JPS61216689A - Cyclic duplex dna, production thereof, microorganism containing said cyclic duplex dna, and production of protein having antigen determining site of poliovirus capside protein vp1 using same - Google Patents

Abstract

PURPOSE:To produce a cyclic duplex DNA in high efficiency, by incising a proper part after the translation start codon of a DNA containing a high- expression promoter operator and a translation-start codon, etc. CONSTITUTION:A DNA containing a high-expression promoter operator, an SD sequence positioned at the downstream side of the operator and dominated by the operator and a translation-start codon are incised with a restriction enzyme at a proper incision part after the translation-start codon. If necessary, the terminal of the incised product is smoothened and a DNA fragment coding a peptide corresponding at least to the amino acid number 92-105 of the capsid protein VP1 of the attenuated poliovirus Sabin1, Sabin2 or Sabin3 is inserted after the translation start codon to obtain the objective cyclic duplex DNA.

Description

Detailed Description of the Invention [Field of Industrial Application] The present invention relates to the production of a protein having the antigen-determining site of the capsid protein tP1 of poliovirus, which is a pathogen of acute poliomyelitis, using genetic recombination technology. It's about technology.

[Prior art and its problems] Currently, immunization against acute poliomyelitis involves treating poliovirus with formalin or other drugs.

This is carried out by parenteral administration of an inactivated vaccine that has lost its infectivity while retaining its antigenicity, or by oral administration of an attenuated poliovirus itself, that is, a live vaccine.

Among these, inactivated vaccines require a large amount of virus to confer immunity, are therefore expensive, and have the disadvantage that the conferred immunity cannot be maintained for a lifetime.

On the other hand, with live vaccines, there is a possibility that highly pathogenic strains may emerge due to mutations that occur on the virus genes during repeated proliferation. Therefore, there is a risk of disease onset due to live vaccination and a problem of depletion of the seed virus, especially the Sabin S type. In addition, there is a risk of administration to immunocompromised individuals, and contamination with monkey tumor virus due to the use of monkey cells.

There are also problems such as difficulty in obtaining monkeys due to emergency vehicles, depletion of monkey resources in the future, and high costs.

Furthermore, attempts have been made to produce immunogenic proteins within Escherichia coli cells instead of inactivated vaccines. That is, van der Werf et al.
[van der Werf, S., et al. Gang, 23, 85 (1983)] and Jiro Marl (Japanese Patent Application Laid-Open No. 5El-173084) reported that the capsid protein VPI of the highly virulent type I strain Mahoney type
The capsid protein VPI is produced in the form of a fusion protein by expressing the cDNA encoding it in Escherichia coli. There is an explanation that the corresponding DNA sequences of attenuated strains such as Sabin 1, 2, and 3 may be used, but there is no specific method or proof of the feasibility of doing so.
Also, Kuge et al. [uge, S., at a
l,; Journal of Biochemistry (Jou
rnal at Bfocbsmftry).

98, 305 (In2)] is the capsid protein VP of Sabinlfi for the first generation motor e! The capsid protein VP1 is produced as a fusion protein by incorporating the cDNA encoding the ampicillin resistance gene into a plasmid and expressing it. However, in both methods, the amount of VPI expressed is extremely small, and there is a desire for a method that can produce a large amount of capsid protein VPI.

Furthermore, when expressed as a fusion protein, the antigenicity and toxicity of the fused peptide may pose problems. In order to solve these problems.

Most preferably, the capsid protein VP1 is expressed in unfused form.

Amino acid number 83 of Sabin3Wi is a polypeptide containing the antigen-determining site of the capsid protein in this form.
A polypeptide corresponding to ~98 has been disclosed (Japanese Patent Publication No. 58-5018H), which was prepared by protein synthesis and not by genetic recombination.

As a result of extensive research to solve the problems of the prior art described above, the present inventors have succeeded in mass producing a protein having the antigen-determining site of the poliovirus carrier protein in a non-fused form. This led to the completion of the present invention.

In addition, in this specification, non-fusion means that it is not fused with a polypeptide other than the protein derived from poliovirus, and the VP3 protein of poliovirus (encoded before VPI) may be attached. Also,
It may be from the middle of the VPt protein.

[Object of the invention] The present invention provides a capsid strain Vl of an attenuated strain of poliovirus.
) It is an object of the present invention to provide a plasmid and a microorganism that can produce a large amount of unfused eggplant and a method for producing the protein using the plasmid and microorganism.

[Configuration of the Invention] The circular double strand of the present invention [INA is a high expression promoter
The attenuated poliovirus strain Sab, which is directly connected to the operator, the SD sequence located in the downstream region under its control, the translation initiation codon, and this so that the reading frame matches the operator.
inl type, Sabin 25! or Sabin3Wi
At least amino acid number 92 of the capsid protein VP1 of
It is characterized by containing a D)IA portion encoding a peptide corresponding to ~105, followed by a translation termination codon.

Examples of the high expression promoter/operator include the incoming phage early gene group (PL) promoter/operator, the Sac UV5 promoter operator, the outgoing promoter operator, and the tac promoter operator.

PH, the promoter operator is 1, e.g. its Hind m -Bas+ HI derived from λ phage
contained in the fragment. Such a fragment may be excised directly from the input phage, or may be excised from other suitable plasmids containing it. Examples of such plasmids include pK030 plasmid [Nature (Na
ture), 292, 128 (1981)] and ]ppi, -to plasmid commercial products).

One example is a DNA sequence containing a PL promoter/operator.

The following formula (1): % formula % (wherein A represents a deoxyhyperdenylic acid group, G represents a deoxycytidylic acid group, C represents a deoxycytidylic acid group, ↑ represents a thymidylic acid group, and X represents a thymidylic acid group. , if the corresponding base of another single-stranded DNA is A, then T, if T, then A, C
When , it represents G; when G, it represents C.). The DNA sequence includes Pl, LLJLd containing the promoter operator
■-BamHI fragment part 1l-LL! It contains a DNA sequence corresponding to the I fragment.

The SO sequences in the present invention include the SD sequence of metapyrocatechase gene, the SD sequence of λC■, and λcr.

SD sequence of gene, SD sequence of 1acZ gene, t
Examples include the rpL nosD sequence and the SD sequence of the tpp gene, but the SD sequence of the metapyrocatechase gene is preferred.

The SD sequence of the metapyrocatechase gene and the HA sequence containing the translation initiation codon ATG are 1, e.g., chemical synthesis 1, coffee'+41y"rrsR&-1, ]-hee, #Illwordi
&nMAWtk4-*Hee, *Jll! It can be obtained by recombining an appropriate expression vector with an 11 promoter operator. Furthermore, such an expression vector may be produced by genetic engineering techniques from an expression vector containing a high expression promoter/operator and the SD sequence of the metapyrocatechase gene. Examples of such an expression vector include the put 3 plasmid ( Nijielisha coli HB 101/pH〒3Feikoken Bacteria No. 7778, Nijielisha coli C800/
pH〒3Feikoken Bacteria No. 7777 and Nijielisha coli W 3ttolpuy3Feikoken Bacteria ゛8
No. 7778, it has been deposited with the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (hereinafter referred to as "Feikoken").

