JPS6034994A - Novel polypeptide and its use - Google Patents

Abstract

NEW MATERIAL:The polypeptide of formula I (X is bond, or peptide or amino acid residue having 1-16 amino acids from the C-terminal of the peptide chain of formula II; Y is peptide or amino acid residue having 1-5 amino acids from the N-terminal of the peptide chain of formula III). EXAMPLE:H-Lys-Arg-Lys-Arg-Ser-Gln-Met-Leu-Phe-Arg-Gly-Arg-Arg-Ala-Ser- Gln-OH. USE:A novel monoclonal antibody can be prepared by bonding the peptide of formula I chemically with a carrier protein, cloning the obtained protein complex, and using the obtained hybridoma. The obtained monoclonal antiboxy can be used for the purification of human IFN-gamma and for RIA-process. PREPARATION:The objective peptide can be prepared by condensing (A) a raw material containing reactive carboxyl group and corresponding to a part of the polypeptide of formula I with (B) another raw material containing reactive amino group and corresponding to the remaining part of the polypeptide, by a peptide- synthesis method.

Description

[Detailed description of the invention] Technical field The present invention relates to novel polypeptides and their uses.

Background technology Nature, developed by Köhler and Milstein,
256, 495 (1975)), the production method of monoclonal antibodies using hybridomas, which has become popular in recent years, has the advantage of being able to obtain antibodies that exhibit monospecificity for each antigenic determinant, and the use of crude preparations. It has excellent features such as not requiring any absorption procedure for the antibodies obtained against the product.

In addition, from the aspect of antibody acquisition, high titer antibodies can be freely distributed to winter melons by turning hybridomas into ascites.
Moreover, it has many advantages, such as being able to always obtain homogeneous specimens with high reproducibility. In this sense, the method of obtaining monoclonal antibodies using hybridomas has been highly evaluated for its usefulness in many fields. In addition, its versatility is not limited to simply detecting antigens, but also through the production of antibody columns.
! , ■Used for purification of ingredients, [Nature, 285
.

446 (1980)), and its application to therapeutic drugs (European Journal of Immunology,
Yu, 94 (1979)] has also been developed.

It is known that there are at least eight types of human interferon CIFN, including antigenically different α, β, and γ types (Nature).

286.110 (1980): ]. R-type α-type interferon FN-γ) is known to be mainly produced by T lymphocytes in response to mitogen or antigen stimulation, and is also known as immune interferon CI-IFN).
Also known as the interferon system (Sbringer).

New York, 1979]. IFN-7 is expected to be produced in vivo in response to various immune reactions, and is thought to play an important role in immune regulation. In addition, the properties of IFN-γ include α-type interferon (IFN-σ) and β-type interferon (IFN-σ).
In addition to having different antigenicity and different inducing agents than N-β), it is also known that they have poor stability against acids and heat [The Interferon System, Sbringer, New York, 1979] ].

IFN is generally defined as having an antiviral effect produced by living organisms, but it has been proven to have many other biological activities as well.

It has attracted particular attention for its antitumor effects [Blood, 55, 711 (1980);
980)). As a method of suppressing tumor growth, a method of directly suppressing tumor cell proliferation.

One possible method is to indirectly suppress tumors via the host's immune response; in the latter case, for example, activation of natural killer cells (NK), macrophages, or killer T
Possible causes include cell activation. In fact, IFN has been proven to have various immune-enhancing activities such as these, in addition to its direct effects.

Eng. 16, 281 (1978)). IFN-γ has various activities linked to these antitumor activities in vitro.

and in vivo antitumor activity, IFN-a and I
Since it is much higher than FN-β, its importance is strong (
It has been pointed out [Cellular Immunology, S, 890 (
1980): l.

However, the titer of IFN-γ induced in vitro is generally low, there are few suitable IFN-γ-producing cell lines, and purification is difficult due to poor stability against heat and acids. Mass production and purification of -γ is much slower than that of IFN-1ffi and IFN-β.

Very recently, there has been a report that a single natural IFN-γ has been produced [Proceedings of the National Academy of Sciences, 79°1820 (1982)].
Recovery of activity is very poor.

A more effective purification method is eagerly awaited.

-Recently, the cloning of the human IFN-γ gene has been reported, and at least 146
A molecular species of approximately 17 kilodaltons consisting of amino acids,
Now produced by Escherichia coli (Nature, 295,5
08 (1982); Nuclear Aids Research, 10.2487 (1982)), naturally occurring IFN-γ has been reported to have various molecular weights, and the correspondence between the molecular species is still unclear. It is.

From this perspective, it is important to obtain monoclonal antibodies against various types of IFN-γ, not only to establish correspondence between single molecular species, but also to obtain monoclonal antibodies against various types of IFN-γ. It is an extremely powerful weapon for refining γ. Very recently, natural IFN
The acquisition of monoclonal antibodies against -γ was reported [
Nature, 296, 258 (1982)), but IFN
When -γ consists of multiple molecular species, it is extremely important to obtain monoclonal antibodies against the molecular species cloned by genetic recombination methods.

Disclosure of the Invention The present inventors have published a report on the amino acid sequence of human IFN-γ deduced from the nucleotide sequence of the structural gene [Nucletics Research 10.2487 (19
82)), H-X-1:ys Arg Ser Gl having a partial structure on the C-terminal side of the amino acid sequence.
n Met Leu Phe Arg(OGty-y-on (I) (Un [wherein, X is a bond or Ile Gin Val M
etAla Glu Leu Ser Pro Ala
Ala Lys Thr (A peptide or amino acid residue having 1 to 16 amino acids counting from the C-terminus in a peptide chain represented by Q Gly Lys Arg and 1 to 5 amino acids counting from the N-terminus) A polypeptide represented by the following formula was chemically synthesized and chemically bonded to a carrier protein to form a protein complex.

A mammal is immunized with the polypeptide or protein complex obtained here, and the removed lung cells and the same or different kind of lymphoid cells are fused to form a hybridoma.
I cloned this.

The hybridoma thus obtained was inoculated into mammals to produce and accumulate monoclonal antibodies, which were collected to produce monoclonal antibodies against the polypeptide.

Using the monoclonal antibodies obtained here,
A method for purifying human IFN-γ from crude human IFN-γ-containing materials and human I
A method for detecting FN-γ was established and the present invention was completed.

That is, the present invention provides a novel polypeptide (I), a protein complex thereof, a novel cloned hybridoma, a novel monoclonal antibody, a method for producing these, and uses of the monoclonal antibody.

Regarding the try polypeptide (1), Y is Arg Ar
gAla Ser Gln is preferable, and in addition to this, it is particularly preferable that X is Lys Arg) Furthermore, it is preferable that the polypeptide has 15 to 25 amino acid residues, including the number of amino acid residues.

The polypeptide can be produced by conventional means of peptide synthesis. Although either the in-phase synthesis method or the liquid-phase synthesis method may be used, the liquid-phase synthesis method is often advantageous. Means for the synthesis of such peptides include, for example, "I'he Pept
ides” Volume 1 (1966).

5chr8der and Lubke, Acad
emic Press, New York, U.S.
, A., or “Peptide Synthesis”, Izumiya et al., Maruzen Co., Ltd. (1975).

Or “Biochemistry Experiment Course, Volume 1, pp. 207-400
Page” by Haruaki Yajima, Tokyo Kagaku Doujin Co., Ltd. (1977)
For example, the azide method, chloride method, acid anhydride method, mixed acid anhydride method, DCC method, active ester method, method using Woodward reagent K, and carbodiimidazole method.

Redox method, DCC/additive (e.g. HONB.

)10Bt, HO8u J method, etc.

Polypeptide (1) consists of (a) a raw material having a reactive carboxyl group corresponding to a part of the polypeptide, both of which may be protected, and (I) polypeptide (+).
If the resulting condensate has a protecting group, it can be produced by condensing raw materials having a reactive amino group corresponding to the remainder by a conventional method for peptide synthesis, and removing the protecting group by a conventional method.

The protection of functional groups that should not be involved in the reaction of the raw materials, the activation of functional groups that are involved in the removal reaction of the protecting groups, and the like can also be appropriately selected from known methods or methods.

Examples of the protecting group for the amino group of the raw material include 1-butyloxycarbonyl and t-butyloxycarbonyl.

t-amyloxycarbonyl, isobornyloxycarbonyl, p-methoxybenzyloxycarbonyl, 2-
Chloro-benzyloxycarbonyl.

Adamantyloxycarbonyl, trifluoroacetyl, phthalyl, formin, 0-nitrophenylsulfenyl, diphenylphosphinothioyl.

Examples include 4-methoxy-2,8,6-)limethylbenzenesulfonyl. Protecting groups for carboxyl groups include, for example, alkyl esters (e.g. methyl, ethyl,
ester groups such as propyl, butyl, t-butyl), benzyl ester groups, p-nitro benzyl ester groups,
Examples include p-methoxybenzyl ester group, p-chlorobenzyl ester group, benzhydryl ester group, carbobenzoxyhydrazide group, t-butyloxycarbonylhydrazide group, and tritylhydrazide group.

As a protecting group for the guanidino group of arginine.

Examples include nitro group, tosyl group, p-methoxybenzenesulfonyl group, carbobenzoxy, isobornyloxycarbonyl, adamantyloxycarbonyl, 4-methoxy-2,6-simethylbenzenesulfonyl group, pentamethylbenzenesulfonyl group, etc. be done. Also, its guanidino group.

(e.g., benzenesulfonic acid, toluenesulfonic acid, hydrochloric acid, sulfuric acid, etc.) may be protected in the form of a salt.

The hydroxyl groups of threonine and serine can be protected, for example, by esterification or etherification. Examples of groups suitable for this esterification include lower alkanoyl groups such as acetyl groups.

Examples include aroyl groups such as benzoyl groups, groups derived from carbonic acid such as benzyloxycarbonyl groups, and ethyloxycarbonyl groups. Examples of groups suitable for etherification include benzyl group, tetrahydropyranyl group, and [-butyl group. However, the hydroxyl group of threonine does not necessarily need to be protected. Methionine may be protected in the form of sulfoxide. Examples of raw materials with activated carboxyl groups include corresponding acid anhydrides, azides, and active esters (pentachlorophenol, p-nitrophenol, etc.).

Examples include esters with N-hydroxysuccinimide, N-hydroxybenztriazole, N-hydroxy-5-norbornene-2,8-dicarboximide, etc. The peptide bond formation reaction is performed using a dehydrating agent (e.g.
In some cases, the reaction can be carried out in the presence of a carbodiimide reagent such as dicyclohexylcarbodiimide or carbodiimidazole.

This peptide condensation reaction can be performed in the presence of a solvent. The solvent may be appropriately selected from those known to be used in peptide condensation reactions. For example, anhydrous or hydrous dimethylformamide, dimethyl sulfoxide, pyridine.

Examples include chloroform, dioxane, dichloromethane, tetrahydrofuran, ethyl acetate, N-methylpyrrolidone, and appropriate mixtures thereof.

The reaction temperature is appropriately selected from the range known to be used for peptide bond formation reactions, and is usually -40℃-
The temperature is appropriately selected from the range of about 60°C, preferably about -20°C to about 0°C.

After the water condensation reaction, if the product has a protecting group,
It can be withdrawn by ordinary means. Such conventional methods include, for example, reductive methods (e.g. hydrogenation using catalysts such as palladium black, reduction with metallic sodium in liquid ammonia), acidolysis (e.g. trifluoroacetic acid, hydrogen fluoride, methanesulfonic acid or Examples include acidolysis using the above acids or a mixture thereof in the presence of a sulfur-containing compound such as anisole.

The peptide of the present invention produced as described above can be extracted from the mixture after the completion of the reaction using conventional peptide separation means or extraction 2.
It can be collected by partitioning, column chromatography, etc.

Regarding the protein complex of polypeptide (1) and carrier protein, the mixing ratio of carrier protein [1f14 and carrier habten (peptide in this case)] is as follows.

