CN111057156A

CN111057156A - O-type FMDV capsid protein-ferritin fusion protein, protein cage nanoparticle and preparation method thereof

Info

Publication number: CN111057156A
Application number: CN201911420453.9A
Authority: CN
Inventors: 杨国宇; 郭玉堃; 王梦珂; 郭豫杰; 明胜利; 张爽; 曾磊
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2019-12-31
Filing date: 2019-12-31
Publication date: 2020-04-24

Abstract

The invention discloses O-type FMDV capsid protein-ferritin fusion protein, a protein cage nanoparticle and a preparation method thereof. The invention connects the dominant epitope of the O-type FMDV with the nucleotide sequence of the ferritin fragment in series to synthesize an O-type FMDV capsid protein epitope-ferritin fragment; then connecting with a dissolving-promoting label and an affinity label EW29 to obtain EW 29/dissolving-promoting label/O type FMDV capsid protein epitope-ferritin fragment, and obtaining the O type FMDV capsid protein-ferritin fusion protein after induction and affinity purification. An electron microscope result shows that the fusion protein forms 20-25 nm of protein cage nanoparticles. The invention lays a foundation for further developing safe and effective O-type FMDV capsid protein vaccines.

Description

O-type FMDV capsid protein-ferritin fusion protein, protein cage nanoparticle and preparation method thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to O-type FMDV capsid protein-ferritin fusion protein, protein cage nanoparticles and a preparation method thereof.

Background

Through DNA recombination technology, the fusion protein can be easily expressed in prokaryotic expression system (Escherichia coli) and eukaryotic expression system (yeast and mammal cells) with high efficiency, and the product is widely applied in biology and medicine, and the rapid development of the fusion protein is promoted. Coli is still the main host for producing recombinant proteins at present due to its advantages of easy operation, low cost and high yield compared to eukaryotic expression systems. However, when recombinant proteins are expressed in the E.coli bacterial system, there are a number of disadvantages which are difficult to overcome in themselves: 1. recombinant proteins often appear as inactive inclusion bodies; 2. the obtained recombinant protein has a correct primary amino acid sequence but has a larger difference from a natural protein in a higher structure and conformation, and has no activity or extremely poor activity in the absence of a mechanism of eukaryotic cell posttranslational modification (glycosylation, phosphorylation, acetylation and the like); 3. host cell (E.coli) self-proteins become pyrogens, are difficult to remove, and have safety, and these problems limit the further application of prokaryotic expression recombinant proteins in practice. In view of this, it is important to select a more effective affinity solubility-promoting tag in order to obtain a recombinant protein with high purity, good solubility and strong activity.

From earthworms (Lumbricus terrestris) Galactose binding lectin EW 29C-terminal galactose binding domain, with a molecular weight of 14.5kDa, reversibly binds to galactose residues in agarose, a highly efficient affinity tag, a commonly used medium for affinity chromatography. Meanwhile, EW29 protein has good solubility, and can promote the solubility of exogenous protein in Escherichia coli when being fused and expressed with other exogenous proteins (Yabe R, Suzuki R, Kuno A, Fujimoto Z, Jigami Y and Hirabayashi J (2007) Taiiling a novel basic binding protein from a rim-B chain-ligand binding protein by natural expression-chemistry, J Biochem 141, 389-399 ke.).

Ferritin (Ferritin) is present in almost all organisms including algae, bacteria, higher plants, and animals, and is essential for the life of the organism. The protein shell is an inner hollow structure composed of 24 subunits in a highly symmetrical manner, the hollow diameter is about 8nm, and the outer diameter is about 12 nm. Researches find that ferritin can be self-assembled in vitro to form sleeve-like protein cage nanoparticles; meanwhile, the ferritin nanocage can be used for filling exogenous small molecular proteins into the nanocage, so that the degradation of small molecular antigens is effectively reduced, the effective concentration of the antigens is improved, the ingestion and processing of corresponding antigens by target cells can be effectively assisted, and the antigen stability and immunogenicity of antigen proteins are remarkably enhanced. Therefore, the unique structure and physicochemical properties of ferritin can be used as a novel antigen presentation nano-delivery platform.

Foot-and-mouth disease (FMD) is an acute, thermal and highly contagious disease caused by FMD epidemic virus (FMDV) which belongs to a member of the genus Foot-and-mouth disease virus of the family picornaviridae, wherein the viral genome is single-stranded positive-strand RNA and has a total length of about 8.5 kb, and four structural proteins, VP4 (1A), VP2 (1B), VP3 (1B) and VP1 (1D), are assembled with FMDV RNA to form mature virions. FMDV can be divided into seven serotypes, namely A serotype, O serotype, C serotype, south Africa I serotype, south Africa II serotype, south Africa III serotype and Asia I serotype, according to the characteristics of the serotypes. Recent researches show that the FMDV empty capsid and the complete virion have similar immunological characteristics, can cause antibody reaction similar to that of natural virion, have good safety and no virus scattering risk, so that the foot-and-mouth disease virus (FMDV) capsid protein and epitopes on the capsid protein have important significance for researching FMDV genetic engineering vaccines.

Subunit vaccines are increasingly gaining importance in the development and application of animal vaccines because of their simple operation and low price, which can distinguish between viral infection and vaccine immunity. The vaccine prepared by expressing the foot-and-mouth disease structural protein with high immunogenicity also attracts the attention of scholars. Many expression systems have been used for expressing FMDV capsid structural proteins, but most of them have the disadvantages of poor solubility, weak immunogenicity, low coat protein assembly efficiency, high cost and the like, so that the foot-and-mouth disease vaccine still mainly comprises inactivated vaccine.

In order to solve the problems of poor solubility and weak antigen immunogenicity, researchers also try to use an expression system instead, a foot-and-mouth disease subunit vaccine with good solubility and strong immunogenicity is expressed by a yeast or baculovirus expression system, and researchers also try to display epitopes on the outer surface of virus particles by serially expressing dominant neutralizing epitopes on a foot-and-mouth disease structural protein or by embedding the dominant neutralizing epitopes into the outer surface of a suitable protein and increasing the molecular weight of the protein, striving for folding and self-assembling certain proteins in vitro, so that the stability and the immunogenicity of the antigen are improved (the expression of the capsid protein of the foot-and-mouth disease virus of the type et al, O in insect cells [ J ]. Chinese veterinary medical science of prevention, 2013, 35(3): 185-8. xu Bing soldier. FMP 1-2A and 3C protein in Pichia pastoris and the research on the immunogenicity [ D ]; southern agricultural university, 2012.). However, no good scheme for improving the solubility of the fusion protein and the immunogenicity of the antigen is obtained at present.

Disclosure of Invention

The invention utilizes galactose-binding lectin EW29 as an affinity tag, efficiently and soluble expresses and purifies O-type FMDV capsid protein-ferritin fusion protein under the action of a dissolution promoting tag, and the fusion protein can form protein cage nanoparticles through self-assembly.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides an O-type FMDV capsid protein-ferritin fusion protein, which comprises an affinity label, a solubility promoting label, an O-type FMDV capsid protein epitope and a ferritin fragment, wherein the solubility promoting label is positioned at the C end of the affinity label, the O-type FMDV capsid protein epitope is positioned at the C end of the solubility promoting label, the ferritin fragment is positioned at the C end of the O-type FMDV capsid protein epitope, the affinity label is an EW29 label, the amino acid sequence of the EW29 label is shown as SEQ ID NO.1, and the amino acid sequence of the solubility promoting label is shown as SEQ ID NO. 2-9; the O-type FMDV capsid protein-ferritin fusion protein can be self-assembled to form a protein cage nanoparticle with ferritin encapsulating the O-type FMDV capsid protein.

Preferably, the amino acid sequence of the O-type FMDV capsid protein epitope is as shown in SEQ ID No. 10; the amino acid sequence of the ferritin fragment is shown as SEQ ID NO. 11.

Preferably, the nucleotide sequence for expressing the EW29 label is shown as SEQ ID NO.12, and the nucleotide sequence for expressing the solubilizing-promoting label is shown as SEQ ID NO. 13-20.

Preferably, the nucleotide sequence for expressing the O-type FMDV capsid protein epitope is shown as SEQ ID NO. 21; the nucleotide sequence for expressing the ferritin fragment is shown as SEQ ID NO. 22.

In a second aspect, the invention provides a protein cage nanoparticle formed by self-assembly of an O-type FMDV capsid protein-ferritin fusion protein.

