JPS61271989A - Eel calcitonin derivative gene - Google Patents

Abstract

PURPOSE:A gene, consisting of a specific amino acid sequence and usable as a precursor for producing an eel calcitonin which is glycine having the C terminal having remedial effect on hypercalcemia and Paget disease economically in a large amount. CONSTITUTION:A gene capable of coding an eel calcitonin derivative having an amino acid sequence expressed by the formula (eel calcitonin which is glycine having the C terminal). The gene can be produced by replacing a codon capable of coding Asn at the 26-position Tbr at the 27-position and Ser at the 29-position from the Cys at the N terminal of a salmon calcitonin in the gene capable of coding the salmon calcitonin with a codon capable of coding Asp, Val and Ala, respectively.

Description

Detailed Description of the Invention [Industrial Application Field] The present invention relates to a gene system for producing eel calcitonin derivatives, and more specifically, a gene encoding four eel calcitonin derivatives, a method for producing the same, and eel calcitonin derivatives. The present invention relates to a plasmid containing a gene encoding an eel calcitonin derivative encoding a fusion protein of the derivative and another protein, and to Escherichia coli transformed with this plasmid.

[Conventional technology]

Calcitonin is a peptide consisting of 32 amino acids with an amidated C-terminus, and is associated with hypercalcemia, Pa.
It has been recognized that it has a therapeutic effect on get (end of page) disease. This polypeptide has also been confirmed to have a bone resorption inhibitory effect and a bone neogenesis promoting effect, and is considered promising for senile osteoporosis.

Calcitonin has already been isolated from pigs, cows, humans, rats, salmon, and eels, and the structures of each have been clarified.

Comparing the physiological activity of calcitonin in the blood between the species from which it is derived, calcitonin obtained from the carp gland of fish has a specific activity approximately 30 times higher than that derived from the thyroid of mammals. The duration is also long. In particular, eel calcitonin not only has high activity but also extremely high stability in vitro in serum or extracts of organs such as liver and kidney. For this reason, eel calcitonin is considered to be particularly advantageous when used as a medicine.

Calcitonin from pigs, salmon, and eel is currently commercially available as therapeutic calcitonin, and these calcitonins are obtained by extraction from living organisms or chemical synthesis. However, its production quantity is small and it is expensive. Therefore, there is a strong desire to develop a new method that can produce eel calcitonin economically and in large quantities.

To achieve this purpose, methods using genetic engineering techniques are most preferred. JP-A-58-203953 describes the chemical synthesis gene for human calcitonin and its expression in Escherichia coli. Special table 1986-501121
describes the precursor gene of human calcitonin. Japanese Patent Publication No. 59-501095 describes the chemical synthesis gene for human calcitonin and its expression. Furthermore, Japanese Patent Publication No. 59-501243 describes the naturally derived human calcitonin gene and its expression.

However, the synthesis and expression of genes for eel calcitonin and its derivatives in E. coli have not yet been described.

[Problem that the invention seeks to solve]

The ultimate purpose of this invention is to develop a new method for producing eel calcitonin economically and in large quantities, which is considered the most promising product as described above. The purpose of the present invention is to provide a gene system for eel calcitonin (referred to as an eel calcitonin derivative) having the following.

[Means for solving problems]

The purpose is to obtain the following amino acid sequence: Cys Ser Asn Leu Ser Thr C
ys Val Leu GlyLys Leu Ser
Gln Glu Leu l1is 1. ys Le
u GinThr Tyr Pro Arg Thr
Asp Val Gly Ala GlyThr Pr
A gene encoding an eel calcitonin derivative represented by o Gly and a method for producing the same; a gene encoding a fusion protein of the eel calcitonin derivative and another protein; a plasmid containing the gene encoding the eel calcitonin derivative; and a gene encoding the eel calcitonin derivative; The problem is solved by providing E. coli that has been transformed.

(Specific explanation) +11 Calcitonin loading biography and person Y
'The eel calcitonin derivative according to the present invention has the following amino acid sequence: It has an additional amino acid, glycine, at the C-terminus of the 32 amino acids of natural eel calcitonin. The amino acids shown in parentheses at positions 26, 27, and 29 in the above sequence are amino acids in salmon calcitonin derivatives.

That is, in the eel calcitonin derivative, asparagine, the amino acid at position 26 in the salmon calcitonin derivative, is replaced with aspartic acid, threonine, the amino acid at position 27, is replaced with valine, and serine, the amino acid at position 29, is replaced with alanine. .

There are five repeating amino acids in the above amino acid sequence, and it is generally difficult to chemically synthesize a structural gene encoding such a peptide. [For example, J. Windass et al.
cleic Ac1ds Research).

6639 (1982)]. However, the present inventors have already developed salmon calcitonin precursor (derivative) i! by the method described in detail in JP-A-59-170492. It synthesizes the I gene. Therefore, as mentioned above, the synthesis of the gene for the eel calcitonin derivative, which differs only in three amino acids from the amino acid sequence of the salmon calcitonin derivative, is possible by using the already synthesized salmon calcitonin derivative gene using the known mutagenesis method. For example, specific base substitution mutation using oligonucleotide primers (Directed a+uta-Lion)
This is advantageously carried out by treatment by means of a method.

