JPH119286A - New physiologically active substance, and its production and use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new substance for a controlling agent of hypophyseal function and centric function, comprising a mouse-derived ligand polypeptide corresponding to a G protein conjugate receptor protein having the same or substantially same sequence as a specific amino acid sequence. SOLUTION: This substance is a mouse-derived new ligand polypeptide corresponding to a G protein conjugate receptor protein having the same or substantially same sequence as a specific amino acid sequence, or its amide, ester or salt. The polypeptide and the DNA coding it are useful for developing a receptor ligation assay, screening a potential medicine by using an expression of a recombinant receptor protein, and a controlling agent for hypophyseal function, centric function or pancreatic function. The other objective polypeptide is obtained by amplifying a receptor protein cDNA by using a human hypophysis-derived cDNA according to the PCR method, cloning it, integrating it into a vector and transducing it into a non-human animal cell for expression.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a novel physiologically active substance, its production method and use. For more information,
G protein-coupled receptor (sometimes called receptor)
The present invention relates to a mouse-derived ligand polypeptide for a protein, a DNA containing a DNA encoding the same, and a use thereof.

[0002]

2. Description of the Related Art Many hormones and neurotransmitters regulate biological functions through specific receptors present on cell membranes. Many of these receptors are conjugated to guanine nucleotide-binding proteins (guanine nucleoti
Intracellular signal transduction is performed through activation of de-binding protein (hereinafter, sometimes abbreviated as G protein).
In addition, since these receptors have a common structure having seven cell transmembrane domains, G protein-coupled receptors or seven transmembrane receptors (7T
MR). The hypothalamus-pituitary system is one of the pathways that regulate the functions of living organisms by such hormones and neurotransmitters and G protein-coupled receptors. This is because hypothalamic hormones (pituitary hormones) regulate the secretion of pituitary hormones from the pituitary gland and regulate the function of target cells and organs via pituitary hormones released into the blood. It is. This pathway regulates important functions for living organisms such as maintenance of homeostasis and development, metabolism and growth of the reproductive system and individuals. Pituitary hormone is secreted and regulated by a positive feedback mechanism or a negative feedback mechanism by hypothalamic hormone and peripheral hormone secreted from a target endocrine gland. Various receptor proteins present in the pituitary play a central role in regulating the hypothalamus-pituitary system. It is also known that these hormones, factors and their receptors do not exist exclusively in the hypothalamus-pituitary system but are generally widely distributed in the brain. From this, it is considered that a substance called hypothalamic hormone functions as a neurotransmitter or a neuromodulator in the central nervous system. In addition, substances called hypothalamic hormones are similarly distributed in peripheral tissues, and are thought to have important functions. In addition to secreting digestive juice, the pancreas plays an important role in glucose metabolism by secreting glucagon and insulin. Insulin is secreted from β cells of the pancreas, but is primarily stimulated by glucose. However, various receptors exist in β cells, and various factors other than glucose, such as peptide hormones (galanin, somatostatin, gastric inhibitory polypeptide, glucagon, amylin, etc.), sugars (mannose, etc.), It is known that the secretion of insulin is controlled by amino acids and neurotransmitters.

Hitherto, among the above-mentioned G protein-coupled receptor proteins, as a means for determining the ligand of the G protein-coupled receptor protein of which ligand is unknown, a method of determining the ligand of a G protein-coupled receptor protein whose ligand is known is known. There was no other way to estimate it than relying on similarities in primary structure. Recently, L, a kind of so-called orphan G protein-coupled receptor protein whose ligand is unknown, has been disclosed.
CDNA encoding C132 or ORL-1
Example of searching for a novel opioid peptide ligand for the receptor protein by introducing it into HO cells, constructing an intracellular signaling system for the receptor, and detecting an intracellular signaling signal similar to an agonist for the receptor protein (Reinsheid, RK
et al., Science, 270, 792-794, 1995; Menul
ar, J.-C., et al., Nature 377, 532-535, 1995
Year). However, in these cases, based on similarity to known G protein-coupled receptor proteins and tissue distribution of the receptor proteins, it has been predicted that ligands for them are peptide ligands belonging to the family of opioid peptides. That is, the history of research and development of substances that act on living organisms via opioid receptors is long, and various antagonists and agonists have already been developed. Therefore, an agonist for this LC132 or ORL-1 is screened from a group of artificially synthesized compounds, and using this as a probe, an activator of an intracellular signal transduction system similar to the agonist is searched for.
This is purified and the structure as a ligand is determined.
However, at present, there are few orphan G protein-coupled receptor proteins whose ligands can be roughly estimated, as in this example. In particular, in the case of an orphan G protein-coupled receptor protein having low similarity to known receptor protein families, since there is almost no information on the ligand for it, it is obvious that the ligand is specified,
It was difficult even to estimate. One such orphan G protein-coupled receptor protein whose ligand is unknown is a human receptor protein encoded by the phGR3 (or sometimes called GPR10) gene [Genomics, Vol. 29, No.
335 (1995)], and the corresponding rat-type receptor protein UHR-1 [Biochemical and
Biophysical Research Communication (Bi
ochem. Biophy. Res. Commun.), Volume 209, Page 606 (1
995)] is known.

[0004]

As one means for elucidating the mechanism of occurrence of various diseases and establishing a therapeutic method for it, Orphan G, which is considered to have some physiological function in vivo, is used as a means. It is important to determine the ligand for the protein-coupled receptor protein.
For example, ligands for orphan G protein-coupled receptors expressed in the pituitary gland, central nervous system, pancreatic β cells, etc., are considered to be useful as pharmaceuticals, but their structures and functions are still sufficiently clear. It has not been. Further, when analyzing the function of a ligand, it is very difficult to compare the case where the gene of the ligand is overexpressed or the case where the function of the gene product of the ligand is deficient with the case where the gene expression is normal. It is an effective means. In this case, the most reliable method for losing the function of a specific gene product is to destroy the gene itself. Gene targeting has been developed as a method (Thomas. KR et al. Cell, 51,
503-512 (1987)), many gene-deficient mice have been created worldwide. In this method, a specific chromosomal gene of a pluripotent mouse embryonic stem cell (ES cell) is disrupted by homologous recombination, and the ES cell is injected into a blastocyst to produce a chimeric mouse. How to get a mouse. At present, only mice can be used as experimental animal models for various diseases, and in order to create useful gene-deficient mice in which genes thought to be involved in a particular disease have been deleted, the target gene must be used. Genomic DNA sequence from the mouse of
PHGR3 (GP, a protein-coupled receptor protein)
For R10) or UHR-1, a mouse-derived ligand peptide and a gene encoding the ligand peptide (cDNA or genomic DNA)
Is not known.

[0005]

Means for Solving the Problems The present inventors have measured the specific cell stimulating (signal transmitting) activity using cells expressing cDNA encoding the orphan G protein-coupled receptor protein pHGR3. As an indicator, a bovine polypeptide recognized by the receptor protein as a ligand was screened for its amino acid sequence and DN.
The A sequence was determined. Using DNA encoding the polypeptide derived from bovine as a primer, PCR (polymera
bovine, human and rat cDNAs encoding said polypeptides are isolated by a se chain reaction) method,
Primers were prepared based on the rat cDNA sequence, and the cDNA and genomic DNA encoding the mouse polypeptide were successfully isolated by PCR. Furthermore, the present inventors can screen a compound that changes the binding property to the receptor protein by using the ligand peptide, and can also use a genomic DNA of a mouse-derived ligand polypeptide. Non-human transgenic animals (especially useful knockout mice) were created, and their gene functions could be analyzed.

That is, the present invention relates to (1) SEQ ID NO: 1.
Or a amide, an ester or a salt thereof having the same or substantially the same amino acid sequence as the amino acid sequence represented by the following formula: (2) a DNA having a base sequence encoding the polypeptide according to the above (1); DNA containing (3) SEQ ID NO: 2 or SEQ ID NO: 3
The DNA according to the above (2), which has a base sequence represented by:
(4) a recombinant vector containing the DNA of (2), (5) a transformant transformed with the DNA of (2) or the recombinant vector of (4),
(6) a method for producing a non-human knockout animal having the inactivated DNA according to (2), (7) the DNA according to (2) or a mutant thereof, or the recombination according to (4) A non-human transgenic animal carrying the vector, (8) a non-human animal cell carrying the inactivated DNA according to (2), (9) a non-human animal cell carrying the inactivated DNA according to (2). (1) the method for producing a non-human animal cell according to the above (8),
0) A method for producing the polypeptide according to the above (1) or an amide, ester or salt thereof, wherein the transformant according to the above (5) is cultured, (11) the polypeptide according to the above (1). Or a pharmaceutical comprising an amide, ester or a salt thereof, and (12)
The present invention also relates to an antibody against the polypeptide according to the above (1) or an amide, ester or salt thereof, and the like.

Further, according to the present invention, (11) dementia, depression, hyperactivity child (microbrain disorder) syndrome, consciousness disorder, anxiety disorder, schizophrenia, phobia, growth hormone secretion disorder, bulimia, bulimia Hypercholesterolemia, hyperglyceridemia, hyperlipidemia, hyperprolactinemia, diabetes, cancer, pancreatitis, renal disease, Turner syndrome, neurosis, rheumatoid arthritis, spinal cord injury, transient ischemic attack, The above agent for treating or preventing a disease such as amyotrophic lateral sclerosis, acute myocardial infarction, spinocerebellar degeneration, fracture, wound, atopic dermatitis, osteoporosis, asthma, epilepsy, infertility or lactation deficiency. The medicament according to 11) is also provided.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION In the present specification and drawings, when bases and amino acids are indicated by abbreviations, IUPAC-
It is based on the abbreviation by IUB Commision on Biochemical Nomenclature or the abbreviation commonly used in the art, examples of which are described below. When an optical isomer is present for an amino acid, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate Phosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate EIA: Enzyme immunoassay Gly or G: Glycine Ala or A: Alanine Val or V: Valine Leu or L: Leucine Ile Or I: isoleucine Ser or S: serine

Thr or T: Threonine Cys or C: Cysteine Met or M: Methionine Glu or E: Glutamate Asp or D: Aspartic acid Lys or K: Lysine Arg or R: Arginine His or H: Histidine Phe or F: Phenylalanine T Or Y: tyrosine Trp or W: tryptophan Pro or P: proline Asn or N: asparagine Gln or Q: glutamine pGlu: pyroglutamic acid Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine-4 R) -carboxamide group

Further, substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. BHA: benzhydrylamine pMBHA: p-methylbenzhydrylamine Tos: p-toluenesulfonyl CHO: formyl HONB: N-hydroxy-5-norbornene-2,3
- dicarboximide OcHex: Cyclohexyl ester Bzl: benzyl Cl ₂ -Bzl: dichlorobenzyl Bom: benzyloxymethyl Z: benzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Boc: t-butyloxycarbonyl DCM: dichloromethane HOBt: 1-hydroxybenztriazole DCC: N, N'-dicyclohexylcarbodiimide TFA: trifluoroacetic acid DIEA: diisopropylethylamine Fmoc: N-9-fluorenylmethoxycarbonyl DNP: dinitrophenyl Bum: tert-butoxymethyl Trt: trityl

