JPS61185189A - Dna sequence of novel interferon-alpha1, recombinant plasmid and transformation - Google Patents

Abstract

PURPOSE:To provide the titled DNA sequence capable of providing a novel IFN-alpha1 coding amino acids different from known amino acid sequence of IFN-alpha1 at the 35th unit and expected to exhibit physiological activity different from that of the known IFN-alpha1. CONSTITUTION:The DNA sequence of the interferon-alpha1 coding the polypeptide of formula. The 35th amino acid in the known interferon-alpha1 was aspartic acid, and the DNA coding the acid was GAC. The interferon-alpha1 of the present invention has asparagine as the 35th amino acid, and the DNA coding the same is AAC.

Description

DETAILED DESCRIPTION OF THE INVENTION [Field of Industrial Application] The present invention is directed to the development of novel human interferon-α1 (hereinafter referred to as IFN-α1) in the field of genetic engineering.
Regarding NA sequences.

[Conventional technology]

IFN-α is generally produced by cells such as white blood cells induced by various viruses (e.g., Sendai virus, New Caff Sul Daisies virus, influenza virus, etc.), and is effective against various diseases caused by viruses. It is said to be useful.

By the way, with the recent development of genetic engineering, IFN-α is also being studied and examined for its structural analysis at the gene level and its relationship with physiological activity.

As a result, the IFN-cx gene is a heterogen
ic, and it has been reported that there are a small number of 20 types of IFN-α genes on human chromosomes.

Among them, 13 types of IFN-α genes have already been cloned and their DNA sequences have been revealed. IF
N-α1 is one of the subtypes, and the DNA sequence has already been elucidated (Japanese Patent Application Laid-Open No. 150100-1983). It has also been found that the type or strength of physiological activity of IFN-α differs depending on the amino acid sequence and the like.

Therefore, IFN-α with novel amino acids.

There is a good possibility that IFN-α1 exhibits physiological activity different from that of conventional IFN-α1.

[Problem that the invention seeks to solve]

The present inventors used recombinant DNA technology to obtain IFN-α
As a result of examining the amino acid sequence of 1, we cloned the human-derived TFN-α1 gene obtained using mRNA obtained from induced human leukocytes as a template, and determined its DNA base sequence and amino acid sequence. ■ A novel human-derived IFN-α1 DNA sequence encoding a novel amino acid different from FN-α, a recombinant plasmid characterized by containing the DNA sequence, and a transformant transformed with the recombinant plasmid. They discovered this and completed the present invention.

(Left below) The present invention includes: ARG ARG THRLED MET LED LE
U ALA GLN M[! T Sl! RARG IL
E SERPROSERSERCYS LEtl? I
ET ASP ARGnrs lforcepnEGLYP)
12 PROccA GLu GLLI PHE AS
PGLY ASN GLN PIE GLN
LYS ALA PROALA ILE 5
ERVAL LIl'D I (Is GLtl LEL
I ILE GLN GLN ILE PHE ASNL
EU PIE THRTHRLYS ASP SERS
ERALA ALA TRPASP GLII ASP
LEULE [I ASP l, YS P) IECYS
T)II? GLULE [l TYRGLN GLN
LEU ASN ASP LEtl GLU ALA
This relates to the DNA sequence of IFN-α1 characterized by encoding a polypeptide represented by CYSt+Lυ, preferably the DNA sequence of IFN-α1 characterized by having the base sequence GATTAAGGAGGAAGGA^.
Regarding NA sequences.

In the conventional [FN-Z+, the 35th amino acid consists of aspartic acid, and the DNA encoding it is GAC.The 35th amino acid of IFN-α1 according to the present invention is asparagine, and the DNA encoding it is GAC. DNA is AAC.

Furthermore, the present invention relates to a recombinant plasmid characterized by containing said DNA sequence, and further relates to a transformant transformed with said recombinant plasmid.

The DNA sequence of IFN-α1 of the present invention is prepared as follows.