) pH7311 plasmid (Sharkoli HB1
01/pH↑311 has been deposited with the Institute of Fine Arts and Science as No. 7994. ).

Furthermore, examples of expression vectors that have the SD sequence and translation disclosure codon of the metapyrocatechase gene and a cleavable restriction enzyme cleavage site at the back include pYTt13.
Plasmid (Elisha coli HB 101/pYT
tj3, which has been deposited with the Institute of Fine Arts and Technology as No. 7992. ).

The SD sequence and the DNA sequence of the start codon region of this pYTU3 plasmid are expressed by the following formula (■): SO sequence C1aI Sal I (in the formula, A, G
, C and T have the same meanings as above. ).

In the present invention, at least amino acid numbers 112 to 10 of the capsid protein VPI of poliovirus attenuated strain Sabin I type, 5abfn211 or 5abfn3fi are used.
The part encoding the peptide corresponding to 5 may be any DNA sequence as long as it encodes a peptide represented by the following formula: %Formula% Among such DNA sequences, S
Those related to the abinl type include, for example, the pB92 plasmid [Nomoto, Akio, at a
l, H Proceedings National Academic
Science nee nis nee (Proc, atl.

Todoroki cad, Sci, USA), 79.5793 (
In2)] The processed fragment derived from ! A! I
I-LL! I fragment and Bag HI-Hinc
Contained in Fragment II etc.

The DNA sequence of the processed fragment is:

The following formula (m): OO XXXXXXXXXmXXXmXXXXXXXX
300000 [mTTGGTATT Ding...
3° (wherein A, G, C, T and X have the same meanings as above), and the Lj I -LL! The IINA sequence of the I fragment is the following formula (■): OO xxxxxxxmmxxmxxxxxxxx
xxxxxxxmxxxxxnxxxmxxxxxxmmm
αIαxxxmxxxtoo.

1050.

'nyyyyywwywyyynnrw'ntwyyy
wnntwynnmwyyrnrymxxxxxxxxxm
XXXXXXXXXXXXX ℃
oooo+:m (in the formula, A, G, C, ?, and X have the same meanings as above), and the 0
The viewing sequence is.

The following formula (V): xxnxxxxmnnxxxxmm
xxxmmOO xxxxxxxxxxxxxxxxxxn
mαxxxmm! 250 ACATA Ding CGATTCGGACACCAAAACA
AAGCGGTGTACACTGCAGGTTACAA
xxxxxxxxxxxxxxxxxxx
xxxxxxxxxxmxxxxxxxxxxxx AA
TTTGCAACTACGATTTO'GCCACTC
AGGAAGATTTIIXIJA^^CGCAGTO
Axxxxxxxxxxxxxxxxxx
xxxxxxmxxxxxxmmxxxxxx1450
'XXXXXXXXXXXXXXXXXXXX
X) ODDαxxx'>αxmxxxxxxmACA
TG'GAGGCTAATAACTA
CTAGGDingaccactcccTodorokiTTodorokimciCxxx
xxxxxxxxxxxxxxxxxxx
xxxmαmmxxxATTGGCCATGGATTC
GCATCTCCAMAmTACTCAGA'rGxx
xxxxxxxxxxxxxxxxxxxmx
xxxxxxtα)000αxxnxxxxxxTCACC
ACGGGOTOATAGGGATC
TGGTGG Todoroki GA^GOU? ! Tmxxxxxxxxx
xxxxxxxxxxxxxxxxxxmxnmx
mxxxxxxxxxxxxxCATTTACAGACATTA
CACACTTOTATGCCTACl;AAGAA
GAAGCCATGG^TodorokixxxxxxXXXXXXXX
XXXXXXXXXXXXXxxxxxxmxxxxxx
XXXXXXXXXXXCAAGGCATCACCA
GTG'G! XXXXXXXXXXXXXXX
XXXXXXXXXXX)000000αxmxxxxxx
xxx (wherein A, G, C, T and X have the same meanings as above).

In addition, those related to the SabinZ strain are, for example, pVS (2
)! 503 plasmid [Toyoda, Haruki (Toyoda)
, H,) + st al,; Journal of Molecular Biology (J, Mo1., Biol,),
174, 581 (In2)] in its -I-PvuII fragment.

The DNA sequence of the ...nee ■ fragment is.

Taiga (■): xxxxxxxxxxxxxxxxxxxxxx
mxxmxmxmxxxxxxxxxxxxxxxxxx
xnxmxnxxnnnn
O xxxxxxxxxxxxxxxxxxxxxxxxx
xxxmxxxxxxm10G (In the formula, A, G, C, T and
) 2803 plasmid [Toyoda, Hellpower (Toyoda
, u” LetaI-* Journal of Molecular Biology (J, No. 1. Biol,), 17
4.581 (1984)].
- Contained in the In fragment.

The SL! ! The DNA sequence of the ■−田■ fragment is expressed by the following formula (■): So! I got it
yga'nntyny violet! Yn! YnYn! nYxxxxx
xxxxxxxxxxxxxxxxxxx
XXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXX)OC
mmXXXXXXXX)OEXXXXXXmh.

5G cheer□ 5G” xxnxxxxxxxxxxxxxxxxxxxxxxxx
It is represented by xxxxxxxxxxxnxxxxxxxxxxxxxxx (where A, G, C, T and X have the same meanings as above).

The circular double-stranded DNA of the present invention preferably contains a temperature-sensitive gene portion 5° upstream of the high-expression promoter/operator to control its activity, that is, it controls the activity of the high-expression promoter/operator. An example of the temperature-sensitive gene portion that can be used is the cI yield mutant gene of the input phage cI gene. This cI cap (rclts below)
The mutant eel gene (referred to as J) is a gene that encodes a warm W-sensitive repressor of the PI promoter/operator. A DNA fragment containing such a gene may be extracted directly from an input phage, for example. For example, pCQV2 plasmid [
Queen, c.: Journal of Molecular and Applied Synetics
nd Applied Genetics), g (
1), 1 (1983)].

The DNA sequence of the cIts mutant gene portion derived from the pcQV2 plasmid is 1. For example, the following formula (■): 0G 5G xxxxxxxxxxxxxxxxxxxxxxxxx
xxxxxxxxxxxxxxxxxxx
5G 300 (W) XXXXXXXXXXXXXXXXXXX
XXXKXXm) OD [mXXXXXXXXX! Examples include a DNA sequence represented by O0 OO OO...3'AG (wherein A, G, C, T and X have the same meanings as above).

The circular duplex [INA of the present invention preferably contains a portion encoding ampicillin resistance downstream of the temperature-sensitive gene portion, and this portion is
11.1 The circular double-stranded DNA of the present invention can be prepared, for example, as follows.

First, in order to make the N-terminus of the poliovirus VP1 protein into a non-fused form, we used the 1 expression vector pYTU3 (Elisha coli HB 101/pYTU3
It has been deposited with the Institute of Fine Technology as No. 32. ) can be used. The pY'rU3 plasmid was digested with 5alI, the overhanging ends were digested with 51 nuclease to make blunt ends, and the blunt ended poliovirus Sabin was inserted into the pY'rU3 plasmid.
A DNA fragment encoding a type 1, Sabin 2, or Sabin 3 VPI antigen region is inserted. Sab
In the case of the in l type, for example, a fusion type expression plasmid pHTP31 plasmid or pYTP11 plasmid can be used.