As used herein, "substantially the same" means that the activities of the proteins, for example, the binding activity of the ligand and the receptor and the physiological characteristics are substantially the same. Accordingly, an amino acid sequence that is “substantially identical” is a state in which the protein activities, for example, the binding activity of a ligand and a receptor, and physiological characteristics are substantially the same (no significant change occurs). Means an amino acid sequence that may have a mutation in the range where In general, mutations such as amino acid substitutions, deletions or insertions (additions) in a polypeptide sequence often do not result in significant (significant) changes in the physiological or chemical properties of the polypeptide. Is a well-known fact. As an example of the substitution, a certain amino acid has a property (characteristic).
Those substituted with other amino acids that are similar to
In general, it is considered that the more the substitution is made between amino acids having similar properties, the smaller the change in the property of the original polypeptide before the substitution is.
Amino acids are classified into, for example, the following classes based on similarity in their properties as one criterion. (I) Examples of non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, methionine and the like. (Ii) Glycine, serine, threonine, and polar (neutral) amino acids
Cysteine, tyrosine, asparagine, glutamine and the like. (Iii) Examples of (basic) amino acids having a positive charge include arginine, lysine, histidine and the like. (Iv) Examples of (acidic) amino acids having a negative charge include aspartic acid and glutamic acid.
As the “substantially identical” substitution of an amino acid in the amino acid sequence of interest in the present specification, for example, it is often selected from other amino acids having similar characteristics among the classes to which the amino acid belongs. In the present invention, the result of a mutation in an amino acid sequence such as a substitution, deletion or insertion that does not cause a significant (significant) change in the physiological or chemical properties of the original (unmutated) polypeptide. The resulting polypeptide (mutated polypeptide) is considered to be substantially identical to the original (unmutated) polypeptide without such mutations, and the amino acid sequence of the mutant polypeptide Is considered to be substantially identical to the amino acid sequence of the original (unmutated) polypeptide.

The polypeptide according to the present invention is a mature ligand polypeptide capable of binding to a G protein-coupled receptor protein (polypeptide having an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 4). Peptide), specifically, a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, or an amide, ester or salt thereof (hereinafter simply referred to as a ligand) (Sometimes abbreviated as polypeptide or polypeptide). However, as the polypeptide in the present invention, those having the same amino acid sequence as that shown in SEQ ID NO: 4 are excluded (the same applies hereinafter).
The polypeptide of the present invention includes humans and warm-blooded animals (eg, guinea pigs, rats, mice, pigs, sheep, cows, monkeys, etc.) in all tissues (eg, pituitary, pancreas, brain, kidney, liver, gonads) , Thyroid, gall bladder, bone marrow,
Polypeptide derived from adrenal gland, skin, muscle, lung, gastrointestinal tract, blood vessel, heart, etc.) or cells, and has an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1. Anything should do. For example, as the ligand polypeptide of the present invention, in addition to a protein containing the amino acid sequence represented by SEQ ID NO: 1, an amino acid sequence represented by SEQ ID NO: 1
0-99.9% (preferably 70-99.9%, more preferably 80-99.9%, even more preferably 90-9%
(9.9%), and a protein having substantially the same activity as the protein containing the amino acid sequence represented by SEQ ID NO: 1. Examples of the activity include activities of the ligand polypeptide, such as receptor binding activity and signal transduction activity. "Substantially the same activity" indicates that the properties such as the receptor binding activity are the same. Therefore, the receptor binding activity may be not significantly different, and the difference in the molecular weight of the ligand polypeptide is not a problem.

More specifically, examples of the ligand polypeptide of the present invention include a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1, particularly derived from a mouse. In addition, the ligand polypeptide of the present invention includes (i) 1 to 15 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids in the amino acid sequence represented by SEQ ID NO: 1. (Ii) SEQ ID NO:
1 or more and 15 or less in the amino acid sequence represented by 1,
Preferably an amino acid sequence in which 1 to 10 amino acids have been deleted, more preferably 1 to 5 amino acids,
i) an amino acid sequence in which 1 to 15 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids have been added (inserted) to the amino acid sequence represented by SEQ ID NO: 1, Further, (iv) the above (i), (i
A polypeptide containing an amino acid sequence having a modification in a constituent amino acid (particularly, its side chain) in the polypeptide of i) or (iii), or an amide, ester or salt thereof is also included.

Examples of the modification of the constituent amino acids in the polypeptide of the present invention include, for example, those in which the N-terminal side of Gln is cleaved in a living body and the Gln is pyroglutamine-oxidized. In the present specification, the title of the peptide is represented by the N-terminus (amino terminus) at the left end and the C-terminus (carboxyl terminus) at the right end according to the customary practice. In the polypeptide of the present invention, for example, the polypeptide represented by SEQ ID NO: 1, the C-terminus usually has a carboxyl group (—COO).
H) or carboxylate (—COO ⁻ ), but the carboxyl group of the C-terminal amino acid residue may be amide (—CONH ₂ ) or ester (—COOR). As R of the ester represented by -COOR, for example, methyl, ethyl,
a C _1-6 alkyl group such as n-propyl, isopropyl or n-butyl; a C _3-8 cycloalkyl group such as cyclopentyl and cyclohexyl; a C _6-13 aryl group such as phenyl and α-naphthyl; benzyl, phenethyl and benzhydryl Other than C _7-14 aralkyl groups such as phenyl-C _1-2 alkyl, diphenyl-C _1-2 alkyl, or α-naphthyl-C _1-2 alkyl such as α-naphthylmethyl, and other general-purpose oral esters And pivaloyloxymethyl ester. When the polypeptide of the present invention has a carboxyl group or a carboxylate other than the C-terminus, the polypeptide of the present invention includes a polypeptide in which those groups are amidated or esterified. The ester in this case is the same as, for example, the aforementioned C-terminal ester. Examples of the salt of the polypeptide of the present invention include salts with physiologically acceptable bases (for example, alkali metals and the like) and acids (organic acids and inorganic acids), and especially physiologically acceptable acid addition salts. Is preferred. Such salts include, for example, salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg, acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid,
Salts with tartaric acid, citric acid, malic acid, oxalic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like are used.

The ligand polypeptide of the present invention or its amide, ester or salt thereof can be produced by (i) a known method for purifying a polypeptide from tissues or cells of humans or warm-blooded animals. ii) It can also be produced according to a known polypeptide synthesis method.
Furthermore, (iii) DN encoding the polypeptide
It can also be produced by a method of culturing a transformant containing A (described later). (I) When the ligand polypeptide is produced from human or warm-blooded animal tissues or cells, the human or warm-blooded animal tissues or cells are homogenized and then extracted with an acid or the like, and the extract is subjected to reverse phase. Purification and isolation can be performed by a method combining chromatography such as chromatography, ion exchange chromatography, and affinity chromatography.

(Ii) The ligand polypeptide can also be produced according to a polypeptide synthesis method known per se. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting a protein with the remaining portion, and when the product has a protecting group, removing the protecting group.
In this case, examples of the known condensation method and the method for removing the protecting group include the following methods. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptid
e), Academic Press, NewYork (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory for Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Drugs Volume 14 Peptide Synthesis Hirokawa Shoten

[0017] More specifically, the following methods can be mentioned as a method for synthesizing the ligand polypeptide. In order to synthesize the amide of the ligand polypeptide, a resin for peptide synthesis suitable for amide formation may be used. Such resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin,
-Methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4- (2 ', 4'-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4-
(2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin. Using such a resin,
An amino acid having an α-amino group and a side chain functional group protected with a known suitable protecting group is condensed on the resin according to the sequence of a target peptide according to various known condensation methods. At the end of the reaction, the peptide is cut out from the resin and various protecting groups are removed to obtain the desired polypeptide. To condense the above protected amino acids,
Various activating reagents that can be used for peptide synthesis can be used, and carbodiimides are particularly preferable. Examples of the carbodiimides include DCC, N, N'-diisopropylcarbodiimide, N-ethyl-N '-(3-dimethylaminoprolyl) carbodiimide, and the like. Activation by these involves adding the protected amino acid directly to the resin along with a racemization inhibitor additive (eg, HOBt) or activating the amino acid previously protected as a symmetric anhydride or HOBt ester or HOOBt ester. And then added to the resin. The solvent used for activation of the protected amino acid or condensation with the resin may be appropriately selected from known solvents that can be used for the peptide condensation reaction. Examples of the solvent include acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide and N-methylpyrrolidone; halogenated hydrocarbons such as methylene chloride and chloroform; alcohols such as trifluoroethanol; Sulfoxides such as dimethyl sulfoxide, tertiary amines such as pyridine, ethers such as dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, or an appropriate mixture thereof. No. The reaction temperature in the condensation reaction may be appropriately selected from the temperature range that can be used for a known peptide bond formation reaction, and usually includes a range of about −20 ° C. to 50 ° C. The activated amino acid derivative is
It is usually used in a 1.5 to 4-fold excess. The degree of achievement of the condensation reaction can be confirmed using a known ninhydrin reaction. As a result, when the condensation is insufficient, sufficient condensation is performed by repeating the condensation reaction without removing the protecting group. be able to. When sufficient condensation cannot be obtained even by repeating the reaction, unreacted amino acids can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.

The protecting group for the amino group of the amino acid used as a raw material in the synthesis of the peptide includes, for example, Z, Boc, tert.
-Amyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z,
Examples include Br-Z, adamantyloxycarbonyl, trifluoroacetyl, phthalyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, and Fmoc. Examples of the carboxyl-protecting group include the aforementioned C _1-6 alkyl group, C _3-8 cycloalkyl group,
_{In addition to 7-14} aralkyl groups, mention may be made of 2-adamantyl, 4-nitrobenzyl, 4-methoxybenzyl, 4-chlorobenzyl, phenacyl group, benzyloxycarbonyl hydrazide, tert-butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl groups of serine and threonine can be protected, for example, by esterification or etherification. Suitable groups for this esterification include, for example, lower (C _1-6 ) alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbonic acid such as benzyloxycarbonyl group and ethoxycarbonyl group. . Examples of the group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a tert-butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, Cl ₂ -Bz
l, 2-nitrobenzyl, Br-Z, tert-butyl and the like. The protecting groups for imidazole of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt,
Fmoc and the like.