In a third aspect, the present invention provides a method for preparing the above-mentioned protein cage nanoparticle, comprising the following steps:

step 1: connecting the nucleotide sequence of the O-type FMDV capsid protein and the nucleotide sequence of the ferritin fragment in series to synthesize an O-type FMDV capsid protein epitope-ferritin fragment;

step 2: connecting the O-type FMDV capsid protein epitope-ferritin fragment with a dissolution promoting label to obtain a dissolution promoting label/O-type FMDV capsid protein epitope-ferritin fragment, connecting galactose binding lectin EW29 serving as an affinity label with the dissolution promoting label/O-type FMDV capsid protein epitope-ferritin fragment in series to form a recombinant sequence, connecting the recombinant sequence to an expression vector, and constructing the recombinant vector;

and step 3: transforming the recombinant vector into an escherichia coli competent cell, and performing induced expression and affinity chromatography purification to obtain a target protein O type FMDV capsid protein-ferritin fusion protein; the purified protein of interest undergoes self-assembly to form protein cage nanoparticles.

In a fourth aspect, the present invention provides a recombinant vector comprising a nucleotide sequence as defined in any one of the preceding claims.

In a fifth aspect, the present invention provides a host cell comprising the recombinant vector described above.

The invention provides the O-type FMDV capsid protein-ferritin fusion protein, the protein cage nanoparticle formed by self-assembly of the O-type FMDV capsid protein-ferritin fusion protein, and the application of the preparation method of the protein cage nanoparticle in preparation of an O-type FMDV capsid protein vaccine.

The existing research shows that galactose-binding lectin EW29 can replace the functions of a His affinity tag and a solubilization-promoting tag which are commonly used as a solubilization-promoting tag and an affinity tag, and is used for the soluble expression and purification of fusion protein of a prokaryotic expression system (escherichia coli). However, after the recombinant expression vector for expressing the galactose-binding lectin EW29 tag-O type FMDV capsid protein epitope-ferritin fragment is transferred into escherichia coli, the recombinant expression vector is obtained and is expressed by inclusion bodies, and the EW29 tag cannot be used as a dissolution promoting tag to promote the dissolution of the O type FMDV capsid protein epitope-ferritin fragment. In order to obtain O type foot-and-mouth disease virus capsid protein with high soluble expression and biological activity, the invention connects the solubility promoting label with EW29 label-O type FMDV capsid protein epitope-ferritin fragment to construct fusion protein.

The invention has the following beneficial effects:

1. according to the invention, an EW29 label-O type FMDV capsid protein epitope-ferritin fragment is connected with a dissolution promoting label to obtain a highly soluble expressed and biologically active O type foot-and-mouth disease virus capsid protein; meanwhile, the introduction of EW29 protein reversibly bound by agarose provides convenience for later-stage protein purification, which is particularly shown in that EW29 protein can be reversibly bound with agarose, lays a foundation for affinity chromatography purification of target protein, and avoids the influence of toxic action contained in imidazole solution in the conventional His affinity tag purification process. Due to the introduction of the ferritin, the target protein can be self-assembled into the iron nano cage, so that the stability and high immunogenicity of the target protein are improved. Through transmission electron microscopy and dynamic light scattering detection, the target protein forms ferritin nanoparticles with uniform particles and 20-25 nm. Through Westernblot detection, the O-type foot-and-mouth disease hyperimmune serum can be specifically combined with recombinant proteins, so that the target protein is correctly expressed and has good immunogenicity.

2. The expression level of the fusion protein with the solubility-promoting label is improved, wherein MBP, Sumo and ArsC labels have high expression level and can promote the solubility expression of the MBP, Sumo and ArsC labels. The result of integrating expression quantity and solubility shows that the MBP label has the best effect of improving the expression quantity and the solubility of the recombinant protein.

3. The recombinant expression vector constructed by the invention can ensure that the recombinant protein is inE.coliLarge amount and low cost expression, convenient separation and purification, avoids the denaturation and renaturation treatment of the inclusion body, and provides guarantee for purifying and maintaining the activity of the target protein O type FMDV capsid protein-ferritin fusion protein.

Drawings

FIG. 1 is a schematic diagram of the construction of the recombinant expression vector EW29 affinity solubilization tag and the target gene of example 1 of the present invention.

FIG. 2 is a diagram of a plasmid of example 1 of the present inventionBamHI andXhoi double enzyme cutting picture. Lane 1 in FIG. 2A shows pET21b/EW29/AfFtn transitBamHI andXhoi, obtaining a pET21b/EW29 vector fragment by double enzyme digestion; lane 1 of FIG. 2B shows the passage of plasmid pUC57/SeFnt16599BamHI andXhoand carrying out double enzyme digestion to obtain a SeFnt16599 fragment. M is DL 5000.

Lane 1 of FIG. 3 shows the passage of recombinant plasmid pET21b/EW29/SeFnt16599 of example 1 of the present inventionNdeI andXhoi double restriction enzyme identification map. M is DL 5000.

FIG. 4 is a soluble SDS-PAGE analysis chart of the recombinant protein of example 1 of the present invention expressed in E.coli BL21(DE3) under different pH conditions. M, Prestained Protein Marker I; a: 1. whole bacteria before induction; total protein after disruption at pH 6.0; 3. supernatant after crushing at pH6.0; 4. precipitation after pH6.0 crushing; total protein after disruption at pH 7.0; 6. supernatant after disruption at pH 7.0; 7. the precipitate was obtained after disruption at pH 7.0. B: 1. whole bacteria before induction; total protein after disruption at pH 8.0; 3. supernatant after crushing at pH8.0; 4. precipitation after pH8.0 crushing; total protein after disruption at pH 9.0; 6. supernatant after disruption at pH 9.0; 7. precipitation after pH9.0 crushing; total protein after disruption at pH 10.0; 9. supernatant after crushing at pH 10.0; 10. the precipitate was obtained after disruption at pH 10.0. C: 1. whole bacteria before induction; total protein after disruption at pH 11.0; 3. supernatant after disruption at pH 11.0; 4. precipitation after pH11.0 crushing; total protein after disruption at pH 12.0; 6. supernatant after disruption at pH 12.0; 7. precipitation after pH12.0 crushing; total protein after disruption at pH 13.0; 9, crushing the supernatant at the pH of 13.0; 10. the precipitate was obtained after disruption at pH 13.0.

FIG. 5 is a schematic diagram of the construction of the recombinant expression vector EW29 affinity solubilization tag, solubilization tag and target gene of example 2 of the present invention.

FIG. 6 is a diagram of a plasmid of example 2 of the present inventionNheI andXhoi double enzyme cutting picture. Lane 1 in FIG. 6A shows the passage of pET21b/EW29/AfFtnNheI andXhoi, double enzyme digestion; lanes 1 to 8 of FIG. 6B show the expression of recombinant plasmid pET21B/His/Grifin (GST, MBP, Sumo, Thioredoxin, γ -crystallin, ArsC, PpiB)/SeFnt16599NheI andXhoi double enzyme digestion. M is DL 5000.

FIG. 7 shows the expression of recombinant plasmid pET21b/EW29/Grifin (GST, MBP, Sumo, Thioredoxin, γ -crystallin, ArsC, PpiB)/SeFnt16599 of example 2 of the present invention byNdeI andXhoi double restriction enzyme identification map. M is DL 5000.

FIG. 8 is an SDS-PAGE analysis of the expression of the recombinant protein of example 2 of the present invention in E.coli BL21(DE 3). M, Prestained Protein Marker I; 1. whole bacteria before induction; 2. performing whole bacteria after induction; 3. total protein after crushing; 4. crushing and then clearing the supernatant; 5. and precipitating after crushing. pET21b/EW29/Grifin/SeFnt16599, B.pET21b/EW29/GST/SeFnt16599, C.pET21b/EW29/MBP/SeFnt16599, D.pET21b/EW29/Sumo/SeFnt16599, E.pET21b/EW29/Thioredoxin/SeFnt16599, F.pET21b/EW 29/gamma-crystallin/SeFnt 16599, G.pET212b/EW 29/ArsC/SeFnt16599, H.pET21b/EW29/PpiB/SeFnt16599

FIG. 9 shows SDS-PAGE analysis and Western identification of the recombinant protein pET21b/EW29/MBP/SeFnt16599 according to example 2 of the present invention. A.M. Prestained Protein Marker I; 1. whole bacteria before induction; 2. performing whole bacteria after induction; 3. crushing and then clearing the supernatant; 4. precipitating after crushing; 5. filtering the solution; 6. wash 5mM lactose; 7. washing with 10mM lactose; 8. washing 20mM lactose; 9. washing with 50mM lactose; 10. washing with 100mM lactose; 11. wash with 200mM lactose; 12. wash 500mM lactose; B.M. Prestained Protein Marker I; lane 1, purified SeFnt16599 recombinant protein.