The method for preparing the pHTP31 plasmid and the pYTPl 1 plasmid is described in detail in Japanese Patent Application No. 1983-IHaH. These plasmids were designated as N. coli 01100/pHTP31 and N. coli C800/pYTP11 in August 1982.
I requested the deposit to the Microtechnical Research Institute on May 30th, but it was rejected as Rejection Notification No. 53 and No. 1210 and No. 59 and No. 1211, respectively, on the grounds that it corresponds to level 22 (notification (Sun: August 8, 1978).

When using the pHTP31 plasmid, it is digested with the restriction enzyme 5alI and ? A 13 base pair DNA fragment is obtained.

This DNA fragment may be blunt-ended with T4 DNA polymerase and inserted into the blunt-ended 5alI site of pYTυ3 using 74 DNA ligase.
A fragment! -, containing the VPI protein antigenic site, tj Sal
The 713 base pair DNA fragment is circularized again using 4 DNA ligase to obtain pYTP102.

Next, pYTP1 is subjected to an operation to unfusion the C-terminus.
The 02 plasmid was digested with restriction enzymes, and then the 74DN
Make blunt ends with A polymerase. The following formula (■) with translation termination codon TAA in three commercially available frames: 5°...GCTTAATTAATTAAGC...3
゜3″...CGAA-TAATTAATTCG...
5° (wherein A, G%C and T have the same meanings as above.

) The 1B base pair oligonucleotide (hereinafter referred to as "translation termination unit") was phosphorylated at the 5° end using T4 polynucleotide kinase, and this and pYTP102
The plasmid was digested with Kpn I and the DNA and fragments were made blunt-ended with T4 DNA polymerase, and the fragments were adhered and circularized with 74 DNA ligase to obtain a plasmid in pYTP102.

On the other hand, it is also possible to simultaneously construct N-terminal and C-terminal non-fusions. The pYTP11 plasmid was transformed into Pat I
and make blunt ends with T4 DNA polymerase. The DNA fragment and the translation termination unit are attached using T4 DNA ligase. Furthermore, it was digested with restriction enzyme 5alI,
After agarose gel electrophoresis, a 1050 base pair DNA fragment containing the region encoding the VPI protein antigen site is recovered.

The PYTU3 plasmid is double digested with restriction enzymes 5alI and NruI to obtain a 400G base pair DNA fragment, and this and the 1050 base pair DNA fragment are adhesively cyclized using 74 DNA ligase to obtain the pYTP102P plasmid.

For Sabin type 2, for example, the fusion expression plasmid pYTP200 is digested with restriction enzyme 5alI, and after agarose gel electrophoresis is performed, a DNA fragment of approximately 1180 base pairs containing the region encoding the VPI protein antigen site is recovered. The fragment and pYTU3 plasmid were digested with restriction enzyme 1.
1. The pYTP')01 plasmid is constructed by attaching and circling the DNA fragment digested in (2) with 4ONA ligase.

The pYTP201 plasmid is digested with the restriction enzyme NarI and made blunt-ended with T4ONA polymerase.

The DNA fragment and the translation termination unit (union/) treated with T4 polynucleotide kinase and phosphorylated at the 5° end were cyclized with 4 DNA ligase to create pYTP20.
Construct a 1N plasmid.

The method for preparing the pYTP200 plasmid is detailed in Japanese Patent Application No. 193889/1989. The plasmid is Elisha coli CB00/pYTP200
year .

However, the request was made to the Microtech Institute for deposit on August 30, 1982, but it was rejected as Rejection Notification No. 58, Weigyomon No. 1213, on the grounds that it corresponded to level 22 (notification date: 1982). (August 8, 2016).

For Sabin 3 type, for example, after digesting the fusion type expression plasmid pYTP300 with the restriction enzyme Pst I, making the ends blunt with T4 DNA polymerase, then digesting with the restriction enzyme BamHI, and performing agarose gel electrophoresis, 5 approximately 1500 base pairs were obtained. Obtain a DNA fragment.

On the other hand, the pYTU3 plasmid was digested with the restriction enzyme 5alI, blunt-ended with Sl nuclease, then digested with the restriction enzyme BamHI, and after agarose gel electrophoresis, a DNA fragment of approximately 3800 base pairs was recovered. The I) HA fragment and the approximately 1500 base pair fragment were combined into 74D
The pYTP301 plasmid is obtained by adhesive cyclization with NA ligase.

The pYTP301 plasmid was digested with restriction enzymes, and T
4 DNA polymerase to make blunt ends, and then.

The DNA fragment and the translation termination unit treated with 4 polynucleoside kinase and phosphorylated at the 5° end are adhered and circularized using 74 DNA ligase to obtain a plasmid pYTP301.

The method for preparing the pYTP30G plasmid is described in Japanese Patent Application No. 59-1.
938E19. The plasmid is Elisha coli C800/pYTP300
As of August 30, 1981, the request was made to the Microtech Institute for deposit, but it was rejected as Rejection Notification No. 58, Micro-Deposit No. 1214, on the grounds that it corresponded to the P2 level (notification date: 1982). (August 8, 2016).

Among the plasmids obtained as above, pYTP
102, plasmid, pYTP102P plasmid, p
Plasmid in ytp301 is poliovirus Sabi
In addition to the n-type derived polypeptide, it encodes only methionine encoded by ATG at the N-terminus, and only 1 to 2 amino acids encoded by a translation termination unit at the C-terminus.
The pYTP201N plasmid is a poliovirus Sab
In addition to polypeptides derived from the in-type, methionine encoded by ATG at the N-terminus and one or two amino acids encoding a restriction enzyme cleavage site are encoded by a translation termination unit (/) at the C-terminus. Codes for only one amino acid.

In the above operations, digestion with each restriction enzyme, ligation with T4 DNA ligase, screening using ampicillin resistance, and amplification of each plasmid can all be carried out using conventional methods. In addition, conventional techniques such as extraction with phenol, precipitation with ethanol, agarose gel electrophoresis and subsequent extraction techniques, and separation by liquid chromatography can be used to separate and purify each DNA fragment and plasmid.

When the circular double-stranded DNA of the present invention obtained as described above is used as a plasmid to transform a bacterium belonging to the genus Elisha, a protein having the antigen-determining site of the capsid protein VPI (hereinafter referred to as rVP1 non-fusion protein) is produced. Producing bacteria can be obtained.

As the bacteria of the genus Nielisha, it is preferable to use Nielisha coli.

On February 27, 1985, we requested that the typical strain of the VP1 non-fusion protein producing strain obtained as described above be deposited with the Microtech Institute, but the request was rejected on the grounds that it corresponded to level 22. (notification date: March 8, 1980), the strains whose deposit was refused are as follows.