The gene synthesized by the method described in JP-A-59-170492 has the following base sequence: Positive 1j: TGCTCCAATCTCTCTACT-Negative H: ACGAGGTTAGAGAC; ATGA-TG
CGTTCTGGGGAAGTTGAGT-ACGCA
AGACCCCTTCAACTCA-CAGGAATT
ACATAAGCTGCAA-GTCCTTAATGT
ATTCGACG1'T-ACTTACCCGCGTA
CCAACACT-TGAATGGGCGCATGGT
TGTGA-GGTTCTGGTACACCTGGTC
CAAC; has ACCATGTGGACCA, C70
It is called. The plasmid containing this gene CT2 is called pSCT2, and the Escherichia coli bacterium containing this plasmid ([1sche-richia c
oli) RRI/pSCT 2 is published by Microtechnical Research Institute No. 7775.
No. (FERM P-7775) and has been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology. The method for producing this plasmid is described in detail in Reference Example 1.

In the present invention, by subjecting the salmon calcitonin derivative gene to specific base substitution mutations, codons for asparagine, threonine, and serine, which are amino acids at positions 26, 27, and 29 of the salmon calcitonin derivative, that is, AAG , ACT and TCT respectively aspartic acid, valine and alanine codons, e.g. GA
C, GTT, and GCT to obtain a gene for an eel calcitonin derivative. Because these codons are close to each other in the base sequence, one primer oligonucleotide, such as the following sequence: 5" TGGTCGTGGTTGCAGCCATGCG
Synthetic oligonucleotides having C3°Ala νa"^sp can be used to perform the above mutations.

This mutation process is performed, for example, as follows.

That is, the plasmid pSCT2 was treated with the restriction enzyme U!
and Sal r to obtain a 0.6 kbp fragment.

On the other hand, double-stranded DNA of phage M 13mp 9 is Σ! and 2.7 kbp by cutting with Sal I
Get a fragment of. These are ligated using T4 DNA ligase, used to transform Escherichia coli JM103, and the transformant is cultured to obtain single-stranded recombinant phage DNA. One tM DNA containing the anticoding 1 yen (negative strand) of the salmon calcitonin derivative gene thus obtained is obtained. This recombinant phage is called C7M31. This one phage li D N
Using the above primer with A as a poem, use two ti D
After forming NA, it is purified and used to transform E. coli JM103. The phage plaques are then screened using, for example, the following synthetic oligonucleotide probe labeled with 32P: 5° TCGTGGTTGCAGCCA 3' to obtain mutant phages. The nucleotide sequence is determined, and a phage containing the gene (eel calcitonin derivative gene) into which the desired mutation has been introduced is selected, and this is designated as C7M41.

The gene encoding the eel calcitonin derivative obtained in this way has the following base sequence: Sada Masaaki: TC; CTCCAATCTCTCTAC
T-negative chain: ACGAGGTTAGAGAGATGA-
TGCGTTCTGGGGAAGTTGAGT-ACG
CAAGACCCCTTCAACTCA-CAGGAA
TTACATAAGCTGCAA-GTCCTTAAT
GTATTCGACGTT-ACTTACCCGGT
ACCGACGTT-TGAATGGGCGCATGG
CTGCAA-GGTC;CTGGTACACCTGG
TCCACGACCATGTGGACCA.

In addition, salmon calcitonin EA 8 gene (phage C
TM31 part), eel calcitonin derivative gene (
The nucleotide sequences of the CTM41 portion), the primer oligonucleotide, and the probe oligonucleotide are shown in FIG. 1 together with the amino acid sequences of the salmon calcitonin derivative and the eel calcitonin derivative.

(2) DNA encoding fusion white 1 Generally, in order to produce a low molecular weight peptide such as calcitonin in Escherichia coli, it is first collected as a stable high molecular weight protein fused with another protein, and then this is in vitro. It is said to be advisable to cleave to obtain the desired low molecular weight peptide. As a protein constituting such a fusion protein, metapyrocatechase or a portion thereof is preferably used in the production of the eel calcitonin derivative of the present invention from the viewpoint of convenience of purification. In addition, in order to obtain the desired calcitonin derivative by cleaving the fusion protein after collecting it, methionine is inserted at the cleavage site between the first amino acid of the Zunawara calcitonin derivative and the C-terminal amino acid of the metapyrocatechase protein. It is preferable to force it.

Therefore, in the present invention, as a DNA fragment of this part, for example, a DNA fragment consisting of a gene encoding an eel calcitonin derivative and a metapyrocatechase gene located upstream thereof via the methionine codon ATG, or a part thereof can be used. I can do it. This metapyrocatechase gene or a portion thereof is used to obtain high translation efficiency.
Preferably, it consists of the SD sequence of the metavirocatecase gene and the metavirocatecase structural gene or a portion thereof.

The size of the metapyrocatechase structural gene portion can vary widely.

(3) Summary The expression plasmid of the present invention is an E. coli plasmid containing an E. coli promoter system and the fusion protein gene in this order. As a promoter system, for example, 1acUV
5 type, Pt type, Lac type, etc. can be used.

A specific example of the expression plasmid is the expression plasmid pCTM4 obtained by inserting the eel calcitonin derivative gene of the phage CTM41 into the expression plasmid pTccMl.

Plasmid ρTCCMI is a plasmid containing the tac promoter and the metapyrocatechase gene (C230) downstream thereof, and Escherichia coli RB7 containing this plasmid
91/pTccM1 as FERM P-7780,
And JM103/pTccM1 is FIERMP-77
81, each has been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology.