Fig. 10 is a physical characterization diagram of ferritin nanoparticles in example 2 of the present invention. A. Observing by a transmission electron microscope; B. dynamic light scattering analysis.

Detailed Description

The present invention is described in detail below with reference to specific examples, but the scope of the present invention is not limited to the following examples, and any technical solutions that can be conceived by those skilled in the art based on the present invention and the common general knowledge in the art are within the scope of the present invention.

Example 1

1. Materials and methods

Expression vector pET-21b/EW29/AfFtn with EW29 gene (EW 29 is inserted into pET-21b at the siteNdeI andNhebetween I, AfFtn has an insertion site at pET-21b ofBamHI andXhoi) is stored in an animal biochemistry and nutrition key open laboratory of Henan agricultural university.

Vector PUC57-SeFnt16599 with O-type FMDV capsid protein-ferritin fusion protein (insertion site of SeFnt16599 in PUC57 isBamHI andXhoi) is constructed and synthesized by Nanjing Kinshire. SeFnt16599 represents an epitope of the O-type FMDV capsid protein, a ferritin fragment. The O-type FMDV capsid protein epitope is enlarged according to O-type foot-and-mouth disease amino acid of FMDV O/GER/Wup/82 strainThe enterobacter expresses the sequence obtained by codon optimization, the amino acid is shown as SEQ ID NO.10, and the nucleotide sequence expressing the O-type FMDV capsid protein epitope is shown as SEQ ID NO. 21. The ferritin fragment is separated from Salmonella enterica (Salmonella enterica), the nucleotide sequence for expressing the ferritin fragment is shown as SEQ ID NO.22, and the amino acid sequence is shown as SEQ ID NO. 11.

The amino acid sequence of the EW29 tag is shown as SEQ ID NO.1, and the nucleotide sequence for expressing the EW29 tag is shown as SEQ ID NO. 12.

T4 DNA ligase, restriction endonucleaseNdeⅠ、BamHI andXhoboth I are from NEB, UK; DNA molecular mass standard DL5000 was purchased from TaKaRa; prestained Protein Marker I was obtained from Biotechnology Inc., Shanghai Ding Guo; the plasmid small-quantity rapid extraction kit and the DNA gel recovery kit are purchased from Shanghai biological engineering Co., Ltd.

1.1 construction and identification of prokaryotic expression vector

Vector PUC57-SeFnt16599 with O type FMDV capsid protein-ferritin fusion proteinBamHI andXhoi double enzyme digestion to obtain SeFnt16599 destination segment, then withBamHI andXhoi double-digested pET-21b/EW29/AfFtn vector is connected by T4 ligase to obtain the recombinant vector shown in figure 1. Transformation of the recombinant vector intoE.coliDH5 α, spreading on Luria-Bertanil (LB) solid medium containing ampicillin (Amp 100 mg/L), culturing at 37 deg.C, selecting positive clone, and processingNdeI-XhoAfter the I double enzyme digestion verification (see lane 1 in FIG. 3), the DNA fragment is sent to Shanghai Bioengineering Limited company for sequencing identification, and recombinant plasmids with correct sequencing are respectively named as: pET21b/EW 29// SeFnt 16599.

1.2 induced expression and solubility identification of recombinant proteins

Transformation of correctly sequenced recombinant plasmids intoE.coliBL21(DE3) competent cells. Single colonies containing the recombinant plasmid were picked up on LB solid medium containing 100mg/L ampicillin, inoculated into LB liquid medium containing 100mg/L ampicillin, and cultured overnight at 37 ℃. Pressing the obtained bacterial liquidInoculating 100 ml LB liquid culture medium containing 100mg/L ampicillin at a volume ratio of 1:100, and shake-culturing at 37 deg.C and 220r/min to mid-log phase (OD)₆₀₀Up to 0.6-0.8), and detecting the expression of the protein by SDS-PAGE. The best induction expression condition is selected as that the induction final concentration of an inducer IPTG is 0.5mmol/L and the induction expression is carried out for 6h at 25 ℃ and 140 r/min. After the induction is finished the next day, sucking 1 ml of bacterial liquid, centrifuging to remove supernatant, adding PBS for heavy suspension, adding an isovolumetric 2 xSDS-PAGE sample buffer solution, mixing uniformly, and boiling for 10 min. The remaining bacterial solution was centrifuged to collect precipitates, 10 ml of Binding Buffer (pH6.0, pH7.0, pH8.0, pH9.0, pH10.0, pH11.0, pH12.0, pH13.0) with different pH values was used to resuspend the cells, lysozyme (1 g/L) was added in ice for 30min, and then the cells were disrupted by low-temperature ultrasonic waves (ultrasonic time 5 s, 10s pause, 120 times). And respectively collecting the supernatant and the precipitate, performing SDS-PAGE analysis, and detecting the soluble expression effect of the recombinant protein under different pH values.

SDS-PAGE showed that the whole strain and supernatant samples after induction had protein bands consistent with the expected size at 58.63kDa, as shown in FIGS. 4A-4C, which show the expression results of recombinant plasmid pET21b/EW29/SeFnt16599 at pH6.0, pH7.0, pH8.0, pH9.0, pH10.0, pH11.0, pH12.0, and pH13.0, respectively. The results showed that except the recombinant protein at pH13.0, the recombinant protein was an inclusion body at other pH. However, pH13.0 is an extremely alkaline condition under which the recombinant protein is denatured and cannot maintain the activity of the fusion protein, and thus cannot be used for preparing an O-type FMDV capsid protein vaccine.

Example 2

1. Materials and methods

8 recombinant plasmids pET21b-His with solubility promoting label and containing target gene (FMDV epitope sequence + ferritin)₆Grifin/GST/MBP/Sumo/Thioredoxin/gamma-crystallin/ArsC/PpiB/-SeFnt 16599 (abbreviated as pET21b1-pET21b8) and expression vector pET-21b/EW29/AfFtn with EW29 gene (EW 29 has an insertion site in pET-21bNdeI andNhebetween I, AfFtn has an insertion site at pET-21b ofBamHI andXhoi) is stored in an animal biochemistry and nutrition key open laboratory of Henan agricultural university.

Reference to the construction of pET21b1-pET21b8 (guo yue 22531, guo waning, mingyi, et al, soluble expression, purification and electron microscopy of capsid proteins of foot and mouth disease virus type O in escherichia coli [ J ] chinese veterinary bulletin, 2018 (7)), wherein SeFnt16599 denotes epitope-ferritin fragments of FMDV type O capsid protein. The O-type FMDV capsid protein epitope is a sequence obtained by optimizing an expression codon of Escherichia coli according to O-type foot-and-mouth disease amino acid of FMDV O/GER/Wup/82 strain, wherein the amino acid is shown as SEQ ID NO.10, and a nucleotide sequence for expressing the O-type FMDV capsid protein epitope is shown as SEQ ID NO. 21. The ferritin fragment is separated from Salmonella enterica (Salmonella enterica), the nucleotide sequence for expressing the ferritin fragment is shown as SEQ ID NO.22, and the amino acid sequence is shown as SEQ ID NO. 11. The amino acid sequence of the EW29 tag is shown as SEQ ID NO.1, and the nucleotide sequence for expressing the EW29 tag is shown as SEQ ID NO. 12. The amino acid sequences of the solubility promotion tags Grifin, GST, MBP, Sumo, Thioredoxin, gamma-crystallin, ArsC and PpiB are respectively shown as SEQ ID NO. 2-9, and the nucleotide sequences of the solubility promotion tags Grifin, GST, MBP, Sumo, Thioredoxin, gamma-crystallin, ArsC and PpiB are respectively shown as SEQ ID NO. 13-20.

T4 DNA ligase, restriction endonucleaseNdeⅠ、NheI andXhoboth I are from NEB, UK; DNA molecular mass standard DL5000 was purchased from TaKaRa; prestained Protein Marker I was obtained from Biotechnology Inc., Shanghai Ding Guo; the plasmid small-quantity rapid extraction kit and the DNA gel recovery kit are purchased from Shanghai biological engineering Co., Ltd.