The method for removing (eliminating) the protecting group includes, for example, (i) in the presence of a catalyst such as Pd-black or Pd-carbon.
Catalytic reduction in a stream of hydrogen, (ii) acid treatment with hydrogen fluoride anhydride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof,
(Iii) base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine and the like; and (iv) reduction with sodium in liquid ammonia. The elimination reaction by the above acid treatment is generally -20 ° C.
Performed at a temperature of ４０40 ° C., but in the acid treatment, anisole, phenol, thioanisole, metacresol,
Addition of a cation scavenger such as paracresol, dimethyl sulfide, 1,4-butanedithiol, 1,2-ethanedithiol is effective. The 2,4-dinitrophenyl group used as a protecting group for the imidazole group of histidine is removed by thiophenol treatment, and the formyl group used as an indole protecting group for tryptophan is as described above.
In addition to removal by acid treatment in the presence of 1,2-ethanedithiol, 1,4-butanedithiol, etc., dilute sodium hydroxide,
It is also removed by alkali treatment with dilute ammonia or the like. In the peptide synthesis reaction, introduction of a protecting group for a functional group that does not participate in the reaction of the starting amino acid, elimination of the protecting group, activation of the functional group involved in the reaction, and the like may be performed according to a known method. Examples of the starting material in which the carboxyl group of the amino acid is activated include the corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol,
2,4-dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide,
Esters with N-hydroxyphthalimide, HOBt)]. The activated amino group of the amino acid as a raw material includes, for example, a corresponding phosphoric amide.

When the polypeptide is in the form of an amide, as another production method, first, after amidating the α-carboxyl group of the carboxy terminal amino acid, a peptide chain having a desired chain length is added to the amino group side by a condensation reaction. To α-
Remove only the α-carboxyl protecting group of the carboxyl terminal peptide from which the carboxyl terminal side is removed from the desired peptide and the carboxyl terminal side peptide from which the protecting group of the amino group is removed, to form an α-amino group or a side chain functional group. The protected peptide having an appropriate protecting group is condensed in the above-mentioned mixed solvent used for the peptide synthesis reaction. The details of the condensation reaction are the same as described above. After isolating and purifying the polypeptide having a protecting group obtained by the condensation reaction, all the protecting groups are removed by the above-mentioned method to obtain a desired crude peptide. This crude peptide is purified by various known purification methods, and if necessary, the main fraction is lyophilized to obtain an amide of the desired polypeptide. To obtain an ester of the polypeptide, the α-carboxyl group of the carboxy-terminal amino acid is condensed with a desired alcohol to form an amino acid ester, and then, as in the case of the amide of the polypeptide, an ester of the desired polypeptide is obtained. You can get the body. The polypeptide after the synthesis reaction can be purified by a conventional purification method such as solvent extraction, distillation,
Column chromatography, liquid chromatography,
Purification and isolation can be performed by appropriately combining various known methods such as recrystallization. When the polypeptide obtained by the above method is a free form, it can be converted to a target salt by a known method. Conversely, when the polypeptide is obtained as a salt, the free form or another acid is obtained by a known method. Can be converted to

The ligand polypeptide of the present invention or its amide, ester or salt thereof is a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1. Either may be used. That is, as long as it has the same physiological action (pituitary function regulating action, central nervous function regulating action, pancreatic function regulating action, etc.) as the polypeptide having the amino acid sequence represented by SEQ ID NO: 1, its amino acid sequence May be any polypeptide having a mutation.
Examples of such a peptide include: (1) Ser-Arg-Ala-His-Gln-His-Ser-Met-Glu-Thr-Arg-
Thr-Pro-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Thr-Gly-Arg-Gl
y-Ile-Arg-Pro-Val-Gly-Arg-Phe (SEQ ID NO: 5) (2) Thr-Pro-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Thr-Gly-
Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe (SEQ ID NO:
6) and the like are preferable. The ligand polypeptide can further be used as an antigen for the preparation of an anti-ligand polypeptide antibody. Such polypeptides as antigens include, in addition to the ligand polypeptides described above, (1) Ser-Arg-Ala-His-Gln-His-Ser-Met-Glu (SEQ ID NO: 7) (2) Thr-Pro -Asp-Ile-Asn-Pro-Ala-Trp-Tyr (SEQ ID NO: 8) (3) Gly-Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe
(SEQ ID NO: 9) A partial peptide of the ligand polypeptide such as, for example, is preferably used. As the partial peptide, a peptide individually containing an individual domain that can function as an antigenic determinant may be used, or a peptide containing a plurality of these domains at the same time may be used (provided that the partial peptide is SEQ ID NO: : Excluding those identical to the amino acid sequence represented by 4).

In the partial peptide of the ligand polypeptide in the present invention, the carboxyl group of the C-terminal amino acid residue may be an amide (-CONH ₂ ) or an ester (-COOR). Examples of the ester group are the same as in the case of the polypeptide described above. As the partial peptide,
When the amino acid constituting the peptide has a carboxyl group or a carboxylate other than the C-terminal, that is, the amino acid side chain includes those in which the group is amidated or esterified. Examples of the ester in this case include an ester of the C-terminal amino acid residue in the aforementioned polypeptide. As the salt of the partial peptide of the ligand polypeptide of the present invention, those similar to the above-mentioned salts of the polypeptide are used. The partial peptide of the ligand polypeptide of the present invention or its amide, ester or salt thereof can be produced by the same synthetic method as in the case of the aforementioned polypeptide. It can also be produced by cleaving the ligand polypeptide with an appropriate peptidase and fragmenting it. The ligand polypeptide of the present invention or a partial peptide thereof may be a fusion protein with another protein (eg, a known protein whose function or property is well known).

The DNA encoding the ligand polypeptide of the present invention may be a nucleotide sequence encoding a polypeptide having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 of the present invention. Any material may be used as long as it is contained. Further, D-containing DNA encoding the ligand polypeptide
The NA may be any of genomic DNA, genomic DNA library, cDNA derived from tissue or cell, cDNA library derived from tissue or cell, synthetic DNA, and the like. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. The DNA encoding a ligand polypeptide or a partial peptide thereof;
Is a direct RT-PCR method using a RNA fraction prepared from tissue or cells
It can also be amplified by a merase chain reaction). As a DNA containing a DNA encoding a mouse-derived polypeptide containing the amino acid sequence of SEQ ID NO: 1, more specifically, a cDNA having the base sequence represented by SEQ ID NO: 2 or a cDNA represented by SEQ ID NO: 3 Genomic DNA having a base sequence to be used. Among these DNAs, for example, a partial base sequence of 6 or more and 90 or less (preferably 6 or more and 60 or less, more preferably 9 or more and 30 or less, still more preferably 12 or more and 30 or less) is contained. The DNA fragment to be used is also preferably used as a DNA detection probe for detecting DNA encoding a mouse-derived polypeptide containing the amino acid sequence of SEQ ID NO: 1.

DNA encoding the polypeptide of the present invention
Can also be produced by the following genetic engineering techniques. Cloning (cloning) of a DNA completely encoding the polypeptide of the present invention or a partial peptide thereof may be performed according to the following method.
That is, (1) D having a partial nucleotide sequence of the polypeptide
NA is synthesized, and using this as a primer to amplify a DNA completely encoding the polypeptide by PCR, or (2) incorporating mouse-derived cDNA or genomic DNA or a DNA fragment thereof into an appropriate vector. The resulting DNA library may be selected by, for example, performing hybridization with a DNA fragment having a part or the entire region of a human- or rat-derived ligand polypeptide or labeled with a synthetic DNA. The hybridization method is described, for example, in Molecular Cloning (2nd ed .; J. Sam).
brook et al., Cold Spring Harbor Lab. Press, 198
It may be performed according to the method described in 9). Also, DN
When a commercially available A library is used, it may be performed according to the method described in the attached instruction manual. The DNA encoding the cloned polypeptide may be used as it is, or may be used after digesting with a restriction enzyme or adding a linker DNA if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter.

An expression vector containing a DNA having a nucleotide sequence encoding the polypeptide is, for example, (a)
D containing DNA encoding the polypeptide of the present invention
A DNA fragment of interest can be cut out from NA, and (b) the DNA fragment can be produced by ligating this DNA fragment downstream of a promoter sequence in a known suitable expression vector. As the vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12, pU
C13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as phage λ, and animal viruses such as retrovirus, vaccinia virus, and baculovirus. As the promoter, any promoter can be used as long as it functions properly in a host used for expression of the gene encoding the polypeptide of interest.

When the host for transformation is Escherichia, the trp promoter, lac promoter,
The recA promoter, the λPL promoter, the lpp promoter, etc. are used when the host is Bacillus sp.
When the host is yeast, such as an O1 promoter, an SPO2 promoter, or a penP promoter, a PHO5 promoter, a PGK promoter, a GAP promoter,
ADH promoters and the like are preferred. When the host is an animal cell, an SV40-derived promoter, a retrovirus promoter, a metallothionein promoter, a heat shock promoter, a cytomegalovirus promoter, an SRα promoter and the like are preferably exemplified. In order to efficiently express the gene encoding the target polypeptide, it is preferable to use an enhancer. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the polypeptide or its partial peptide. When the host is Escherichia, an alkaline phosphatase signal sequence, an OmpA signal sequence, and the like are used. When the host is Bacillus, an α-amylase signal sequence, a subtilisin signal sequence, and the like are used. When the host is an animal cell, for example, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. Available. D encoding the polypeptide thus constructed or its partial peptide
A transformant is produced using a vector containing NA.

Examples of the host for transformation include known Escherichia, Bacillus, yeast, insect, animal cells and the like. Specific examples of the genus Escherichia include, for example, Escherichia coli
li) K12 DH1 [Procedings of the National Academy of Sciences of Science
The USA (Proc. Natl. Acad. Sci. USA), No.
60, 160 (1968)], JM103 [Nukuilec
Acids Research, ninth
Vol., P. 309 (1981)], JA221 [Journal of Molecul Biology (Journal of Molecul)
ar Biology)], Volume 120, 517 (1978)], HB1
01 [Journal of Molecular Biology, Vol. 41, p. 459 (1969)], C600 [Genetics, Vol. 39, p. 440 (1954)], and the like. Specific examples of the bacterium belonging to the genus Bacillus include, for example, Bacillus subtilis MI1.
14 [gene, Vol. 24, p. 255 (1983)],
207-21 [Journal of Biochemistry, Vol. 95, p. 87 (1984)
Year)].

As the yeast, for example, Saccharomyces cerevisiae AH22, A
^{H22R -, NA87-11A, DKD-5D} , 20B
-12. Examples of such insects include silkworm larvae [Maeda et al., Nature (Natu
re), Volume 315, p. 592 (1985)]. Examples of the animal cells include monkey cells COS-7, Vero, Chinese hamster cells CHO, DHFR gene-deficient Chinese hamster cells CHO (dhfr ^- CHO cells), mouse L cells, mouse myeloma cells, and human FL cells. To transform Escherichia,
For example, Processings of the National Academy of Sciences of the USA, 69, 2110 (1972), and Jean, 17, 107
Page (1982) or the like.
In order to transform Bacillus, for example, Molecular and General Genetics (Molecular
& General Genetics), vol. 168, p. 111 (1979). Transformation of yeast may be performed, for example, according to the method described in Procesings of the National Academy of Sciences of the USA, Vol. 75, p. 1929 (1978). . In order to transform insect cells, for example, bio / technology,
The method may be carried out according to the method described in Vol. 6, page 47 (1988). Transformation of animal cells is performed, for example, according to the method described in Virology, Vol. 52, p. 456 (1973). Thus, a transformant transformed with the expression vector containing the DNA encoding the polypeptide or its partial peptide can be obtained.