As long as an antibody can be efficiently produced against the immunized habuten by coupling it to a carrier, any substance can be coupled in any ratio, such as bovine serum albumin or bovine thyroglobulin, etc., in a weight ratio of l to habuten. 0.1 to 20. Preferably, a method of coupling at a ratio of 1 to 5 is used.

Also, for the coupling between hub ten and carrier.

Although various condensing agents can be used, glutaraldehyde, carbodiimide, etc. are preferred.

When immunizing with polypeptide (1) or protein complex, experimental animals such as sheep, goats, rabbits, guinea pigs, rats, and mice are used as the mammals to be immunized, but in order to obtain monoclonal antibodies, Rats and mice are preferred. The immunization method is 1. For example, when immunizing mice, subcutaneous
It can be administered by any route such as intraperitoneal, intravenous, intramuscular, or intravenous, but it is mainly administered subcutaneously, intraperitoneally, or intravenously (
Injection (especially subcutaneous) is preferred. Also, the immune interval.

The degree of variability in the amount of immunity etc. is K<, J! For example, the method of
A method using lung key 11 cells after ~5 days, preferably 2 to 4 days, is often used. As a peptide shop, the amount of immunomodule should be more than 1μf per mouse, preferably 1011g.
It is desirable to use ~300 μf.

Also, before removing the lungs, a partial blood sample is taken and after confirming the rise in blood antibody titer, Ill'l! It is desirable to perform fusion experiments using Ia4 (If cells).

The cell fusion between +11'll visceral cells and lymphoid cells is as follows.

For example, excised mouse lung cells are treated with hypoxanthine-
Guanine-phosphoribosyltransferase deficiency (H
GPRT)- or a lymphoid cell line, such as a JEa-positive homogeneous or xenogeneic (preferably homogeneous) myeloma, which has markers such as thymidine kinase deficiency (TK). For fusion.

Sendai virus, polyethylene glycol (PEG)
Fusing agents such as the following are used. Of course, it is also possible to add other fusion promoters such as dimethyl sulfoxide (CDMSO). The degree of polymerization of PEG is usually between 1000 and 6000.
, time is o, 6-30 minutes.

The concentration used is 10% to 80%, but as an example of preferable conditions, PEG6000 is 36 to 55% and 4 to 1
By processing for 0 minutes, efficient fusion can be achieved. The fused cells are hypoxanthine-aminopterin-
Thymidine medium (HAT medium; Nature, 256, 49
5 (1975) 1 etc. can be used to selectively propagate one seed.

The culture supernatant of the proliferated cells can be screened to determine whether the desired antibody is produced or not, and the antibody titer can be screened as follows. That is, in this case.

First, as the first step, the antibody BH against the immunized peptide
Raw material H, (can be investigated using the RIA method or the EIA method, but various methods can also be used for these methods. As an example of a preferred measurement method,
One method using EIA will be described. For example, a rabbit anti-mouse immunoglobulin antibody is coupled to a carrier such as cellulose beads according to a conventional method, and culture supernatant or mouse serum to be measured is added to this and kept at a constant temperature for a certain period of time (hereinafter referred to as 4 to 4 hours). (indicated in °C). After this.

After thoroughly washing the reaction product, an enzyme-labeled peptide (purified after coupling M element and peptide according to a conventional method) was added, and the mixture was incubated for a certain period of time. React with crystals.

After thoroughly washing the reaction product, an enzyme substrate is added and allowed to react for a certain period of time at a constant temperature. Thereafter, the colored product produced can be measured by absorbance or fluorescence.

Cells in wells that showed growth in the selective medium and showed antibody activity against the peptide used for immunization.

It is desirable to perform cloning by the limiting dilution method or the like. By similarly screening the supernatant of the cloned cells and increasing the number of cells in wells with high antibody f+Iti, monoclonal antibody μU-producing hybridoma clones that exhibit reactivity with the immunized peptide can be obtained.

Next, it is necessary to examine whether the antibodies produced by these clones show reactivity not only with the peptide used for immunization but also with the IFN-1 molecule itself.

For this purpose, there are two methods: EIA method using labeled IFN-γ, or EIA method to examine reactivity, and method to check whether biological activity (IFN-γ activity) is absorbed by this antibody. etc. are used. In the latter case, IFN-γ
Since there is no need to purify it, it can be used advantageously.

An advantageously used example will be described below, but of course other methods are also possible, such as measuring residual IFN-γ activity in the supernatant after removing the immunoprecipitate using protein A. For example, a rabbit anti-mouse immunoglobulin antibody is coupled to a carrier such as cellulose beads using a conventional method, and the Hypuridoma supernatant or mouse serum to be measured is added thereto for a certain period of time.

React at constant temperature. After this, the reaction product was thoroughly washed and a certain amount of I
Add FN-γ. As IFN-γ, for example, a cultured Jjiv containing IFN-γ induced from human peripheral blood lymphocytes with lectin and phorbol ester, etc., or an extract containing IFN-γ produced by recombinant E. coli, etc. can be used. I can do it. After adding IFN-γ, the mixture was allowed to react at a constant temperature for a certain period of time.

The activity of IFN-γ contained in the reaction supernatant is measured. In this manner, the ability of the antibody of interest to absorb IFN-γ activity can be measured.

Hybridomas thus cloned are grown in liquid culture or intraperitoneally in mammals. Specifically, for example, in a liquid medium such as RPMI-1640,
．． For 2 to 10 days in a medium containing 1 to 40% bovine serum, etc.
The monoclonal antibody can be obtained from the skin fluid by culturing it preferably for 8 to 5 days, but it can also be inoculated intraperitoneally into a suitable mammal such as a mouse, allowing the cells to proliferate, and ascites fluid is collected. By doing so, it is possible to efficiently obtain antibodies with a much higher titer than the cell culture supernatant. For this purpose, for example, in the case of mice, BALB/c inoculated with mineral oil etc.
1 x 104 to 1 x 107 mice, preferably 5
7 to 20 days after intraperitoneal inoculation of ~2X10' hybridomas.

Preferably, ascites fluid etc. are collected after 10 to 14 days.

Antibodies produced and accumulated in ascites are 5, for example, ammonium sulfate fraction.

By DEAE-cellulose column chromatography, etc.

Monoclonal antibodies can be easily isolated as pure immunoglobulins.

The monoclonal antibody of the present invention has the following properties.

(1) Binds to polypeptide (1) used for immunization.

Binds to t211FN-1 molecules and produces IFN-σ and IFN-
It does not combine with β.

(3) Assay by Ophthalony method: Koyori IgG2b
or belongs to the IgG1 subclass of antibodies.

(4) In SDS-polyacrylamide gel electrophoresis, only two /< nodes are shown that perfectly match standard immunoglobulin H and L #)4.

What about this monoclonal antibody? Completely made and used.

Can be stored.

Monoclonal antibodies obtained according to the present invention.

EIA method (Immunochemistry, 1,000, 429 (197
1)) Or RJ, A method and science.

158.1570 (1968)), the IFN-
In addition to being able to be used for the production of γ, for example, by creating an antibody column, it is possible to obtain natural 1. It can be used to efficiently purify IFN-γ produced by genetic recombination in a non-intrusive manner.

In order to detect IFN-γ, for example, a material containing IFN-γ to be measured or a standard IFN-γ is reacted with the monoclonal antibody that has been labeled in advance with radioactive iodine or an enzyme, and then the immune complex is reacted with the monoclonal antibody. For example, protein A can be added to precipitate the immunoprecipitate, and after reacting for a certain period of time, IFN-γ can be easily measured by measuring the radioactivity or enzymatic activity of the immunoprecipitate. Also,
When using a competitive method using antigens, for example, what about eyes? When ribebutide (1) is labeled with radioactive iodine or an enzyme and reacted with a certain unlabeled monoclonal antibody of the present invention, a material containing IFN-γ to be measured is coexisted. Next, the immune complex is precipitated. Let me do it.

or by conjugating to an anti-mouse antibody.

IFN-γ can be quantified. The radioactive iodine or enzyme label used here is the polypeptide (
Using purified IFN-γ instead of 1) Partially purified IFN-γ or 1 and polypeptide (1) are immobilized on the same phase as a microtray. As a method for immobilization, for example, IFN-γ or polypeptide (1) is added to 01111-1 in a phosphoric acid 1IJI solution containing 0.1M sodium hydroxide.
00 μf/me concentration preferably 10 to 20 μp/m (
This can be done by suspending 100 μgt in 100 μg/ml and treating each well of this microtray for 24 hours. The monoclonal antibody of the present invention was added to this well for measurement.
Materials containing N-γ were heated at 87℃ for 1 hour or at 4℃ for 200 minutes.
IFN-γ can be quantified by adding a time-reacted product and further adding a radioactive iodine- or enzyme-labeled anti-mouse or rabbit antibody. These series of EI
When an enzyme-labeled anti-mouse/rabbit antibody or the like is used in Method A, a rapid assay method using MultiScan (Flow Co., Ltd.) or the like is possible using the so-called ELISA (enzyme-linked immunosorbent assay) method. In addition, when monoclonal antibodies produced by two types of 11 hybridoma clones having different antigen recognition sites are used.

The so-called sandwich method (European Journal of Biochemistry, 71, 459 (19
76)) enables easier measurement of IFN-γ. Of course, these EIAs.

As long as an antibody suitable for a constant If level of IFN-γ using RIA can be obtained, various modified methods can be used, and the method is not limited to the above-mentioned method.

For purification of IFN-γ, the purified antibody is coupled to a suitable carrier, such as an activated agarose gel piece, in a conventional manner, and then loaded onto a column and cultured or broken. Materials containing CD crude IFN-γ, such as bacterial cells, are applied to the column, adsorbed, washed, and then treated with chaotropic reagents such as KSCN, or IFN-γ.
- Depending on the method of elution under weakly acidic conditions without loss of γ.

Can be purified efficiently.

The antibody column can be produced by the following method by coupling the monoclonal antibody of the present invention, which has been purified from, for example, ascites inoculated with hybridoma, to an appropriate carrier.

The carrier to be used may be any carrier as long as it allows IFN-γ to be specifically and efficiently adsorbed after coupling and is then eluted appropriately. Become viscous to
etc. are conveniently used in the manner described below. The reaction between Affigel-1O and antibody was 0.001 to IM,
The reaction is preferably carried out in a 0.1 M bicarbonate buffer. Reaction conditions are θ°~20℃, 10 minutes~
24 hours 1 Various I)Hs are possible, but preferably:
Conditions of 4° C., 4 hours, and pH 8 to 10 are used. What is the ratio of Affigel-10 and antibody to be mixed?

About 50ml of antibody per 1mJ of Affigel is 3.
Antibodies of the same type are advantageously used. After washing the antibody-carrier conjugate thus prepared thoroughly with the buffer used in the reaction, it is left to stand for several days, or ethanolamine/hydrochloric acid with a final concentration of 005M is added and reacted at 4°C for 1 hour. After blocking the remaining unreacted active groups using the method described above, it can be used as an antibody column by packing it into an appropriate column.

When performing purification using the antibody column described above, for example, a human immune interferon protein-containing material is dissolved in a near-neutral buffer, such as a phosphate buffer or a Tris/HCl buffer, and then adsorbed onto the antibody column. Next, after washing the column with the same buffer solution, IFN-γ is terminated. As an eluent, use a weakly acidic solution such as acetic acid solution! A solution containing lyethylene glycol, a solution containing a peptide that binds more easily to the antibody compared to the reference material, a high concentration salt solution, and a combination of these solutions are used. preferable.

The column eluate is neutralized with a buffer solution using a conventional method.4 If necessary, the above-described purification operation using the antibody column can be performed again.

The human I-IFN protein solution obtained here is subjected to dialysis, and if necessary, it can be lyophilized to form a powder. Stabilizers such as sorbitol, mannitol, dextrose, maltose, and glycerol can be added during freeze-drying.