When constructing plasmid ρCTM 40, please refer to Figure 2 (A
), by digesting the double-stranded version of phage CTM41 containing the eel calcitonin derivative gene (indicated by CT in the figure) with EC0RI, the eel calcitonin derivative gene located upstream of the methionine codon at position 0 of the eel calcitonin gene was digested with EC0RI. The EcoR1 site located near the EcoR1 site is cut and smoothed by fill-in, and the EcoR1 site located downstream of the eel calcitonin derivative gene is further cut with ΣNiji1. Next, 590 containing the eel calcitonin derivative gene
A small fragment of bp is isolated.

On the other hand, by digesting the plasmid pTccM1 with Aval, the metaviral tecase gene (
The Ava1 site located in the middle of (indicated by C230 in the figure) is cut and smoothed by fill-in.

Next, the 2,940 bp large fragment in which the downstream portion of the metavirocatechase gene has been removed is isolated by cutting the Σall site (located downstream of the metavirocatechase gene).

Next, these two fragments were ligated using T4 DNA ligase and used to transform Escherichia coli strain JM103, and a clone containing a plasmid into which the eel calcitonin derivative gene had been properly inserted was subjected to colony hybridization, silanization, and nucleotide sequencing. The selection is made based on the decision etc. One such plasmid is designated pCTM4. Eel calcitonin derivative gene (C7M41
origin) and the upstream region of the metapyrocatechase gene (pTCC
The base sequence of the connecting region with the downstream region of M1 (derived from M1) is shown in FIG. 2(B).

This plasmid pCTM 4 contains a gene encoding a fusion protein (174 amino acids in total) consisting of amino acids of metaviral tecase and 33 amino acids of an eel calcitonin derivative downstream thereof under the control of the Lac promoter. E. coli containing this plasmid
Cori (Ecscherichia Kumidan) JM103/
pCTM4 has been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology as FERM P-8239.

By introducing the expression plasmid described above into E. coli, an E. coli strain capable of producing the fusion protein can be obtained. Examples of hosts for this include R8791 strain, JM103 strain,
W3110 strain, R old strain, 5M32 strain, etc. can be used.

Cultivation is carried out according to a conventional method, for example, in LB medium under aerobic conditions. In order to maintain a host containing the target plasmid, it is preferable to add ampicillin, for example, about 50 μg/ml to the medium. The bacterial cell concentration is the desired concentration, e.g.
When the optical density at 00 nm reaches 0.3 to 0.6, as an inducer, for example, isopropy+-β-D-thiogalactopyranoside [1sopropy+-β-D-thi
ogalactopyranoside; abbreviated as IPTG] is added, for example, to a final concentration of 1 mM,
Cultivate for a further several hours, for example 2 to 8 hours.

After the culture is completed, the bacterial cells are separated according to conventional methods such as centrifugation and filtration, and if desired, the bacterial cells are added to an appropriate buffer solution, such as pH
Wash with 7,5 potassium phosphate 11fJiM. Next, the bacterial cells are disrupted by conventional methods such as lysozyme treatment and ultrasonication, and the precipitated fraction is collected by centrifugation. If desired, the precipitate is washed by resuspending it in, for example, a potassium phosphate buffer and centrifuging it again to collect the precipitate.

By such treatment, most of the target fusion protein is recovered in the precipitate fraction, and contaminant proteins are dissolved in the supernatant fraction and removed. The fact that the desired fusion protein can be separated from contaminant proteins by such a simple operation is significant.
One of the major features of this invention is that the eel calcitonin derivative is expressed as a fusion protein with metapyrocatechase.

Next, in order to further purify the insoluble fraction thus obtained, it is dissolved in an aqueous solution of guanidine hydrochloride, and this solution is dialyzed to remove guanidine hydrochloride to precipitate the fusion protein, which is then recovered by a method such as centrifugation. . If desired, this precipitate can be redissolved in guanidine hydrochloride solution and further purified by chromatography.

Next, the fusion protein thus recovered is cleaved at its methionine portion using CNBr in a conventional manner to release the desired eel calcitonin derivative.

Finally, this eel calcitonin derivative is purified according to a conventional method. In this purification, for example, CI8 column chromatography, TSK G200O8W column chromatography, etc. are suitable.

(5) Analysis of purified eel calcitonin-induced λ The results of amino acid analysis are shown in the following table.

The theoretical value of Cl31 in the table below is the value when it is assumed that cry is present at the C-terminus. The amino acid composition of the peptide obtained by the present invention was comparable to that of the eel calcitonin described in the literature with the addition of a glycine residue.

Furthermore, when the amino acid sequence was determined using an amino acid sequencer, it was confirmed that the amino acid sequence was the same as that of the predicted eel calcitonin derivative.

Next, the present invention will be explained in more detail with reference to Examples.