Rejection notification number Nijielisha Cori 0800/pYTP102P 8
0 Minori Bun No. 271 Niji Elisha Cori 0800/pY
TP102K 80 Minor Letter No. 270 Nizie Elisha
Cori Cll100/pYTP201N 80 Minori Bun No. 272 Niji Elisha Cori (JOO/pYTP301
60 Weiyobun No. 273 The present invention also provides a method for producing a poliovirus vaccine, which comprises culturing the transformed strain in a nutrient medium and collecting non-fusion proteins accumulated within the bacterial cells. It is something.

The nutrient medium used in the production method of the present invention is a conventional medium, such as L
B medium, LB agar medium, SB medium, etc. can be used. Drugs such as ampicillin are added to these media as necessary.

In the production method of the present invention, the transformed strain can be cultured by conventional methods such as culture on a solid medium and liquid aeration culture. The culture conditions such as culture temperature and medium liquid quality are also the same as for the strain 1 before transformation, such as N. coli ceoo, N. coli HBIOI.

Niji Elisha Cori w3110, Niji Elisha Cori RB? 91, and similar to that of N. Elisha coli RRI. The culture time is usually about several hours to one day.

The transformed strain used in the production method of the present invention can be transformed into a repressor of a high-expression promoter/operator, such as a PL promoter/operator, by raising the culture temperature from the usual 30°C to about 42°C during or after growth. Since the cIts protein becomes inactive, the promoter/operator is activated and the VP under its control is activated.
The gene portion encoding the I non-fusion protein is strongly transcribed and expressed.

The grown bacterial cells are collected by a conventional method, and after destroying the bacterial cells in an aqueous suspension by ultrasonic treatment or a commonly used bacterial treatment method using enzymes and surfactants, the cells can be treated as needed. After extraction with an aqueous solution containing a high concentration of urea or a denaturing agent such as guanidine hydrochloride, the desired VPI non-fusion protein can be obtained by restoring the activity by dilution or the like. In addition, this extract was added to Tris-HCl buffer (
The target product can be obtained as a soluble protein by dialysis with rTris-H (hereinafter referred to as ILl) and a phosphate buffer.

[Effects of the Invention] According to the present invention, poliovirus capsid protein VPI
It is possible to supply a large amount of a protein having an antigen-determining site in an unfused form. The active protein thus obtained is
It can be used as a detection reagent for poliovirus antibodies, for example, in radioimmunoassay. Furthermore, it is useful for poliovirus vaccines because antibodies against the poliovirus capsid VPI protein can be produced by parenterally administering it to mammals. In addition, it can be used for preliminary immunization for live vaccine administration to reduce side effects of live vaccines.

[Examples of the Invention] Next, the present invention will be explained in more detail with reference to Examples and Preparation Examples, but the present invention is not limited by these unless the gist thereof is exceeded.

The composition of the medium used in the examples is as follows.

LB amp culture #! ! : NaCJL 5g Pepto 7 (Bactotryptona, Trademark) 5
g yeast extract 5g ampicillin 25mg water
11 LB a-layer p agar medium: Contained 15 g of agar in addition to each component of the LB ap medium. The LB a-layer p agar medium was used as the screening medium, and the LB amp medium was used as the amplification culture medium.

Preparation Example 1 Preparation of pHTP31 pH92 plasmid (Nomoto, Akio
'to'.

A.), et al.;
roc, Natl, Acad, Sci, 1fs
A), 79.5793 (1992)) 20g of buffer solution (10mM Tris-HCjL pH 7,5
, 7mM MgCl2, 100mN N
aC1, 7mM β-memercaptoethanol)2
After reacting with 7g3I200 at 80°C for 2 hours in 0μ solution, 4% polyacrylamide electrophoresis was performed.

A DNA fragment of approximately 700 base pairs was extracted using Maxam.
) and Gilbert's method (Proc., Natl.).

Acad, Sci, USA), 74.580 (1
977)). Add this to buffer solution (l17
mMTris-HC! LpH8,8,8,7■M
MgCl2, 10mM β-mercaptoethanol, 8.7gMEro↑A, 18.8mM (114
)2804, 330%MdCTP, dATP,
dGTP, d'rTP) 20ILl, T4ON
The mixture was reacted with 2.5 u of A polymerase at 37°C for 15 minutes. After phenol treatment, ethanol precipitation was performed, and the precipitate was dissolved in 10mM Tris-HC, pH 7.5, and 1mM E.
Dissolved in DTA solution topz. This solution contains I
Contains 0.081 Lg of DNA per ILl.

This DNA fragment is a 713 base pair (2373 to 3
085).

Meanwhile, add 91-311 plasmid long to buffer solution (
10■M Tris-HCRpH7,5,7ho M
MgC12, 150mM NaCu, 0.2mM EDT
A, 7-feng was reacted with Jiang I 10[1 in β-mercaptoethanol)2OILjL at 37°C for 2 hours. After ethanol precipitation, the precipitate was mixed with a buffer solution (87mM Tris-
HCJL pH8, 8, 8, 7mM HgCl2.1
0mN β-mercaptoethanol, 8.7M EDT
A, 18°8 ■ right (NH4) 2SD4 33G#N
dcTP% dATP, dGTP, dDingP) 20 final viewing, T0n) IA polymerase 2゜5
It was reacted with u at 37°C for 15 minutes. After phenol treatment,
Ethanol precipitation was performed. The precipitate was soaked in buffer (50sN
Tris-HCRpHs, o, 1iIN NgCJ
L2, 0.1mM ZnCJL2, 1mN spermidine)20. i, alkaline phosphatase (bovine @
)10 at 37°C for 300 minutes. After the phenol treatment, ethanol precipitation was performed. Precipitate, 10mM
Tria-HCjL pH? , 5.1mM EDT
A solution 20=dissolved in JL. This solution contains lkl
Each sample contains 0.4 g of DNA.

This ONA IILg was added to the poliovirus Sab described above.
A buffer solution (Ei8mW Tris-
HCI pH7,8,8,8mM HgCl2,
10mM OTT, 1mM ATP)
20μ, 4DNA ligase 2.8υ and 1 at 15℃
The reaction was allowed to proceed for 5 hours. This reaction product was used to transform Elisha coli 18101 strain, and the pHTP31 plasmid shown in FIG. 1 was isolated from the ampicillin-resistant strain.

Poliovirus Sabin contained in this plasmid
Type l cDNA is found in one document (Nomoto, Akio).
o, A,), et al-; Proceedings National Academic Book Science Fist Ninis e
x - (Proc, )latl, Acad, Sc
i, USA), 79.

2373 as shown in 5793 (1992))
It is 713 base pairs from base 3085 to base 3085.

Preparation Example 2 Preparation of pYTP 11 pB92 plasmid 15ILg was added to buffer solution (10mM T
ris-HCQpH7,5,7w+N 14gCl
2, 7mM β-mercaptol) in 20 gl,
After reacting with 20 U of LLII at 37°C for 3 hours,
It was subjected to 1.2% agarose gel electrophoresis. The approximately 800 base pair HA fragment was retzen ([1retzen)
method (Analytical O Biochemistry)
-(Anal, Bsocham,), 112. 2
95 (1181)). This is 10
mM Tris-H (fLpH?, 5, 1mM ED
? Solution A was dissolved in 20 min. This solution contains llLi
Each sample contains 0.03 pg of DNA.