As a medium for culturing a transformant whose host is Escherichia or Bacillus, a liquid medium is preferred. Among them, a carbon source, a nitrogen source, and an inorganic substance necessary for growth of the transformant are included. It is prepared to contain others.
Examples of the carbon source include glucose, dextrin,
Soluble starch, sucrose and the like, as the nitrogen source, for example, inorganic or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, as the inorganic substance Is, for example, calcium chloride, sodium dihydrogen phosphate,
Magnesium chloride and the like. In addition, yeast extract, vitamins, growth promoting factors and the like may be added to the medium as needed. The pH of the medium may be any pH as long as the transformant can grow, but the pH is usually preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, an M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), p.431, C
old Spring Harbor Laboratory, New York 1972]. If necessary, a drug such as 3β-indolylacrylic acid may be added to the medium and cultured in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring may be added. When the host is Bacillus, the culture is usually about 30 to 4
The reaction is carried out at 0 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be applied. When culturing a transformant whose host is yeast, for example, a bark holder (Bu
rkholder) minimal medium [Bostian, KL et al., Processings of the National Academy of Sciences of the USA (Proc. Natl.
Acad. Sci. USA), Vol. 77, p. 4505 (1980)] or an SD medium containing 0.5% casamino acid [Bitter, GA
Proc. Natl. Acad. Sci. USA, Proc. Of the National Academy of Sciences of the USA, 81, 5330
Page (1984)]. Preferably, the pH of the medium is adjusted to about 5-8. The cultivation is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and if necessary, aeration and stirring can be added.

When culturing a transformant whose host is an insect, Grace's Insect Medium (Grace, T .;
CC, Nature, 195, 788 (1962
Page)) to which an additive such as immobilized 10% bovine serum is appropriately added. The pH of the medium is about 6.2 to 6.
Adjustment to 4 is preferred. Culture is usually performed at about 27 ° C for about 3
It is carried out for up to 5 days, and if necessary, ventilation or stirring can be added. When culturing a transformant in which the host is an animal cell, the culture medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Seience, Vol.
1 (1952)], DMEM medium [Virol
ogy), Volume 8, p. 396 (1959)], RPMI 164
0 medium [Journal of the American Medical Association
199, p. 519 (1967)],
199 medium [Proceeding of the Society for the Biological Medicine (Proceedi
ng of the Society for the Biological Medicine),
73, p. 1 (1950)]. Preferably, the pH is between about 6-8. Culture is usually about 30 ° C to 40
C. for about 15 to 60 hours, and aeration and / or stirring may be added as necessary.

The polypeptide can be separated and purified from the above culture (culture solution and cultured cells or cultured cells) by, for example, the following method. When the polypeptide is accumulated in cultured cells or cultured cells, after culture, the cells or cells are collected by a known method, suspended in an appropriate buffer, and then subjected to a known ultrasonic treatment. After disrupting the cells or cells by lysozyme treatment and / or freeze-thaw treatment, the target polypeptide or its partial peptide can be obtained as an extract by a known operation such as centrifugation or filtration. Some of the buffers include protein denaturants such as urea and guanidine hydrochloride, and Triton X-100 (trademarks of Wako Pure Chemical Industries, Ltd.).
A surfactant such as TM may be used as needed. On the other hand, when the polypeptide is secreted into the culture solution, after culturing, the cultured cells or cultured cells and the culture supernatant can be separated by a known method to obtain the culture supernatant. The polypeptide contained in the obtained culture supernatant or extract can be purified by appropriately combining known separation and purification methods. These known separation and purification methods include (1) methods using solubility such as salting out and solvent precipitation, (2) dialysis, ultrafiltration, gel filtration, and SD.
A method mainly using a difference in molecular weight such as S-polyacrylamide gel electrophoresis, (3) a method using a charge difference such as ion exchange chromatography, and (4) a specific affinity such as affinity chromatography. (5) a method using a difference in hydrophobicity such as reversed-phase high performance liquid chromatography, and (6) a method using a difference in isoelectric point such as isoelectric focusing or chromatofocusing. .

When the polypeptide or its partial peptide is obtained in a free form, it can be converted to a salt by a method known per se or a method analogous thereto, and conversely, when the polypeptide or a partial peptide is obtained as a salt, it is known per se. It can be converted to a free form or another salt by a method or a method analogous thereto. Before or after purification of the polypeptide or a partial peptide thereof, an appropriate protein modifying enzyme is allowed to act on the polypeptide or a partial peptide thereof according to a known method to add any modification to the polypeptide or to modify the sequence in the polypeptide. Can also be partially removed. Examples of the protein modifying enzyme include trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase, and the like. The activity of the mutant polypeptide thus obtained can be measured by a receptor binding experiment, an enzyme immunoassay using a specific antibody, or the like.

The DNA containing the DNA encoding the ligand polypeptide of the present invention and the ligand polypeptide are (a) synthesis of a ligand peptide of a G protein-coupled receptor protein, and (b) a physiological action of the ligand polypeptide. Search, (c) preparation of synthetic oligonucleotide probes or oligonucleotide primers in PCR method, (d) acquisition of DNA encoding ligand peptide of G protein-coupled receptor protein, (e) production of recombinant receptor protein Development of a receptor binding assay system using an expression system and screening of drug candidate compounds using the same, (f) Obtaining antibodies and antisera against ligand peptides of G protein-coupled receptor proteins, (g)
(H) development of drugs such as pituitary function regulators, central nervous function regulators or pancreatic function regulators, (i) gene therapy, (j) protein-coupled receptors It can be used for producing non-human transgenic animals related to the gene encoding the protein ligand peptide. In particular, DNA containing the DNA encoding the ligand polypeptide of the present invention can be used to produce non-human transgenic animals related to the gene encoding the ligand peptide of the protein-coupled receptor protein, particularly knockout mice deficient in the gene. , And the analysis of the physiological action and function of the ligand polypeptide using the same.

Further, with respect to the above (h), the ligand polypeptide of the present invention is a polypeptide that is recognized as a ligand by a G protein-coupled receptor protein expressed in the pituitary gland, the central nervous system, pancreatic β cells and the like. Therefore, the ligand polypeptide of the present invention or D encoding the same
DNA containing NA is considered to be useful as a safe and low toxic drug. Since the ligand polypeptide of the G protein-coupled receptor protein is considered to be involved in the pituitary function regulating action, the central nervous function regulating action, the pancreatic function regulating action, etc., the ligand polypeptide of the present invention or the polypeptide encoding the same is encoded. D containing DNA
NA includes, for example, senile dementia, cerebrovascular dementia, degenerative degenerative diseases caused by systemic transformation (eg, Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc.),
Dementia, endocrine, metabolic, or toxic diseases (eg, hypothyroidism, vitamin B) due to infectious diseases (eg, late viral infections such as Creutzfeldt-Jakob disease)
12 deficiency, alcoholism, poisoning by various drugs, metals and organic compounds, etc.), dementia due to neoplastic diseases (eg, brain tumors, etc.), traumatic diseases (eg,
Dementia such as dementia due to chronic subdural hematoma), depression, hyperactive child (microbrain disorder) syndrome, consciousness disorder, anxiety disorder, schizophrenia, phobia, growth hormone secretion disorder (eg:
Gigantism, acromegaly, etc.), bulimia, bulimia, hypercholesterolemia, hyperglyceridemia, hyperlipidemia, hyperprolactinemia, diabetic complications, diabetic nephropathy, diabetic neuropathy , Diabetic retinopathy, diabetes, cancer (eg, breast cancer, lymphocytic leukemia, bladder cancer, ovarian cancer, prostate cancer, etc.), pancreatitis, kidney disease (eg, chronic renal failure, nephritis, etc.), Turner syndrome, neurosis, Rheumatoid arthritis, spinal cord injury, transient ischemic attack, amyotrophic lateral sclerosis, acute myocardial infarction, spinocerebellar degeneration, fracture, wound, atopic dermatitis, osteoporosis, asthma, epilepsy, infertility or milk It can be used as a therapeutic and / or prophylactic agent for diseases such as secretory deficiency.
Furthermore, it can also be used as a postoperative nutritional condition improving agent, a vasopressor, and the like. When the polypeptide of the present invention (or a DNA containing a DNA encoding the polypeptide) is used as the above-mentioned medicine, it may be carried out in a conventional manner. For example, the polypeptide (or DNA containing the DNA encoding the polypeptide) is orally or water-coated as a dosage form such as tablets, capsules, elixirs, microcapsules, etc., which are sugar-coated as necessary. Alternatively, it can be used parenterally in the form of an injection such as a sterile solution or suspension with another pharmaceutically acceptable liquid. For example, these dosage forms can be prepared by combining the compound or a salt thereof with a physiologically acceptable carrier, flavoring agent, excipient, vehicle, preservative, stabilizer, binder and the like in a unit dosage form commonly used in pharmaceutical practice. And can be produced by mixing. The amount of the active ingredient in these preparations is
It is intended to obtain an appropriate capacity in the specified range.

[0036] Additives that can be incorporated into tablets, capsules and the like include, for example, binders such as gelatin, corn starch, tragacanth gum, and gum arabic; excipients such as crystalline cellulose; corn starch, gelatin, alginic acid and the like. Lubricating agents such as magnesium stearate; sweetening agents such as sucrose, lactose or saccharin; flavoring agents such as peppermint, reddish oil or cherry. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. Examples of aqueous liquids for injection include physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol,
And suitable solubilizing agents such as alcohols (eg, ethanol), polyalcohols (eg, propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80 (TM), HCO-50). ) May be used in combination. The oily liquid includes sesame oil, soybean oil and the like, and may be used in combination with benzyl benzoate, benzyl alcohol and the like as a solubilizing agent. In addition, buffers (eg, phosphate buffer, sodium acetate buffer), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), storage Agents (eg, benzyl alcohol,
Phenol), an antioxidant and the like.
The prepared injection is usually aseptically filled in a suitable ampoule. The preparations obtained in this way are safe and have low toxicity, so that, for example, humans and mammals (eg, mice,
Rats, guinea pigs, rabbits, sheep, pigs, cows, cats, dogs, monkeys, baboons, chimpanzees, etc.). The dose of the polypeptide of the present invention (or the DNA encoding the same) varies depending on the condition and the like, but when administered orally, generally, in an adult (as 60 kg), the dose is about 0.1 to 50 mg / day. 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg. In the case of parenteral administration, the single dose varies depending on the administration subject, symptoms, administration method and the like. For example, in the case of an injection, usually in an adult (as 60 kg), about 0.01 day per day. To about 30 mg, preferably about 0.1 to 2 mg
It is convenient to administer about 0 mg, more preferably about 0.1 to 10 mg, by intravenous injection. In the case of other animals, the dose can be administered in terms of 60 kg.