1.1 construction and identification of prokaryotic expression vector

8 recombinant plasmids pET21b1-pET21b8 with solubility-promoting labels and containing target genes are respectively usedNheI andXhoi double digestion to obtain 8 solubilizing-promoting tags-SeFnt 16599 (1734 bp), GST-SeFnt16599 (1971 bp), MBP-SeFnt16599 (2421 bp), Sumo-SeFnt16599 (1617 bp), Thioredoxin-SeFnt16599 (1644 bp), gamma-crystallin-SeFnt 16599 (1851 bp), ArsC-SeFnt16599 (1740 bp), PpiB-SeFnt16599(1809 bp) and the likeFragments of, respectively withNheI andXhothe double-digested pET-21b/EW29/AfFtn vector is connected by T4 ligase to obtain the recombinant vector shown in figure 5. Transformation of the recombinant vector intoE.coliDH5 α, spreading on Luria-Bertanil (LB) solid medium containing ampicillin (Amp 100 mg/L), culturing at 37 deg.C, selecting positive clone, and processingNdeI andXhoafter I double enzyme digestion verification, sending to Shanghai biological engineering Limited company for sequencing identification, and respectively naming the recombinant plasmids with correct sequencing as: pET21b/EW29/Grifin (GST, MBP, Sumo, Thioredoxin, γ -crystellin, ArsC, PpiB)/SeFnt 16599.

Wherein pET21b/EW29/AfFtn passes throughNheI andXhoi, obtaining a pET21b/EW29 vector by double enzyme digestion, as shown in a figure 6A; 8 recombinant plasmids pET21b/His/Grifin (GST, MBP, Sumo, Thioredoxin, gamma-crystellin, ArsC, PpiB)/SeFnt16599 were obtained byNheI andXhoGrifin-SeFnt16599, GST-SeFnt16599, MBP-SeFnt16599, Sumo-SeFnt16599, Thioredoxin-SeFnt16599, gamma-crystallin-SeFnt 16599, ArsC-SeFnt16599, and PpiB-SeFnt16599 were each cut by double digestion, as shown in FIG. 6B. The recombinant vector pET21b// EW29/Grifin (GST, MBP, Sumo, Thioredoxin, gamma-crystallin, ArsC, PpiB)/SeFnt16599 was obtained byNdeI andXho2148 bp, 2385 bp, 2835 bp, 2031 bp, 2058 bp, 2265 bp, 2154 bp and 2223 bp are cut out by double enzyme digestion I, and as shown in figure 7, the construction of the recombinant vector is shown to be successful; meanwhile, the sequencing result also indicates that the recombinant vector is successfully constructed.

1.2 induced expression and solubility identification of recombinant proteins

Transformation of correctly sequenced recombinant plasmids intoE.coliBL21(DE3) competent cells. Single colonies containing the recombinant plasmid were picked up on LB solid medium containing 100mg/L ampicillin, inoculated into LB liquid medium containing 100mg/L ampicillin, and cultured overnight at 37 ℃. Inoculating the obtained bacterial liquid into 100 ml LB liquid culture medium containing 100mg/L ampicillin at a volume ratio of 1:100, and performing shake culture at 37 deg.C and 220r/min to middle logarithmic phase (OD)₆₀₀Up to 0.6-0.8), and detecting the expression of the protein by SDS-PAGE. Experiment on isopropylthio in different concentration gradientsGalactoside (isoproyl β -D-thiogalactia, IPTG) (0.5, 1.0 mmol/L), induction time (4 h, 6 h) and induction temperature (25 ℃, 37 ℃) are optimized and combined, the final induction concentration of inducer IPTG is selected to be 0.5mmol/L, induction expression is carried out for 6h at 25 ℃, 140 r/min to be the optimal induction expression condition, after the induction is finished the next day, 1 ml of bacterial liquid is sucked, supernatant is centrifuged and removed, PBS is added for re-suspension, equal-volume 2 xSDS-PAGE sample buffer solution is added for mixing, boiling water is carried out for 10min, the residual bacterial liquid is centrifuged and collected for precipitation, 10 ml of PBS is used for re-suspension of the bacterial, lysozyme (1 g/L) is added for ice bath for 30min, then the bacterial liquid is subjected to low-temperature ultrasonic crushing (ultrasonic time is 5 s, intermittent time is 10s, 120 times), the supernatant and the precipitation are respectively collected for SDS-PAGE analysis, and the expression of the recombinant protein is.

SDS-PAGE shows that the induced whole bacteria and supernatant samples have protein bands with the same expected sizes at 78.76, 87.45, 103.95, 74.47, 75.46, 83.05, 78.98 and 81.51kDa, as shown in FIGS. 8A-4H, and FIGS. 8A-8H show the induced expression results of recombinant plasmid pET21b/EW29/Grifin (GST, MBP, Sumo, Thioredoxin, gamma-crystallin, ArsC, PpiB)/SeFnt16599, respectively. The recombinant protein with soluble expression is selected and analyzed by using Image J software (http:// Image J. Nih. gov/ij), and as shown in Table 1, the result shows that the label MBP obviously improves the solubility level of the recombinant protein and has very high expression.

TABLE 1 soluble expression analysis results of recombinant proteins

Figure number	Name of protein	Protein size (kDa)	Amount of expression（μg）	Amount of supernatant (. mu.g)	Solubility (%)
						8C	pET21b/EW29/MBP	103.95	6.13	2.11	34.42
8D	pET21b/EW29/Sumo	74.47	3.25	1.57	48.31
						8G	pET21b/EW29/ArsC	78.98	5.04	0.67	13.29

1.3 affinity purification and Western identification of recombinant proteins

The expression level and solubility of 8 different fusion proteins are comprehensively analyzed, and Escherichia coli containing pET21b/EW29/MBP/SeFnt16599 with good solubility and high expression level is selected as a subsequent expression engineering strain.

Affinity purification of the recombinant protein: carrying out induction expression on the strains which are induced and screened by IPTG with the final induction concentration of 0.5mmol/L at 25 ℃ and 140 r/min, collecting thalli after induction for 6h, and carrying out ultrasonic disruption at low temperature. After the disruption, the mixture was centrifuged at low temperature for 30min, and 100. mu.L of the supernatant was collected to prepare SDS-PAGE electrophoresis samples. The remaining supernatant was added to pretreated agarose medium, bound at 4 ℃ at 200r/min for 3 h, and the supernatant-agarose medium mixture was washed 3 times with 5 volumes of Tris-HCl (pH = 8.0) to wash away non-specific bands, and then target proteins were eluted with Tris-HCl containing lactose at various concentrations (5 mM, 10mM, 20mM, 50mM, 100mM, 200mM, and 500 mM), and eluates at various concentrations were collected. Absorbing 100 μ L of eluate with each concentration, adding equal volume of 2 xSDS-PAGE sample buffer, mixing, boiling in boiling water for 10min, and storing at-20 deg.C. The resulting protein was dialyzed to remove lactose.

The C-terminal galactose binding domain of the EW29 protein can be reversibly bound with galactose residues of agarose of affinity chromatography media, and the target protein containing EW29 can be eluted under certain concentration of lactose. Eluting with buffer containing 5, 10, 20, 50, 100, 200, and 500 mmol/L lactose respectively, collecting eluates, and detecting purification effect by SDS-PAGE electrophoresis, as shown in FIG. 9A. The results showed that the target protein could be specifically eluted at the elution of the buffer containing 5mmol/L lactose.

Identifying the recombinant protein by Western blot: cutting a PVDF membrane with a proper size according to the size of PAGE gel, soaking the PVDF membrane in a methanol solution for 1 min, soaking the electrophoretic PAGE gel and absorbent filter paper in a membrane transfer buffer solution, sequentially placing the filter paper, the PVDF membrane, the PAGE gel and the filter paper on a membrane transfer instrument from bottom to top to ensure that no bubbles exist between each layer, performing electric transfer for 50 min under a constant voltage of 15V, taking off the PVDF membrane after the electric transfer is completed, soaking the PVDF membrane into a 5% skimmed milk solution, performing warm bath sealing for 2 h in a shaking table at 37 ℃, adding 1:1000 diluted guinea pig anti-FMDV hyperimmune serum after the sealing is completed, combining for 1 h at 37 ℃, washing the PVDF membrane for 3 times and 10min each time by PBST, and then placing the PVDF membrane in 1:5000 times diluted rabbit anti-guinea pig IgG-HRP; reacting at 37 ℃ for 40min, washing for 3 times, developing by using AEC liquid, observing the color development condition, adding single distilled water to stop color development immediately when obvious bands appear, and storing by taking pictures.

The Western blot result is shown in a lane 1 of FIG. 9B, and the result shows that the target protein can be identified by guinea pig anti-FMDV hyperimmune serum and is specifically combined, so that the recombinant expression protein has better antigenicity.