Meanwhile, pntpat plasmid 5ILg was added to buffer solution (10
■Tris-HCfLpH? , 5, 7mM 14gC
12, 7mM β-mercaptoethanol) 20 Le Emperor, LL! It was reacted with 110U at 37°C for 2 hours. After ethanol precipitation, the precipitate was mixed with a buffer solution (50sN Tris
-HCJL pH9-0,lsMHgC12,0,1
mM ZnCl2, 1sM spermidine)2O
In pJL, alkaline phosphatase (bovine II) Ill
The reaction was carried out at 37°C for 300 minutes. After phenol treatment.

Ethanol precipitation was performed. Precipitate to 10μ
Dissolved in HC pH 7.5, 1 M EDTA solution 20 min. This solution contains 0.000 mg/IILjL.
Contains 251Lg of DNA. This DNAIJL
g and the aforementioned DNAQ-91L g)-tfW Banso (RflmM〒ris-)ICG-o)17-8
-8.8mF4 HgCl2, 10mM O
It was reacted with 2.8 u of T4DN Todoroki ligase in TT, 0-4mM ATP)2OIL i at 15°C for 15 hours.

This reaction solution was used to transform Elisha coli 18101 strain, and the pYTP11 plasmid shown in FIG. 2 was isolated from the ampicillin-resistant transformants.

Poliovirus Sabin contained in this plasmid
Type l cDNA is 239 as shown in the above literature.
From the 3rd base to the 3883rd base! 29! It is a base pair.

Preparation Example 3 Production of pYTP200 pVS(2)2503 plasmid (-Toyota, Haruki (
↑oyoda, H,), et al, ; (Journal of Molecular Biology ('', M
o1. Rial, ).

174, 5111 (19B4)) Add 15ILg to buffer solution (8■↑rrs-HCI pH 7,5, f1
Layer M NaC1, emHHgC12, 8mM β-
Mercaptoethanol) 20IL Emperor, -I30υ
and was reacted at 37°C for 3 hours.

After ethanol precipitation, transfer the precipitate to buffer solution (10μ↑rll
l-HCJI pH 7, 5, 7mM NgCJL 2
, ElO*N NaC, 7sNβ-mercaptoethanol) was reacted with Pvul1300 in 2OujL at 37°C for 3 hours. This was subjected to 1.2% agarose gel electrophoresis, and a DNA fragment of about 11 BO base pairs was recovered from the gel. Add this to 74 DNA polymerase reaction solution (
87mM Tris-HCl pH7,8,8,7sM
MgCl2, 101M β-mercaptoethanol, 6
．． 71M 10TA, 18.8mM (NH4)25
04, 330gNdCTP, dATP, dG
TP, dTTP) After 20 days, the mixture was reacted with 2.5 u of T4ONA polymerase at 37°C for 15 minutes. After phenol treatment, ethanol precipitation was performed and 10ml Tris
- Dissolved in HCl pH 7,5, 1mM EDTA solution 20%. This solution contains 0.00% per IILJl.
Contains 0.5gg of oral HA. This DNA 0.5
1Lg and DNA fragment I JLg obtained from the pH7311 plasmid described in Preparation Example 1 in a buffer solution (Ei 8mM
Trim-HCJL pH7,8゜6.6 layer M
MgCl2, 10■M [17 pieces, 1■M
ATP) 2G 2.5u of T4 DNA ligase in
and was reacted at 15°C for 5 hours.

Elisha coli HB 101 strain was transformed with this reaction product, and the PYTP200 plasmid shown in FIG. 3 was isolated from among the ampicillin-resistant transformants.

Poliovirus Sabin contained in this plasmid
Type 2 cDNA has 1157 base pairs from base 2288 to base 3442 as shown in the above-mentioned literature.

Preparation Example 4 Preparation of pYTP300 pVS(3)2803 plasmid (Toyoda, Haruki (T
oyoda, H,), at al,; J. Mo1. Bial, 174
．． 581(19,84)) 15ILg in buffer (8mM
Dingris-HCJL pH7,7,125+++
N NaCfL, 6 MgC 2.7 Otori Nβ
-Mercaptoethanol%TritonX-100)
The mixture was reacted with 300 plow I in 2OILl at 37°C for 3 hours. After ethanol precipitation, the precipitate was diluted with buffer (10mM
Tris-HCl pH 7.5, 7mM Ng (dL
2. A 60 volume MNaC 1.7 layer was reacted with 30 U of Nirag II in 20 L of β-mercaptoethanol at 37°C for 3 hours, and then subjected to 1.2% agarose gel electrophoresis. A DNA fragment of approximately 1040 base pairs was recovered from the gel. This was mixed with buffer solution (87mM Tris-HCup
H8.8, 8, 7mM MgCIL2, 10mMβ
-Mercaptoethanol, 8.7mM EDTA%
IB-13mM (NH4)2SD4,
330pNdcTP. dATP. dGTP. d
The mixture was reacted with 2.5 U of 4 DNA polymerase in TTP) at 37°C for 15 minutes. After phenol treatment, ethanol precipitation was performed, and the precipitate was dissolved in 10 Tris-H.
(jL pH 7.5, 1mM EDT^ solution 20IL
Dissolved in l. This solution contains 0.05 per IILfL.
Contains terminal g DNA. This DNA O. 5IL
g and the i DNA fragment tILg obtained from the pH7311 plasmid described in Preparation Example 1 in a buffer solution (88 mM Tr
is-MCI pH7.8, 8.8mMHzCl
2, 10mM OTT. 1mM A
TP) in 201L l, T4 DNA ligase 2.
5. The reaction was carried out at 15° C. for 15 hours.

This reaction product was used to transform N. Elisha strain 1988101, and a third strain was selected from among the ampicillin-resistant transformants.
The pYTP30G-1 plasmid shown in the figure was isolated.

Then, 5 g of pYTP30G-1 plasmid was added to buffer C8mH Trrs-HCi pH 7.9,
150mM NaCl, 8mM MgCl2,
8mM β-mercaptoethanol) in 2Oal,
It was reacted with SalI 100 at 37°C for 3 hours. After ethanol precipitation, the precipitate was diluted with buffer solution (CH3COO
Na, 200mM NaCfL, 1mM
ZnSO4, 0.5% glycerol)2OI
It was reacted with 50 U of S1 nuclease in Li at 37°C for 300 minutes. After phenol treatment, ethanol precipitation was performed.
Transfer the precipitate to buffer solution (88ml Trss-HCfL
pH7.8, 8.8mM 8gC12,,
10mM OTT, 1mNATP) Currently watching 20IL. The mixture was reacted with 2.5 μl of T4 DNA ligase at 15° C. for 15 hours.

Using this reaction product, N. Elisha strain 2918101 was transformed, and among the ampicillin-resistant transformed strains,
The PYTP30G plasmid shown in Figure 3 was isolated.

Poliovirus Sabin contained in this plasmid
Type 3 cDNA has 1041 base pairs from base 241B to base 345B as shown in the above-mentioned literature.