1) (Figure 1) 1) Preparation of single-stranded template DNA Plasmid p containing the salmon calcitonin derivative gene
Dan11-Gota jO, 6 kbp DNA fragment 0.5 μm containing the salmon calcitonin derivative gene from SCT 2
ol and a 12.7kbp DNA fragment from M13 phage mp9 double-stranded DNA, 0.5p ta
55 mM Tris-11 (l
(pH 7,5), 5 m M MgCj! t, 5
Solution 20 containing m M D T T and 1m MATP
μ! After a ligation reaction using 100 units of T4 DNA ligase at 12°C for 16 hours, the reaction solution was used to perform meshing or other methods [such as meshing, etc.].
Methods in Enzymology
Escherichia coli JM103 was transformed according to ymology) YuOf, 20-78゜1983), and 0.02%
Plated with soft agar containing ga+ and l mV IPTG and cultured overnight at 37°C. Single-stranded template DNA was prepared from white plaques formed by the recombinant. That is, pick up the white plaque with the tip of a toothpick and add 1.5 ml of 2XY containing E. coli JM103.
Suspended in T culture medium (1.6% Bactodrypton, 1% yeast extract and 0.5% Mace) at 37°C.
The cells were cultured for 5 hours, and single-stranded recombinant phage DNA was recovered from the culture supernatant by polyethylene glycol precipitation, phenol treatment, and ethanol precipitation.

Using the obtained single-stranded DNA as a template, the base sequence was determined by the dideoxy method according to the method of Messing et al. (cited above), and the sequence of the cloned single-stranded DNA was expressed as l+
1! Approved. In this way, one DNA containing the anticoding strand of the salmon calcitonin derivative gene was obtained. This recombinant phage was named C7M31.

2) Double-stranded DNA using oligonucleotide as a primer
Synthesis of A One piece of C7M31 obtained as above tM D
Synthetic oligonucleotide: 5' using NA as a template
TGGTCGTGGTTGCAGCCATGCGC3
DNA polymerase Kleno with ゜ as a primer
A repair reaction using the w fragment was performed. That is, mold 1 zero 9
i DNA 0.5 pmole was added with 5'-terminally phosphorylated Brimer'l pmole, and 7
mM Tris-IICl (pH 7,5), 0.1
mM EDTA, 20mM NaCl and 7mM
20 ml at 60°C in 10 pl of a solution containing Mg (Jt).
It was held for 20 minutes, followed by a 20 minute hold at 23°C. Additionally, dATP, dGTP, dTT were added to this reaction mixture.
P and dCTP were added to 0.5mM each, the total volume was 20μl, and DNA polymerase Klen was added.
Two units of ow fragment were added and incubated for 20 minutes at 23°C. Next, 1μ of 10mM ATP!
and 1 unit of T4 DNA ligase were added and incubated overnight at 12°C.

3) Separation of double-stranded DNA by agarose gel electrophoresis To remove background unreacted single-stranded DNA from the two $I DNAs obtained as above, the total amount of the reaction solution was 2 μg. Separation was performed by electrophoresis on a 0.8% agarose gel containing /me ethidium bromide. After confirming the target double-stranded DNA, cut out the gel piece of that part and put it in a dialysis tube,
After filling with M tris-borate and 2mM EDTA buffer and sealing, the DNA in the gel was eluted by electrophoresis in the same buffer at a constant voltage of 50 μm for 12 hours. Then DN
A was taken out from the dialysis tube and freeze-dried, and the dried product was
Dissolve in 00 μl of distilled water and add to the ion exchange disposable column Elutip-d (Schleicher
&5chue11).

4) Transformation of E. coli JM103 E. coli JM103 was transformed using the above double-stranded DNA O,l pmole according to the method of meshing.

5) Search for mutants Regarding the phage plaques obtained as above,
Synthetic oligonucleotide: 5' TCGTGGTTGCAGCC^ 3' (!!
Mutant phages were screened by plaque hybridization using the phage (identified with P) as a probe. That is, the method of Benton-Davis et al. (W, D., Benton and Ro-, Davis, Science 196.180°1977).
Plaques were transferred from soft agar to nitrocellulose filters and baked in vacuo at 80'C for 2 hours. This nitrocellulose filter is 6 x S
Hybridization was performed overnight at 23°C in SC, 10X Denhardt solution using a 3tp-labeled primer oligonucleotide as a probe. The filter was then washed in 6XSSC at 46°C and
Then, autoradiography was performed and mutant phage plaques showing positive signals were isolated.

6) Determining the base sequence of the mutant DNA The base sequence was determined by the dideoxy method using the mutant phage DNA as a template, and it was confirmed that a base substitution mutation had occurred and that a phage containing the eel calcitonin derivative gene was obtained. This mutant phage plaque strain JM103/C
It was named TM41.

Double-stranded DNA of Chisen Shichu Phage CTM41 10ps+ole
, 10mM Tris-C1 (pH 7,5), 0.
7 mM 14gC1z.

20 units of E in 100 II buffer containing 5 mM NaCl and 0.7 mM β-mercaptoethanol.
Digested with coRI for 4 hours at 37°C, the reaction mixture was extracted with phenol and chloroform, the DNA was precipitated with ethanol, and the precipitate was dried. This DNA, 5
0mM Tris-CI! (pH 8.0), 75mM NaCl, 10mM Mgcl, 5mM β-mercaptoethanol, and 0.25mM each of dATP.
A fill-in reaction was performed for 2 hours at 37°C with 20 units of DAN polymerase Klenow fragment in 100 μl of buffer containing dGTP, dCTP, dTTP, and ATP. The reaction extract was extracted with phenol and chloroform, the DNA was precipitated with ethanol, and dried. This DNA was treated with 1mM Tri
s-C1 (pH 7,5), 0.7 mM MgC1z
115mM NaCj! , 100A of buffer containing 0.7mM β-mercaptoethanol and 0.02mM EDTA! 3 by Σall of 8 units in f
Digestion was performed for 2 hours at 7°C. This reaction solution was electrophoretically separated on a 1 to 2% agarose gel containing ethidium bromide, the gel portion containing small DNA fragments was cut out, and the desired DNA fragment was extracted by electroelution using a dialysis membrane. It eluted. DNA fragments were precipitated from the eluate with ethanol, and the precipitate was dried and dissolved in 40 μl of water.