The human immune interferon protein thus obtained exhibits a specific activity of 10'U/my or more in viral activity measurement using a test for inhibiting the cytopathic effect of vesicular stomatitis virus (VSV) on human amnion-derived WISH cells.

Here, the activity of IFN is expressed as U/mg (units/mg).
me) was disbursed as follows. The unit's established international standard IFN-α and leukocyte-derived crude IFN-γ were measured using a vSv cytopathic effect inhibition test on human amnion-derived FL cell lines, and from a comparison of their titers, leukocyte-derived IFN-γ The titer of the product was determined and used as a standard product of IFN-γ. In order to calculate the titer of IFN-γ in the target material, line up this standard IFN-γ in the field and perform the WISH test described above.
-VSV system was assayed, and the titer was calculated from the ratio.

The human immune interferon protein to be purified in the present invention has, for example, the general formula % (1) [wherein A represents Met or a bond]
2 represents Cys or t/2cy8, respectively. According to the purification process of the present invention, it is possible to remove proteins containing 90% or more, especially 95% or more of the polypeptide on a dry product basis.

1) Molecular weight determined by SDS-polyacrylamide gel (17.5%) electrophoresis: 17,000±i, oo.

shows.

2) Has cystine or half-cystine or methionine as the amino terminal amino acid.

8) H-Lys-Arg-Lys-Arg-8er-
Gln-Met-Leu-Phe-Arg-Gly-A
It binds to a monoclonal antibody directed against rg-Arg-Ala-5er-Gln-OHI.

The human immune interferon protein purified according to the present invention can be used for the same purposes and in the same way as I-IFN obtained by conventional methods, since it has 5 contaminant proteins, 1 pyrogen, and 0 less than the conventional product.

It is safer to use as an active ingredient for injections.

The human I-IFN protein produced according to the present invention exhibits antiviral, antitumor, cell proliferation suppressive and immunoenhancing effects. The human I-IFN protein produced according to the present invention can be mixed with sterile water, human serum albumin (ISA), physiological saline, or other known physiologically acceptable carriers, and can be applied non-ironally or topically. It can be administered to

For example, preferably 100,000 to 100 million units per day for adults [
6 o o o 600,000 to 600 (I unit administered intravenously (
It can be administered by intramuscular injection.

The preparation containing the human I-IFN protein of the present invention includes a salt,
Diluents, adjuncts, other carriers,
Other physiologically acceptable active ingredients such as binders, surfactants, preservatives, etc. may also be included. Preparations for parenteral administration may be prepared in ampoules of sterile aqueous solution or suspension in a physiologically acceptable solvent, or as a sterile powder (usually a 1-IFN solution) diluted for each day with a physiologically acceptable diluent. (obtained by freeze-drying) is provided as an ampoule.

Further, the above-mentioned preparations containing the human immune interferon protein may contain 1 to 99% of other active ingredients such as IFN-α or IFN-β or lymphokines such as interleukin-2 based on the substance of the present invention. Good too.

In this specification, when amino acids, peptides, binding groups, active groups, etc. are indicated by abbreviations.

They are IUPAC-IUB (Comm1ssion
on Biologcal Nomenclatur
e) or the abbreviations commonly used in the field.

Here are some examples: Furthermore, when an amino acid or the like can have optical isomers, the L-isomer is indicated unless otherwise specified.

DNA, Deoxyribonucleic acid A: Adenine T: Thymine G Nigeanine C: Cytosine RNA: Ribonucleic acid dATP: Deoxyadenosine triphosphate dTTP: Deoxythymidine triphosphate dGTP: Deoxyguanosine trisphosphate dCTP
: Deoxycytidine trisunate ATP : Adenosine triphosphate EDTA : Ethylenediaminetetraacetic acid SDS Sodium nidodecyl sulfate Gly Nigericin Ala : Alanine Val : Valine Leu : Leucine lie : Isoleucine Ser : Serine Thr : Threonine Cys Nidistine Met : Methionine Glu : Glutamic acid Asp: Aspartic acid Lys: Lysine Arg: Arginine His: Histidine Phe: Phenylalanine Tyr: Tyrosine Trp Nitributophane Pro Nibroline Asn: Asparagine Gln: Glutamine 2: Carbobenzoxy Boa: t-Butoxycarbonyl Mtr': 4-methoxy -2,8,6-)limethylbenzenesulfonyl Pme: Pentamethylbenzenesulfonyl OBu:
t-Butyl ester ONB: N-hydroxy-5-norbornene-2,8
-Dicarboximide ester DCC: N,N'-dicyclohexylcarbodiimide DCU: N,N'-dicyclohexylurea HONB
: N-hydroxy-5-norbornene-2,8-dicarboximide HQBt: N-hydroxybenzotriazole CHA
Nidichlorohexylamine DCHA Nidicyclohexylamine TEA:) Liethylamine TFA Nitrifluoroacetic acid MSA: Methanesulfonic acid THF, Tetrahydrofuran DMF Nidimethylformamide MeOH: Methanol Ac0Et: Ethyl acetate The present invention will be described more specifically with the following examples and reference examples. However, the present invention is not limited thereto.

Maunu B hybridoma γ2 disclosed in the Examples below
-11.1 and mouse B hybridoma γ3-11.
1 is C for panu/I/ri [prominence [Paris, France]
, N, C, M, respectively, with deposit numbers l! 1L1-242
and l'hI-243.

Also, transformant E disclosed in Reference Example 2 below.

coli 294/pHIT trp 2101 was developed by the Institute of Microbial Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry.
) with accession number FERM P-ri! It has been deposited as 0.

Invention'f! In the following examples, thin layer chromatography was carried out using silica gel plate 60 F254 manufactured by Merck or cellulose plate Avicel SF manufactured by Funakoshi Pharmaceutical Co., Ltd., and the following developing solvent was used.

Rfl: Chloroform: methanol, acetic acid 9:1
:0.5 Rf2: Ethyl acetate: Pyridine: Vinegar Gt: Water=s.

:10:8:5 Rf3:chloroform:methanol:water=723:0.
5 Rf': n-butanol:pyridine:acetic acid:water-80
:20:6:24 Rf': ethyl acetate: n-butanol: acetic acid: water = l:
1:1:1 Example 1 (1) Production of Z-3er-Gln-OBuL Z-Gi
n-OBuI O, 1p was dissolved in 500 mg of methanol and subjected to ring reduction in a hydrogen stream using palladium black as a catalyst. The catalyst was removed by filtration, and the residue obtained by distilling off the dissolved W and Je was
DMF2 with OH7,5f and HONB6.81
It was dissolved in 60 mg' and cooled on ice. DCC7,1 under water cooling
5F was added and stirred at 0° C. for 4 hours and at room temperature for 12 hours. The precipitated DCU was filtered off, the solvent was distilled off, and the residue was evaporated with Ac.
Extracted to 800 mg of 0Et, 4% NaHCO3 water, 0
．． It was washed with 2N hydrochloric acid and water, and dried over anhydrous sodium sulfate. The solvent was distilled off, and the precipitated crystals were collected by filtration with ether, dried, and then recrystallized from Cf13CN. Accommodation M6.5f,
Yield 51.2%.

mp, 97-100°C, (αlV'-24,1'(c=
0.40) p/-Jl/), Rf' 0.
Calculated value as 64-element element analysis C20H2O07N3:
C, 56,72; H, 6,90; N, 9.92 Experimental value: C, 56,21; H, 6,72; N, 9.7
6 (If) Z-Ala-5er-Gln-OBut M-built Z-5er-Gln-0Bu' 4.28
f is methanol 800ml? The palladium black was reduced to the catalyst in a hydrogen stream. The catalyst was filtered off and the solvent was distilled off, and the residue was converted to Z-Ala-OH2,841,HON.
With B 2.271.

AcOEt200me and dioxane 2oome, DMF
It was dissolved in a mixed common medium of loomli and cooled with water. DCC2,881 was added under cooling, and after stirring at 0° C. for 4 hours and at room temperature for 12 hours, DCU was filtered off and the solvent was distilled off. To the residue (JLiCN and ether were added, crystals were collected by filtration, dried, and then crystallized from CI (:+CN).

Yield 8.72g, yield 75.8%, +11p, 1(i5
1705°C, [αml D-41,2° (c, = 0.50, methanol).

Rflo, 60 Elemental analysis C2s H340s Calculated value as N: C
,55,86;H,6,98;N,11J8 experimental value:C
, 55, 58; H, 6, 74; N, 11.12 (fi
l) Z-Arg(Pme)-Ala-5er-Gin
Production of -OBu Z-Ala-5er-Gin-OBuL8.46y was dissolved in methanol soome, and reduced in a hydrogen stream using palladium black as a catalyst. The catalyst was filtered off and the solvent was distilled off, and the residue was converted to Z-Arg(Pme)-011-CIIA
4.54 Z-Arg(Pme)-o prepared from f
Dissolve in DMF150me with 1.9 y of H, HOBt and cool with water. DCC 1.9t under cold water, t
, 4 hours at 0℃, room 1! f+! The mixture was stirred for 15 hours. DCU was filtered off, the solvent was distilled off, and the residue was dissolved in Ac0Et.
was added to obtain a gel-like precipitate, which was collected by filtration. After drying, it was reprecipitated from methanol and Ac0Et. Yield fi4.55F, yield 75.5%, mp, 180-5 184℃, [1D-24,1° (c=0.26.methanol), Rf'0.57 Elemental analysis C40H6o 0tINs 5-iH20 as Calculated value: C, 55, 22; H, 7, 07; N, 12
．． 88; S, 8.69 Experimental value, C, 55, 28; H, 6, 98; N, 12.
54;S, 8.48 (IV) Z-Arg(Pme)-Arg(Pme)-
Production of Ala-5er-Gln-OBuZ-Arg(Pme)-Ala-5er-Gln-
Dissolve 0But4.8y in methanol 400me,
Palladium black was reduced to a catalyst in a hydrogen stream. After filtering off the catalyst and distilling off the melt, the residue was converted to Z-Arg (Pme).
-0H-CHA8.24f prepared from Z-Arg(P
me)-0II, 110B tl, and 42F were dissolved in DMF200me for t6 and washed with water. Dc under cooling
Add ct41p O'C't' for 4 hours.

Stirred at room temperature for 20 hours. DCU was removed by filtration, and Ac0Et was added to the residue after distilling off medium 16 to obtain a precipitate, which was collected by filtration.

After drying, it was poured with methanol and Ac0Et. Yield 44g, yield 71.7%, mp, 125-180°C,
[α] ”, F -18,0° (c = 0.40° methanol), Rf' 0.68 Elemental analysis Calculated value as C57H86014N12 S2°H20: C, 54,96; H, 7, 12; N, 18
．． 50; S, 5.15 Experimental value: C, 54,66; H, 6,92; N, 1
8.82;S, 5.84 (V) Production of Z-Arg(Pme)-Gly-()Bu Z-Gly()Bu 18. Of'/MeOH50
0ml? Nitokaji, in a hydrogen stream using Pd black as a catalyst,
The catalytically reduced zero catalyst was delivered to each house, the P liquid was concentrated under reduced pressure, and the residue was dissolved in DMF200me. To this, Z-Arg
(Pme)-0H-CI(A 20. From II,
] 1pjJ (, Z-Arg(Pme)-OH,
Add HOB t 5.4 y and cool with water, DCC 8.2
f was added and stirred for 48 hours. The precipitated DCU was distributed from house to house, concentrated, and then dissolved in Ac0Et 500me. Ac
0Et/l'9 to 4% Na IICO: + water, 10
After washing with % citric acid water, it was dried with Na2SO4. After concentration, 1 petroleum benzene was added and the mixture was collected in a furnace as a precipitate.

Yield ff119.81 (96.8%). mp, 71-7
8℃.