1.4 formation and physical characterization of ferritin nanocages (Electron microscopy and dynamic light Scattering detection)

To further analyze whether the recombinant protein EW29/MBP/SeFnt16599 formed nanoparticles and whether the particles were homogeneous, the recombinant protein was physically characterized by Transmission Electron Microscopy (TEM) and Dynamic Light Scattering (DLS), respectively. And (3) observing the formation condition of the ferritin nanocages by using a transmission electron microscope: dropping 10 muL of concentrated purified protein onto a copper mesh, standing for 10min, and sucking liquid from one side of the copper mesh by using filter paper; then dropwise adding 10 mu L of 1% phosphotungstic acid staining solution, standing for 2min, and then sucking the staining solution from one side of the copper mesh by using filter paper; clamping the copper mesh with a pair of tweezers, putting the copper mesh into a glass plate, and naturally airing the liquid on the copper mesh; fixing the prepared copper mesh on a sample table of a sample holding rod, inserting the copper mesh into a sample chamber, vacuumizing, finding a proper visual field in an observation window, and observing and analyzing whether the purified fusion protein forms nanoparticles. Meanwhile, a Darwin particle size tester is used for detecting the particle size and the uniformity of the ferritin nanocages.

FIG. 10A shows that recombinant protein EW29/MBP/SeFnt16599 forms 20-25 nm protein cage nanoparticles. DLS results are shown in FIG. 10B, where the recombinant protein formed particles with a relatively single shape and a size of 20-25 nm.

In this example, eight kinds of prokaryotic expression vectors pET21b-EW 29-affinity tag-SeFnt 16599 were successfully constructed, and a method for preparing active SeFnt16599 recombinant protein was established, and electron microscopy results show that EW29/MBP/SeFnt16599 forms protein cage nanoparticles.

The above embodiments are merely preferred embodiments of the present invention, and not intended to limit the scope of the invention, so that equivalent changes or modifications made based on the structure, characteristics and principles of the invention should be included in the claims of the present invention.

SEQUENCE LISTING

<110> Henan university of agriculture

<120> O type FMDV capsid protein-ferritin fusion protein, protein cage nanoparticle and preparation method thereof

<130> do not

<160>22

<170>PatentIn version 3.5

<210>1

<211>138

<212>PRT

<213>Lumbricus terrestris

<400>1

His Met Lys Tyr Tyr Lys Pro Lys Phe Phe Tyr Ile Lys Ser Glu Leu

1 5 10 15

Asn Gly Lys Val Leu Asp Ile Glu Gly Gln Asn Pro Ala Pro Gly Ser

20 25 30

Lys Ile Ile Thr Trp Asp Gln Lys Lys Gly Pro Thr Ala Val Asn Gln

35 40 45

Leu Trp Tyr Thr Asp Gln Gln Gly Val Ile Arg Ser Lys Leu Asn Asp

50 55 60

Phe Ala Ile Asp Ala Ser His Glu Gln Ile Glu Thr Gln Pro Phe Asp

65 70 75 80

Pro Asn Asn Pro Lys Arg Ala Trp Ile Val Ser Gly Asn Thr Ile Ala

85 90 95

Gln Leu Ser Asp Arg Asp Ile Val Leu Asp Ile Ile Lys Ser Asp Lys

100 105 110

Glu Ala Gly Ala His Ile Cys Ala Trp Lys Gln His Gly Gly Pro Asn

115 120 125

Gln Lys Phe Ile Ile Glu Ser Glu Ala Ser

130 135

<210>2

<211>183

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Thr Leu Arg Phe Glu Ala Ser Cys Pro Asp Gly Leu Cys Pro Gly

35 40 45

Trp Ser Val Ile Leu Lys Gly Glu Thr Pro Pro Glu Ala Ser Lys Phe

50 55 60

Glu Ile Asn Phe Leu Cys Asp Arg Asp Asp Arg Val Ala Phe His Phe

65 70 75 80

Asn Pro Arg Phe Thr Glu Ser Asp Ile Ile Cys Asn Ser Tyr Met Ala

85 90 95

Asn Arg Trp Gly Gln Glu Glu Arg Cys Asn His Phe Pro Leu Gly Val

100 105 110

Glu Glu Pro Phe Gln Ile Glu Ile Tyr Ser Asp Asn Asp His Phe His

115 120 125

Val Tyr Ile Asp Lys Ala Lys Val Met Gln Tyr Lys His Arg Val Glu

130 135 140

Asp Leu Lys Thr Ile Thr Lys Leu Gln Val Val Asn Asp Val Lys Ile

145 150 155 160

Ser Ser Leu Glu Ile Thr Lys Lys Leu Phe Tyr Gly Ile Glu Glu Asn

165 170 175

Leu Tyr Phe Gln Ser Gly Ser

180

<210>3

<211>262

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Ser Pro Ile Leu Gly Tyr Trp Lys Ile Lys Gly Leu Val Gln Pro

35 40 45

Thr Arg Leu Leu Leu Glu Tyr Leu Glu Glu Lys Tyr Glu Glu His Leu

50 55 60

Tyr Glu Arg Asp Glu Gly Asp Lys Trp Arg Asn Lys Lys Phe Glu Leu

65 70 75 80

Gly Leu Glu Phe Pro Asn Leu Pro Tyr Tyr Ile Asp Gly Asp Val Lys

85 90 95

Leu Thr Gln Ser Met Ala Ile Ile Arg Tyr Ile Ala Asp Lys His Asn

100 105 110

Met Leu Gly Gly Cys Pro Lys Glu Arg Ala Glu Ile Ser Met Leu Glu

115 120 125

Gly Ala Val Leu Asp Ile Arg Tyr Gly Val Ser Arg Ile Ala Tyr Ser

130 135 140

Lys Asp Phe Glu Thr Leu Lys Val Asp Phe Leu Ser Lys Leu Pro Glu

145 150 155 160

Met Leu Lys Met Phe Glu Asp Arg Leu Cys His Lys Thr Tyr Leu Asn

165 170 175

Gly Asp His Val Thr His Pro Asp Phe Met Leu Tyr Asp Ala Leu Asp

180 185 190

Val Val Leu Tyr Met Asp Pro Met Cys Leu Asp Ala Phe Pro Lys Leu

195 200 205

Val Cys Phe Lys Lys Arg Ile Glu Ala Ile Pro Gln Ile Asp Lys Tyr

210 215 220

Leu Lys Ser Ser Lys Tyr Ile Ala Trp Pro Leu Gln Gly Trp Gln Ala

225 230 235 240

Thr Phe Gly Gly Gly Asp His Pro Pro Lys Gly Ile Glu Glu Asn Leu

245 250 255

Tyr Phe Gln Ser Gly Ser

260

<210>4

<211>412

<212>PRT

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400>4

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Lys Ile Glu Glu Gly Lys Leu Val Ile Trp Ile Asn Gly Asp Lys

35 40 45

Gly Tyr Asn Gly Leu Ala Glu Val Gly Lys Lys Phe Glu Lys Asp Thr

50 55 60

Gly Ile Lys Val Thr Val Glu His Pro Asp Lys Leu Glu Glu Lys Phe

65 70 75 80

Pro Gln Val Ala Ala Thr Gly Asp Gly Pro Asp Ile Ile Phe Trp Ala

85 90 95

His Asp Arg Phe Gly Gly Tyr Ala Gln Ser Gly Leu Leu Ala Glu Ile

100 105 110

Thr Pro Asp Lys Ala Phe Gln Asp Lys Leu Tyr Pro Phe Thr Trp Asp

115 120 125

Ala Val Arg Tyr Asn Gly Lys Leu Ile Ala Tyr Pro Ile Ala Val Glu

130 135 140

Ala Leu Ser Leu Ile Tyr Asn Lys Asp Leu Leu Pro Asn Pro Pro Lys

145 150 155 160

Thr Trp Glu Glu Ile Pro Ala Leu Asp Lys Glu Leu Lys Ala Lys Gly

165 170 175

Lys Ser Ala Leu Met Phe Asn Leu Gln Glu Pro Tyr Phe Thr Trp Pro

180 185 190

Leu Ile Ala Ala Asp Gly Gly Tyr Ala Phe Lys Tyr Glu Asn Gly Lys

195 200 205

Tyr Asp Ile Lys Asp Val Gly Val Asp Asn Ala Gly Ala Lys Ala Gly

210 215 220

Leu Thr Phe Leu ValAsp Leu Ile Lys Asn Lys His Met Asn Ala Asp

225 230 235 240

Thr Asp Tyr Ser Ile Ala Glu Ala Ala Phe Asn Lys Gly Glu Thr Ala

245 250 255

Met Thr Ile Asn Gly Pro Trp Ala Trp Ser Asn Ile Asp Thr Ser Lys

260 265 270

Val Asn Tyr Gly Val Thr Val Leu Pro Thr Phe Lys Gly Gln Pro Ser

275 280 285

Lys Pro Phe Val Gly Val Leu Ser Ala Gly Ile Asn Ala Ala Ser Pro

290 295 300

Asn Lys Glu Leu Ala Lys Glu Phe Leu Glu Asn Tyr Leu Leu Thr Asp

305 310 315 320

Glu Gly Leu Glu Ala Val Asn Lys Asp Lys Pro Leu Gly Ala Val Ala

325 330 335

Leu Lys Ser Tyr Glu Glu Glu Leu Ala Lys Asp Pro Arg Ile Ala Ala

340 345 350

Thr Met Glu Asn Ala Gln Lys Gly Glu Ile Met Pro Asn Ile Pro Gln

355 360 365

Met Ser Ala Phe Trp Tyr Ala Val Arg Thr Ala Val Ile Asn Ala Ala

370 375 380

Ser Gly Arg Gln Thr Val AspGlu Ala Leu Lys Asp Ala Gln Thr Asn

385 390 395 400

Gly Ile Glu Glu Asn Leu Tyr Phe Gln Ser Gly Ser

405 410

<210>5

<211>144

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>5

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Ala Ser Met Ser Asp Ser Glu Val Asn Gln Glu Ala Lys Pro Glu