Human peripheral blood leukocytes for IFN-α production were subjected to leukocyte-derived IF.
After brining with N, it is induced with Sendai virus etc. and cultured. After culturing, the cells are homogenized, mRNA encoding IFN-α is extracted, and single-stranded cDNA is synthesized from this mRNA using, for example, reverse transcriptase. Furthermore, the double-stranded DNA is introduced into a suitable vector, such as pBR322.
or insert it into pUC9. For example, large 1) E1 is transformed with this recombinant plasmid. Transformants are screened using appropriate markers such as drug resistance, and a plasmid containing fFN-α1 cDNA is isolated by colony hybridization and restriction enzyme treatment of plasmid DNA. This allows the production of double 1) [DNA encoding IFN-α. This double strand D
For example, the base sequence of NA is determined by the Maxam-G1) bert method (Maxam+A, and G1) bert.

H, 1979, Methods in Enzymol
The preparation of a recombinant plasmid containing the DNA sequence of IFN-α, which was determined by 0 (log)+65+499-560) and confirming the presence of the IFN-α1 gene, is shown below.

All or part of the IFN-α1 gene is excised from the obtained clone, and if necessary, a translation initiation codon is added to the translation initiation site. Furthermore, a suitable promoter, SD (
It can also be connected downstream of a Shine and Dalgarno) sequence.

Promoters include trp promoter, lac promoter, amylase promoter, SV40 promoter, λphage promoter, tufB promoter, and hybrid promoters thereof, such as t
Examples include ac promoter.

The IFN-α1 gene, to which a translation initiation codon and promoter have been added as necessary, is inserted into a suitable vector to obtain a recombinant plasmid.

A transformant can be obtained by transforming a suitable host with the obtained recombinant plasmid according to a conventional method.

Examples of the host include Escherichia coli, yeast, Bacillus subtilis, and animal cells, with Escherichia coli being preferred.

The host thus obtained is cultured in a known medium.

After culturing, the cells are collected by a known method, suspended in a buffer solution, for example, and then disrupted and centrifuged to obtain a supernatant.

IFN-α in the supernatant can be purified using an anti-IFN-α polyclonal antibody and/or an anti-rFN-α monoclonal antibody.

〔Effect of the invention〕

Thus, the DNA sequence encoding the IFN-α1 polypeptide provided by the present invention can be compared to known IFN-α1 polypeptides.
It encodes an amino acid that differs at position 35 from the amino acid sequence of , making it possible to supply a novel IFN-α derivative and satisfying the need for technological diversification in IFN development technology.

〔Example〕

Hereinafter, the present invention will be explained in more detail with reference to Examples, but the present invention is not limited to these Examples.
5au3AI, H4nf I, BamH1% Ha e
■, Hael[[, Bgl■, Pvu■ are manufactured by Takara Shuzo Co., Ltd.
ECORI and PstI are manufactured by Nirapon Gene, Ddel
The one manufactured by BRL was used. T4 DNA ligase manufactured by Takara Shuzo was used.