10 pmole of DNA of plasmid pTccM1,
1mM Tris-Cj! (pH 7,4), 1 m
Mg(J, 5mM NaCl and 0.1mM E
20 units of A in 100 μβ buffer containing DTA
Digested with va+ for 4 hours at 37°C. The reaction mixture was extracted with phenol and chloroform, and the DNA
was precipitated with ethanol, and the precipitate was dried. After this C
Fill-in reaction in the same manner as the treatment of TM41 DNA,
After digestion with 5ail and gel separation of the DNA fragments, a solution containing the target fragments was obtained. [40 μl was obtained.

5μβ of each solution containing the above DNA fragments was added with 25mM N-2-hydroxyethylpiperazine N'
-2-ethanesulfonic acid (HIEPES) (ρ117
．． 8), 30 units of T 4 DNA in a total of 100 μβ of buffer containing 7 mM MgC1z, 12 mM dithiothreitol and 0.4 mM ATP.
Ligation was performed using IJ gauze at 16°C for 24 hours.

Escherichia coli JM103 (competent cells that had been cryopreserved) was transformed using 10 μl of this reaction mixture.

For the E. coli colonies treated in this way, calcitonin derivative structural gene U31 fragment (GGGAA
GTTGAGTCAG) (see Reference Example 1) was used to perform colony hybridization, and positive colonies were obtained at a frequency of about 60%. An expression test was performed on these positive strains, and a strain expressing a protein of about 19,100 daltons was selected. Plasmid DNA was prepared from these strains, and calcitonin derivative structural gene L-417 fragment (GTAATTCCTGACTC
＾) (see Reference Example 1) was used as a probe to determine the base sequence by dideoxy sequencing method,
It was confirmed that the eel calcitonin derivative gene was inserted appropriately. This plasmid is called ρCTM4.

This plasmid contains a gene encoding a fusion protein of metapyrocatechase and eel calcitonin derivative under the control of the tac promoter.

1゛111)
E. coli strain JM103 containing culture plasmid pCTM 4 at 50 μg/m 7! LB medium containing ampicillin lQmj! The cells were cultured overnight at 37°C with shaking.

Next, this culture solution IQml was inoculated into the same medium of Ia, and
The cells were cultured at 37° C. for an hour, and when OD s S-0 reached approximately 0.5, IPTG was added to a final concentration of 1 mM, and the cells were further cultured for 6 hours.

(2) Isolation of fusion protein The culture solution obtained as described above was heated at 600 rpm for 15 minutes.
Bacterial cells were collected by centrifugation for a minute. 5 for this
Add 0mg of Norizozyme, suspend in 50mM potassium phosphate buffer (pH 7, 5, containing 10mM EDTA), bind at 50m/h, leave at 0°C for 30 minutes, and then
It was crushed by ultrasonication twice for 5 minutes each. This was centrifuged at 10,000 rp+w for 30 minutes at 4°C to separate it into a supernatant (5-1 in Figure 3) and an insoluble fraction (5P1 in Figure 3). As shown in Figure 3,
In S, DS-polyacrylamide gel electrophoresis,
Most of the protein was present in the insoluble fraction. This insoluble fraction was resuspended in 5Qml of the same phosphate buffer as above, and centrifuged at 10,000 rpm for 30 minutes at 4°C to separate the supernatant (5-2 in Figure 3) and the insoluble fraction. (5P2 in Figure 3). Approximately 19 as shown in Figure 3
Most of the protein, including the 100 Dalton fusion protein of interest, was present in the insoluble fraction. This insoluble fraction was
1 in a 7M guanidine hydrochloride aqueous solution and incubated at 0°C for 30
The fusion protein was solubilized by standing for a minute. This solubilized fraction mainly contained the target fusion protein (5P-3 in Figure 3). This was centrifuged at 8.00 rpm for 15 minutes to obtain a supernatant containing the fusion protein. This solution was dialyzed against distilled water to remove guanidine hydrochloride, thereby precipitating the fusion protein. After adding about 59 mN of distilled water to this precipitate, it was freeze-dried to obtain about 280 mg of pale yellow powder.

(3) Isolation of eel calcitonin derivative
The fusion protein was cleaved by adding 70% m1 of formic acid and further 500 mg of CNBr and placing the mixture in the dark at room temperature to release the eel calcitonin derivative peptide from the metapyrocatechase protein. Next, this mixture was diluted with water and lyophilized to obtain about 260 mg of white powder.