For the ligand polypeptide of the present invention,
The G protein-coupled receptor protein includes any tissue (eg, pituitary, pancreas, brain, kidney, liver, gonad) of humans and warm-blooded animals (eg, guinea pig, rat, mouse, pig, sheep, cow, monkey, etc.) , Thyroid, gall bladder,
A G protein-coupled receptor protein derived from bone marrow, adrenal gland, skin, muscle, lung, gastrointestinal tract, blood vessel, heart, etc.) or cells;
Alternatively, any amino acid sequence may be used as long as it has the same or substantially the same amino acid sequence as the amino acid sequence represented by 14. That is, the G protein-coupled receptor protein includes, in addition to the protein containing the amino acid sequence represented by SEQ ID NO: 10, 11, 12, 13, or 14, and SEQ ID NO: 1
An amino acid sequence represented by SEQ ID NO: 10, 11, 12, 13 or 14 containing an amino acid sequence having about 90 to 99.9% homology with the amino acid sequence represented by 0, 11, 12, 13 or 14; And a protein having substantially the same activity as a protein containing the same. The activities exhibited by these proteins include, for example, ligand binding activity and signal transduction. “Substantially the same” means that the ligand binding activity and the like are the same in nature. Therefore, the quantitative factors such as the strength of the ligand binding activity and the molecular weight of the receptor protein may be different.

For the ligand polypeptide of the present invention,
More specifically, the G protein-coupled receptor protein is a human pituitary-derived G protein-coupled receptor protein containing the amino acid sequence represented by SEQ ID NO: 10 or / and SEQ ID NO: 11, represented by SEQ ID NO: 13. And a mouse pancreas-derived G protein-coupled receptor protein containing the amino acid sequence represented by SEQ ID NO: 14. The G-protein coupled receptor protein derived from human pituitary gland containing the amino acid sequences represented by SEQ ID NO: 10 and SEQ ID NO: 11 is specifically a human protein containing the amino acid sequence represented by SEQ ID NO: 12. Pituitary-derived G protein-coupled receptor proteins and the like. Here, the protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 12 contains the entire amino acid sequence of the human pituitary-derived G protein-coupled receptor protein. A protein containing an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 10 or / and SEQ ID NO: 11 is
This is a protein fragment or partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 12. Further, SEQ ID NO: 13
Alternatively, the protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 14 is a G-protein-coupled receptor protein derived from mouse pancreas, but has SEQ ID NO: 10 and / or SEQ ID NO: : 1
The protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 13 or 14 also shows a very high similarity to the amino acid sequence represented by SEQ ID NO: 1. : 12 is included in a protein fragment or partial peptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 12. That is, a protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 12 or a partial peptide of the protein described later or a salt thereof is represented by SEQ ID NO: 10, 11, 12, It also includes a protein having an amino acid sequence identical or substantially identical to the amino acid sequence represented by 13 or 14, or a salt thereof. Furthermore, in the G protein-coupled receptor protein, the N-terminal Met has a protecting group (for example, formyl group,
Such as those protected with a C _1-6 alkanoyl group such as an acetyl group), those in which the N-terminal side of Glu has been cleaved in vivo and the Glu has been subjected to pyroglutamine oxidation, and those in which the side chains of constituent amino acids of the receptor protein are suitable. Examples include those protected with a protective group (for example, a C _1-6 alkanoyl group such as a formyl group and an acetyl group), and complex proteins such as so-called glycoproteins to which sugar chains are bonded.

Examples of the salt of the G protein-coupled receptor protein include those similar to the salts exemplified for the aforementioned ligand polypeptide. G protein-coupled receptor protein or its partial peptide, or a salt thereof,
It can be produced from human or warm-blooded animal tissues or cells by a known method for purifying a protein, and can be produced by a method similar to the above-described method for culturing a transformant containing the DNA encoding the polypeptide. You can also. Further, it can be produced according to the above-mentioned peptide synthesis method. The production method is described in detail in Examples 3, 4, 6 and 17 of WO96 / 05302.

DNAs encoding G protein-coupled receptor proteins include SEQ ID NOs: 10, 11, 12, 1
Any DNA may be used as long as it contains a nucleotide sequence encoding a G protein-coupled receptor protein having the same or substantially the same amino acid sequence as the amino acid sequence of 3 or 14. They are genomic DNA,
Genomic DNA library, tissue / cell derived cDN
A, Tissue / cell-derived cDNA library, synthetic DN
Any of A may be used. The genomic DNA or cD
The vector used for the NA library may be any of bacteriophages, plasmids, cosmids, phagemids, etc., and should be directly amplified by RT-PCR using RNA fractions prepared from tissues and cells. Can also. Specifically, examples of the DNA encoding the human pituitary-derived G protein-coupled receptor protein having the amino acid sequence of SEQ ID NO: 10 include a DNA having the base sequence represented by SEQ ID NO: 15. Examples of the DNA encoding the human pituitary G protein-coupled receptor protein containing the amino acid sequence of SEQ ID NO: 11 include a DNA having the base sequence represented by SEQ ID NO: 16. SEQ ID NO: 1
DNA encoding a human pituitary-derived G protein-coupled receptor protein containing the amino acid sequence of
DNA having the base sequence represented by SEQ ID NO: 17 and the like. Examples of the DNA encoding the G-protein-coupled receptor protein derived from mouse pancreas containing the amino acid sequence of SEQ ID NO: 13 include a DNA having the base sequence represented by SEQ ID NO: 18. G from mouse pancreas containing the amino acid sequence of SEQ ID NO: 14
The DNA encoding the protein-coupled receptor protein includes a DNA having the base sequence represented by SEQ ID NO: 19.
NA and the like. A method for cloning a DNA completely encoding the G protein-coupled receptor protein,
The vectors, promoters, hosts, transformation methods, culture methods, and separation and purification methods that can be used are the same as those described above for the ligand polypeptide.

The ligand polypeptide of the present invention, the DNA encoding the same, and the use of the antibody against the ligand polypeptide and the like will be described more specifically below. (1) Agent for preventing / treating ligand polypeptide deficiency DNA encoding the ligand polypeptide of the present invention is
It can be used as a prophylactic and / or therapeutic agent for the ligand polypeptide deficiency. For example, in the case where there is a patient in vivo who cannot expect the physiological action of a ligand (such as a pituitary function controlling action, a central nervous function controlling action or a pancreatic function controlling action) due to a decrease in the ligand polypeptide, (a) ) By administering the DNA encoding the ligand polypeptide to the patient and expressing it, or (ii) after inserting and expressing the DNA encoding the ligand polypeptide in brain cells or the like, and then expressing the brain cells in the patient. By transplanting or the like, the amount of the ligand polypeptide in the brain cells of the patient can be increased, and the effect can be sufficiently exerted. Therefore, the DNA encoding the ligand polypeptide can be used as a safe and low-toxic agent for preventing and / or treating the ligand polypeptide deficiency. Said D as said therapeutic agent
When NA is used, the DNA is used alone or after being inserted into an appropriate vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like, to prevent the ligand polypeptide deficiency and / or It may be used as a therapeutic agent.

(2) Method for Quantifying G Protein-Coupled Receptor Protein for Ligand Polypeptide The ligand polypeptide of the present invention binds to a G protein-coupled receptor protein or a salt thereof, or a partial peptide of the receptor protein or a salt thereof. Therefore, the amount of the G protein-coupled receptor protein, its partial peptide, or a salt thereof in a living body can be quantified with high sensitivity. This quantification method can be used, for example, in combination with a competition method. That is, the amount of the G protein-coupled receptor protein, its partial peptide, or a salt thereof in the test sample can be measured by bringing the test sample into contact with the ligand polypeptide of the present invention. Specifically, for example, it can be used according to the method described below or the like or a method analogous thereto. Edited by Hiro Irie "Radio Immunoassay" (Kodansha, Showa 4)
(Published in 1997) edited by Hiroshi Irie, "Radio Immunoassay" (Kodansha, published in 1979)

(3) The binding property between the G protein-coupled receptor protein and the ligand polypeptide of the present invention, or its amide, ester or salt thereof (hereinafter sometimes abbreviated as ligand or ligand polypeptide). Screening method of compound to be changed G protein-coupled receptor protein or its partial peptide, or a salt thereof is directly used, or an expression system is constructed using them as a recombinant receptor protein, and the receptor binding assay system is used. A compound that alters the binding between the ligand polypeptide and the G protein-coupled receptor protein, ie, an agonist or antagonist (eg, peptide, protein, non-peptide compound, synthetic compound, fermentation product, etc.) for the receptor protein or That Salts can be screened. Such compounds have a cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release,
Compounds having intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, activation of c-fos, activity for promoting or suppressing pH reduction, etc.) (Ie, a G protein-coupled receptor agonist) and a compound having no cell stimulating activity (ie, a G protein-coupled receptor antagonist). The phrase "altering the binding to the ligand" includes both the case where the binding to the ligand is inhibited and the case where the binding to the ligand is promoted. The screening method comprises the steps of (i) contacting the ligand peptide of the present invention with a G protein-coupled receptor protein or a partial peptide thereof, or a salt thereof, and (ii) contacting the ligand peptide of the present invention with a test compound. Screening a compound or a salt thereof that changes the binding property between the ligand polypeptide and a G protein-coupled receptor protein, which is characterized by comparing the amount of binding to the ligand and the change in activity such as cell stimulation. The following are specific examples.

(A) A labeled ligand polypeptide of the present invention can be prepared in the presence or absence of a test compound.
The effect of the test compound is examined by contacting the G protein-coupled receptor protein or its partial peptide, or a salt thereof, and measuring and comparing the amount of binding to the ligand polypeptide. (B) contacting the labeled ligand polypeptide of the present invention with a cell containing a G protein-coupled receptor protein or a membrane fraction of the cell in the presence or absence of a test compound, The effect of the test compound is determined by measuring and comparing the amount of the ligand polypeptide bound to the cell or the membrane fraction. (C) The labeled ligand polypeptide of the present invention was expressed on the cell membrane by culturing a transformant containing a DNA encoding a G protein-coupled receptor protein in the presence or absence of a test compound. The effect of the test compound is examined by contacting the receptor protein and measuring the amount of the ligand polypeptide bound to the cell or the membrane fraction of the ligand polypeptide and comparing the amounts. (D) a compound that activates a G protein-coupled receptor protein (eg, the ligand polypeptide of the present invention)
Is contacted with a cell containing a G protein-coupled receptor protein in the presence or absence of a test compound, and cell stimulating activity via the receptor (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ Release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c-fos activation, pH reduction, etc. The effect of the test compound is determined by measuring and comparing. (E) a compound that activates a G protein-coupled receptor protein (eg, the ligand polypeptide of the present invention)
Is contacted with a G protein-coupled receptor protein expressed on a cell membrane by culturing a transformant containing a DNA encoding the G protein-coupled receptor protein in the presence or absence of a test compound, Receptor-mediated cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca ²⁺ release, intracellular cAMP production, intracellular cGMP production, inositol phosphate production, cell membrane potential fluctuation, intracellular protein phosphorylation, c
-Fos activation, activity promoting or suppressing pH reduction, etc.) and comparing
The effect of the test compound is examined.