35 40 45

Val Lys Pro Glu Val Lys Pro Glu Thr His Ile Asn Leu Lys Val Ser

50 55 60

Asp Gly Ser Ser Glu Ile Phe Phe Lys Ile Lys Lys Thr Thr Pro Leu

65 70 75 80

Arg Arg Leu Met Glu Ala Phe Ala Lys Arg Gln Gly Lys Glu Met Asp

85 90 95

Ser Leu Arg Phe Leu Tyr Asp Gly Ile Arg Ile Gln Ala Asp Gln Thr

100 105110

Pro Glu Asp Leu Asp Met Glu Asp Asn Asp Ile Ile Glu Ala His Arg

115 120 125

Glu Gln Ile Gly Gly Ile Glu Glu Asn Leu Tyr Phe Gln Ser Gly Ser

130 135 140

<210>6

<211>153

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>6

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp Ser Phe Asp Thr Asp

35 40 45

Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp Phe Trp Ala Glu Trp

50 55 60

Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu Asp Glu Ile Ala Asp

65 70 75 80

Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu Asn Ile Asp Gln Asn

85 90 95

Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly Ile Pro ThrLeu Leu

100 105 110

Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys Val Gly Ala Leu Ser

115 120 125

Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn Leu Ala Gly Ile Glu

130 135 140

Glu Asn Leu Tyr Phe Gln Ser Gly Ser

145 150

<210>7

<211>222

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>7

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Ser Lys Thr Gly Thr Lys Ile Thr Phe Tyr Glu Asp Lys Asn Phe

35 40 45

Gln Gly Arg Arg Tyr Asp Cys Asp Cys Asp Cys Ala Asp Phe His Thr

50 55 60

Tyr Leu Ser Arg Cys Asn Ser Ile Lys Val Glu Gly Gly Thr Trp Ala

65 70 75 80

Val Tyr Glu Arg Pro AsnPhe Ala Gly Tyr Met Tyr Ile Leu Pro Gln

85 90 95

Gly Glu Tyr Pro Glu Tyr Gln Arg Trp Met Gly Leu Asn Asp Arg Leu

100 105 110

Ser Ser Cys Arg Ala Val His Leu Pro Ser Gly Gly Gln Tyr Lys Ile

115 120 125

Gln Ile Phe Glu Lys Gly Asp Phe Ser Gly Gln Met Tyr Glu Thr Thr

130 135 140

Glu Asp Cys Pro Ser Ile Met Glu Gln Phe His Met Arg Glu Ile His

145 150 155 160

Ser Cys Lys Val Leu Glu Gly Val Trp Ile Phe Tyr Glu Leu Pro Asn

165 170 175

Tyr Arg Gly Arg Gln Tyr Leu Leu Asp Lys Lys Glu Tyr Arg Lys Pro

180 185 190

Ile Asp Trp Gly Ala Ala Ser Pro Ala Val Gln Ser Phe Arg Arg Ile

195 200 205

Val Glu Gly Ile Glu Glu Asn Leu Tyr Phe Gln Ser Gly Ser

210 215 220

<210>8

<211>185

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>8

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Ser Asn Ile Thr Ile Tyr His Asn Pro Ala Cys Gly Thr Ser Arg