(1) Extraction of mRNA Leukocytes isolated from human peripheral blood 10” cells/
! 5! After priming with 100 TLI/+sl of leukocyte IFN in MEM medium containing J1i plasmanets, 4.
Induced for 5-5 hours*3. Cells were collected by centrifugation for 20 minutes at OOO rpm, and 1 x 10 to 3 x 10'' cells were placed in guanidine thiocyanate (Gu-H3CN) solution (
4MGu-H3CN, 0.1M Tris-HCl, pH 1
, 5,0,1M 2-mercaptoethanol). This was placed in a 15-20ml 5.7M polyaromer tube for Beckman 60Ti rotor.
Cesium chloride, layered on top of 0.1 MEDTA solution,
Centrifuge at 0.00 rpm and 15°C for 17 hours or more,
An RNA precipitate was obtained. The obtained RNA precipitate was
1 ml of guanidine hydrochloric acid (Gu-HCj lysis fFL (
6MGu ・HCI, 10+sM EDTA, p
)I7.0.10+wM dithiothreitol), heated at 68°C for 3 minutes, and then rapidly cooled with ice water. 0.
0.4 volume of IN acetic acid and 0.5 volume of ethanol were added, and the mixture was left at -80°C for 2 hours and then centrifuged to obtain RNA precipitate. This RNA was washed with 709A ethanol, dried and
．． O1? After dissolving in Tris-HCl buffer (pH 7,5), heat and rapidly cool at 65°C for 3 minutes, and add 1/9 volume of 5MNa.
Cj! was added, and poly(A) RNA Afc was concentrated using an oligo(dT)-cellulose column. The obtained poly(A)R
After ethanol precipitation of the NA fraction, 8-30% (w/w) It1) Density gradient centrifugation (SW41Ti rotor,
22.00 Orpm, 5°C, 17 hours) to obtain 6 fractions, and a portion of the RNA from each fraction was injected into African frog oocytes.
When the activity was measured (RPHA reagent, manufactured by Midori Juji Co., Ltd.), fraction 3 (12-15S) had a
001) The activity of J/ptRNA was detected.

Synthesis of +21 c DNA The reaction mixture 1 of 133 PJ containing the obtained 2ON RNA was cooled with water for 5 minutes and then treated at 46° C. for 10 minutes. This was deproteinized with phenol and 0. 7 with NaOH in N
RNA was degraded by treatment at 0°C for 20 minutes.

Reaction mixture l Tris-HCJ, pH 8,350a + MKCII
7(1+
MMgCjtt
10MM dATP, dCTP, dGTP.

and TTP (Boehringer) each 0.
5mMα-”P-dCTP (A+wershas
) 50 μci dithiothreitol
0.2 mM oligo(dT)+□-+*(
CRI) 25 i/end 1mRNA
150 Pg/ml AMV re
verse transcriptase 8
00 U/1fIIχ0 Total amount 13
(3) Synthesis of double-stranded DNA The obtained cDNA was added to a 100μ solution (200s + M phosphate buffer, pH 7, 4, 20mM MgClt, 2m
M dithiothreitol, 0.5mM each dATP, d
CTP, dGTP, TTP) at 58°C for 2.5
After processing for 10 minutes. The mixture was centrifuged at OOOrpm+ for 2 minutes, and 22 units of DNA polymerase I Klenow fragment were added to the resulting supernatant to make the total volume 200μ.

After reacting overnight at 15°C, protein was removed with phenol, and glycerol was added to a final concentration of 10%. Apply this to a Sephadex G-100 column, and
Elution was performed with 00 buffer. Five drops of the eluate were divided into one fraction, the radioactivity of each fraction was measured, and the peak radioactivity was collected and mixed, followed by ethanol precipitation.

The two obtained 1) [Dissolve the DNA in 72 PJ of water,
．． 2 volumes of 5x31 nuclease buffer (0,167M
Sodium acetate, pH 4, 5, 5mM ZnCj! i
), then 0.02 uni of Sl nuclease
t/7μ was added and reacted at 37°C for 5 minutes. After the reaction was completed, the DNA was extracted with phenol using a water-saturated phenol-chloroform (1:1) solution (1:0 uIt), and the resulting solution was precipitated with ethanol.

The obtained precipitate was diluted with TE buffer (10Il1M Tris, 1m
M EDTA, pH 8,0)? Dissolve, 65℃, 3
Heat for a minute and then rapidly cool with ice water. It was layered on 5-25% sugar syrup and centrifuged for 17.5 hours at 4°C and 38.000 rpm+ using a Spinco 5W41Ti rotor. After centrifugation, 20 fractions were obtained, radioactivity was measured, the two fractions with the highest activity were mixed, ethanol precipitation was performed, the precipitate was washed with 70% ethanol, and then dried.

Through the above operations, two tiDNAs were obtained.