Preparation Example 5 Preparation of PYTP102 pYTt13 plasmid sILg was added to buffer solution (10 gg
Tris-HCI pH 7.5, 7m
M MgCl7, 150mM Na
Cl, 0, 2mM EDTA, 7mM β-)
k captoeta/-7L,)2Oxi, Sal 1
The reaction was carried out at 50°C and 37°C for 3 hours.

After ethanol precipitation, the precipitate was diluted with 10mM Trrs-HC.
I PH7.5, 1mM EDTA solution was dissolved for 20 minutes. On the other hand, poliovirus Sabin type cDNA
Of A, 15 μg of pHTP 31 plasmid containing the DNA region encoding the VPI protein was added to buffer solution (10 s +
M Tris-HCI pH 7,5.

7mM MgC12, 151)eM NaCR
, 0,2mM E[]TA, 7s+Nβ-mercaptoethanol) during 20 days, Sal I200 and 37
After 3 hours of reaction at ℃, 1.2% agarose electrophoresis was performed. - A 13 base pair DNA fragment was extracted using a conventional method. After ethanol precipitation, the precipitate was
mM Tris-HCI pH7.5, 1mM ED
Dissolved in 20g1 of TA solution. This DNA fragment is a part of the poliovirus Sabin I type cDNA that has been reported in the literature (Nomoto, Akio (Nos+oto, A.), etc.
l; Proceedings National Fist Academics
Science nee varnish ex-(Proa, Natl
, Acad, Sci, tlsA, 79.579
3 (1992)), it is 713 base pairs from the 2373rd base to the 3085th base.

0.5g of this DNA fragment and 0.2ILg of DNA obtained by cutting 5all of the PYTtl 3 plasmid were mixed in a buffer solution (88mM Tris-HCI pH 7, 8, fl
, 8mM NgCfl2, 10mM OTT
, 1m MA DIP) 2OILl, T4DNA IJ
, f-ze 2.5 [1 to 150° C.] and reacted at 15° C. for 15 hours.

Elisha coli H8101 strain was transformed using this reaction solution, and the pif9102 plasmid shown in Figure 4 was isolated from the ampicillin-resistant bacteria.
According to a conventional method, Elisha coli ceoo strain was transformed using the pYTP 102 plasmid,
Elisha coli CE100/pYTP 102 was isolated.

Example 1 Preparation of pYTP102 pYTP102 plasmid 11 was diluted with buffer solution (1 (laNT
ris-HCI pH 7, 5, 7-layer MMgCJ12.
7 Heel β-Mercap) Technique 9 / -Jlz) 20I
During Li, LL! I 50,! The reaction was carried out at -37°C for 2 hours. After ethanol precipitation, the precipitate was mixed with a buffer solution (8?
mM Tris-HCI pH8, 8, 8, 7mM
MgC12.

10mM β-mercaptoethanol 18, 8mM
(NH4)2SO4, 33G. M dcTP
, dATP. dGTP, dTTP) 2OIL
15 at 37°C with 2.8 U of 74 DNA polymerase in n.
Allowed to react for minutes. After phenol treatment, ethanol precipitation was performed, and the precipitate and commercially available Universal Translation Terminator Fist Oligonucleotide (Pharmacia PL Biochemical Sales) 0.5ILg were treated with 〒4 polynucleotide kinase to obtain 5° ends. Phosphorylated and buffer solution (88mM Tris-HCiL
pH7.8, 8.8mM MgCl2
, 10mM DTT, 1mM ATP) 20g
2.5 μl of T4 DNA ligase and 15 μl of T4 DNA ligase at 15°C.
A time reaction was performed. Using this reaction solution, Niji Elisha
E. coli ) 1B101 strain was transformed, and a plasmid pYTP102 shown in FIG. 4 was isolated from ampicillin-resistant bacteria. Next, according to a conventional method, the N. coli ceoo strain was transformed into pYTP102 using a plasmid, and the N. coli C80
0/pYTP102K was isolated.

Example 2 Preparation of pYTP1G2P 101Lg of pYTP11 plasmid was added to buffer solution (10mM
Tris-'HC pH7.5, 7mM
Mg0 sentence 2, 5QllN (NH
4) 2SO4) Pst I 30 in 2OuJl
The reaction was carried out at 0 and 37°C for 3 hours. After ethanol precipitation, the precipitate was mixed with a buffer solution (67 Tris-HCi pH
8.8, 8.7yg14 MgCl2,
10mM β-mercap) ethanol, 8.
7mM EOTA, 18.8sN(NH4)2SD4
, 330ILM dCTP. dATP%
dGTP. dTTP)2OILl, T4ON
The mixture was reacted with 2.8 U of A polymerase at 37°C for 15 minutes. After treatment with phenol, ethanol precipitation was performed, and the precipitate and 0.5 gg of a commercially available universal umbrella translation terminator oligonucleotide (sold by Pharmacia PL Biochemical) were treated with 〒4 polynucleotide kinase to remove the 5° end. The phosphorylated product was added to a buffer solution (laNTris-HCI pH 7.8, 8
．． 8mM NgCl2, 10mM
OTT.

The mixture was reacted with 2.5 U of T4 DNA IJ case in 2 OpI (1mM ATP) at 15°C for 15 hours. After ethanol precipitation, Il solution <10mM Trrs-HCI
pH 7.5, 7mM NgCfl2,
150mM NaC, 0.2mM EDTA, 7cm β-mercaptoethane) in 20JLi. Sal
I 300. ! : After reacting at 37°C for 3 hours,
1.2% agarose gel electrophoresis was performed. Approximately 105
A 0 base pair DNA fragment was recovered according to conventional methods.

Meanwhile, pYTU3 plasmid sILg was added to buffer solution (61M
Tris-HCI PH7.4. 6mM
MgC12, 101)eN NaCl.

5mM β-mercaptoethanol) 20 wins out of 411,
The mixture was reacted with Koma I 180 at 37°C for 3 hours. After ethanol precipitation, the precipitate was added to buffer solution (10mM Tris −).
ICJL pH7, 5°7mM KgCl2
, 150i+N HaCl, 0.2mM
EIIITA, 13mN β-mercaptoethanol) was reacted with 5alI200 in 20gJL at 37°C for 3 hours. ! . 2% agarose gel electrophoresis was performed and a DNA fragment of about 4000 base pairs was recovered.

0.5 g of the approximately 1050 base pair DNA fragment and approximately 40
1.0% g of a 00 base pair DNA fragment was added to a buffer solution (Ha
Tris-HCJL pH 7, l! , 8.8m
M NgCl2, 10mM D? ? .

1 serving M IP) 20 years old, 4 DNA ligase 2.5
It was reacted with U at 15°C for 15 hours. This reaction solution was used to transform Elisha coli 18101 strain,
Among ampicillin-resistant bacteria, pYTP shown in Figure 5
The P plasmid was isolated and the N. coli ceoo strain was then transformed into pYTP according to conventional methods.
The 102P plasmid was used to transform and isolate N. coli 0800/pYTP102P.

Example 3 Preparation of pYTP201N 10ILg of pYTP200 plasmid was added to buffer solution (10m
M Trys-HCI pH7,5,7mM M
gCl2, 150mM HaCl.