35 40 45

Asn Thr Leu Glu Met Ile Arg Asn Ser Gly Thr Glu Pro Thr Ile Ile

50 55 60

His Tyr Leu Glu Thr Pro Pro Thr Arg Asp Glu Leu Val Lys Leu Ile

65 70 75 80

Ala Asp Met Gly Ile Ser Val Arg Ala Leu Leu Arg Lys Asn Val Glu

85 90 95

Pro Tyr Glu Glu Leu Gly Leu Ala Glu Asp Lys Phe Thr Asp Asp Arg

100 105 110

Leu Ile Asp Phe Met Leu Gln His Pro Ile Leu Ile Asn Arg Pro Ile

115 120 125

Val Val Thr Pro Leu Gly Thr Arg Leu Cys Arg Pro Ser Glu Val Val

130 135 140

Leu Glu Ile Leu Pro Asp Ala Gln Lys Gly Ala Phe Ser Lys Glu Asp

145 150 155160

Gly Glu Lys Val Val Asp Glu Ala Gly Lys Arg Leu Lys Gly Ile Glu

165 170 175

Glu Asn Leu Tyr Phe Gln Ser Gly Ser

180 185

<210>9

<211>208

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>9

His Met Thr Asp Val Thr Ile Lys Asp Ser Ala Arg Gly Phe Lys Lys

1 5 10 15

Pro Gly Lys Arg Ala Ser Ser His His His His His His Gly Ser Ser

20 25 30

Met Val Thr Phe His Thr Asn His Gly Asp Ile Val Ile Lys Thr Phe

35 40 45

Asp Asp Lys Ala Pro Glu Thr Val Lys Asn Phe Leu Asp Tyr Cys Arg

50 55 60

Glu Gly Phe Tyr Asn Asn Thr Ile Phe His Arg Val Ile Asn Gly Phe

65 70 75 80

Met Ile Gln Gly Gly Gly Phe Glu Pro Gly Met Lys Gln Lys Ala Thr

85 90 95

Lys Glu Pro Ile Lys Asn Glu Ala Asn Asn Gly Leu Lys Asn Thr Arg

100 105 110

Gly Thr Leu Ala Met Ala Arg Thr Gln Ala Pro His Ser Ala Thr Ala

115 120 125

Gln Phe Phe Ile Asn Val Val Asp Asn Asp Phe Leu Asn Phe Ser Gly

130 135 140

Glu Ser Leu Gln Gly Trp Gly Tyr Cys Val Phe Ala Glu Val Val Asp

145 150 155 160

Gly Met Asp Val Val Asp Lys Ile Lys Gly Val Ala Thr Gly Arg Ser

165 170 175

Gly Met His Gln Asp Val Pro Lys Glu Asp Val Ile Ile Glu Ser Val

180 185 190

Thr Val Ser Glu Gly Ile Glu Glu Asn Leu Tyr Phe Gln Ser Gly Ser

195 200 205

<210>10

<211>217

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>10

Gly Ser Thr Thr Ser Ala Gly Glu Ser Ala Asp Pro Val Thr Ala Thr

1 5 10 15

Val Glu Asn Tyr Gly Gly Glu Thr Gln Val Gln Arg Arg Gln His Thr

20 25 30

Asp Ile Ser Phe Ile Leu Asp Arg Phe Val Lys Val Thr Pro Lys Asp

35 40 45

Gln Ile Asn Val Leu Asp Leu Met Gln Ile Pro Ala His Thr Leu Val

50 55 60

Gly Ala Leu Leu Arg Thr Ala Thr Tyr Tyr Phe Ser Asp Leu Glu Leu

65 70 75 80

Ala Val Lys His Lys Gly Asp Leu Thr Trp Val Pro Asn Gly Ala Pro

85 90 95

Glu Thr Ala Leu Asp Asn Thr Thr Asn Pro Thr Ala Tyr Tyr Lys Ala

100 105 110

Pro Leu Thr Arg Leu Ala Leu Pro Tyr Thr Ala Pro His Arg Val Leu

115 120 125

Ala Thr Val Tyr Asn Gly Ser Cys Lys Tyr Ser Asp Ala Arg Val Ser

130 135 140

Asn Val Arg Gly Asp Leu Gln Val Leu Ala Gln Lys Ala Glu Arg Ala

145 150 155 160

Leu Pro Thr Ser Phe Asn Tyr Gly Ala Ile Lys Ala Pro Arg Val Ile

165 170 175

Glu Leu Leu Tyr Arg Met Lys Arg Ala Glu Thr Tyr Cys Pro Arg Pro

180 185 190

Leu Leu Ala Ile Gln Pro Ser Asp Ala Arg His Lys Gln Lys Ile Val

195 200 205

Ala Pro Ala Lys Gln Leu Leu Glu Leu

210 215

<210>11

<211>182

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>11

Glu Leu Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro

1 5 10 15

Glu Ser Leu Lys Thr Glu Met Ile Asp Lys Leu Asn Glu Gln Met Asn

20 25 30

Leu Glu Leu Tyr Ser Ser Leu Leu Tyr Gln Gln Met Ser Ala Trp Cys

35 40 45

Ser Tyr His Ser Phe Glu Gly Ala Ala Ala Phe Leu Arg Arg His Ala

50 55 60

Gln Glu Glu Met Thr His Met Gln Arg Leu Phe Asp Tyr Leu Thr Asp

65 70 75 80

Thr Gly Ser Leu Pro Arg Ile His Thr Val Ser Ser Pro Phe Ala Glu

85 90 95

Tyr Ala Ser Leu Asp Glu Leu Phe Arg Ala Thr Tyr Glu His Glu Gln

100 105110

Leu Ile Thr Gln Lys Ile Asn Glu Leu Ala His Ala Ala Met Thr Ser

115 120 125

Gln Asp Tyr Pro Thr Phe Asn Phe Leu Gln Trp Tyr Val Ala Glu Gln

130 135 140

His Glu Glu Glu Lys Leu Phe Lys Ser Ile Ile Asp Lys Leu Thr Leu

145 150 155 160

Ala Gly Lys Ser Gly Glu Gly Leu Tyr Phe Ile Asp Lys Glu Leu Ser

165 170 175

Thr Leu Asp Thr Gln Asn

180

<210>12

<211>414

<212>DNA

<213>lumbricus terrestris

<400>12

catatgaaat attataaacc gaagttcttt tacatcaaga gcgagctgaa cggtaaagtg 60

ctggacattg agggtcagaa cccggcgccg ggcagcaaga tcattacctg ggaccagaag 120

aaaggtccga ccgcggtgaa ccaactgtgg tataccgatc agcaaggcgt tatccgtagc 180

aaactgaacg acttcgcgat cgatgcgagc cacgagcaga ttgaaaccca accgtttgat 240

ccgaacaacc cgaagcgtgc gtggatcgtg agcggtaaca ccattgcgca gctgagcgac 300

cgtgatatcg ttctggacat cattaagagc gataaagagg cgggcgcgca catttgcgcg 360

tggaagcagc atggtggccc gaaccaaaaa ttcatcattg agagcgaagc tagc 414

<210>13

<211>549

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatga ccctgcgttt cgaagcttct 120

tgcccggacg gtctgtgccc gggttggtct gttatcctga aaggtgaaac cccgccggaa 180

gcttctaaat tcgaaatcaa cttcctgtgc gaccgtgacg accgtgttgc tttccacttc 240

aacccgcgtt tcaccgaatc tgacatcatc tgcaactctt acatggctaa ccgttggggt 300

caggaagaac gttgcaacca cttcccgctg ggtgttgaag aaccgttcca gatcgaaatc 360

tactctgaca acgaccactt ccacgtttac atcgacaaag ctaaagttat gcagtacaaa 420

caccgtgttg aagacctgaa aaccatcacc aaactgcagg ttgttaacga cgttaaaatc 480

tcttctctgg aaatcaccaa aaaactgttc tacgggatcg aggaaaacct gtacttccaa 540

tccggatcc 549

<210>14

<211>786

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatgt cccctatact aggttattgg 120

aaaattaagg gccttgtgca acccactcga cttcttttgg aatatcttga agaaaaatat 180

gaagagcatt tgtatgagcg cgatgaaggt gataaatggc gaaacaaaaa gtttgaattg 240

ggtttggagt ttcccaatct tccttattat attgatggtg atgttaaatt aacacagtct 300

atggccatca tacgttatat agctgacaag cacaacatgt tgggtggttg tccaaaagag 360

cgtgcagaga tttcaatgct tgaaggagcg gttttggata ttagatacgg tgtttcgaga 420

attgcatata gtaaagactt tgaaactctc aaagttgatt ttcttagcaa gctacctgaa 480

atgctgaaaa tgttcgaaga tcgtttatgt cataaaacat atttaaatgg tgatcatgta 540

acccatcctg acttcatgtt gtatgacgct cttgatgttg ttttatacat ggacccaatg 600

tgcctggatg cgttcccaaa attagtttgt tttaaaaaac gtattgaagc tatcccacaa 660

attgataagt acttgaaatc cagcaagtat atagcatggc ctttgcaggg ctggcaagcc 720

acgtttggtg gtggcgacca tcctccaaaa gggatcgagg aaaacctgta cttccaatcc 780

ggatcc 786

<210>15

<211>1236

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatga aaatcgaaga aggtaaactg 120

gtaatctgga ttaacggcga taaaggctat aacggtctcg ctgaagtcgg taagaaattc 180

gagaaagata ccggaattaa agtcaccgtt gagcatccgg ataaactgga agagaaattc 240

ccacaggttg cggcaactgg cgatggccct gacattatct tctgggcaca cgaccgcttt 300

ggtggctacg ctcaatctgg cctgttggct gaaatcaccc cggacaaagc gttccaggac 360

aagctgtatc cgtttacctg ggatgccgta cgttacaacg gcaagctgat tgcttacccg 420

atcgctgttg aagcgttatc gctgatttat aacaaagatc tgctgccgaa cccgccaaaa 480

acctgggaag agatcccggc gctggataaa gaactgaaag cgaaaggtaa gagcgcgctg 540

atgttcaacc tgcaagaacc gtacttcacc tggccgctga ttgctgctga cgggggttat 600

gcgttcaagt atgaaaacgg caagtacgac attaaagacg tgggcgtgga taacgctggc 660

gcgaaagcgg gtctgacctt cctggttgac ctgattaaaa acaaacacat gaatgcagac 720

accgattact ccatcgcaga agctgccttt aataaaggcg aaacagcgat gaccatcaac 780

ggcccgtggg catggtccaa catcgacacc agcaaagtga attatggtgt aacggtactg 840

ccgaccttca agggtcaacc atccaaaccg ttcgttggcg tgctgagcgc aggtattaac 900

gccgccagtc cgaacaaaga gctggcaaaa gagttcctcg aaaactatct gctgactgat 960

gaaggtctgg aagcggttaa taaagacaaa ccgctgggtg ccgtagcgct gaagtcttac 1020

gaggaagagt tggcgaaaga tccacgtatt gccgccacta tggaaaacgc ccagaaaggt 1080

gaaatcatgc cgaacatccc gcagatgtcc gctttctggt atgccgtgcg tactgcggtg 1140

atcaacgccg ccagcggtcg tcagactgtc gatgaagccc tgaaagacgc gcagactaat 1200

gggatcgagg aaaacctgta cttccaatcc ggatcc 1236

<210>16

<211>432

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatgg ctagcatgtc ggactcagaa 120

gtcaatcaag aagctaagcc agaggtcaag ccagaagtca agcctgagac tcacatcaat 180

ttaaaggtgt ccgatggatc ttcagagatc ttcttcaaga tcaaaaagac cactccttta 240

agaaggctga tggaagcgtt cgctaaaaga cagggtaagg aaatggactc cttaagattc 300

ttgtacgacg gtattagaat tcaagctgat cagacccctg aagatttgga catggaggat 360

aacgatatta ttgaggctca cagagaacag attggtggga tcgaggaaaa cctgtacttc 420

caatccggat cc 432

<210>17

<211>459

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatga gcgataaaat tattcacctg 120

actgacgaca gttttgacac ggatgtactc aaagcggacg gggcgatcct cgtcgatttc 180

tgggcagagt ggtgcggtcc gtgcaaaatg atcgccccga ttctggatga aatcgctgac 240

gaatatcagg gcaaactgac cgttgcaaaa ctgaacatcg atcaaaaccc tggcactgcg 300

ccgaaatatg gcatccgtgg tatcccgact ctgctgctgt tcaaaaacgg tgaagtggcg 360

gcaaccaaag tgggtgcact gtctaaaggt cagttgaaag agttcctcga cgctaacctg 420

gccgggatcg aggaaaacct gtacttccaa tccggatcc 459

<210>18

<211>666

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatgt ctaaaactgg aaccaagatt 120