[α]2o8+0.2°(c-0,9,DMF),
Rf'0.62 Elemental analysis Calculated value as C31H460y Ns S: C, 58,98; H, 7,18; N, 11.09
;S, 5.08 Experimental value: C, 59,42; H, 7,58; N, 1
0.95; S, 4.84 (Vl) Z-Phe-Arg(Pme)-Gly-O
Production of Bu'Z-Arg(Pme)-Gly-OBu
tl 0. After catalytic reduction of Of in MeOH5oomt', it was transferred to DMF800me. Z-P on this
he-OH4,72f.

HOBt2.85 Add y and cool with water, DCC8.5
91 was added and stirred for 15 hours. The precipitated DCU was taken from house to house, the P solution was concentrated, and the residue was poured into 400 ml of AcOEt.
I combed it into l. AcoEt layer is 4% NaHCO3 water.

Washed with 10% citric acid water, dried with Na2SO4, concentrated, and added ether to collect the crystals.MeOH-
Recrystallized from ether. Yield 10.5 #6 (85.8%). mp, 101-108℃, r-a]
D-8,8° (c=0.9, DMF), Rf'
0.64 Elemental analysis C4o H640s N, Calculated value as S: C, 61,67; H, 6,99; N, 10.
79; S, 4.12 Experimental value: C, 61,66; H, 6,56; N, 1
0.98; S, 4.14 (Vif) Z-Leu-Phe-Arg(Pme)-
Production of Gly-OBut Z-Phe-Arg(Pme)-Gly-OBut5-
After catalytic reduction of 5′ in Me01800me, D
Transferred to MF800me. In addition, Z-Leu-O
Z-Leu-O prepared from HDCIIA 8.81f
Add 1.47 f of H, HONB, cool on ice, and dilute with DCCl.
, 68f was added and stirred for 48 hours. Precipitated Dcu
After z7p separation and concentration.

I mixed it with AcOEt800me. Ac0EtlQ is
Washed with 4% NaHCOs water, 10% citric acid water, and dried over Na2S04. After concentration, ether was added to obtain a powder. Yield% 6.21 (98,8
%)''-15,5° (c=n1p, 171-178℃, [α]D 0.9, DMF), Rf' 0.64 Elemental analysis C46I (6509N7 S calculated value: C, 61,9
8; H, 7,84; N, 10.99; S, 8.59 Experimental value: C, 62,02; H, ? , 87; N, 11
．． 08;S, 8.59 (Vil:)Boc-Met-Leu-Phe-Arg
Production of (Pme)-Gly-OBut Z-Leu-Phe-Arg(Pme)-Gly-()
But6. After catalytic reduction of Of in MeOH20Ome, the mixture was transferred to DMF150me. To this, Boc
-Met-OH.Boc-Met-OH prepared from DCHA a,o 41.

Add HONBl, 891 and cool on ice, DCC1,59f
was added and stirred for 15 hours. The precipitated DCU was separated by P, concentrated, and then dissolved in *n-BuOH-AcOEt.
% citric acid water and dried over Na2SO4. After concentration, ether was added to form crystals. Yield +1e
21 (98,1%). mp, 192-195°C.

(α) 26-19.7° (c=1.0, DMF)
, Rf'0164 Elemental Analysis Calculated as C48H76010Ns S2: C, 58,27; H, 7,74; N, 11.
83; S, 6.48 Experimental value: C, 58,48; H, 7,79; N, 11.8
4;S, 5.98 (IX) Boc-Gln-Met-Leu-Pbe-
Production of Arg(Pme)-G I Y-OH Boc-Met-Leu-Phe-Arg(Pme)
-Gly-()Bu'5.5f T F A 50 m
After stirring for 10 minutes at room temperature, the mixture was concentrated, ether was added, and the mixture was dried several times. This is DA(F
The mixture was dissolved at 50 mE, cooled with water, and 1.8 mg of TEA was added. To this, Boc-GIn-OH1,851, HO
Boc-Gln-0NB prepared from NB1.49y, DCCl, and 9Of was added.

Stir for 16 hours. After i0 contraction, add A c OH,
Ac0Et was added to collect P as a precipitate. Yield 53, (
89.8%). mp, 181-188°C (decomposed).

6 (α] D-19,6° (c=1.0, DMF)
, old 10.80 Elemental analysis Calculated value as C411H76012N10S2: C, 55,45; H, 7,22; N, 18
．． 20; S, 6.04 Experimental value: C, 55,89; H, 7,17; N, 1
8.84; S, 6.20 (X) Production of Z-3er-NHNH-Boc Z-8
er-oH10,Of, t-butylcarbazate 6
．． Dissolve 2I in 150 mg of DMF and cool on ice.

HONB 8. Of, DCC9,81 added to 15
I stirred the time. After separating the precipitated DCU and concentrating it.

AcoE was transferred. AcoEt layer is 4% Na
Wash with HCO3 water and 10% citric acid water, and Na2S
Dry with O4. After concentration, ether was added to form crystals. Collection j917. a p (50,4%) mp
, 95-98°C.

[α] 26-62° (c = 0.8, DMF)
, Rf'0962 elemental analysis C16112308N3 as a calculation value,
C, 54J8; H, 6,56; N, 11.89 Experimental value: C, 54,77; If, 6.88; N, 12
．． 29(Xt) Z-Arg(Pme)-8er-N
Production of IINH-Boc Z-5er-NHNH-Boc
After catalytic reduction of 8.9 p in 800 me of MeOH, it was dissolved in 50 mg of DMF and f:.

To this, Z-Arg(Pme)-0H-CHA6.
Z-Arg(Pme)-0H,1I prepared from 2f
Add OBt 1.5f and water cool, DCC2.8f
was added and stirred for 15 hours. After separating the precipitated DCU and concentrating it.

It's Ac0Et and Cal. Ac0E t jpj is 4O
f a HCO: + water, washed with 10% citric acid water, N
Dry with a2SO4. After concentration, add ether and collect as a precipitate. Yield 317.45'f (98.7%)
. mp, 100-101℃, (α') D -0,9
°(c+p1.2, DMF).

Rf'0.5x Elemental analysis Calculated value as C33H41+ 09 Ny S: C, 55,06; H, 6,86; N, 18
．． 62; S, 4.46 Experimental value: C, 55,49; H, 6,94; N,
18.14;S, 8.86 (Xt:) Z-Lys(Mtr)-Arg(Pme)
-3er-N)INH-Boc Production Z-ArgCPme)-5er-NHNH-Boc 8
．． 9y was dissolved in 800 mg of AleOH, subjected to catalytic ring reduction, and then transferred to 50 mg of DMF. To this, Z
-Lys(Mtr)-OH-DCHA 8.4 Z-Lys(Mtr)-OH prepared from p.

Add 110Bt 0.88F and cool on ice, DCC1
, 84f was added and stirred for 20 hours. Precipitated DCU
P was separated, D was reduced, 8 cOEt was added to form a powder, and the powder was recrystallized from MeOH-AcOEt. Yield 5.1
jl(93,4Rn.mp, 108-105℃.

26.

(α) L) '1.2 (c "" 0.8, D
M F ), Rf '0.57 Elemental analysis Calculated value as Ca9H73013N9 S2: C, 55,50; H, 6,94; N, 11
．． 89; S, 6.05 Experimental value: C, 55, 70; H, ? , 15; N, 1
1.60;S, 5.68 (Xlii) Z-Arg(Pme)-Lys(Mtr
)-Arg(Pme)-8e r-N)INII-Bo
Preparation of c Z-Lys(8(tr)-Arg(Pme)
-8er-NHNII-Boa4.8f with MeOH80
After dilution and catalytic reduction, DΔIF70m
It was transferred to e. To this, Z-Arg(Pme)-0H-
C) Z-A r g (Pm
e) Add -OH, HOBt 0.741 and cool on ice.

DCCl and t2p were added and stirred for 15 hours. After separating the precipitated DCU8F and expanding and shrinking it, it was dissolved in Ac0Et and ACO
EtP was washed with 4% NaHCOA water, 10% citric acid water, and dried over tNa2SO4. After concentration, ether was added to form a precipitate, which was then separated and reprecipitated from AieOH-ether. Yield 5.81' (89.8%).

26.

mp, 186-187℃, [n)l)-6,6('c
=1.0, DMF), Rflo, 58 elemental analysis Printed value as CgaH990+sN+3S3, C,
55,56; H, 6,99; N, 12.76; S,
6.74 Experimental values: C, 55,84; H, 7,07; N, 1
2.50;S, 6.59 (XIV)Z-Lys(Mtr)-Arg(Pme)-
Lys(Mtr)-Arg(Pme)-5er-NHN
Preparation of H-BocZ-Ar'g(Pme)-Lys(M
Lr)-ArgCPme)-5er-NHNH-Boc
3. Dissolve OI in 150 mg of MeOH.

After catalytic reduction, it was transferred to DMF60me. To this, Z-Lys(Mtr)-0H-DCIM 1.54
Z-Lys(Mtr)-OH,HOBt prepared from p
Add O.81t and cool on ice, add DCCo.51 and stir for 16 hours. The precipitated DCU was separated by P, concentrated, and dissolved in Ac0Et, and the AcoEt layer was concentrated at 4%/'/a.
Wash with HCO3 water and 10% citric acid water, and Na2S
Dry with O4. After concentration, ether was added to obtain crystals, which were then recrystallized from Ac0Et. Yield 2.701
(72,8%)rllp, 128-125℃ L('!
]"6-5.9° (c = 1°l, DMF), Rf'
o, s7 Elemental analysis Calculated value as Cl12HI2302ON1554, C,55,78;H,? ,02;N,11.8
9; S, 7.26 Experimental value: C, 55, 89; H, ? , 80; N, 11
．． 72;S, 7.08 (XV) Boa-Gin-Met-Leu-Phe-
Arg(Pme)-Gly-Arg(Pme)-Arg
Production of (Pme)-Ala-8er-Gln-OButZ-Arg(Pme)-Arg(Pme)-Ala-8
er-Gln-OButl, Ol fjeMeOH1
After catalytic reduction, DIl (F20
Transferred to ml+. to this.

Boc-Gin-Met-Leu-Phe-Arg(P
me)-Gly-OHO,851,HO13tl
Add f35mf to 1111, cool on ice, and DCC210mF.
Add and stir for 20 hours. The precipitated DCU was separated by P, and after concentration, M e OH was added to form a precipitate.
child. Yield 1.50 f t B? ,4L! 10).

mp, 216-2H°C (decomposition), [lr]D-118°Ic=1.0, DMF), Rf' 0.
48 elemental analysis C9RHIS4023 N22 S4
Word arithmetic group as: C, 55, 09; H, 7, 27;
N, 14.42; S, 6.00" 14mVj: C, 54,81; H, 7,88;
N, 14.28; S, 5.79 (X&i) H-Lys-Arg-Lys-Arg-5
er-Gln-Alet-Leu-Phe-Arg-G
ly-Arg-Arg-Ala-3er-G In-
Preparation of 011Boc-Gln-Met-Leu-Pbe-Arg(
Pme)-Gly-Arg(Pme)-Arg(Pm
e )-Ala-5er-G In-0Butl,
Add TFA lOme to Of, mix 4 times for 50 minutes at room temperature, concentrate, add ether and precipitate as stage I.
It was taken and dried.

- million, Z = Lys (Mtr) - Arg (Pme) -
Lys(Mtr)-Arg(Pme)-8er-NHN
After adding T F Alome to H-Boc O, 88t and shaking at room temperature for 10 minutes.

Dark N<! L and ether were added to form a precipitate, which was then dried. This was dissolved in 10 mg of I) MF, cooled for 1 liter with dry ice-acetone, and then dissolved in 6.2N HCI/Ac0.
EtO, 28er, II! , isoamyl nitrate (0,0
The mixture was cooled again with dry ice-acetate and neutralized by adding 25 mg of EAO. The amine component was dissolved in DMF40me, cooled with water to obtain 16 mg of TEAo, and then the azide solution prepared earlier was added and stirred at 4°C for 72 hours.The reaction solution was poured into dilute acetic acid water and the precipitated gel was removed. It was washed with water-containing Cft, CN. Yield: 1.40 #(
81.5%), if' 0.09゜40 of these
0mF to 0.15M? 1 (contains SA & TFA-thioanisole-methyl sulfide L 8 : 1 : l
) After dissolving to 60 mg and shaking at room temperature for 2 hours,
Ac0NH4400mF was added to condense the mixture, ether was added to precipitate it, and the mixture was dried. Add this to a small amount of 1NA
Sephadex G-25 column (2,
2x120cm). Elute with lNAc0)f1
The 60w1-260er fractions were collected and lyophilized, then passed through a column of Amberlite IRA-410 (acetic acid form) and lyophilized.