(162 ng of 41d C-tailed double-stranded DNA and its 3°-OH terminal s,
ooo times the amount of dCTP and 5μ of 1OXTdT buffer (1
, 4M potassium cacodylate, 0.3M) lithium-hydrochloric acid.

pH 7,0, 10mM COCl1t, 1mM dithiothreitol) were mixed to make a total volume of 50μ, and the mixture was heated at 37°C.
After treatment for 2 minutes, 45 units of terminal deoxynucleotidyl transferase was added and reacted for 1 minute at 37℃.
It was attached to the 3'-OH end of A.

dC tail double-stranded DNA was recovered by phenol extraction and ethanol precipitation.

(5) Cleavage of E. coli plasmid and addition of dG Till 6H of E. coli plasmid pBR322 was dissolved in PstI reaction solution (12 units of PstI, 0.02M Tris-HCl, pH 7,5,0,01M MgCj!z)
, 3 in 0.05 M (NHs) t SO4)
The reaction was carried out at 7°C for 2 hours.

The obtained Pstl-digested pB R322 (4pmo+), dGTP (12nmol) and 10XTdTll
10μ of street liquid was mixed to make a total volume of 100μ, and after standing at 37°C for 2 minutes, 84 units of terminal deoxydyltransferase were added and reacted at 37°C for 105 seconds to add about 18 residues of dG. . phenol extraction,
and dG tail pBR322 was recovered by ethanol precipitation.

(6) dC tail double-stranded DNA obtained in annealing reaction and E. coli transformation (3), 25 pmol
, dG tail pB R322 (0,0
25pa+ol), 10x annealing buffer (100
mM Tris-HCl, pH 7,5, IM NaCl, 2
5mM NagEDTA) 15μ was prepared to a total amount of 600Pt, heated at 70°C for 10 minutes, and then heated at -70°C day and night.
The temperature was gradually lowered from 37° C. to 37° C. to complete the annealing reaction. Using the obtained DNA, incubate E. coli using standard methods.
RRI was transformed and 74,000 strains having properties of tetracytalline resistance and ampicillin sensitivity were selected.

(Selection of 71c DNA-containing plasmid) From the mRNA obtained in (1), Maizel's method (NoMai-ze
ls, Ce1l, 9.431-438 (197
The probe was prepared according to 6)). The amount of mRNA used, the hydrolysis time, and the amount of (r-''P)ATP are summarized in Table 1.

(Left below) Colony hybridization was performed using the obtained ("P) mRNA as a probe, and as a result, 894 colonies were selected.

Next, selection using restriction enzymes was performed. IFN-α shown in Nature + Atobori, 20-26 (1981)
Table 2 shows the sizes of fragments predicted from restriction enzyme digestion based on the base sequence of . DNA was extracted from strains selected by colony hybridization and digested with each restriction enzyme (Table 3). DNs that give rise to the fragments shown in Table 2
When A was selected, pHL696 produced fragments of approximately the same size. Therefore, we prepared a large amount of pHL696,
When we created a map of the restriction enzyme cleavage sites (Figure 1), we found that
It matched the expected restriction enzyme map.

(Margins below) Table 2 Table 3 No 12 fragments were obtained. NT: not tested Unit: (bp) Furthermore, the entire base sequence of the IFN-α1 structural gene was Max.
As determined by the a+s-Gilbert method, the base sequence was as shown below.