actttctatg aagacaaaaa ttttcaaggc cgtcgctatg actgtgattg cgactgtgca 180

gatttccaca catacctaag tcgctgcaac tccattaaag tggaaggagg cacctgggct 240

gtttatgaaa ggcccaactt tgctgggtac atgtacatct taccacaggg agagtaccct 300

gaataccagc gttggatggg cctcaacgac cgcctcagct cctgcagagc tgttcatctg 360

cctagtggag gccagtataa gattcagatc tttgagaaag gggattttag tggtcagatg 420

tatgaaacca ccgaagattg cccttccatc atggagcaat ttcacatgcg agagatccac 480

tcctgtaagg tgctggaggg tgtctggatt ttctatgagc tacccaacta ccgtggcagg 540

cagtacctcc tggacaagaa ggagtaccgg aagcccatcg attggggtgc agcctcccca 600

gctgtccagt ctttccgccg cattgtggag gggatcgagg aaaacctgta cttccaatcc 660

ggatcc 666

<210>19

<211>555

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatga gcaacattac catttatcac 120

aacccggcct gcggcacgtc gcgtaatacg ctggagatga tccgcaacag cggcacagaa 180

ccgactatta tccattatct ggaaactccg ccaacgcgcg atgaactggt caaactcatt 240

gccgatatgg ggatttccgt acgcgcgctg ctgcgtaaaa acgtcgaacc gtatgaggag 300

ctgggccttg cggaagataa atttactgac gatcggttaa tcgactttat gcttcagcac 360

ccgattctga ttaatcgccc gattgtggtg acgccgctgg gaactcgcct gtgccgccct 420

tcagaagtgg tgctggaaat tctgccagat gcgcaaaaag gcgcattctc caaggaagat 480

ggcgagaaag tggttgatga agcgggtaag cgcctgaaag ggatcgagga aaacctgtac 540

ttccaatccg gatcc 555

<210>20

<211>624

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

catatgacag atgtaacgat taaagactct gctcgtggtt tcaaaaaacc gggtaaacgt 60

gctagctctc accatcacca tcaccatggt tcttctatgg ttactttcca caccaatcac 120

ggcgatattg tcatcaaaac ttttgacgat aaagcacctg aaacagttaa aaacttcctg 180

gactactgcc gcgaaggttt ttacaacaac accattttccaccgtgttat caacggcttt 240

atgattcagg gcggcggttt tgaaccgggc atgaaacaaa aagccaccaa agaaccgatc 300

aaaaacgaag ccaacaacgg cctgaaaaat acccgtggta cgctggcaat ggcacgtact 360

caggctccgc actctgcaac tgcacagttc ttcatcaacg tggttgataa cgacttcctg 420

aacttctctg gcgaaagcct gcaaggttgg ggctactgcg tgtttgctga agtggttgac 480

ggcatggacg tggtagacaa aatcaaaggt gttgcaaccg gtcgtagcgg tatgcaccag 540

gacgtgccaa aagaagacgt tatcattgaa agcgtgaccg ttagcgaggg gatcgaggaa 600

aacctgtact tccaatccgg atcc 624

<210>21

<211>651

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

ggatccacca cctctgctgg tgaatctgct gacccggtta ccgctaccgt tgaaaactac 60

ggtggtgaaa cccaggttca gcgtcgtcag cacaccgaca tctctttcat cctggaccgt 120

ttcgttaaag ttaccccgaa agaccagatc aacgttctgg acctgatgca gatcccggct 180

cacaccctgg ttggtgctct gctgcgtacc gctacctact acttctctga cctggaactg 240

gctgttaaac acaaaggtga cctgacctgg gttccgaacg gtgctccgga aaccgctctg 300

gacaacacca ccaacccgac cgcttactac aaagctccgc tgacccgtct ggctctgccg 360

tacaccgctc cgcaccgtgt tctggctacc gtttacaacg gttcttgcaa atactctgac 420

gctcgtgttt ctaacgttcg tggtgacctg caggttctgg ctcagaaagc tgaacgtgct 480

ctgccgacct ctttcaacta cggtgctatc aaagctccgc gtgttatcga actgctgtac 540

cgtatgaaac gtgctgaaac ctactgcccg cgtccgctgc tggctatcca gccgtctgac 600

gctcgtcaca aacagaaaat cgttgctccg gctaaacagc tgctggagct c 651

<210>22

<211>555

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

gagctctctg gttctgaaac cccgggtacc tctgaatctg ctaccccgga atctctgaaa 60

accgaaatga tcgacaaact gaacgaacag atgaacctgg aactgtactc ttctctgctg 120

taccagcaga tgtctgcttg gtgctcttac cactctttcg aaggtgctgc tgctttcctg 180

cgtcgtcacg ctcaggaaga aatgacccac atgcagcgtc tgttcgacta cctgaccgac 240

accggttctc tgccgcgtat ccacaccgtt tcttctccgt tcgctgaata cgcttctctg 300

gacgaactgt tccgtgctac ctacgaacac gaacagctga tcacccagaa aatcaacgaa 360

ctggctcacg ctgctatgac ctctcaggac tacccgacct tcaacttcct gcagtggtac 420

gttgctgaac agcacgaaga agaaaaactg ttcaaatcta tcatcgacaa actgaccctg 480

gctggtaaat ctggtgaagg tctgtacttc atcgacaaag aactgtctac cctggacacc 540

cagaactaac tcgag 555

Claims

The O-type FMDV capsid protein-ferritin fusion protein is characterized by comprising an affinity tag, a solubility promoting tag, an O-type FMDV capsid protein epitope and a ferritin fragment, wherein the solubility promoting tag is positioned at the C end of the affinity tag, the O-type FMDV capsid protein epitope is positioned at the C end of the solubility promoting tag, the ferritin fragment is positioned at the C end of the O-type FMDV capsid protein epitope, the affinity tag is an EW29 tag, the amino acid sequence of the EW29 tag is shown as SEQ ID No.1, and the amino acid sequence of the solubility promoting tag is shown as SEQ ID No. 2-9; the O-type FMDV capsid protein-ferritin fusion protein can be self-assembled to form a protein cage nanoparticle with ferritin encapsulating the O-type FMDV capsid protein.
2. The O-type FMDV capsid protein-ferritin fusion protein according to claim 1, wherein the amino acid sequence of said O-type FMDV capsid epitope is set forth in SEQ ID No. 10; the amino acid sequence of the ferritin fragment is shown as SEQ ID NO. 11.
3. The O-type FMDV capsid protein-ferritin fusion protein according to claim 1, wherein the nucleotide sequence for expression of said EW29 tag is shown in SEQ ID No.12, and the nucleotide sequence for expression of said solubility-promoting tag is shown in SEQ ID No. 13-20.
4. The O-type FMDV capsid protein-ferritin fusion protein according to claim 2, wherein the nucleotide sequence expressing the epitope of said O-type FMDV capsid protein is set forth in SEQ ID No. 21; the nucleotide sequence for expressing the ferritin fragment is shown as SEQ ID NO. 22.
5. The protein cage nanoparticles formed by self-assembly of the O-type FMDV capsid protein-ferritin fusion protein of any one of claims 1 to 4.
6. A method of preparing the protein cage nanoparticle of claim 5, comprising the steps of:

step 1: connecting the nucleotide sequence of the O-type FMDV capsid protein and the nucleotide sequence of the ferritin fragment in series to synthesize an O-type FMDV capsid protein epitope-ferritin fragment;

step 2: connecting the O-type FMDV capsid protein epitope-ferritin fragment with a dissolution promoting label to obtain a dissolution promoting label/O-type FMDV capsid protein epitope-ferritin fragment, connecting galactose binding lectin EW29 serving as an affinity label with the dissolution promoting label/O-type FMDV capsid protein epitope-ferritin fragment in series to form a recombinant sequence, connecting the recombinant sequence to an expression vector, and constructing the recombinant vector;

and step 3: transforming the recombinant vector into an escherichia coli competent cell, and performing induced expression and affinity chromatography purification to obtain a target protein O type FMDV capsid protein-ferritin fusion protein; the purified protein of interest undergoes self-assembly to form protein cage nanoparticles.
7. A recombinant vector comprising the nucleotide sequence of any one of claims 3 to 4.
8. A host cell comprising the recombinant vector of claim 7.
9. The use of the O-type FMDV capsid protein-ferritin fusion protein of claims 1-4, the protein cage nanoparticle formed by self-assembly of the O-type FMDV capsid protein-ferritin fusion protein of claim 5, and the cage nanoparticle of claim 6 in the preparation of an O-type FMDV capsid protein vaccine.