0.2M EDTA, 7mM β-mercaptoethanol) 30U of Sal I in 20IL
The reaction was carried out at ℃ for 3 hours. 1.2% agarose gel electrophoresis was performed, and a DNA fragment of about 1050 base pairs was recovered.

On the other hand, 5 pg of pYTυ3 plasmid was added to buffer solution (10 μg).
Trig-HCI pH 7, 5, 7mM Kg (J
L2, 150mM NaCl 1,0,2 layer with EDTA
, 7 servings of β-mercaptoethanol) 20 L, S
It was reacted with al I 200 at 37°C for 3 hours. 1.
2% 7 galose gel electrophoresis was performed, and a DNA fragment of about 4500 base pairs was recovered.

The approximately 1180 base pair DNA fragment 0.51Lg and approximately 4
1.01Lg of a 500 base pair DNA fragment was added to a buffer solution (
Bays Tris-HCI pH7,8,8,8sN
MgCJl2, 10mM OTT.

1mM ATP) 20IL Kochu, 4 DNA ligase 2
．． It was reacted with 5U at 15°C for 15 hours. Using this reaction solution, Niji Elisha Fist coli strain 18101 was transformed, and pY
The TP201 plasmid was isolated.

pYTP201 plasmid 2ILg in buffer (8mM
Tris-HCjL pH7,4,8mM
g (JL2, 50mM Na11.8m
β1-mercaptoethanol) in 20 ILl, Nar
It was reacted with IIOIJ at 37°C for 3 hours. After ethanol precipitation.

Buffer (87sNTris-HCfLpH8,8,8
, 7mM Nt (, l 2 .

β-mercaptoethanol, 8.7mM
ED'rA, 18.8mM (NH4)2SO4,3
30JLM dcTP, dATP, dG'r
P, attP) 4 DNA polymerase 2.80 in 2OIL1 and reacted at 37°C for 15 minutes. After phenol treatment, ethanol precipitation was performed, and the precipitate and commercially available universal translation terminator
Oligonucleotide (Pharmacia P-L Biochemical Sales) 0-5JLg was treated with 〒4 polynucleotide kinase and the 5° end was phosphorylated, and a buffer solution (8
8mM Trjs-HCfL pH7, Ei,
8-layer mM MgCJl 2,1 (lsND
T4DNA in 20pl (T〒, 1mM ATP)!
It was reacted with 2.5 u of J gauze at 15°C for 15 hours. This reaction product was used to transform N. coli strain 18101, and the pYTP201N plasmid shown in FIG. 6 was isolated from the ampicillin-resistant bacteria. The pYTP201N plasmid was used to transform and isolate N. coli 0800/pYTP201N.

Example 4 Construction of pYTP301 pYTP30G plasmid 10gge buffer (10mM
Trim-HCfL pH? , 5, 7mM M
gCJl2, 50m)I (NH4)2SO4
) 20IL, ① It was reacted with 20u of I at 37°C for 3 hours. After ethanol precipitation, the precipitate was soaked in buffer solution (87sN
Tris-MCI pH8,8% 8.7m14
HaCl2, 10mM β-filh
7' Tri/-L, 8.7mM EOofA, 1
8.8mM(NH4)2SD4.330ILM dCT
P, dATP, dGTP, dTTP) was reacted with 2.8 U of T4ON polymerase at 37°C for 15 minutes. After the phenol treatment, ethanol precipitation was performed, and the precipitate was mixed with a buffer solution (10mM Tris-HCfL).
pH8.0, 7mM MgCJl2, 100
in mM NaCJl, 2mM 73-mercap)zJ)/-JL/)2OJLl,
It was reacted with BajHI 300 at 30°C for 3 hours. 1
．． 2% agarose gel electrophoresis was performed and a DNA fragment of about 1500 base pairs was recovered.

On the other hand, add 5 μg of pYTU3 p=xmid solution (10
mNTria-HCl pH? , 5.7yiM M
gC12, 150mM NaCl.

5alI in 2OpA (0.2mM EDTA, 7mM β-mercaptoethanol) at 37°C with 200
Allowed time to react. After ethanol precipitation, the precipitate was dissolved in buffer solution (
5(lsNC)13COONa, 200mM
Mace, 1s+M ZnSO4, 0,5% glycerol) 100 final viewing, st nuclease 1011
and reacted at 37°C for 15 minutes. After the phenol treatment, ethanol precipitation was performed, and the precipitate was mixed with a buffer solution (10mM Tr
im-HCJl pH8-0,7mM NaC
jL2, 100mM NaCjL, 2m
Nβ-mercaptoethanol) 20aJL, BamH
It was reacted with I300 at 30°C for 3 hours. 1.2% 7 galose gel electrophoresis was performed, and approximately 3800 base pairs of [lNA
Fragments were recovered.

Approximately 38 g of the approximately 1500 base pair DNA fragment
00 base pair DNA fragment 1.0 ILg and buffer solution (e
llsMTris-HC1LpH? , 8.8.8mM
MgCl2, 10mM DTT.

1mM ATP) 20ml, T4 DNA ligase 2.
Using 0 reactants reacted with 5U at 15°C for 15 hours,
Elisha coli H8101 strain was transformed, and pYTP3 shown in Figure 7 was selected from ampicillin-resistant bacteria.
The el plasmid was isolated.

pYTP301 plasmid 2ILg was added to buffer (10mM
Tris-HC! LpH? , 5.7mM HgC1
2.7mM β-mercaptoethanol) in 20μJl,
LL! The mixture was reacted at 37° C. for 3 hours.

After ethanol precipitation, the precipitate was mixed with a buffer solution (87mM Tr
is-HCl pH8,8,8,7mM NgC
jL 2. 10mM β-mercaptoethanol,
8.7 layer Mgro↑A, 18.8ieN (NH4)2
904. 330 Ashi N tcTP, dATP,
dGTP, dDingTP) 20s l, T4DN
A polymerase 2.8U,! : Reacted at 37°C for 15 minutes. After phenol treatment, ethanol precipitation was performed, and the precipitate and commercially available universal transrage terminator oligonucleotide (Pharmacia P-
0.51 Lg of L Biochemical Co., Ltd.) was treated with 〒4 polynucleotide kinase to phosphorylate the 5' end, and 0.51 Lg of 885M Tris-HCjL p
H7,11, 8,6mM HgC12, 10mN0T
7, 1mM ATP) in 2OILl, T41]N
The mixture was reacted with 2.5 U of A ligase at 15° C. for 15 hours. This reaction product was used to transform N. Elisha coli strain Ha 101, and a plasmid was isolated from the ampicillin-resistant bacteria into pYTP301 shown in FIG. IJOO
The strain was transformed into pYTP301 using a plasmid, and the strain was transformed into Elisha coli C800/pYTP301K.
was isolated.

Example 5 Production of VPI protein Elisha coli C600 strain carrying the pytp 102P plasmid was grown in L medium (ampicillin concentration 25a
T/Otomi) 11 cells were cultured with shaking at 28°C overnight. When the ODa of the culture solution reached 0.8,
The cells were immediately transferred to a constant temperature bath at 42° C. and cultured with shaking for 3 hours.