TGTGATCTCC辷TGAGACCCACAGCC
TGGAT'AACAGGAGGACctrcatcc
tcctcccAcAarcAccacaAtctcr
ccrtccTCCTGTCTG entered TGGACAGAC
ATAACTTTGGATTTCCCCCAGGAGGA
GTTTG'ATGGCAAACCAtotalccAcaAc
i;
CCTCTTTACCACAi1^AGatrcatc
tcctccttcmGATGAGGACCtcctx
cAcaiattcyccAc辷G^^CTCTAC辷AGCAGCTGAAGATTAAGGAゐGAAGG
AA (8) Creation of mature IF N-α1 gene IFN-α cloned into the obtained pHL696
, the region encoding the signal sequence of the gene was removed and the protein start codon ATG was added. Second outline
It is shown in Fig. and Fig. 3. pHL696 (498N)
It was digested with au3Ar and a 176 bp fragment was separated using 6% PAGE. The separated fragments were recovered using DBAE-cellulose barber to obtain 8,2n fragments. The obtained fragment was digested with Hinf I and separated by 10% PAGE to obtain a 64 bp fragment (1.5 Pg). 1) mer GATCACAC labeled with 31p at the 5° end
ATG (manufactured by Cell-tech) 500pa+ol
500 pmol of 1 mer GATCCATGTGT (manufactured by Nippon Zeon) and 1.1 mer of 64 bp fragment.
After heating at 65°C for 5 minutes and rapid cooling, add reaction buffer for ligation (66mM t-lys-HCl, pH 7.6).
, 6.6mM MgC7! i, 10mM dithiothreitol, 0.5mM ATP) and incubated at 16°C.
I let it react overnight. After the reaction, phenol/chloroform treatment and ethanol precipitation were performed according to a conventional method, followed by digestion with 30 units of Hinr I at 37°C for 1 hour. Hint
f [Fragments were separated using 10% PAGE after treatment, and fragments with the desired size <75 bp were confirmed. DE this fragment
It was recovered by the AE-cellulose paper method. The radioactivity of the obtained fragment was 2.34X10'cp+m. The resulting fragment was digested with 60 units of Ddel and 10%
When subjected to PAGE, 9J of gel around the target 18 bp was extracted, adsorbed onto DEAE-cellulose paper, and eluted, radioactivity of 2.04 x 10' cps was measured. On the other hand, pHL696 (10Pg) was added to Pstl and Dda.
An 829 bp fragment was isolated by digestion with l. Next, this 8
29bρ was digested with ECORI to obtain a 549bp fragment of 250
ng was obtained.

The total amount of the obtained 18 bp fragment and 125 ng of 549b
After the p fragments were ligated, they were separated on 5% PAGE. As a result, a band was detected near the target 567 bp. DNA was extracted from this band and the radioactivity was measured and found to be 1.49 x 10' cpa+.

pBR322 was digested with ECORI and BamHI to isolate a 3985 bp fragment containing the ampicillin resistance gene (Ap'). A total of 340 ng of this fragment and a 567 bp fragment were ligated using 5.6 units of T4 DNA ligase. E, co using the entire amount of reaction solution
When the li RRI strain was transformed, about 4,000 A pr transformants were obtained.

Plasmid DNA was extracted from the obtained transformant by the minibleb method, and ss'ybp EcoRI-BamH
Those with the I fragment were selected. As a result, we investigated 120
Among the clones, 1) 8 clones had plasmid DNA giving an EcoRI-BamH fragment with a size close to 567 bp.

When the plasmid DNA of four of the clones was analyzed using various restriction enzymes, it was strongly suggested that all of them were the desired plasmids. Therefore, a large amount of plasmid DNA of clonal disease 1) was prepared by the cleared Iysate method, and the following experiment was conducted.

Plasmid DNA derived from clone 1) purified by the cleared Iysate method was treated with various restriction enzymes, and the sizes of the fragments were measured by 6% PAGE. As a result, the clover 1) plasmid gave a fragment of the same size as the target plasmid (Table 4).

(Margins below) Table 4 Pνull fragment m1il (fragment generated by human) Digesting this plasmid with Ddel produces two Ddel fragments (1,223b) that are characteristic of the target plasmid.
p, 621 bp) was confirmed. clone 1kll
The plasmid DNA was named pIα1.

Furthermore, the Bgtn site of this plasmid is 3! The base sequence was determined for the 470 bp fragment obtained by labeling with P and cutting with )(incl[) (Mayam-G
ilbert method). Figure 4 shows a part of the determined base sequence. The obtained sequence matched the expected sequence.

(9) Preparation of plasmid for expression in E. coli (the outline is shown in Figure 5) a) Isolation of each fragment plαl was digested with EcoRI and 13amHI, separated by 1% agarose gel electrophoresis, and the desired 567 bp fragment was isolated. Fragment 23.8q of was obtained.