When screening for G protein-coupled receptor agonists or antagonists, first, candidate compounds are obtained using cells, tissues or cell membrane fractions containing G protein-coupled receptor proteins such as mice and rats (primary screening). Thereafter, a test (secondary screening) is required to confirm whether the candidate compound actually inhibits the binding between the human G protein-coupled receptor protein and the ligand. However, if the cell, tissue or cell membrane fraction is used as it is, other receptor proteins are also mixed, and it is difficult to actually screen for an agonist or antagonist for the target receptor protein. However, human-derived G
By using a protein-coupled receptor protein,
The need for primary screening is eliminated, and a compound that changes the binding property between the ligand polypeptide and the G protein-coupled receptor can be efficiently screened. Furthermore, it can be evaluated whether the screened compound is a G protein-coupled receptor agonist or a G protein-coupled receptor antagonist. The screening method is specifically described below. First, the G protein-coupled receptor protein used in the screening method may be any one containing the aforementioned G protein-coupled receptor protein or a partial peptide thereof. Are preferred. However, since it is extremely difficult to obtain human organs in particular, G protein-coupled receptor proteins expressed in large amounts using recombinants are suitable for screening. To produce a G protein-coupled receptor protein, the above-described method is used. When cells containing the G protein-coupled receptor protein or the cell membrane fraction are used, the above-described preparation method may be used.

In order to carry out the above (a) to (c) for screening for a compound that alters the binding property between the ligand polypeptide of the present invention and a G protein-coupled receptor, an appropriate G protein-coupled receptor fragment is used. A minute and a labeled ligand polypeptide of the invention are required. As the G protein-coupled receptor fraction, a natural G protein-coupled receptor fraction or a recombinant G protein-coupled receptor fraction having an equivalent activity is preferably used (where the equivalent activity is determined). Indicates equivalent ligand binding activity and the like). As the labeled ligand, a labeled ligand, a labeled ligand analog compound, or the like is used. For example, ligands labeled with [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S] and the like can be used.
Specifically, to screen for a compound that alters the binding between a ligand polypeptide and a G protein-coupled receptor protein, first, a cell or a membrane fraction of the cell containing the G protein-coupled receptor protein is screened. A receptor preparation is prepared by suspending in a suitable buffer. The buffer may be any buffer such as a phosphate buffer of pH 4 to 10 (preferably pH 6 to 8) or a buffer such as Tris-HCl buffer that does not inhibit the binding between the ligand and the receptor. Further, in order to reduce non-specific binding, CHAPS, Tween
Surfactants such as n-80 ^™ (Kao-Atlas), digitonin, deoxycholate and the like can also be added to the buffer. In addition, PMSF, leupeptin,
Protease inhibitors such as E-64 (manufactured by Peptide Research Laboratories) and pepstatin can also be added. 0.01ml
Add a fixed amount (5000 c) to 10 ml of the receptor solution.
pm to 500,000 cpm) of the labeled ligand, and at the same time, 10 ^-4 M to ^{10 -10} M of the test compound. A reaction tube containing a large excess of unlabeled ligand is also prepared to determine the amount of non-specific binding (NSB). The reaction is carried out at 0 to 50 ° C, preferably at 4 to 37 ° C for 20 minutes.
The reaction is carried out for a period of from minutes to 24 hours, preferably from 30 minutes to 3 hours. After the reaction, the mixture is filtered through a glass fiber filter or the like, washed with an appropriate amount of the same buffer, and the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or a γ-counter. Count (B ₀ −) obtained by subtracting the amount of non-specific binding (NSB) from the count (B ₀ ) when there is no antagonistic substance
NSB) as 100%, the specific binding amount (B-NS
A test compound having B) of, for example, 50% or less can be selected as a candidate substance having a competitive inhibitory ability.

In order to carry out the above methods (d) to (e) for screening for a compound that changes the binding property between the ligand of the present invention and a G protein-coupled receptor protein, the G protein-coupled receptor protein must be screened. Cell stimulating activity (eg, arachidonic acid release, acetylcholine release, intracellular Ca release, intracellular cAMP generation, intracellular cG
MP production, inositol phosphate production, cell membrane potential fluctuation,
Phosphorylation of intracellular protein, activation of c-fos, activity of promoting or suppressing pH reduction, etc.) can be measured using a known method or a commercially available measurement kit. Specifically, first, cells containing a G protein-coupled receptor protein are cultured in a multiwell plate or the like. When performing screening, the cells were exchanged with a fresh medium or an appropriate buffer that does not show toxicity for cells in advance, and test compounds were added and incubated for a certain period of time. The product is quantified according to the respective method. When the production of a substance (for example, arachidonic acid or the like) as an indicator of cell stimulating activity is difficult due to a degrading enzyme contained in a cell, an assay may be performed by adding an inhibitor against the degrading enzyme. In addition, the activity such as cAMP production suppression can be detected as a production suppression effect on cells whose basic production amount has been increased by forskolin or the like. In order to perform screening by measuring cell stimulating activity, cells expressing an appropriate G protein-coupled receptor protein are required. Cells expressing the G protein-coupled receptor protein of the present invention include, for example, a cell line having the natural G protein-coupled receptor protein of the present invention (for example, mouse pancreatic β cell line MIN).
6), and the above-mentioned cell line expressing the recombinant G protein-coupled receptor protein and the like are desirable. As test compounds,
Examples include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like.These compounds may be novel compounds or known compounds. It may be.

The kit for screening a compound or a salt thereof that changes the binding property between the ligand and the G protein-coupled receptor protein of the present invention is a G protein-coupled receptor protein or a salt thereof, or a partial peptide of the G protein-coupled receptor protein. Or a salt thereof, a membrane fraction of a cell containing a G protein-coupled receptor protein, or a membrane fraction of a cell containing a G protein-coupled receptor protein, and a ligand polypeptide of the present invention. Examples of the screening kit of the present invention include the following. 1. Screening reagent Measurement buffer and washing buffer Hanks' Balanced Salt Solution (manufactured by Gibco)
One containing 05% bovine serum albumin (manufactured by Sigma). Sterilized by filtration through a 0.45 μm filter, 4 ° C
Or may be prepared at the time of use. G protein-coupled receptor sample CHO cells expressing the G protein-coupled receptor protein were subcultured on a 12-well plate at 5 × 10 ⁵ cells / well.
Cultured at 7 ° C., 5% CO ₂ , 95% air for 2 days. Labeled ligands Ligands labeled with commercially available [ ³ H], [ ¹²⁵ I], [ ¹⁴ C], [ ³⁵ S], etc. Dissolved in a suitable solvent or buffer solution and stored at 4 ° C. or −20 ° C. When used, dilute to 1 μM with the measurement buffer. Ligand standard solution 0.1% bovine serum albumin (Sigma)
And dissolved at 1 mM in PBS, and stored at -20 ° C.

2. Assay Method Cells washed on a 12-well tissue culture plate and expressing the G protein-coupled receptor protein are washed twice with 1 ml of the measurement buffer, and 490 μl of the measurement buffer is added to each well. After adding 5 μl of a test compound solution of 10 ⁻³ to 10 ⁻¹⁰ M, 5 μl of a labeled ligand is added, and the mixture is reacted at room temperature for 1 hour. To determine the amount of non-specific binding, 5 μl of 10 ⁻³ M ligand is added instead of the test compound. Remove the reaction solution and wash 3 times with 1 ml of washing buffer. The labeled ligand bound to the cells was 0.2N NaOH
1% SDS, 4 ml of liquid scintillator A
(Made by Wako Pure Chemical Industries). Liquid scintillation counter (Beckman)
Radioactivity was measured using Percent Maximum Binding
(PMB) is obtained by the following equation (Equation 1).

(Equation 1) PMB: Percent Maximum Binding B: Value at the time of adding the sample NSB: Non-specific Binding (non-specific binding amount) B ₀ : Maximum binding amount

The compound or a salt thereof obtained by using the screening method or the screening kit is a compound that alters the binding (inhibits or promotes the binding) between the ligand polypeptide of the present invention and the G protein-coupled receptor. Specifically, a compound having a cell stimulating activity via a G protein-coupled receptor or a salt thereof (a so-called G protein-coupled receptor agonist) or a compound having no such stimulating activity (a so-called G protein-coupled receptor antagonist) is there. Examples of the compound include a peptide, a protein, a non-peptidic compound, a synthetic compound, a fermentation product, and the like. These compounds may be novel compounds or known compounds. The G protein-coupled receptor agonist is G
Since it has the same action as the physiological activity of the ligand polypeptide for the protein-coupled receptor protein, it is useful as a safe and low-toxic drug according to the ligand activity. Conversely, a G protein-coupled receptor antagonist can suppress the physiological activity of a ligand polypeptide for a G protein-coupled receptor protein, and is therefore useful as a safe and low-toxic drug for suppressing the ligand activity. Since the ligand of the G protein-coupled receptor is involved in pituitary function regulating action, central nervous function regulating action or pancreatic function regulating action, the above-mentioned agonists or antagonists can be used, for example, in senile dementia, cerebrovascular dementia, Metamorphic degenerative metamorphic disease (eg:
Dementia caused by Alzheimer's disease, Parkinson's disease, Pick's disease, Huntington's disease, etc .; dementia caused by infectious diseases (eg, late-onset viral infections such as Creutzfeldt-Jakob disease); endocrine / metabolic / medium Dementia due to toxic diseases (eg, hypothyroidism, vitamin B12 deficiency, alcohol poisoning, poisoning with various drugs / metals / organic compounds, etc.), dementia due to neoplastic diseases (eg, brain tumors, etc.), traumatic diseases (Eg, chronic subdural hematoma)
Dementia due to dementia, depression, hyperactivity child (microbrain disorder) syndrome, consciousness disorder, anxiety disorder, schizophrenia, phobia, impaired growth hormone secretion (eg, giantosis, acromegaly, etc.), overeating Dysphagia, bulimia, hypercholesterolemia, hyperglyceridemia, hyperlipidemia, hyperprolactinemia, hypoglycemia, hypopituitarism, pituitary dwarfism, diabetes (eg:
Diabetic complications, diabetic nephropathy, diabetic neuropathy, diabetic retinopathy, etc.), cancer (eg, breast cancer, lymphocytic leukemia,
Bladder cancer, ovarian cancer, prostate cancer, etc., pancreatitis, kidney disease (eg:
Chronic renal failure, nephritis, etc.), Turner syndrome, neurosis, rheumatoid arthritis, spinal cord injury, transient ischemic attack, amyotrophic lateral sclerosis, acute myocardial infarction, spinocerebellar degeneration, fracture, wound, atopy It can be used as a therapeutic / prophylactic agent for diseases such as atopic dermatitis, osteoporosis, asthma, epilepsy, infertility and lactation deficiency. Furthermore, it can be used as a sedative-hypnotic, post-operative nutritional condition improver, vasopressor, antihypertensive and the like. When a compound or a salt thereof obtained by using the screening method or the screening kit is used as the above-mentioned medicine, it can be carried out in the same manner as when the ligand polypeptide of the present invention is used as a medicine.