This was further added to a TSK-LS-410 column (2,14
H P using x7.5cm+2.14x80cm)
Purification by LC was performed to obtain the desired product. Yield 459 [α) D-45,9° (c = 0.7, 0.IN AcOH) Rf' (c
ellulose) 0.20 Amino acid analysis: Lys
1.71. Arg 4.71. Ser 1.69
゜Glu 2.12. Gly 1.00. Ala
1.08. Met O, 82, Leul, 80,
Phe 1.08 (average recovery rate 77%) Example 2 Synthesis of carrier protein and polypeptide complex Example 1 (
The binding of the polypeptide obtained in XVi) with thyroglobulin (hereinafter referred to as TG) was performed according to the method of Gutfriend et al. (Science, World.

1884 (1964)). That is, the polypeptide 2.
5) 71, mixed with TG8.75 Cape, 2er 6
゜mM phosphate buffer was added, and the mixture was thoroughly stirred in ice water. A solution of carbodiimide hydrochloride 304 Misaki in 200 μe of distilled water was slowly added drop by drop to this, and the mixture was reacted with stirring in ice water for 8 hours. After the reaction, the mixture was thoroughly dialyzed against distilled water and freeze-dried to obtain 4.7q of protein complex.

Example 8 Preparation of antigen for EIA for antibody detection Antigen for EIA was prepared by the method of Kitagawa et al. [Journal of Biochemistry, ? 9, 2, 98 (1976)]
I followed the 0-way decision.

(1) Example 1 of introducing a maleimide group into a polypeptide
(Xvl) (850 nmoles
) was dissolved in lll1 100mM phosphate buffer pH 6,8, 685μ of N-hydroxysuccinimide ester of N-(4-carboxycyclohexylmethyl)maleimide, (1,75μmoles) and 70μ
e was added to the N,N-dimethylfoilmamide solution and mixed, stirred at 80 tl for 80 minutes to react, and then fractionated using a Sephadex G-25 column to obtain a polypeptide fraction with maleimide groups introduced, 185 nmoles. Ta.

(11) Binding of maleimide group-introduced polypeptide and β-high leutosidase Maleimide group-introduced polypeptide 1 obtained in Example 8 (1)
6゜5nrnoles and β-D-galactosidase 88
After mixing nmoles and reacting at 4°C for 18 hours.

The reaction was stopped with 412.5 nmoles of β-mercaptoethanol. The polypeptide bound to β-D-galactosidase was fractionated using a Sepharose 6B column and used in the following experiment.

Example 4 EIA method Detection of antibody activity in mouse serum or hybridoma supernatant immunized with the protein complex obtained in Example 2 was performed using the EIA method (Immunopharmacology, 1, 8 (1)
978)]. That is, serum or hybridoma supernatant was mixed with buffer A (20mM Na2HPO4, 100
mM NaCl, 0.1% NaN3, 1mM MgC
I2, pH 7,0), and this i o o
Polypeptide derivative 10 obtained in Example 3
The mixture was mixed well with 0 μe and reacted at 24° C. for 24 hours. After the reaction, 100 μe of 3% cellulose conjugated with rabbit anti-mouse IgG was added and reacted at 24° C. for 4 hours. After the reaction, the cellulose was thoroughly washed with buffer A containing 0.5% Tween 20, and 4-methinotora/peripherylu β-
D-galactoside 20 μg/me in 5 ootte 1 liter
After reacting at 87°C for 2 hours, the reaction was stopped by adding 8g of 100mM carbonate buffer (pH 105), and the fluorescence intensity in the supernatant was measured using Fluorescence J1 (excitation: 865 nm, emission: 450 nm).

Example 6 Immunization: Protein h1 of the protein complex obtained in Example 2 was given as an antigen to each of six 7- to 8-week-old BALB/C female mice.
40 μg was thoroughly mixed with Freund's Complete Adjuvant and inoculated subcutaneously (first immunization). First immunization 2
After a week, the same amount of antigen was thoroughly mixed with Freund's complete adjuvant and inoculated subcutaneously (secondary immunization).

Furthermore, two weeks later, a tertiary immunization was performed in the same manner as the tertiary immunization. Six days after the third immunization, a portion of blood was collected from the mouse, and the antibody titer in the serum was measured by the EIA method described in Example 4. Of these, the 7--2 mouse that showed a high antibody titer was given a final immunization by intravenously injecting 120 μg of the antigen dissolved in 0.5 we of saline with Fl++. The antibody titer of each mouse is shown in Table 1.

Table 1 Anti-peptide antibody titer of immunized mice 1) Serum dilution is 1/1000 2) Serum dilution is 1/6800 8) Serum dilution is 1/7800 4) -: Undetectable 5) N, D ,, B/T: (combined enzyme activity/total enzyme activity added)
X 100 Example 6 Cell fusion Immunization was performed by the method described in Example 5, and 3 days after the final immunization, Jl'? Extract l1fi, compress and filter with stainless steel mesh, and use Eagles Minimum.
Suspended in essential medium (MEM), I
I'/visceral cell suspension was obtained. As cells used for cell fusion, BALB/C mouse-derived myeloma cells PF3-X
68. Ag 8. using Ul(P2O3) [Current Topics in Microbiology and Immunology, 81.1 (1978)]. Cell fusion is described in the original note [Nature.

256.495 (1975)), i.e.,
Serum-free M for lung cells and P2O3, respectively
The cells were washed 8 times with EM, mixed at a ratio of 11p-visceral cells and P2O3 at a ratio of 5:1, and centrifuged at 800 rpm for 15 minutes to pellet the cells.

After thoroughly removing the supernatant, loosen the precipitate slightly.

0.8 g/45% polyethylene glycol (PEG) 6000 (manufactured by Kotsuholite Co., Ltd.) was added and allowed to stand for 7 minutes in a hot water bath at 87° C. to effect fusion. 2 per minute to cells after fusion
Add MEM at a ratio of IIl to make MEM with a concentration of δ112d.
was added, and the mixture was centrifuged at 600 rpm for 15 minutes to remove the supernatant. This cell pellet was dissolved in RPM containing 10% tallow serum.
11640 Medium (RPMI 1640-10F
PdUl was suspended at 5 2XlO per lyl in C5) and seeded in 144 wells of 1 m1-f in a 24-well multi-dish (Linpro Co., Ltd.).After seeding, the cells were incubated at 87°C. Cultured in 5% carbon dioxide gas furan. 24 hours later, HAT (hypoxanthine I
-'M, aminopterin 4X10'M, thymidine 1.
RPMl 1640-10FC containing 6XlO'M)
By adding 1++l of 3 medium (H person 1' medium) per well.

) (AT selective culture was started. HA Ti selective culture was started.

8, 5.7 days after the start of culture, after discarding the old solution for 1s+/.

Continued by adding 1 ml HAT medium.

Is hybridoma proliferation due to cell fusion? - Recognized in 10 to 14 days, when the culture solution turns yellow (approximately 1 x 10 @/
We) The supernatant was collected and searched for the presence of antibodies using EIA method. When the supernatants of 141 wells in which hybridoma growth was observed were examined in this way, strong antibody activity was observed in 2 wells (γ2-11.γ2-100) and strong antibody activity in 2 wells (γ2-62.γ2-70). Weak activity was observed.

Example 7 Cloning 8 wells showing positive antibody activity (r2-11°62.
Each hybridoma of 100) was cloned by the limiting dilution method. That is, 2 hybridomas/
We're looking for RPMI 1640-20FC5
966 microplate (manufactured by Nunc) and 0.0.0% per well. The solution was dispensed in 1 ml portions.

During dispensing, BALB/C mouse thymocytes were added as feeder cells at a density of 5xlO' per well. In this manner, cell proliferation was observed after about 2 weeks, and the supernatant was collected and examined for the presence of antibodies using the EIA method described in Example 4. As a result, 8 out of 19 clones were found for γ2-11, and 8 out of 54 clones were found for γ2-62.

For γ2-100, 5 out of 47 clones were tested for antibody ability.The binding ability of the monoclonal antibody to IFN-γ was examined using the following method. That is, 8% cellulose ffJ Ma o o tt to which rabbit anti-mouse XIgG antibody was conjugated
72-11.72-62.72-100, culture supernatants of 2 to a clone cells derived from 72-11.72-62.72-100 were added to
00 μe was added and the reaction was carried out at room temperature for 18 to 20 hours. After the reaction, the cellulose was thoroughly washed with physiological saline and heated at 550 U/s.
lFN-γ obtained as described below in t was added and reacted for 8 to 4 hours. After the reaction, the supernatant was collected from seedlings. 2 Table: Anti-peptide antibody activity of cloned hybridomas B/T: (bound enzyme activity/total enzyme activity added)
× 100 The IFN-γ activity in the supernatant was measured by the cytopathic effect (CPE) leaching method using a microplate. (
Applied Microbiology 16.1706 (1
968J. That is, 50 μe of M E hi was added to each well of a 966 microplate (manufactured by Nunc), and 50 μe of the IFN sample was added to the first well, followed by serial two-fold dilution. Add WISH #[ll1iffl to 20% FC8-containing M
50 μe of a cell suspension adjusted to 48,106 cells per ml was added to EM, and cultured for 24 hours at 87° C. in a carbon dioxide gas furan vessel. After culturing, the vesicular stomatitis virus (New Jersey strain) was adjusted to 2000 TCIDso (tissue culture infecting dose 50) using MEM, and 50 μe of the solution was added to each well and cultured at 87° C. in a carbon dioxide gas furan vessel. Approximately 85
After some time, when the cells in the wells to which no IFN sample was added had caused 100% CPE, the CPE in each well was observed under a microscope, and the number of dilutions of the IFN-sample in the wells that had caused 50% CI・E. The reciprocal of the value was taken as the IFN titer.

The IFN-γ sample used was human peripheral blood lymphocytes mixed with concanavalin A at 40 μg/me and 12-
〇-Tetradecanoylphorbol-18 acetate l
The supernatant was collected 72 hours after stimulation with 5 ng/s+r, and 1 ml of this culture supernatant contained human IFN-γ (
It contained 4,400 units of acid (unstable to pH treatment). If there is an antibody capable of binding to IFN-γ in the culture supernatant of the cloned cells, the I
FN-γ activity will bind to the antibody on the cellulose and the activity in the supernatant should be reduced. The results showed that relatively strong IFN-γ binding ability was observed in the supernatant of the γ2-11 clone, and 50 to 7 of the added IFN-γ (5500/*/)
5% bound to antibody (Table 3).

Example 9 Ascites formation of monoclonal antibody-producing hybridoma Table 8 Absorption capacity of IFN-γ activity by monoclonal antibody B.05-resistant mineral oil was previously administered intraperitoneally.
Asciticization was performed by intraperitoneally inoculating ALB/c mice. g) Ten days after intraperitoneal administration of Ibridoma, ascites was collected and the antibody titer was measured by EIA method.
Antibody activity was shown up to 10'-fold dilution. The antibody activity in the culture supernatant of the cloned cells was observed up to a 104-fold dilution, but the antibody activity increased approximately 1000-fold by ascites formation.

Example 10 Purification of monoclonal antibodies 4 ml of ascites obtained in Example 9 was used as a starting material.

Monoclonal antibodies were purified according to the method of Stalin et al. (Journal of Biological Chemistry, 256, 9750 (1981)).

