloramphenicol resistance and ambicillin resistance.
Plasmid p8 in which the UKIN-B fragment was inserted in the llI site in the forward direction (the insulin B chain gene is connected in the same direction as the penicillinase gene)
Got 5h08. The outline of this operation is as shown in FIG.

The orientation of the inserted fragment was confirmed by determining the DNA base sequence. As a result, the DNA base sequence is as shown in Table 3 below, and the DNA base sequence where p84h08 encodes penicillinase, the urokinase recognition amino acid sequence and the DNA base sequence that encodes insulin B chain are exactly in this order. It was confirmed that they were arranged in Table 3 also lists the amino acid sequences corresponding to the DNA base sequences.

CGAATTGGCGGAATAACAGCGTTGA
AAGAAAGAGGCATTA＾rgI1eGlyG
1yIleThrA1aLeuLysG1uArgGl
ylleLysA1aHisSerThrA1aLeu
ThrAlaG1uLeuA1aLysLysSerG
lyTyrGIuGIuProLeuG1yAspLe
uG1nThrValThrAsnLeuLysPhe
GIyAsnThrLysVal. GluThrPhe
TyrProGlyLysGlyHisThrG1uA
spAsnl 1eValValTrpLeuProG
InTyrGInl1eLeuAlaG1yG1yCy
sLeuValLysSerA1aG1uAlaLys
AsnLeuGlyAsnValA1aAspAIaT
yrValAsnG1uTrpSerThrSerr
leG1uAsnMetLeuLysArgTyrAr
gAsnI1eAsnLeuValValProGIy
HisGlyLysValG1yAspLysGlyL
euLeuLeullisThrLeuAp 85
h08 is an indication of the Microbial Technology Research Institute, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (HB 101 (p85h08)),
It has been deposited as 4).

(B) Construction of secretory expression vector p85h09 having a DNA base sequence encoding a fusion polypeptide in which penicillinase and insulin B chain are linked via a cyanogen bromide recognition amino acid sequence ■ DNA base encoding insulin B chain The sequence is preceded by D encoding a restriction enzyme recognition site and a cyanogen bromide recognition amino acid sequence (Met).
For the synthesis of oligonucleotides in which an NA base sequence is added and then a stop codon and a restriction enzyme recognition site are added, two types of oligonucleotides having the following base sequences were newly added, manufactured by AB1, Synthesis was performed using an automatic DNA synthesizer model 380B system.

<9>(5') GATCTATGTTCGTC
AATCAGCACCTTTTGTGGTTCTCACC
TCGTTGAAGCCTTGTAC(3')<10>
(5') TCAACGAGGTGAGAACC
ACA 88GGTGCTGATTGACGAAC to A
(3') T4 polynucleotide kinase (manufactured by Toyobo Co., Ltd.,
Phosphorylated using PNK-104) <9>.

Approximately 1 μg of each of <5>, <7>, and <10> were combined and subjected to a ligation reaction with T4 DNA ligase to produce BRIN-B Bg consisting of 104 base pairs shown in Table 4 below.
An lrI DNA fragment was obtained.

Table 4 BRIN-B </> Table 5 ＞Genetic Code [Univer
sal]■ 1 μg of pEAP85 obtained in Example 1 was digested with restriction enzyme BglII, and BRIN-B obtained in the above
This was mixed with 1 μg of BglII DNA fragment and subjected to a ligation reaction using T4 DNA ligase. After the reaction, E. coli 881
01 strain was transformed, and plasmid p85h09 was obtained by the same method as described in (A) ① above. The outline of this operation is as shown in FIG.

The orientation of the inserted fragment was confirmed by determining the DNA base sequence. As a result, the DNA base sequence is as shown in Table 5 below, and P 84 h Q9 is the DNA base sequence encoding penicillinase, and the DNA base sequence encoding cyanogen bromide recognition amino acid and insulin B chain.
It was confirmed that the base sequences were arranged exactly in this order. Table 5 also lists the amino acid sequences corresponding to the DNA base sequences.

erLeuLeuGIyThrThrGlnPheVa
ISerThrlleSerSeAsnGIuThrG
lyThrlleSerlleSerGlnLeuAs
nLysAsnValTrpValHisThrGlu
LeuGlyTyrPheAsnGlyGluA 1a
Va 1Pr08erAsnG IyLeuVa IL
euAsnThrSerLyssArgValThrA
spVa111elleThrHisA1aHisA1
aAsp p 85 h 09 was submitted to the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (HB 101 (p 85 h
09) ] with the display, Microtechnical Research Institute No. 10265 (F
ERM P-10265).