Next, 20 ml of 10.1% trifluoroacetic acid (TFA) was added to the lyophilized powder and chromatographed using a CI8 column. 10%-50% C1h in 0.1% TFA
Both fractions were separated by linear gradient elution with CN. This situation is shown in Figure 4.
Reversed phase high performance liquid chromatography using 04 column (
Salmon calcitonin was analyzed using reverse phase 11PLC).
Both samples (4th sample) have almost the same retention time as the standard sample.
(indicated by arrows in the figure) was fractionated. Next, this fraction was converted into TSK-
0.0 by gel filtration HPLC using G2000SW
Purified in 5% TFA. This situation is shown in FIG. Both fractions, which have almost the same molecular weight as the salmon calcitonin l sample, were fractionated and subjected to reverse phase HP analysis using a semi-preparative RP-304 column.
It was further purified twice by LC, and both fractions having approximately the same molecular weight as the salmon calcitonin sample were separated. The state of this second reverse phase It PLC is shown in FIG. This eel calcitonin derivative-containing fraction was transferred to RP304 reverse phase 11
PLc and TSK-G2000 SW gel filtration + 1PL
When analyzed by c, Figure 7(A) and
As shown in (B), a single peak showing almost the same molecular weight as the salmon calcitonin l standard was obtained, confirming that a uniform eel calcitonin derivative was obtained. By freeze-drying both homogeneous portions, a 200 μm white powder of eel calcitonin derivative was obtained.

Figure 8 shows the sequence of the salmon calcitonin derivative gene of the present invention. Chemical synthesis of these oligonucleotides was carried out using the phosphotriester solid phase method. To synthesize oligonucleotides, 40 mg (2.2 μm 0
15 mg of CGSAA for each cytosine nucleoside
and 10 mg each of dimer units of AG, CC, CC, TT, and AT were reacted sequentially.

In one condensation operation, 20 mg of 2.4.
16-) Dimethylbenzenesulfonyl-3-nitrotriazolide (MSNT) was used to react in 350 μl of anhydrous pyridine at room temperature for 1 hour. After the reaction, the solid was washed with pyridine and 1
Camping reaction was carried out in 0% anhydrous pyridine acetate solution at room temperature for 3 minutes.

After washing with pyridine and dichloromethane solutions, 3%
Dimethoxytrityl (D
MTr)% was removed. After this, dichloromethane,
The water in the reaction vessel is completely removed by washing with tetrahydrofuran (THF) and azeotropic dehydration with pyridine, and the next condensation reaction is continued. The average condensation yield calculated from the removal rate of DMTr groups was 91%.

Next, an oligonucleotide containing a -31 protecting group was synthesized by continuous condensation reaction using 40 mg of nucleoside resin, and a 50% dioxane aqueous solution of 0.5 M pyridine aldoxime and tetramethylguanidine (TMG) was added at 1.5 mA. ' and reacted at 30°C for 2 days. After concentrating and recovering the solvent, it was reacted with 2 ml of an aqueous pyridine solution containing 22% ammonia at 55° C. for 5 hours in a sealed tube.

These reactions cleave the bond between the nucleoside and the resin, and protect the phosphate group of the internucleotide bond and the nucleobase i! group has been removed.

After removing the resin by filtration and removing ammonia by vacuum concentration, the obtained oligonucleotide containing a protecting group at the 5' end was transferred to a C-18 disposable column 5.
eppak (Waters).

After 20 ml of a 15% acetonitrile aqueous solution is passed through the column, 2 ml of a 30% acetonitrile aqueous solution is added to the column, and the target substance is eluted and flows out.

Equivalent amounts of acetic acid were added to both eluted fractions and reacted for half an hour at room temperature to remove the DMTr group. After removing acetic acid by ether extraction and azeotropic dehydration, the solvent was replaced with ethanol, and 3,0
The oligonucleotide was sedimented by centrifugation at 00 rpm for 10 minutes. After removing the supernatant, ethanol was removed under reduced pressure, and the solution was dissolved in 100 μE of distilled water.

Purification by HPLC was performed using μBondpak C-18 (W
Aters) column was used in a solvent system of 001M triethylamine acetate aqueous solution and acetonitrile.

Start with acetonitrile concentration of 10% and increase it every minute to 0.
It was ramped up at a 6% gradient for 60 minutes. Elution was performed at a flow rate of 1 ml per minute, and the peak of interest was collected using a fluxin collector (Gilson) and lyophilized.

It was purified by performing one preparative production three times.
An oligonucleotide of 210D (measured at 260 mμ) was obtained.

Other oligonucleotides were synthesized in the same manner. The purity of the synthesized fragment was determined by one-dimensional homochromatography as T+iL=.

The Rr value in one-dimensional homochromatography is shown as the physical property of the oligonucleotide.

Array R, value U 1 16mer AACATGTGCT
CCAATCO, 14U 2 17a+er TCT
CTACTTGCGTTCTG O, 17U31
15mer GGGAAGTTGAGTCAG
O,19U 41 15mer GA^T
TACATAAGCTG O, 17U
5 15mer CAAACTTTACCCGGT
O,15U 6 17mer ACCAA
CACTGGTTCTGG 0.10U 7
18mer TACACCTGGTTAATAGAT
O,10L 1 8mer CACATG
TTO, 26L 2 17m
er AAGTAGAGAGATTGGAG
Q,lOL 31 15mer ACTTCC
CCAGAACGCO, 13L 4 15mer
GCAGTTCCTGGGACA O, 13
L41 15a+er GTAATTCCTGACT
CA O, 15L 5 16mer T
AAGTTTGCAGCTTAT O,14L
6 17a+er CAGTGTTGGTACG
CGGG O,08L 7 14a+er
AGGTGTACCAGAACO, 17L 8 1
3a+er CGATCTATTAACCO, 21 and for half of the fragments, two-dimensional homochromatography methods (e.g., R, Bambara et al., NAR
±331 (1974)) or the Maxam, Gilbert method (e.g., Maxam et al., Men's in
Methods in Enzymo
The purity and nucleotide sequence were confirmed using the following method (see 65499 (1980)).