First, io, o to remove fibrin-like material from ascites.
After centrifugation at oo rotation for 15 minutes, phosphate buffer-saline solution (
PBS: 8.1m M-NaH2PO4, 1.5m
MKH2PO4,2,7mM KCl, 187mM NaC
1, pH 7, 2) and 280 nm ultraviolet absorption (A211
0) was diluted to a concentration showing a value of 12 to 14. After dilution, saturated ammonium sulfate solution was added to the sample to give a concentration of 47%, and salting out was performed for 60 minutes while stirring at 4°C, followed by centrifugation (10,000 rpm, 15 minutes) to obtain a precipitate. . The precipitate was mixed with 50mM NaCl2
It was soaked in 0 mR1 Tris buffer solution (pH 7,9) and dialyzed against the same bath solution 2e. After 2:00 p.m., the dialysate was replaced with the same new dialysate 2e, and dialysis was continued for another 15 hours.

After dialysis, centrifugation was performed at 10,000 rpm for 15 minutes to remove the precipitate, and the supernatant was adjusted to have an A2!10 concentration of 20 to 80. This sample has a sufficient wind of 50
8d D conditioned with Tris buffer containing mM NaCI
1. applied to an EAE cellulose column (Whatman DEsz) using a Tris buffer solution containing 50n+MNaC+.
Fractionation was carried out at a flow rate of 5*//min. Under these conditions, antibody activity was mainly observed in the flow-through fraction (first
figure).

Antibodies can be confirmed using the method of Laemli et al. (Nature.

227.680 (1970)), the 5DS-polyacrylamide gel electromethod N (SDS-PAGE) method was used. That is, several fractions fractionated using an ammonium sulfate salting-out DEAE cellulose column were each subjected to Mi extraction using 2-mercaptoethanol, and then transferred to a 17% SDS gel.
Migration was performed at 0 volts for 24 hours. As a result, in agreement with the antibody activity, one molecule of nail had an H chain around 65 kilodaltons.
Two clusters of light chains were found around 28 kilodaltons (Figure 2). The thus purified antibody fraction 17 was tested for IFN-γ2200 according to the method of Example 8.
0/*? When I searched by adding
% shows binding ability to the antibody; 1'-1lIlt
3 (Table 4).

Table 4 Example 11 Subclass γ2-11.1 to which monoclonal antibody belongs
The IgG subclass to which the monoclonal antibody belongs was determined by diluting fraction 17 prepared by the method of Example 1O 10 times and using goat anti-mouse IgG1. G2a,
This was investigated using the agar precipitation reaction method (Ophthalonimetry: Immunological Methods Gel Diffusion Techniques, Blackwell, Ixford 1, 1964) with G2b and C8 antibodies (Mile Note). As a result, one prominent band was observed between the monoclonal antibody and the goat anti-mouse IgG2b antibody, and between the other anti-1gG antibodies.

No hunt formation was observed. Therefore, the monoclonal antibody was found to belong to IgG2b (Table 6).

Example 12 25 g/(65, a'f) of a monoclonal antibody purified as in Example 1O and fractionated was added to 0.1 M NaH.
Dialyze overnight against COs, pH 8.8 solution.
, :O-10,000, Affigel-10 (Bio-Rad) 25
Table 5 Subclass-l containing monoclonal antibodies was thoroughly washed with water using a glass filter, and then washed with O, 1M Na
The antibody was suspended in a HCO3 pH 8.8 solution and reacted with the above antibody for 4 hours at 4°C with stirring.After that, it was left at 4°C overnight, and then filtered using a glass filter to remove the Wash well with a .1 M Na HC03 pH 8.8 solution.A solution (pH 8.0) containing 0, 1 M ethanolamine, and 0.15 M NaCl was added to the reacted gel for 2 hours.
51 was added and shaken at 4°C for 1 hour to block any unreacted active groups that may remain. Its i (PB gel)
Wash thoroughly with S.

PBS2511/containing 01% Na N3 was heated with N4 and stored at 4°C. Amount of antibody added and recovered! From the amount of antibodies in the F3 solution, it was found that 285 antibodies were bound per ml of gel. The reaction product thus obtained was filled into a column and used as an antibody column.

Example 18 60 ml of supernatant obtained in Reference Example 4 'e 1 m MEDT
A.

20mM Tris-HCI containing 0.15M NaCl,
After diluting to 150*l with pH 7.6 (TEN),
Anti-IFN-γ antibody column C prepared by the method of Example 12
9ml). After thorough cleaning with TEN, 0. O1% Nonidet P-40 (manufactured by Shell) 0.5M
Washed with TEN containing NaCl. Next o, 25M N
IFN-7 was extracted with 0.1 M acetic acid containing aC1, and the extract was immediately neutralized with IMF Lithium IICI pH 7.6. The resulting solution was dialyzed against distilled water at 4°C for 16 hours, frozen with acetone-dry ice, and then freeze-dried to form a powder.

The results were as follows.

Total protein activity Specific activity Recovery rate CQ) (U) (U/Misaki) (%) Solution supernatant 250.8 4X10'1.6X10'
-Antibody strength % Jl 2,01.5X10” 7.5
xlO' 87.5 Specific activity of the final human immune interferon protein obtained here (V
Virus activity II was determined by S■ cytopathic effect inhibition assay (examination) at 7.5x 10' U/my. The properties of this protein were as follows.

Properties of human immune interferon protein (1) Molecule t (Protein obtained in Example 18 was treated with 2-mercaptoethanol to form a 5DS-polyacrylamide gel (17,
When subjected to electrophoresis (15 mV, 6 hours) and stained with Coomassie blue, a band of protein Pi hatl- was confirmed (Fig. 3).

Furthermore, from the relationship between the migration distance of the molecular weight marker and the migration distance of the protein that were electrophoresed at the same time, the molecular weight of the protein was 17,00.
It was estimated to be 0±1,000 (Figure 4). -Protein not treated with 10,000,2-mercaptoethanol has a molecular weight of 8
Another band was detected at the position of 8,000±2,000. This (tef old 1; molecular weight of N-γ 17,
000±1,000, this band is considered to originate from the 2[1] body of IFN-γ.

(11) Amino Acid Analysis The protein obtained in Example 18 was placed in a glass hydrolysis test tube, and a constant 1 sample containing 4% thioglycolic acid at 200 times M (V/w) was added. Ilj! After adding hydrochloric acid and sealing the tube under reduced pressure, it was hydrolyzed at -10° C. for 24,48,72 hours. After hydrolysis, the mixture was desweetened, hydrochloric acid was removed under reduced pressure, and the residue was diluted with 0.02N hydrochloric acid for 1 hour. Amino acid analysis was performed using Hitachi Model 885 Instant Amino Acid Analysis G1.

Cystine and cysteine were obtained by oxidizing the above protein with formic acid according to the Haas method (Methods of Enzymology 11, 197 (1967)), and then hydrolyzing it for 24 hours in the same manner as above.

It was quantified as cystic acid using an amino acid analyzer. Amino acid analysis values were determined by averaging the values obtained for 24.48 and 72 hours of hydrolysis. However, the values of serine, threonine, tyrosine, and human lift fan were obtained by extrapolating the hydrolysis time to 0 hours. The results are shown in Table 6.

Table 6 (11D Amino-terminal Amino Acid Analysis The protein obtained in Example 18 was oxidized with performic acid according to Haas's method, Methods of Enzymology 11, 197 (1967)), and then subjected to performic acid oxidation according to the Edman degradation method according to Iwanaga et al. The amino-terminal amino acid analysis was carried out according to the European Journal of Biochemistry, 8.189 (1969)]. The generated phenylthiohydantoin-amino acid (PTH-amino acid) was purified using Ultrasphere-0DS column (manufactured by Altex Co., Ltd. [J,
S, A,), 4.6 x 250 mm, particle size 5 μm] and Alcher's method [Altex
Chromatogram, 8.8 (1980) E, J:S.
High performance liquid chromatograph 504 I9 (
U, S, A,) were identified and quantified. The conclusion! Q! ,,
PTH-methionine sulfone and PTH-cystic acid were detected.

As is clear from the above examples, according to the purification method of the present invention, a substantially pure human immune interferon protein having a specific activity of 7.5×10 7 U/cape or more can be produced.

The results using monoclonal antibodies obtained from γ-3 mice are shown below.

Example 14 Fourth immunization was performed in the same manner as the third, and two weeks after the fourth immunization, 120 μg of antigen dissolved in 0.5 ml of saline was inoculated intravenously in the same manner as in Example 5. The final immunization was carried out.

Example 15 Cell Fusion Lungs were removed from γ-8 mice 8 days after the final immunization described in Example 14, and cell fusion and HAT selection culture were performed using the method described in Example 6.

As a result, hybridoma growth was observed in 43 wells.
When the presence or absence of antibodies was investigated using the EIA method described in Example 4, strong antibody activity was observed in 2 wells (γ8-11 and γ8-19).

Example 16 Two wells showing strong cloning antibody activity (γ8-11°γa
-19) each hybridoma was cloned by the method described in Example 7. the result.

9 out of 21 clones for γ8-11, γ3-19
Antibody activity was observed in 15 out of 25 clones (
Table 7).

Example 17 Binding ability of monoclonal antibodies to IFN-γ The binding ability of monoclonal antibodies to IFN-γ was examined using the method described in Example 8. however.

The IFN-γ sample used in this example was seven IFN-γ samples.
The γ gene was integrated into a plasmid and expressed in E. coli [socombinant IFN-γ; see Reference Example 4].
It was adjusted to be 11000/++Z. The result is γ8
-11.1. A strong IFN-γ binding ability was observed in the supernatant of the γ8-19.20 clone, and approximately 9% of the added IFN-γ
Table 7: Anti-peptide antibody activity of cloned hybridomas R/T' + ui association I,? -RVi'LGb/y
+n4 S・仝iWW;:El 1v1n nta (8th
Table 8: Recombinant IF using monoclonal antibodies
Absorption capacity of N-γ activity Example 18 Subclass γB-11,1 to which the monoclonal antibody belongs
, γB-19,20 clone cells.

Ascites was obtained by the method described in Example 9, and the obtained ascites was purified by the method described in Example 10. The subclass of the obtained monoclonal antibody was examined by the agar precipitation reaction method described in Example 11. The result is γ3-11
．． 1. A distinct band was observed between each of the γ3-19.20 monoclonal antibodies and the goat anti-mouse IgG1 antibody, and no band formation was observed between the other anti-1gG antibodies.

Therefore, the γB-11,1γ8-19.20 monoclonal antibody was found to belong to TgGl (Table 9) Subclass to which monoclonal antibodies belong Example 19 Quantification of IFN-γ by EIA method 1 Assay method for monoclonal antibodies by competition between (a) IF N-γ and (b) IFN-γ immobilized on a solid phase I expressed in E. coli and purified as shown in Example 13
FN-γ was suspended at 15 μf/ml in phosphate buffer (pi 8.0) containing 01 M sodium bicarbonate, and this (D100 tte) was dispensed into each well of a 96-well microplate. The reaction was carried out for 24 hours at ℃.After the reaction, 2%
Bovine serum albumin-containing phosphate buffer was dispensed in 100 μe portions and treated at 4° C. for 24 hours to prepare a plate for use in ELISA.

On the plate prepared as above, 100 μe of antibody (1 g-1
1,1) Solutions and various concentrations (75,8×102°1.2
5XIO', 5X10'', 2X10', 8X10'U/
A mixed solution prepared by preparing GFN-gl) or reacting combination TFN-γ at 87° C. for 1 hour was added, and the mixture was allowed to react at room temperature for 3 hours. After the reaction, the mixture was thoroughly washed with phosphate buffer, 100 μe of goat anti-mouse IgG antibody labeled with horseradish peroxidase 7ase was added, and the mixture was allowed to react at room temperature for 8 hours. After the reaction, the wells were thoroughly washed with phosphate buffer, and 22# orthophenylenediamine and 10 μe of hydrogen peroxide were added to 10 g of 0.1 M citrate buffer to prepare the substrate solution.
00 μe was added and the enzymatic reaction was carried out at room temperature for 15 minutes, and the reaction was stopped with 4N sulfuric acid. After stopping, multi-scan (
By using Thailand/this ELISA method, 8X10'～
5×I Q3 U/I F in IFN-r-containing solution of cod l
It was found that N-7- could be quantified.