After centrifugation, remove the supernatant and add 100 mJL f to the precipitated bacterial cells.
) 10mM↑rig-H (fLpH7,5,1mM
EDT^ solution was added, and the bacterial cells were disrupted by ultrasonication at 2°C.

After separating the crushed solution and removing the supernatant, 8M urea solution 10
ml and stirred well. The mixture was left standing on a water bath for 30 minutes and centrifuged. Furthermore, add 100 times the amount of supernatant solution to 10
Dew M Trig-HCILPH7,5,1mM EDT
It was dialyzed three times with solution A.

Add an equal volume of sample buffer for electrophoresis (finally 10mM Tris-HCl pH8,0,1) to a part of the upper groove.
m with EDTl, 10% Shi, Jii, 40mM D
TT, 1% 5tDS) and subjected to 5DS-polyacrylamide gel electrophoresis.

Then, Coomassie blue staining was performed, and a band believed to be the VPl protein with a molecular weight of about 39,000 daltons was detected.

The content of VPI protein was measured using a densitometer and was found to be 20.3%. Add this to culture solution 11
When converted to the expression amount per unit, it becomes 9.8s+H. It was confirmed by enzyme antibody staining that this protein reacts with antibodies against Sabin I virus.

Nijielisha Cori C3QO/pYcho P102,
08007pYTP201N, 0800/pYTP3
The same operation was performed for 01K, and the molecular weights were 25,500 and 29,000, respectively.

25.500 VPI proteins were obtained. These were determined by enzyme-antibody staining to detect Sabinl type virus and
It was confirmed that it reacts with antibodies against Sabin Z type virus and Sabin 3 type virus. The table below shows the content of VP1 protein in the solution obtained by extracting the precipitate after ultrasonication with 8M urea solution and the expression level per 11 culture fluids.

table

[Brief explanation of the drawing]

Figures 1, 2 and 3 show Tsuretsure pHTP31 plasmid, pYTP11 plasmid and pYTP20
FIG. 3 is a diagram showing an example of the production of plasmids No. 0 and No. 300. FIG. 4, FIG. 5, FIG. 6, and FIG. 7 are diagrams showing examples of preparing a circular double-stranded DNA according to the present invention. Figure 5

Claims (13)

[Claims] (1) A high-expression promoter/operator, an SD sequence located in the downstream region under its control, a translation initiation codon, and directly connected to this so that the reading frame matches
A cyclic duplex characterized by comprising a DNA portion encoding a peptide corresponding to at least amino acid numbers 92 to 105 of the capsid protein VP1 of the attenuated poliovirus strain Sabin 1 type, Sabin 2 type, or Sabin 3 type, and a translation termination codon following the DNA portion. Stranded DNA. (2) The circular double-stranded DNA according to claim 1, wherein the SD sequence is that of a metapyrocatechase gene. (3) The high-expression promoter/operator is a P_L promoter/operator, and the plasmid is a plasmid containing a temperature-sensitive gene portion that controls its activity 5° upstream thereof. Circular double-stranded DNA. (4) A high-expression promoter/operator, an SD sequence located in the downstream region under its control, a translation initiation codon, and a DNA sequence directly connected to this so that the reading frame coincides with the SD sequence.
A cyclic double-molecule characterized by containing a DNA portion encoding a peptide corresponding to at least amino acid numbers 92 to 105 of the capsid protein VP1 of the attenuated poliovirus strain Sabin 1 type, Sabin 2 type, or Sabin 3 type, and a translation termination codon connected thereto. In the method for producing heavy chain DNA, an appropriate restriction enzyme cleavage site is inserted after the translation initiation codon of DNA containing a high expression promoter/operator, an SD sequence located in the downstream region under its control, and a translation initiation codon. Cleavage treatment is performed with the restriction enzyme, and then blunt-ended treatment is performed as necessary, and at least amino acid numbers 92 to 105 of the capsid protein VP1 of the attenuated poliovirus strain Sabin 1 type, Sabin 2 type, or Sabin 3 type are added after the translation initiation codon. A production method characterized by inserting a DNA fragment encoding a peptide corresponding to. (5) The production method according to claim 4, wherein the SD sequence is that of a metapyrocatechase gene. (6) A high-expression promoter/operator, an SD sequence located in the downstream region under its control, a translation initiation codon, and directly connected to this so that the reading frame coincides with the SD sequence.
A cyclic duplex characterized by comprising a DNA portion encoding a peptide corresponding to at least amino acid numbers 92 to 105 of the capsid protein VP1 of the attenuated poliovirus strain Sabin 1 type, Sabin 2 type, or Sabin 3 type, and a translation termination codon following the DNA portion. In the method for producing chain DHA, attenuated poliovirus strains Slbin1 type and Snbin2
Oligos designed so that translation termination codons are placed in three frames at appropriate restriction enzyme cleavage sites of a DNA fragment encoding a peptide corresponding to at least amino acid numbers 92 to 105 of the Sabin 3 type or Sabin 3 type capsid protein VPI. By inserting a nucleotide, a translation termination codon is added to the carboxyl group end, and this is used to insert a translation termination codon into the DNA containing the high expression promoter/operator, the SD sequence located in the downstream region under its control, and the translation initiation codon. A suitable restriction enzyme cleavage site behind the translation initiation codon is cleaved with the restriction enzyme, and then, if necessary, the resulting DNA fragment is blunt-ended and inserted after the translation initiation codon. manufacturing method. (7) The production method according to claim 6, wherein the SD sequence is that of a metapyrocatechase gene. (8) A high-expression promoter/operator, an SD sequence located in the downstream region under its control, a translation initiation codon, and directly connected to this so that the reading frame matches
Holds a circular double-stranded DNA containing a DNA portion encoding a peptide corresponding to at least amino acid numbers 92 to 105 of the capsid protein VP1 of the attenuated poliovirus strain Sabin 1 type, Sabin 2 type, or Sabin 3 type, and a translation termination codon following the DNA portion. A bacterium of the genus Escherichia characterized by the following. (9) The bacterium according to claim 8, wherein the SD sequence is that of a metapyrocatechase gene. (10) The high expression promoter/operator is the P_L promoter/operator, and upstream on the 5° side thereof,
10. The bacterium according to claim 8 or 9, which has a circular double-stranded DNA containing a temperature-sensitive gene portion that controls its activity. (11) Attenuated poliovirus strains Sabin 1 and Sabin 2, which are directly connected to a high expression promoter/operator, an SD sequence located in the downstream region under its control, a translation initiation codon, and the same reading frame.
Escherichia (\Esh
A method for producing a protein having an antigen-determining site of the poliovirus capsid protein VP1, which comprises culturing bacteria of the genus Erichia in a nutrient medium and collecting the VP1 protein accumulated within the bacterial cells. (12) The production method according to claim 11, wherein the SD sequence is that of a metapyrocatechase gene. (13) The high expression promoter/operator is the P_L promoter/operator, and upstream on the 5° side thereof,
13. The manufacturing method according to claim 11 or 12, which comprises a temperature-sensitive gene portion that controls its activity.