(4) Production of Antibody or Antiserum Against the Ligand Polypeptide of the Present Invention
A polyclonal antibody, a monoclonal antibody) or an antiserum can be produced by using the ligand polypeptide as an antigen according to a known method for producing an antibody or an antiserum. For example, a polyclonal antibody or a monoclonal antibody can be produced according to the following method. (A) Preparation of polyclonal antibody The ligand polypeptide as an antigen is bound to a carrier protein. Examples of the carrier protein include bovine thyroglobulin, bovine serum albumin, bovine gamma globulin, hemocyanin, Freund's complete adjuvant (manufactured by Difco) and the like. The binding between the ligand polypeptide as the antigen and the carrier protein may be carried out by a known conventional means. Examples of the reagent used for the binding include glutaraldehyde and water-soluble carbodiimide. The use ratio of the ligand polypeptide as an antigen and the carrier protein is as follows:
About 1 to 1 to about 1 to 10 is suitable and the pH of the reaction
In many cases, near neutrality, particularly around 6 to 8 gives good results. The time required for the reaction is usually about 1 to 12 hours, but about 2 to 6 hours is particularly suitable. The composite thus prepared may be dialyzed against water at about 0 to about 18 ° C. by conventional means, and may be frozen and stored, or may be freeze-dried and stored. To produce polyclonal antibodies, a warm-blooded animal is inoculated with the immunogen produced as described above. Examples of warm-blooded animals used for the production of the antibody include warm-blooded mammals (eg, rabbits, sheep, goats, rats, mice, guinea pigs, cows, horses, pigs), birds (eg, chickens, pigeons, ducks) , Geese, quail) and the like. Immunogen,
As a method of inoculating a warm-blooded animal, the immunogen to be inoculated into the animal may be an effective amount for producing antibodies. For example, 1 mg of rabbit is emulsified with 1 ml of physiological saline and complete Freund's adjuvant at a time. 4 subcutaneously on the back and hind limbs
Antibodies are often produced when inoculated five times every week. As a method for collecting the antibody formed in the warm-blooded animal in this manner, for example, in rabbits, usually, from 7 to 12 days after the final inoculation, the antibody is collected from the ear vein and centrifuged to obtain serum. Can be The polyclonal antibody can be purified from the obtained antiserum by collecting the fraction adsorbed by affinity chromatography using a carrier holding each antigen peptide.

(B) Preparation of Monoclonal Antibody (a) Preparation of Monoclonal Antibody-Producing Cell The ligand polypeptide of the present invention is used alone or together with a carrier and a diluent at a site where the antibody can be produced by administration to a warm-blooded animal. Is administered. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every 2 to 6 weeks, about 2 to 10 times in total. Examples of the warm-blooded animal used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats, and chickens, and mice and rats are preferably used. When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization and contained in the spleen or lymph node. The monoclonal antibody-producing hybridoma can be prepared by fusing the antibody-producing cells thus obtained with myeloma cells of the same or different kinds of warm-blooded animals. The measurement of the antibody titer in the antiserum is performed, for example, by reacting a labeled polypeptide described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation can be performed by known methods, for example, the method of Kohler and Milstein [Nature, 2nd ed.
56, 495 (1975)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used. Examples of myeloma cells include NS-1, P3U
1, SP2 / 0, AP-1, etc., but P3U
1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is 1: 1 to 1
20: 1 and PEG (preferably PEG100
0 to PEG6000) at a concentration of about 10 to 80%, and at 20 to 40 ° C, preferably 30 to 37 ° C, 1 to 1%.
By incubating for 0 minutes, cell fusion can be performed efficiently. Various methods can be used to screen the anti-ligand polypeptide antibody-producing hybridoma. For example, the hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which the ligand polypeptide antigen is adsorbed directly or together with a carrier. Anti-immunoglobulin antibody (anti-mouse immunoglobulin antibody is used if the cells used for cell fusion are mice) or protein A, and an anti-ligand polypeptide monoclonal bound to the solid phase A method for detecting an antibody, adding a hybridoma culture supernatant to a solid phase to which an anti-immunoglobulin antibody or protein A is adsorbed, adding a ligand polypeptide labeled with a radioactive substance, an enzyme, or the like, How to detect peptide monoclonal antibodies And the like. Selection of the anti-ligand polypeptide monoclonal antibody can be performed according to a method known per se or a method analogous thereto. Usually, it is performed in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine). As a selection and breeding medium, any medium can be used as long as a hybridoma can grow.
For example, RPMI 1640 medium containing 1-20%, preferably 10-20% fetal bovine serum, GIT medium containing 1-10% fetal bovine serum (Wako Pure Chemical Industries, Ltd.) or serum-free for hybridoma culture Medium (SFM-101,
Nissui Pharmaceutical Co., Ltd.) can be used. The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The cultivation is usually performed under 5% carbon dioxide.
The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the anti-ligand polypeptide antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of the anti-ligand polypeptide monoclonal antibody can be carried out in the same manner as in the separation and purification of normal polyclonal antibodies, such as immunoglobulin separation and purification methods (eg, salting out method, alcohol precipitation method, isoelectric method, etc.). Spot precipitation, electrophoresis, ion exchanger (eg, D
EAE) adsorption / desorption method, ultracentrifugation method, gel filtration method, specific purification method in which an antibody alone is collected using an antigen-bound solid phase or an active adsorbent such as protein A or protein G and the bond is dissociated to obtain the antibody] It is performed according to. Since the antibody against the ligand polypeptide of the present invention produced according to the above methods (a) and (b) can specifically recognize the ligand polypeptide, the quantification of the ligand polypeptide in the test solution, particularly It can be used for quantification by sandwich immunoassay and the like. That is, the present invention provides, for example, (i) competitively reacting an antibody against the ligand polypeptide of the present invention, a test solution, and a labeled ligand polypeptide to form a labeled ligand polypeptide bound to the antibody. A method for quantifying a ligand polypeptide in a test solution, which comprises measuring the ratio,
(Ii) A test solution characterized by reacting a test solution with an antibody insolubilized on a carrier and a labeled antibody simultaneously or continuously, and then measuring the activity of a labeling agent on the insolubilized carrier. In the method for quantifying a ligand polypeptide therein, one antibody is an antibody that recognizes the N-terminus of the ligand polypeptide, and the other antibody is an antibody that reacts with the C-terminus of the ligand polypeptide. Provided is a method for quantifying a ligand polypeptide in a test solution.

The ligand polypeptide can be measured using a monoclonal antibody recognizing the ligand polypeptide of the present invention (hereinafter sometimes referred to as an anti-ligand polypeptide antibody), and the detection can be performed by tissue staining or the like. it can. For these purposes, the antibody molecule itself may be used, and F (ab ') ₂ , Fa
b ′ or Fab fraction may be used. The measurement method using the antibody of the present invention is not particularly limited, and the amount of the antibody, the antigen, or the antibody-antigen complex corresponding to the amount of the antigen (eg, the amount of the ligand polypeptide) in the liquid to be measured can be determined by chemical analysis. Alternatively, any measurement method may be used as long as it is detected by physical means and is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephelometry, competition method, immunometric method and sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use the sandwich method described later. Examples of the labeling agent used in the measurement method using a labeling substance include a radioisotope, an enzyme, a fluorescent substance, and a luminescent substance. As the radioisotope, for example, [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], [ ¹⁴ C] and the like are preferable, and as the above enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β -Glucosidase, alkaline phosphatase, peroxidase,
Malate dehydrogenase, etc., as fluorescent substances, fluorescamine, fluorescein isothiocyanate, etc.
Examples of the luminescent substance include luminol, luminol derivatives, luciferin, lucigenin, and the like. Furthermore, biotin-
Avidin systems can also be used.

For insolubilization of the antigen or antibody, a known method of physical adsorption may be used, or a known method of chemical bonding usually used for insolubilizing and immobilizing proteins or enzymes may be used. As the carrier, agarose, dextran, insoluble polysaccharides such as cellulose,
Examples include synthetic resins such as polystyrene, polyacrylamide, and silicon, and glass. In the sandwich method, a test solution is reacted with an insolubilized anti-ligand polypeptide antibody (primary reaction), and further a labeled anti-ligand polypeptide antibody is reacted (secondary reaction).
By measuring the activity of the labeling agent on the insolubilized carrier, the amount of the ligand polypeptide in the test solution can be determined. The primary and secondary reactions can be performed in reverse order,
It may be performed simultaneously or at a different time. The labeling agent and the method of insolubilization may be performed according to those described above. In the immunoassay by the sandwich method, the antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies is used for the purpose of improving measurement sensitivity and the like. You may. In the method for measuring a ligand polypeptide by the sandwich method, an anti-ligand polypeptide antibody used in the primary reaction and the secondary reaction is preferably an antibody having a different binding site of the ligand polypeptide.
That is, the antibody used in the primary reaction and the secondary reaction is preferably, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the ligand polypeptide, the antibody used in the primary reaction is preferably C An antibody that recognizes other than the end, for example, the N-end, is used.

The ligand polypeptide antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nephrometry. In the competition method, an antigen in a test solution and a labeled antigen are allowed to competitively react with an antibody, and then the unreacted labeled antigen is separated from (F) and the labeled antigen (B) bound to the antibody. (B / F separation), the labeling amount of either B or F was measured,
The amount of antigen in the test solution is quantified. In this reaction method, a liquid phase method using a soluble antibody as an antibody, B / F separation using polyethylene glycol, a second antibody against the antibody, or the like,
In addition, an immobilized antibody is used as the first antibody, or an immobilization method using a soluble first antibody and using the immobilized antibody as the second antibody is used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. Is reacted with an excess amount of the labeled antibody, and then the immobilized antigen is added to bind the unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated.
Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry utilizing laser scattering is preferably used.

In applying these individual immunological measurement methods to the measurement method of the present invention, no special conditions, operations, and the like need to be set. What is necessary is just to construct a measuring system of a ligand polypeptide by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews, books, and the like (for example, “Methods in ENZYMOL
OGY "Vol. 70 (Immunochemical Techniques (Part A)),
Ibid Vol. 73 (Immunochemical Techniques (Part B)),
Ibid Vol. 74 (Immunochemical Techniques (Part C)),
Ibid Vol. 84 (Immunochemical Techniques (Part D: Sele
cted Immunoassays)), ibid.Vol. 92 (Immunochemical
Techniques (Part E: Monoclonal Antibodies and Genera
l Immunoassay Methods)), ibid., Vol. 121 (Immunochem
ical Techniques (Part I: Hybridoma Technology and Mo
noclonal Antibodies)) (above, published by Academic Press). As described above, the ligand polypeptide can be quantified with high sensitivity by using the ligand polypeptide antibody of the present invention.