Example 20 Determination of IFN-γ by EIA method Determination method by competition between (a) IF N-γ sample and (b) enzyme-labeled peptide of the present invention against enema monoclonal antibody Example 20-(+> Reference example 4 and the combinant IFN-γ at various concentrations (64,820, 1, 6X10', 8XIO''.

5X 10', 2x lO' U/ml), and 100tte of this was mixed with a certain amount (7) γ8-11.1.
7s-x92o antibody-containing solution for 2 hours at room temperature. To this was added 100 μe of the enzyme-linked polypeptide derivative obtained in Example 8, and the mixture was reacted at 4° C. for 48 hours. After the reaction was completed, the mixture was mixed with rabbit anti-mouse I
gG 3% cellulose conjugated with anti-VF 1100μ
Processing 1. E was allowed to react at room temperature for 4 hours. After reaction, Example 4
The enzymatic reaction was carried out in the same manner as described above, and the fluorescence intensity was measured. As a result, monoclonal antibody (γ8-
11.1. The binding of enzyme-linked polypeptide derivatives to γ8-19.20) was slightly inhibited in the presence of 820 U/we of IFN-7, and almost completely inhibited in the presence of 8 X lO'U/g/we. (Figure 10). Therefore, by using this method, 320~8×103U/s
It became possible to quantify IFN-7 in the IFN-r-containing solution of Z.

Example 20-(ID The principle is the same as Example 20-(1), but the following modified method is used as a method that can automatically and quickly measure a large number of samples using multi-scanning. - 200 μe of myf70%P+P++ plate (Nuncous acid buffer pH 8,0) was injected into a 96-well plate and left at 4°C overnight. After removing the solution, 0.02M containing 1% BSA was added.
800 pg of phosphate buffer (pH 7.4) was injected, and after being left at room temperature for 8 hours, the solution was removed.

(2 monoclonal antibodies γB-11, 1i1; 'L
/ - Preparation of 150 μe was injected. After being left overnight at 4°C, the solution was removed and washed eight times with 0.01M phosphate buffer (pH 7,4) to prepare an antibody plate N plate.

(Force manipulation method Loosen the test sample or standard IFN-γ j/l!A(0
, 1M NaCI, 1mM MgCl2, 0.1
%BSA.

Dilute to an appropriate concentration with 0.02 M phosphate buffer (pH 7 containing 0.1% NaN3), and inject 75 μe of each into each well of a plate prepared at +21. Next, 5 µe of the enzyme labeled compound of Example 8 diluted 180 times with buffer A't'' was injected into each hole of the plate. Parafilm was covered and the plate was reacted for 1 hour at 37°C, and then reacted for 8 hours at room temperature. After removing the reaction solution, add 0.01M phosphate buffer (pH 7).
, 4) Washed 4 times with 75 μe.

For the color reaction, 1,5 W/me of 4-nitrophenyl-β-D prepared in buffer A was added to each well of the plate.
- 150 μe of galactopyranoside (Wako Tsumugi Pharmaceutical Co., Ltd., special grade) was injected and allowed to react overnight at room temperature. Add 100 μe of 0.4 M carbonate buffer (pH 10,5) to each well.

The coloring reaction was stopped, and the absorbance at 405 nm was measured using a J1 Titertech Multiscan for microtitration plates (manufactured by Flow Inc., USA).

FIG. 11 shows the standard curve of IFN-γ. In Table 10, six types of test samples containing IFN-γ showed perturbation,
It gave good results with a coefficient of variation of 7.4%.

Table 10 Table 11 The crude IFN-γ-containing supernatants used in Examples 18, 19 and 20 (1) and (II) were obtained by the method shown in the following Reference Examples.

Reference Example 1 (1) Isolation of mRNA encoding human I-IFN Lymphocytes prepared from human peripheral blood were treated with 12-0-tetradecanoylphorbol-18-acetate (TPA) (15
The cells were cultured at 87° C. in RPMI-1640 medium (containing 10% fetal bovine serum) containing ng/g () and concanavalin A (40 μg/tolerance) to induce I-IFN. After 24 hours, the induced human lymphocytes were denatured with thioguanidine (5M guanidine thiocyanate, 5% mercaptoethanol, 50mM Tr 1s).
-HCe pH 7,6.

After denaturation with a Teflon homogenizer in 10mM EDTA), sodium N-lauroyl sarcosinate was added to 4%, and the homogenized mixture was dissolved in 5.7M cesium chloride solution, 0. 1M ethylenediaminetetraacetic acid (EDTA) 6mg
The mixture was layered on top and centrifuged at 16°C for 24,000 rpm using a Beckman 5W27 rotor.
An RNA precipitate was obtained.

This RNA precipitate was dissolved in a 0.26% sodium N-lauroyl sarcosinate solution, and then precipitated with ethanol to obtain 8.811F RNA. This RNA was added to high salt bath solution L0.5MNa (1,10mM Tris-H (JpH7).
, 6,1mM EDTA, 0.8% SDS) on an oligo(dT) cellulose column, and poly(a)-containing mRNA was absorbed in a low salt solution (10mM Tri 5-HC).
l ・pH 7, 6, 1mM EDTA, 0.8% SDS
) to elute mRNA containing poly(2).
70011 g was collected.

This mRNA was further precipitated with ethanol, and 0.2 ml
solution (10mM Tris-HCI pH7,6,2m
Dissolve MEDTA, 0.8% SDS, and heat at 65°C for 2 min.

The mixture was fractionated by centrifugation at 25,000 rpm for 21 hours to obtain 22 fractions. For each fraction, RNA
Interferon activity in the synthesized protein was injected into African frog oocytes. It was measured using antiviral activity, Xinter'Feron System, Springane].

New York, p. 11, 1979].

1 in fraction 12 (sedimentation constant S value showed 12-145)
An activity of 95 units/μg RNA was detected.

The amount of mRNA in fraction 12 thus obtained was approximately 20 μg.

(11) Synthesis of single-stranded DNA Using the mRNA and reverse transcriptase obtained above, Zoo,
1 reaction mixture (5 μg mRNA, 50 pg oligo (
dT), lOO units of reverse transcriptase 11mM each dATP, dcTP, dGTP and dTTP, 8mM
Mgcl+, 50mM KCl, 10mM dithiothreitol, 50mM”rris-HCI pl(s, 8
) After incubating at 42°C for 1 hour and 1'lfl, the protein was removed with phenol, and the mixture was incubated at 70°C with 01N NaOH.
RNA was degraded and removed by treatment for 20 minutes.

(ill) Synthesis of double-stranded DNA The single-stranded complementary DNA synthesized here is reacted for 2 hours at 42°C in 50p (the same reaction solution as above except that reaction solution 1 does not contain CmRNA and oligo-dT). Double-stranded DNA was synthesized by this.

(IV) Addition of dC tail This double-stranded DNA was mixed with 50 µe of nuclease S1 in a reaction solution (double-stranded DNA 0.1M sodium acetate pH 4,5
, 0.25M NaC+, 1.5mM ZnSO4 (60 units of Sl nuclease) at room temperature for 80 minutes, protein removal with phenol, and DNA precipitation with ethanol.
Reaction solution of e (double-stranded DNA, 0.14M potassium cacodylate, 0.8M Tris (base) pH 7, 6, 2mM dithiothreitol.

1mM CoCl2.0.15mM dCTP, 80-y
- knit terminal transferase) for 8 min.
The reaction was carried out at 7°C to elongate about 20 deoxycytidine chains at both 8' ends of the double-stranded DNA. Through these series of reactions, a double-stranded DN with a deoxycytidine chain of approximately 800 nH was produced.
I got an A.

(V) Cleavage of E. coli plasmid and addition of dG tail, 10 gg of E. coli plasmid pBR822 DNA
Add restriction enzyme PstI to 50μe of reaction solution [1011gD
NA, 50mM NaCl, 6mM Tris-HCI (1
)H7,4), 6mM MgC12, 6mM 2-mercaptoethanol, 100μg/w1 bovine serum albumin.

The single PstI recognition site in pBR82g DNA was cleaved by reacting in 20 units of Pstll at 37°C for 8 hours, and the protein was removed with phenol.
μg, 0.14M potassium cacodylate, 03M Tris (base) pH 7,6, 2mM dithiothreitol, 1mM
Approximately 841i! was added to both 8' ends of the above plasmid pBR822 DNA by reacting in COCl2.0.15mM dGTP, 80 unit terminal transferase] for 8 minutes at 87°C. The deoxyguanine chain of H was extended.

(Vl) Association of cDNA and transformation of E. coli 0.1 μg of the thus obtained synthetic double-stranded DNA and the above plasmid pBR8220,5/'g were mixed in 0.1 MNa.
Cl, 50mM Tris-HCl pH7, 6, 1mM
Method LJ of Enea et al.: heating at 65° C. for 2 minutes and 45° C. for 2 hours in a solution consisting of EDTA, and then slowly cooling to cause association.

Mo1. E. coli χ1776 was transformed according to Biol, 96, 495 (1975)).

Isolation of (Vfl) cDNA-containing plasmids Approximately 8500 tetracycline-resistant strains were thus isolated.1 The DNA of each of these was immobilized on a nitrocellulose filter. [Proceedings of National Academy of Sciences USA 72.3961 (1975)] On the other hand, Goeder et al.'s report Nature, 295°508 (
Amino acid AI-5 (Cys4yr-Cys・Gln-A
sp) and amino acids A77-82 (Lys-GIrr
Base sequence deduced from Asp-Met-Asn-Val) ACGTTCAT father TcH"rcH'r")
using the triester method (Frere et al., Proceedings 1)
National Academy of Sciences USA,
75, 5765 (1978)]. For this oligonucleotide, 50μe of reaction solution (0.2μg of oligonucleotide 17, 50mM Tris・lIC1p) was prepared using T4 polynucleotide kinase.
H8, 0, 10mM MgC12, 10mM mercaptoethanol.

50 μCi γ-32PATP, 8 units of T4 polynucleotide kinase] at 87°C.
・The end was labeled with 82F. Using this labeled oligonucleotide as a probe, the method of Lawn et al.

6108 (1981)) or immobilized on the above-mentioned nitrocellulose filter or associated with DNA.

Four bacterial strains that reacted with the above two types of oligonucleotide probes were isolated by autoradiography. Plasmid DNA was extracted from the cells of each of these strains using the alkaline method ([irnboim f(, C, aDoly, J.
,,Nucleic Ac1ds Res,,7,
1518 (1979)). Next, the inserted part of the plasmid DNA was cut out using the restriction enzyme Pstl.

Among the separated plasmids, select the one containing the longest fragment of the insertion region, and incubate this plasmid with pHIT.
It was named 8709.

Next, cD inserted into this pHIT8709 plasmid
The primary structure of the NA sequence (base sequence) was determined by the dinucleotide synthesis chain termination method and the method of Maxam-Gilbert. The primary structure was as shown in Figure 5.
IFN-γ coding region of HIT8709 (codons AS1 to
The nucleotide sequence of 7j1.146) was the same as that described in the published document (Figure 8) of Nucleitsuk ASITZ RESEARCH-0, 2487 (1982).

Reference Example 2 (1) Part of the promoter for tryptophan synthesis in Escherichia coli as an expression plasmid [DNA fragment containing promoter and operator, 276 base pairs, Bennett et al., Journal of Molecular Biology, 121.11
8 (1978)] containing the plasmid ptrp601 (
The vector pBR822) was constructed.