Example 3 p 85 h 08 and p 85 h 0
Expression of extracellular secretion of penicillinase-fused insulin B chain by Escherichia coli harboring 9 (8) Distribution of expression■ Plasmid p85h08 obtained in Example 2
and p85h09 were each inoculated into 10 ml of a broth medium containing 0.2% glycerin, and cultured with shaking at 37°C for 24 hours. After completion of the culture, the mixture was centrifuged at 8,000 rpm for 10 minutes, and the resulting culture supernatant was used as the extracellular fraction.

(2) The precipitated bacterial cells obtained in (1) above were washed with 5 ml of physiological saline, and the bacterial cells were recovered by centrifugal sedimentation again.

Next, the bacterial cells were suspended in 5 ml of 25% sucrose (containing 1 mM EDTA), shaken at room temperature for 10 minutes, and then
Centrifugation was performed for 10 minutes at rpm. After discarding the supernatant, five parts of distilled water chilled at 0°C were poured into the obtained bacterial cells at once, and the cells were shaken at 0°C for 10 minutes.

Next, it was centrifuged at 110,000 rpm for 10 minutes, and the resulting supernatant was used as a periplasm fraction [Osmoti-Nkusho-Tsuku method, Kato et al, Eur, J.
8pp1. Microbio1. Biotechno1
．． , 18.339 (1983)).

■ Suspend the precipitate obtained in step (■) above in 5 ml of 50 mM phosphate buffer pH 7.0, and use an ultrasonic cell disruption device (
Tomy Seiko Co., Ltd., model - UR200P) at 0°Cl
Ultrasonication was performed at 20 kilohertz for 1 minute. Thereafter, centrifugal sedimentation was performed at 1,001,000 rpm, and the resulting supernatant was used as the intracellular fraction.

■ The activity of penicillinase was measured for each of the two samples obtained in the above ■■■. The activity of penicillinase was determined by the method developed by Sawai et al.
ob, Agents, Chemother, + 13+
910 (1978)). Based on the obtained penicillinase activity measurements for both parts, the amount of penicillinase fusion protein contained in each part was determined from the specific activity of each fusion protein shown below. p
Penicillinase and insulin B through the urokinase recognition sequence obtained from Escherichia coli containing 85h08.
The specific activity of the fusion protein (hereinafter referred to as PENHO3) in which the chains are fused is 460 units/mg protein. and insulin B chain (hereinafter referred to as PENHO9)
The specific activity is 390 units/mg protein.

Table 6 summarizes these results.

(Margin below this page) p85h08 12.8 0.2
3.0p85h09 6.9 0
．． 8 3.8 However, the numbers represent the number of ■ per liter of culture medium.

From Table 6 above, the polypeptide secretory expression vectors p85h08 and p85h09 provided by the present invention
The respective penicillinase-fused insulin B chains, PENHO3 and PENI!, expressed from PENHO3 and PENI! It was confirmed that approximately 80% and 60% of 09 were secreted and produced in the extracellular fraction, respectively.

(B) Purification and analysis of fusion protein■ Plasmid p85h08 obtained in Example 2
and p85h09 were inoculated into 100 volumes of L-broth medium containing 0.2% glycerin, and precultured overnight at 37°C.

Add 20μg/m of chloramphenicol to the previous TJ solution.
After inoculating 5% of the same medium containing 1.5 liters of
Shaking culture was performed at 7°C for 24 hours. After culturing, 8
The culture supernatant obtained by centrifugation at 000 rpm for 30 minutes was dialyzed against distilled water overnight. Next, adjust this to pH 7.5
CM adjusted to 50mM phosphate buffer and equilibrated with
Cellulofine (manufactured by Pharmacia) column (2,5c
After thorough washing with the same buffer, elution was performed using a linear gradient end method from OM to 0.5 M NaCl. Protein-specific absorption at 280 nm was measured from each eluted fraction, and at the same time, penicillinase activity was also measured.

As a result, a single peak was obtained (Figure 4).

FIG. 4 shows the pattern in the CM cellulofine force ram of PENHO3, and almost the same pattern was observed in the case of PENHO9.

Table 7 summarizes the purification of the above penicillinase fusion protein.

[PEN) 108] Post-dialysis M Cellulofine [PENI+09] Post-dialysis M Cellulofine 1570 55.5 2103 37.
913.0 2.31 1139 493
．． 01600 5B, 2 1584 2
7.210.0 1.49 585 3
93.154.2 36.9 ■ Penicillinase-fused insulin B chain obtained in (■) above, P E N 1108 and PENI (09 is S
As a result of DS polyacrylamide gel electrophoresis, it was confirmed that the product was purified into a single product. Therefore, amino acid analysis was performed on these purified fusion proteins, and the amino acid analysis values were completely different from those predicted from the DNA base sequences (Tables 3 and 5).