1) DR540 (PL, Biochemica1)
LOln (obtained from Biotech, Inc.) was digested with BamHI and Hindl[I to obtain 8.46N, a 91 bp fragment containing the desired tac promoter. On the other hand, 37.5Pg pDR5
Digest 40 with BamHl and EcoRI to obtain the desired 371
1.98 pg of a bp fragment was obtained.

The region containing the AATAAA sequence at the 3' end of pHL696 was digested with EcoRI and Bgll to obtain 14.6 pg of a 380 bp fragment. - 5.65M of pBR322 was treated with EcoRI and PatI to obtain a 3.610 bp fragment 2.81M containing the tetracytalline resistance gene (Tc'). On the other hand, p
BR322 was digested with EcoRI and HindllI,
A portion of it was run on 10% PAGE to confirm that it had been digested. The remaining reaction solution was added to B A without separating the fragments.
P (Bacterial alkaline ph
osphatase (manufactured by BRL)] and used as is in the Gesin reaction.

b) Plasmid plα1tacl for expression in E. coli
First, a fragment (567 bp) containing the IFN-α1 gene.
, 5q and ^ATAAA sequence-containing fragment (38 obp) 4
．． 5 possible was ligated. 8 each of ligation reactants
Treated with 0 units of Pstl and BamHI, 4.5%
The target fragment of 847 bp was obtained by separation by PAGE.

This fragment was subjected to BAP treatment, and a 371 bp fragment (a fragment containing the TaC promoter/operator and SD sequence) was In
he asked.

After digesting the ligation reaction with 5 units of PstI,
When analyzed with 4.5% PAGE, the desired size (1218
A fragment close to bp) was detected. Collect this fragment,
200 ng of pBR322EcoRl-Pstl fragment (
3,610 bp), then E, col
i JM 103 was transformed. As a result, 600 tetracytalline-resistant transformants were obtained.

Plasmids of these transformed strains were prepared by the minibleb method and analyzed using various restriction enzymes, and strains that seemed to contain the desired plasmids were obtained. When the plasmid of this strain was purified using the cleared Iysate method and further analyzed, the sizes of the fragments obtained by various restriction enzyme treatments all agreed with the expected values (Table 5).
Therefore, this plasmid was named plα1·tacl.

(Margin) Table 5 C) Plasmid plα1tac2 for expression in E. coli
Made by! I (schematically shown in Figure 6).

First, a fragment (567 bp) containing the IFN-α1 gene 5
/If and '['ac promoter/operator and S
The 91 bp fragment 1.46/If containing the D sequence was ligated, the polymer was degraded with 60 units of Hindll, and the polymer was run on 4.5% PAGE. As a result, the desired 658 bp fragment was detected. Half of this recovered fragment was treated with BAP and used as pBR322EcoRI-Hin.
d[[fragment 1.18/1)- and E,
When coli J M2O3 was transformed, 75
Zero ampicillin-resistant transformants were obtained. Plasmids of these transformants were prepared by the minibleb method,
Analysis of various restriction enzymes revealed a strain that appeared to contain the desired plasmid. Therefore, a plasmid of this strain was prepared by the cleared Iysate method and further analyzed. As a result, the sizes of fragments obtained by treatment with various restriction enzymes were consistent with the expected values (Table 6). This plasmid was named plαl tac2.

Table 6 1 and 3. Fragment QI IF N-α generated by partial digestion of amHI, gene expression JM103/pIα1tacl and JM103/piα
l tac2 in LB medium (Bacto-trypton
log, Bacto-yeast extract
Dissolve 1210 g of NaC in the distilled water of 1), culture with shaking overnight at 37°C in a medium containing Q, IN NaOH (prepared to pl + 7.5) and ampicillin or tetracycline, and culture with shaking overnight at 37°C. 5 (1+
The cells were inoculated into the same medium as in Section 1 above, and cultured with shaking at 37°C. O.D. = 1 and a final concentration of 1 mM I P TG (
1sopropyl-β-D-thiogalacto
side) was added. After that, the shaking culture was continued until the OD6. . -3 to collect bacteria from 40 ml of culture solution, wash the bacterial cells with physiological saline, and then
) 1B), 30mM NaCR.