10,000, plasmid pBR822 was digested with restriction enzyme EcoRI.
and restriction enzyme Ava I, and the margin of the obtained EcoRl-AvaI fragment containing the tetracycline resistance gene was filled in with DNA polymerase I large fragment. This fragment was ligated to the Pvu I cleavage site of ptyp601 using 1'4 DNA ligase and pt
rp701 was constructed (Figure 6).

(11) Next, in order to delete one of the two restriction enzyme CIaI cleavage sites in ptrp701, ptrp7
01 was partially digested with CIaI to obtain one in which only one of the two C1al VJ cleavage sites was cleaved. The resulting margin was filled in with DNA polymerase I large fragment and ligated 11 times with T4 DNA ligase to obtain ptrp771 (Figure 6).

(ILD pHIT8709 was cut with the restriction enzyme Pstl to obtain a PstI fragment containing the rN polygenic gene of IFN-γ. This fragment was partially digested with the restriction enzyme BstNI, and the IF
A Bst tNI-I's t I fragment was obtained in which the Bst NI site within the N-γ structural gene was cleaved. BstNI
After filling the margin of the cleavage site with DNA polymerase 1 large fragment, the oligonucleotide adapter CGATAATGTGTTACTGCCTATTACA containing the protein synthesis utJ start codon ATG was chemically synthesized by the triester method described above.
CAATGACGG was ligated with T4 DNA ligase.

- 10,000, ptrp771 is combined with the above adapter, and the IFN-γ gene is combined with restriction enzyme Pstl and restriction enzyme C1al.
The obtained fragment was inserted downstream of the tryptophan promoter, ligated using T4 DNA ligase, and
An N-r expression plasmid pHITtrpH01 was constructed (Figure 7).

(IV) pHITtrp 1101 was further improved to construct pHITtrp2101 as follows.

First, ptrp601 is treated with restriction enzyme C1al and restriction enzyme Hpal to generate C1al-
A 0.88 Kb Hpal fragment was obtained. This fragment,
pHI W with C1aJ and treated with alkaline phosphatase
pHITtr which is linked to TtrpHol using T4 DNA ligase and has two trp promoters in series
p 2101 was obtained (Figure 8).

This plasmid was transformed into “@” (r ft
4 K(1!:.

coli) 294/pHIT trp2101 was obtained.
child.

Reference Example 8 E, co1i294/pHITLrp, 210] to 81
1g/ml Tetracycline, 04% Casamino Acids, 1
200 liters of M9 medium containing 200% glucose was cultured at 87°C in a LL bottle, and when growth reached KU220, 8β-indolyl acrylic acid (IAA) was added to 30 μg/d and cultured. The cells were cultured for 4 hours.

Reference Example 4 Centrifuge 1.2e of the culture solution obtained in Reference Example 8 for 1ulf.
t.

Collect the bacterial cells and add them to 60 wl of 0.05M Tris-HCI pH 7 containing 10% sucrose.
6.

Add 0.8aJ of 0.2M phenyl-methyl-sulfonyl fluoride (PMSF) and 5M Na to this bacterial cell suspension.
C12, 4ml, 0.2M ethylenediaminetetraacetate (EDTA) 2.4aJ, 1M spermidine 2,4ml, 5 sp/tl LysozyA 2.
Add 4 wl and leave it for 1 hour in OC, then heat at 87℃ for 5 hours.
This was further processed for 80 seconds at 0°C using an ultrasonic crusher manufactured by Altic Corporation (USA).

This solution M solution was centrifuged at 105,0 OQxI for 1 hour to collect 66 ml of solution.

[Brief explanation of drawings]

FIG. 1 shows the elution pattern of the monoclonal antibody of the present invention in a DEAE cellulose column in Example 1O, and FIG. 2 shows the results of electrophoresis of the monoclonal antibody in Example io. FIG. 8 shows the results of electrophoresis of human immune interferon protein obtained by the purification method of the present invention shown after Example 18, and FIG. 4 shows the results of molecular weight measurement shown similarly after Example 18. Figure 5 shows the primary depiction of the pHIT8709 plasmid obtained in Reference Example 1 (vii).
) Le Yu RFJll+An'anbo 11911) (11) p.
trp 701 and ptrp 771. FIG. 7 shows the pH value of Reference Example 2 (Ill).
Figure 8 shows reference example 20V) of pH engineering T trp 2101.
(a) Recombinant IFN-
Competition between γ sample and +b) engineered FN-γ immobilized on solid phase. FIG. 10 and FIG. 11 are respectively Example 2
O-11). 20-(ii) against monoclonal antibodies (a
1) shows competition between engineered FN-γ material and (b) enzyme-labeled peptide of the present invention. Figure 3 Figure ≠ Figure Relative movement bottom E Lithoteam (/41.'llρ) No. 5 gu
; t-t Re E-06% and 8 same speed
ζ toto 88 琥 鑓 し E 8 days -< U days, days C < E4 hh 5 5 Noodles: Ω-cutting ode ni 悴 YO 畦 5 1 し 议 B み か Tomoe [YO 目 EW ■ a: 畦 1, 1 2. 3*! -8 Go 8 Sudden % Tip 1 Figure 6 Figure 2 Figure 1 O Figure Sofun Binant 1FN-fL ((U/m)) Mukisokukuku - Tashi♂ Shimi -'3-19.20 Figure 11 Ze△2〆 Continuation of 2nd page 1 oInt, C1,' Identification code Office serial number // G
07 K 99:00 Priority claim 6198%th January nth [phase] Monaco (MC
) [Yes] PCIO1g83 May 31st [Phase] Monaco (
MC) [PC]'/JP82/ 00444'/JP83100174

Claims (1)

[Claims] (1) Formula % Formula % () () (wherein, X is a bond or Ile Gin ValMe
t Ala Glu Leu Ser Pro Ala
Ala (C) Lys Thr Gly Lys A peptide or amino acid residue having 1 to 16 amino acids counting from its C-terminus in the peptide chain represented by Arg, and Y is Arg Arg Ala 5er
(C) A peptide or amino acid residue having 1 to 5 amino acids counted from the N-terminus in the peptide chain represented by Gln]. (2) The polypeptide according to claim 1, wherein Y is Arg Arg Ala Ser Gln. (The polypeptide according to claim 1 or 2, wherein 31x is Lys Arg. (C) Phe Arg Gly -Y-OH (1) (wherein, X is a bond or Ile Gln ValMe
t Ala Glu Leu Ser Pro Ala
Ala(C) Lys Tbr Gly Lys Indicates a peptide or amino acid residue having 1 to 16 amino acids counting from the C-terminus in the peptide chain represented by Arg, and Y is Arg Arg Ala 5er
(C) A peptide having 1 to 5 amino acids counted from the N-terminus in the peptide chain represented by Gln or a reactive carboxyl group corresponding to a part of the polypeptide represented by It is characterized by condensing the raw material and (b) a raw material having a reactive amino group corresponding to the remainder of the polypeptide (+), and removing the protective group if the resulting condensate has a protecting group. '1Wffi method of polypeptide (1). (5) The manufacturing method according to claim 4, wherein Y is Arg Arg Ala Ser Gln. (6) The manufacturing method according to claim 4 or 5, wherein X is Lys Arg. (7) Formula) %Formula% () () [In the formula, X is a bond or Ile Gin ValMe
t Ala Glu Leu Ser Pro Ala
Ala (C) Lys Thr Gly Lys Indicates a peptide or amino acid residue having 1 to 16 amino acids counting from the C-terminus in the peptide chain shown by Arg, and Y is Arg Arg Ala Ser
Ω indicates a peptide or amino acid residue having 1 to 5 amino acids counted from the N-terminus in a peptide chain that can be accepted by Gin] and a carrier protein. (8) The protein complex according to claim 7, wherein the carrier 4 is bovine thyroglobulin. (9) Formula%Formula% ((11) [In the formula, X is a bond, Ile Gln VatM
et Ala Glu Leu Ser Pro Al
a Ala (C) Lys Thr Gly Lys Indicates a peptide or amino acid residue having 1 to 16 amino acids counting from the C-terminus in the peptide chain represented by Arg, and Y is Arg Arg Ala 5er
(C) A peptide having 1 to 5 amino acids or amino acid residues counted from the N-terminus in a peptide chain represented by Gin] is coupled to a carrier protein. Method for producing a protein complex of polypeptide (1) and carrier protein. (a) Formula () %Formula% () (1) [In the formula, X is a bond, Ile Gln VatM
et Ala Glu Leu Ser Pro Al
a In the peptide chain represented by AlaLys Thr Gly Lys Arg, 1 to 1 counting from the C-terminus
Indicates a peptide or amino acid residue having 16 amino acids, Y is Arg Arg Ala 5er
(C) A peptide or amino acid residue having 1 to 5 amino acids counted from the N-terminus in a peptide chain represented by Gln] or a protein complex of a polypeptide (1) and a carrier protein. A cloned hybridoma consisting of lung cells of an in vivo immunized mammal and (b) homologous or xenogeneic lymphoid cells. 11. The hybridoma according to claim 10, wherein the mammal is a mouse. (2) The hybridoma according to claim 1O, wherein the lymphoid cells are myeloma. Q:l (a) Formula%Formula% ((5) [In the formula, X is a bond or lie Gin ValMe
t Ala Glu Leu Ser Pro Ala
Ala<0 Lys Thr, Gly Lys Indicates a peptide or amino acid residue having 1 to 16 amino acids counting from the C-terminus in the peptide chain shown by Arg, and Y is Arg Arg Ala 5er
(C) A peptide or amino acid residue having 1 to 5 amino acids counted from the N-terminus in a peptide chain represented by Gin] or a protein complex between a polypeptide (1) and a carrier protein. A clone consisting of (b) pancreatic cells and lymphoid cells characterized by cell fusion of lung cells of a mammal immunized with the body and (b) homologous or heterologous lymphoid cells. A method for producing hybridomas. a◆Formula%Formula% () () (In the formula, X is a bond or Ile Gln VatMe
t Ala Glu Leu Ser Pro Ala
AlaLys Thr Gly Lys Arg 1 to 1 counting from the C-terminus in the peptide chain
Indicates a peptide or amino acid residue having 6 amino acids, Y is Arg Arg Ala 5er
(Q indicates a peptide or amino acid residue having 1 to 5 amino acids counted from the N-terminus in the peptide chain indicated by Gln)] A monoclonal antibody against a polypeptide represented by Q. A patent claim that binds to O5 human γ-type interferon. The monoclonal antibody 0 Qf9 according to claim 14, which belongs to the subclass of IgG2b as determined by the Ophthalony method; Monoclonal antibody according to item 14. (a) Formula % Formula % (1) [In the formula, X is a bond or Ile Gln ValMe
t Ala Glu Leu Ser Pro Ala
Ala(C) Lys Tbr Gly Lys Indicates a peptide or amino acid residue having 1 to 16 amino acids counting from the C-terminus in the peptide chain shown by Arg, and Y is Arg Arg Ala 5er
(Indicates a peptide or amino acid residue having 1 to 5 amino acids counted from the N-terminus in the peptide chain represented by O Gln) A protein complex of a polypeptide or polypeptide (1) represented by O Gln and a carrier protein A cloned hybrid consisting of lung cells of a dancing mammal immunized with (b) homologous or heterologous lymphoid cells.
The cells are grown in liquid culture or intraperitoneally in mammals to produce monoclonal antibodies. A method for producing a monoclonal antibody against a polypeptide, which comprises accumulating and collecting the antibody. The production method according to claim 18, wherein the αI@mammalian animal is a mouse. (Currently below) (1) Formula as an antibody] % Formula % ( () [In the formula, X is a bond or Ile Gln Val M
etAla Glu Leu Ser Pro Ala
Ala Lys ThrtC) A peptide or amino acid residue having 1 to 16 amino acids counting from the C-terminus in the peptide chain and 1 to 5 amino acids counting from the N-terminus in the peptide chain represented by Gly Lys Arg. A method for detecting human interferon by a Fuji immunoassay method or an enzyme immunoassay method, which is characterized by using a monoclonal antibody against a polypeptide represented by the following.