Figure 9 shows subblocks produced by enzymatic reaction. For example, to produce subblocks 3-5, each of the 10 fragments constituting the subblock must be
Dilute 0pml with distilled water to 9μ! Toshi, 10pc
i no r (32p) ATP (3100ci/en-o
l) and dilute the solution with 50 mM Tris-HCl, ρ11
9.6.10mM MgC1*, 2mM spermine,
Adjustments were made to 100mM MCI and 1OmMDTT, and 4 units of polynucleotide kinase was added to bring the total volume to 15μ. 5 by reacting at 37℃ for 30 minutes.
In order to phosphorylate all the 5' ends of the 0-terminus labeled with 32p, ATP of lnmoZ and 1 unit of polynucleotide kinase were added and reacted at 37°C for 60 minutes.

After the reaction, the 10 fragments were mixed and purified using a C-18 disposable column 5eppak (Ha Lers) as described above. The eluted DNA solution was concentrated and subjected to ethanol precipitation to precipitate the DNA. After removing the supernatant, the ethanol was removed under reduced pressure, and the dried product was diluted with 40μ2 of ligase buffer (25mM N-2-hydroxyethylpiperazine N'-2-ethanesulfonic acid (N'-2-ethanesulfonic acid).
HEPES) pl+ 7.8.7.5mM MgCl
,) was dissolved in. This solution was placed in a 1.5 ml empendorf tube and heated at 65°C for 10 minutes and at 42°C for 30 minutes, and then the 10 fragments were allowed to adhere at 0°C. This DNA solution was mixed with 0.2 mM ATP,
Make a ligase buffer solution containing 6mM DTT, add 8 units of T4 ligase, make a total volume of 50μ2, and incubate at 12°C for 1 hour.
The reaction was allowed to proceed for 6 hours.

A portion of the reaction solution was taken out and examined by 2% polyacrylamide gel electrophoresis. Two types of gels were used, one containing 7M urea and one without. After electrophoresis, radioautography was performed, and a densitometer (HEL) was used.
The composition of the reactants was investigated using ena Laboratories). As a result, DNA corresponding to 78 bases and 93 bases was generated at a ratio of 15% and 27%. I synthesized other Zab blocks in the same way.

The synthesis yield was as follows.

Subblock Yield (%) Subblocks were assembled and linked to produce the entire nucleotide sequence. That is, 1.5 mj of each 45 μp of the reaction solution after the glue gauze reaction of subblocks 3-5 and 3-7 is completed!
After mixing in an Eppendorf tube and heating at 65°C for 10 minutes and 42°C for 30 minutes, the subblock DNAs were allowed to adhere to each other at 0°C. Add 3Qna+ol ATP and 500 nsol DT to this DNA solution.
Add T, add T4 ligase ILit 1st position, and bring the total amount to 10
0IJ1 and allowed to react at 12°C for 16 hours.

Examining the composition of the reactants, we found that DNA corresponding to the pairing of bases 113 and 115 was produced at a rate of 23% of the total (see Figure 10).

Next, the entire amount of the above reaction solution was separated by electrophoresis on 12% polyacrylamide containing 7M urea.

6'ff of target DNA by radioautography
After confirming this, cut out that part of the gel piece, put it in a dialysis tube, fill it with 89mM lithoboric acid, 2mM EDTA buffer, seal it, and electrophores the gel in the same buffer at a constant voltage of 50V for 12 hours. After the DNA was eluted, the DNA was taken out from the dialysis tube and freeze-dried, and the dried product was filtrated.

Dissolve in μl of distilled water and add to the ion exchange disposable column Elutip-d (Schleicher &
5chuell).

All genes produced were phosphorylated at their 5' ends using T4 polynucleotide kinase and ATP.

Jal fragment of plasmid pH72 and Jal I,
A recombinant plasmid was constructed in which the salmon calcitonin gene was incorporated so that the restriction enzyme recognition sequence of Cymbo I was reproduced (see Figure 11).

That is, 20 μg of pH 72 (7) was added to 100. c.
+J (7) Coa + reaction solution (6mM Tris hydrochloric acid, pH?, 9.6mMMgCj!2.50mM Na
In C1), 10 units of restriction enzyme I was added, the reaction was carried out at 37°C for 60 minutes, and the DNA was precipitated by ethanol precipitation.

This DNA precipitate was added to 100 μl of Dang1 reaction solution (10 mM
Tris HCl, pl+7.5.7 mM HgClt
, 100mM MCI, 7mM β-mercaptoethanol), 15 units of restriction enzyme Dan I was added thereto, and the reaction was carried out at 37°C for 90 minutes. Furthermore, 0.08 unit of Escherichia coli alkaline phosphatase (RAP) was added to the reaction solution, and the reaction was carried out at 65° C. for 30 minutes to dephosphorylate the 5' end. After washing the reaction solution with 100 μl of phenol,
7% agarose gel electrophoresis (AGE) was performed, and large NA fragments were collected by electrophoresis.