Suspended in 6mMEDTA, 10q/a+1 phenylmethylsulfonyl fluoride, final concentration 1 mg/ll1)
(7) Lysozyme was added and treated at 0°C for 30 minutes.

Next, after 5 times of rapid freezing and rapid thawing, 10,000
Centrifuge for 20 minutes at rpm s 4°C and 40. OOOr
pm, 4°C, 1 hour (5pinco 5W50.10-
Ultracentrifuge the supernatant (S-100sup, )
I got it. The IFN-α activity of the obtained S-100sup was measured. The wet weight of the collected bacterial cells was 0.18 to 0.20 g/401 culture solution for both strains.

The activity of IFN-α was measured using the CPE method (FL3-1ce
The test was carried out using a preliminary research method using ll and 5indbis viruses. JM103/plα1tacl is 3.8X10
'+1)/f culture solution, JM103/prL0xltac
What about 2? , 6 X L O' Iu/l culture solution tea ivy.

Preparation of a purified monoclonal antibody column for αυ IFN-α1 BAL B/C mice were immunized with IFN-α1 for 10 weeks, and after confirming that the blood antibody titer had increased, the lung cells (B cells) were collected. . This cell and mouse myeloma cell X63-Ag8653 (USA, FLOW
Co., Ltd.) and fused in the presence of polyethylene glycol #1000.

Among these fused cells, cells producing antibodies against IFN-α1 were examined by methods such as hemagglutination reaction, enzyme immunoreaction, and neutralizing antibody reaction to obtain IFN-α and antibody-producing strains. This cell line was cultured intraperitoneally in mice for 7 to 10 days.
Mouse ascites was isolated on day one. This mouse ascites is IFN
-strongly inhibited α1 activity. This monoclonal antibody in mouse ascites was bound to CNBr-activated Sepharose (manufactured by Pharmacia) according to a conventional method to prepare a water-insoluble immobilized monoclonal antibody.

A column was filled with 10 ml of this water-insoluble immobilized monoclonal antibody, and the supernatant of the lysate was allowed to flow down at a flow rate of 50 ml/hour at room temperature to adsorb IFN-α. Total 4X
After adsorbing 10'lll of IFN-α1, 0.1~
], the column was washed with OM NaCl solution to remove impurities.

Next, a 3.5M KSCN solution was injected into the column, and IFN
-α1 was eluted.

The recovery rate of eluted IFN-α was 80%, and the specific activity was 1.
5 x 10'1) 17 mg.

[Brief explanation of the drawing]

FIG. 1 shows the restriction enzyme cleavage site of the cDNA insertion portion of pHL696. □ indicates the cDNA insertion part, ... indicates p
Derived from BR322. FIG. 2 shows an outline of the preparation of the mature IF N-α1 gene. Figure 3 shows the method for constructing the translation initiation site. Figure 4 shows the IF of the plasmid derived from clone Na1).
The DNA sequence of the translation initiation site of N-α1 is shown. FIG. 5 shows a method for producing the expression plasmid pIα1tacl. FIG. 6 shows a method for producing the expression plasmid piαl tac2.

Claims (4)

[Claims] (1) The DNA sequence of interferon-α_1, which is characterized by encoding the polypeptide shown below. [There is a gene sequence] (2) A DNA sequence according to claim (1), which has the following base sequence. [There is a gene sequence] (3) A recombinant plasmid characterized by containing the DNA sequence of interferon-α_1, which encodes the polypeptide shown below. [There is a gene sequence] (4) A transformant transformed with a recombinant plasmid characterized by containing the DNA sequence of interferon-α_1, which encodes the polypeptide shown below. [There is a gene sequence]