(C) Separation of insulin B chain from purified penicillinase-fused insulin B chain ■ Escherichia coli 881 containing plasmid p84h08
Fusion protein PIENH purified from the culture filtrate of strain 01
1 mg of O8 was heated in a boiling water bath in the presence of 0.1% SDS, and after cooling, 0.02 mg of urokinase was added.
Digested for 24 hours at °C. After digestion, a reverse phase liquid chromatography column (RP-1, manufactured by ABI) was added using a high-performance liquid chromatography system model 130 manufactured by ABI.
300, 400419), and 20 μg of insulin Bt) separated from the fusion protein was collected.

■ Escherichia coli 881 containing plasmid p84h09
Fusion protein PENI+ purified from the culture filtrate of strain 01
Dissolve 1 mg of 09 in 70% formic acid and add cyanogen bromide 10
0■ was added and allowed to react at room temperature for 24 hours. After the reaction, the mixture was concentrated under reduced pressure, neutralized with 4N NaOH, and then subjected to liquid chromatography in the same manner as in (2) above to collect 30 μg of insulin B chain separated from PENHO9.

■ As a result of amino acid analysis of the target polypeptide (insulin B chain) obtained in above ■ and ■,
It was confirmed that the amino acid analysis values were completely consistent with the amino acid analysis values of human-derived insulin B11.

[Brief explanation of drawings]

Figure 1 shows pEAP83 obtained from the origin vector pEAP82, pEAP84 obtained by inserting the synthesized NA fragment p107, and then DNA containing the rrnB transcription terminator consisting of 0.75 kilobase pairs excised from pKK2233-3. The fragment of pEAP84B
It is a figure showing the process of obtaining pEAP85, a vector for secretion and expression of the polypeptide of the present invention, by recombining into the amHI-Pstl site, and the characteristics of pEAP85 obtained thereby. In the figure, Ex- indicates a gene region involved in extracellular secretion. Figure 2 shows NA"'UKIN-B synthesized in pEAP85.
'' to create the polypeptide secretory expression vector p of the present invention.
Steps for obtaining 85 h 08 and the resulting vector p
FIG. 85 is a diagram showing the characteristics of 85 h 08. The white part in the figure indicates the insulin B chain gene. Figure 3 shows NA “BRIN-B” synthesized into pEAP85.
into the polypeptide secretory expression vector p of the present invention.
Steps for obtaining 85 h 09 and the resulting vector P
FIG. 85 is a diagram showing the characteristics of 85 h 09. As in FIG. 2, the white area indicates the insulin B chain gene. FIG. 4 shows the outflow pattern of the CM-Cellulofine force ram during the purification of PENHO8.

Claims (9)

[Claims] (1) DNA that corresponds to the amino acid sequence that a highly specific protease such as urokinase recognizes the DNA base sequence that encodes penicillinase derived from alkalophilic bacillus and the DNA base sequence that encodes the target polypeptide.
In order to secrete and express the target polypeptide outside the bacterial cell as a penicillinase fusion protein by linking it via a base sequence or a DNA base sequence corresponding to an amino acid specifically recognized by a chemical substance such as cyanogen bromide, A DNA base sequence encoding a penicillinase derived from alkalophilic Bacillus, a promoter derived from the penicillinase,
A polypeptide secretion expression vector comprising a ribosome binding site and a transcription termination factor derived from rrnB ribosomal RNA. (2) The vector according to claim 1, which is pEAP85. (3) The DNA base sequence encoding penicillinase and the DNA base sequence encoding the target polypeptide are DNA base sequences that correspond to amino acid sequences recognized by highly specific proteolytic enzymes such as urokinase, or cyanogen bromide, etc. The vector according to any one of claims 1 to 2, comprising a DNA base sequence encoding a fusion polypeptide linked via a DNA base sequence corresponding to an amino acid specifically recognized by the chemical substance. . (4) The vector according to claim 3, wherein the DNA base sequence encoding the target polypeptide encodes insulin B chain. (5) The vector according to claim 3, which is p85h08. (6) The vector according to claim 3, which is p85h09. (7) The DNA base sequence encoding penicillinase and the DNA base sequence encoding the target polypeptide are DNA base sequences that correspond to amino acid sequences recognized by highly specific proteolytic enzymes such as urokinase, or cyanogen bromide, etc. A microorganism transformed with a vector containing a DNA base sequence encoding a fusion polypeptide linked via a DNA base sequence corresponding to an amino acid specifically recognized by a chemical substance. (8) The vector according to claim 7, which is E. coli. (9) Cultivating a microorganism transformed with a vector containing a DNA base sequence encoding a fusion polypeptide in which a DNA base sequence encoding penicillinase and a DNA base sequence encoding a target polypeptide are directly linked; A method for producing a polypeptide, which comprises collecting a fusion protein secreted outside the body and then separating a target polypeptide.