0.5 psol of pHT2 C1a + - one animal fragment DNA obtained in this way and 0.5 μmoj+ of salmon calcitonin derivative gene containing a phosphate group at the 5' end,
T, DNA ligation reaction solution 20μm (25mM
II EPES, pH 7, 8, 7, 5mM Mg
Cj! t 10.2mM ATP, 6mM DTT), T, DNAIJgar-t'3 units and 20'C
After reacting for 6 hours, 10 μl of the reaction mixture was used to transform E. coli strain RRI, and transformants resistant to 100 μg and 7 ml of ampicillin were selected. RRI the transformed strain of the frozen subblocks 3-5 and 3-7 in Figure 8.
/pscr2.

The nucleotide sequence of the salmon calcitonin derivative gene in the plasmid of the above transformed strain was analyzed as follows.

That is, 15 μg of pSCT2 plasmid DNA was cut with 15 units of restriction enzyme Finger I, the 5' end was dephosphorylated with E. coli alkaline phosphatase, and then cleaved with r-C', p, ) ATP and polynucleotide kinase. 0-order 15 labeled with 3JP at the 5' end
After digestion with the restriction enzyme Bam1ll, the desired DNA fragment was purified, and its nucleotide sequence was determined by the Maxam and Gilbert method. As a result, the plasmid had the designed base sequence.

[Brief explanation of drawings]

FIG. 1 shows the relationship between the base sequence of the salmon calcitonin derivative gene, the amino acid sequence of the salmon calcitonin derivative, the base sequence of the eel calcitonin derivative gene, the amino acid sequence of the eel calcitonin derivative, a primer oligonucleotide, and a probe oligonucleotide. Figure 2 (A) shows phage CTM41 and plasmid pTc.
shows the construction of plasmid pCTM4 from cM1 and
(B) shows the base sequence of the junction between the pTccM1-derived DNA fragment and the C7M41-derived DNA fragment. FIG. 3 shows the purification process of the fusion protein produced by E. coli containing plasmid pCTM4. FIG. 4 shows the purification of an eel calcitonin derivative by C1B column chromatography. Figure 5 shows the TSK-Gel G elution fraction from the 018 column.
The state of purification by gel filtration using a 200OS-column is shown. Figure 6 shows reverse phase 11PLC using RP-304 column.
The state of purification is shown. Figure 7 shows the final fraction l? P304 Reverse Phase II P L
Results of analysis by C (A) and KS-G2000 S
The results of analysis using W gel (B) are shown. FIG. 8 is an overall diagram of the salmon calcitonin derivative gene (including the structural gene and its surrounding parts). FIG. 9 is a diagram showing the configuration of subblocks used for the synthesis of the salmon calcitonin derivative gene, and the mark ・indicates the addition of a phosphate group by an enzyme. FIG. 10 is an autoradiogram showing that salmon calcitonin derivative genes are produced from subblocks 3-5 and 3-7. Figure 11 shows the construction of plasmid pSCT2. S-4P-I S-2P-25P-31 Fig. 3'::AT :A CGC Fraction Fig. 5 Fig. 6 Fig. 7 (A) ↓ Fig. 7 (B) Fig. 9 Front line --- --- Marker (number of bases) Bottom line 3-A 3-7 Figure 10 after reaction Figure 11

Claims (1)

[Claims] 1. A gene encoding an eel calcitonin derivative represented by the following amino acid sequence: [There is an amino acid sequence]. 2. The gene according to claim 1, consisting of the following base sequences: Positive strand: [There is a base sequence] Negative strand: [There is a base sequence]. 3. A method for producing a gene encoding an eel calcitonin derivative represented by the following amino acid sequence: [There is an amino acid sequence], in which the gene encoding the salmon calcitonin derivative contains the 26th Cys from the N-terminus of the salmon calcitonin derivative. Asn, 27th Thr and 2
The codon encoding the 9th Ser is changed to Asp.
, Val and Ala. 4. The method according to claim 3, wherein the replacement is performed by a specific base substitution mutagenesis method using an oligonucleotide primer. 5. The method according to claim 4, wherein the primer has the following base sequence: [There is a base sequence]. 6. The following amino acid sequence: [There is an amino acid sequence] A gene that encodes a fusion protein of an eel calcitonin derivative and another protein. 7. The gene according to claim 6, comprising a gene encoding the eel calcitonin derivative, and a metapyrocatechase gene or a portion thereof located upstream thereof via a methionine codon ATG. 8. A plasmid containing a gene encoding an eel calcitonin derivative consisting of the following amino acid sequence: [There is an amino acid sequence]. 9. The plasmid according to claim 8, comprising an E. coli promoter system, a metapyrocatechase gene or a portion thereof, and a gene encoding said eel calcitonin derivative in this order. 10. The plasmid according to claim 9, wherein the promoter system is a tac system. 11. Claim 1 which is plasmid pCTM4
The plasmid described in item 0. 12. Escherichia coli transformed with a plasmid containing a gene encoding an eel calcitonin derivative consisting of the following amino acid sequence: [There is an amino acid sequence]. 13. The E. coli according to claim 12, which has been transformed with a plasmid comprising, in this order, the E. coli promoter system, the metapyrocatechase gene or a portion thereof, and the gene encoding the eel calcitonin derivative. 14. The E. coli strains are RB791, HB101, and JM1.
03 strain, C600 strain, RR1 strain, SM32 strain, or W3
110 strain as a host.Escherichia coli according to claim 13. 15. Escherichia coli
coli) JM103/pCTM4 (Feikoken Bacteria Serial No. 82
39) according to any one of claims 12 to 14.