(5) Preparation of non-human transgenic mammal DNA containing the DNA encoding the ligand polypeptide of the present invention, or a mutant DNA thereof (hereinafter may be abbreviated as the mutant DNA of the present invention) may be used. A non-human transgenic mammal having the same. That is, the present invention provides (a) a non-human transgenic mammal having a DNA encoding the ligand polypeptide of the present invention or a mutant DNA thereof, and (b) the above-mentioned (a), wherein the non-human mammal is a rodent (C) the mammal according to the above (b), wherein the rodent is a mouse or a rat; and (d) a DNA encoding the ligand polypeptide of the present invention or a mutant DNA thereof.
And (e) a drug for gene therapy comprising (e) the recombinant vector described in (d) above.

The DNA encoding the ligand polypeptide in the present invention has a base sequence encoding a polypeptide containing the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 described above. It is a DNA containing DNA (hereinafter, sometimes abbreviated as the DNA of the present invention), and includes, for example, a DNA having a base sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3. In the present invention, the “mutant DNA” in the “DNA encoding the ligand polypeptide of the present invention or its mutant DNA” is a naturally occurring or artificial mutation in the nucleotide sequence of the DNA encoding the ligand polypeptide. That is, it means a DNA having a mutation such as substitution, deletion (deletion) or insertion (addition) of a base, and as a result of this mutation, the original DNA (unmutated DNA encoding the ligand polypeptide) is normal. Abnormal DN that does not function properly
A is also included. The abnormal DNA means a DNA that causes abnormal expression of the ligand peptide of the present invention,
For example, DNA that expresses a protein that suppresses the normal function of the ligand peptide of the present invention can be used.
To artificially mutate the DNA of the present invention, for example,
A part or all of the DNA sequence may be deleted, and another DNA may be inserted or replaced by a known genetic engineering technique. By these mutation treatments, for example, the reading frame of the codon of the DNA encoding the ligand polypeptide can be shifted or the function of the promoter or exon can be disrupted, and as a result, recombination with the genomic DNA can be caused. Thus, a targeting vector DNA for introducing a mutation can be prepared.
Non-human transgenic mammals having a DNA encoding the ligand polypeptide of the present invention or a mutant DNA thereof (hereinafter may be abbreviated as the transgenic animal of the present invention) include unfertilized eggs, fertilized eggs, sperm, The germinal cells containing the progenitor cells, etc. are preferably known at the stage of embryonic development in non-human mammal development (more preferably, at the stage of single cells or fertilized egg cells and generally before the 8-cell stage), respectively. DNA encoding a ligand polypeptide of interest or a mutant thereof (mutant DNA) is obtained by the calcium phosphate method, electric pulse method, lipofection method, agglutination method, microinjection method, particle gun method, DEAE-dextran method, or the like. Can be created by introducing into mammals Kill. In addition, the DNA of the present invention can be introduced into somatic cells, organs of living organisms, tissue cells, and the like by the DNA introduction method and used for cell culture, tissue culture, and the like. The non-human transgenic mammal of the present invention can also be produced by fusing cells with a cell fusion method known per se.

The non-human mammal includes, for example, bovine,
Pigs, sheep, goats, rabbits, dogs, cats, guinea pigs, hamsters, mice or rats. Above all, rodent mammals, which are relatively short in ontogeny and biological cycle in terms of preparation of diseased mammal model systems, and are easy to breed, especially mice (for example, C57BL / 6 strain, DBA2 strain, etc. as pure strains) , As crosses, _one B6C3F line, _one BDF line, B6D2F
_One strain, a BALB / c strain, an ICR strain, etc.) or a rat (eg, Wistar, SD, etc.) is preferred. The “mammal” in the “recombinant vector that can be expressed in mammals” includes humans in addition to the above-mentioned non-human mammals. The DNA of the present invention
May be derived from either the same or different mammal as the mammal to be introduced. The DN of the present invention
In order to introduce A into a target mammal, it is generally preferable to use the DNA by binding it downstream of a promoter capable of being expressed in mammalian cells. For example, the mouse-derived D of the present invention
When introducing NA, the DN of the present invention having a high homology to this is used.
DN derived from various mammals having A (eg, rabbits, dogs, cats, guinea pigs, hamsters, rats, etc.)
A DNA (DNA construct; for example, a vector) obtained by binding the mouse-derived DNA of the present invention downstream of various promoters capable of expressing A can be used to fertilize eggs of a target mammal, for example, mouse fertilized eggs by a known microinjection method or the like. A DNA-transfected mammal that highly expresses the DNA of the present invention can be produced.

Examples of the expression vector of the polypeptide of the present invention include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a bacteriophage such as phage λ, a retrovirus such as Moloney leukemia virus, a vaccinia virus or a baculovirus. And other mammalian viruses. Among them, a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis or a plasmid derived from yeast is preferably used. Examples of the promoter that regulates the expression of the DNA include promoters of DNA derived from viruses (eg, simian virus, cytomegalovirus, Moloney leukemia virus, JC virus, breast cancer virus, poliovirus, etc.), various mammals ( Those derived from humans, rabbits, dogs, cats, cats, guinea pigs, hamsters, rats, mice, etc. and birds (such as chickens) include albumin, insulin II, uroplakin II, elastase, erythropoietin, endothelin, muscle creatine kinase, glial fibrosis Acidic protein, glutathione S-transferase, platelet-derived growth factor β, keratins K1, K10 and K14, collagen types I and II, cyclic AMP-dependent protein kinase β
I subunit, dystrophin, tartrate-resistant alkaline phosphatase, atrial natriuretic factor, endothelial receptor tyrosine kinase (generally abbreviated as Tie2), sodium potassium adenosine 3 kinase (Na, K-ATPase), neurofilament light chain , Metallothioneins I and IIA, metalloproteinase 1 tissue inhibitors, MHC class I antigens (H-
2L), H-ras, renin, dopamine β-hydroxylase, thyroid peroxidase (TPO), polypeptide chain elongation factor 1α (EF-1α), β actin, α and β myosin heavy chains, myosin light chains 1 and 2 , Myelin basic protein, thyroglobulin, Thy-1, immunoglobulin, heavy chain variable region (VNP), serum amyloid P component, myoglobin, troponin C, smooth muscle α-actin, promoter such as preproenkephalin A, vasopressin and the like are used. But preferably a cytomegalovirus promoter capable of high expression throughout the body, human polypeptide chain elongation factor 1α (EF-1α)
, Human and chicken β-actin promoters and the like.

The vector preferably has a sequence (generally called terminator) that terminates transcription of the messenger RNA of interest in the mammal into which the DNA has been introduced. For example, the vector may be derived from a virus, derived from various mammals and birds. The sequence of each DNA can be used, and preferably, SV40 terminator of simian virus or the like is used. In addition, a splicing signal of each DNA, an enhancer region, a part of an intron of eukaryotic DNA, and the like are placed 5 'upstream of the promoter region, between the promoter region and the translation region, or 3' downstream of the translation region for the purpose of further expressing the target DNA. Alternatively, it is also possible to connect as needed. The normal translation region of the polypeptide of the present invention can be derived from liver, kidney, thyroid cell, fibroblast derived from various mammals (eg, rabbit, dog, cat, guinea pig, hamster, rat, mouse, human, etc.).
All or part of genomic DNA from NA and various commercially available genomic DNA libraries, or complementary DNA (cDNA) prepared by known methods from liver, kidney, thyroid cell, and fibroblast-derived RNA is obtained as a raw material. I can do it. Further, by using the abnormal DNA, it is possible to prepare a translation region obtained by mutating the normal translation region of the polypeptide obtained from the above cells or tissues by a known point mutagenesis method or the like. The translation region can be prepared as a DNA construct that can be expressed in the introduced mammal by ordinary DNA engineering techniques in which it is ligated downstream of the promoter and, if desired, upstream of the transcription termination site. Introduction of the DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target mammal.
The presence of the DNA of the present invention in the germinal cells of the produced mammal after the introduction of the DNA means that the progeny of the produced mammal, all of its germ cells and somatic cells,
It means to keep NA. Progeny of this type of mammal that has inherited the DNA have the DNA of the present invention in all of its germinal and somatic cells.

The non-human mammal into which the exogenous normal DNA of the present invention has been introduced can be subcultured in a normal breeding environment as a mammal having the DNA after confirming that the non-human mammal stably retains the DNA by mating. I can do it. Introduction of the DNA of the present invention at the fertilized egg cell stage ensures that the DNA is present in excess in all germinal and somatic cells of the target mammal.
Excessive presence of the DNA of the present invention in the germinal cells of the produced mammal after the introduction of the DNA indicates that all of the offspring of the produced mammal have the DN of the present invention in all of their germ cells and somatic cells.
It means having A in excess. Progeny of such mammals that have inherited the DNA will have an excess of the DNA of the present invention in all of their germinal and somatic cells. By obtaining a homozygous mammal having the introduced DNA on both homologous chromosomes, and crossing the male and female mammals, it is possible to breed subculture so that all progeny have the DNA in excess. The non-human mammal having the normal DNA of the present invention has a high level of expression of the normal DNA of the present invention, and eventually promotes the function of the endogenous normal DNA, so that the hyperactivity of the polypeptide of the present invention is finally increased. May occur, and can be used as a model mammal for the disease state. For example, using the normal DNA-transfected mammal of the present invention, elucidation of the hyperfunction of the polypeptide of the present invention and the pathological mechanism of diseases associated with the polypeptide of the present invention, and examination of treatment methods for these diseases. It is possible to do.
Further, since the mammal into which the exogenous normal DNA of the present invention has been introduced has an increased symptom of the released polypeptide of the present invention, it is also used for a screening test for a therapeutic drug for a disease associated with the polypeptide of the present invention. It is possible.

On the other hand, after confirming that the non-human mammal having the abnormal DNA of the present invention stably retains the DNA by mating, it can be subcultured as a mammal having the abnormal DNA in a normal breeding environment. I can do it. Furthermore, the purpose DN
A can be incorporated into the above-mentioned plasmid and used as a source substance. The DNA construct with the promoter can be prepared by a usual DNA engineering technique. Introduction of the abnormal DNA of the present invention at the fertilized egg cell stage is ensured to be present in all germ cells and somatic cells of the target mammal. The presence of the abnormal DNA of the present invention in the germinal cells of the produced mammal after DNA introduction means that all the offspring of the produced mammal have the abnormal DNA of the present invention in all of the germ cells and somatic cells. The progeny of this type of mammal that has inherited the DNA has the abnormal DNA of the present invention in all of its germinal and somatic cells. By obtaining a homozygous mammal having the introduced DNA on both homologous chromosomes, and crossing the male and female mammals, it is possible to breed so that all offspring have the DNA. The non-human mammal having the abnormal DNA of the present invention has a high level of expression of the abnormal DNA of the present invention, and eventually inhibits the function of the polypeptide of the present invention by inhibiting the function of endogenous normal DNA. It may be a type refractory disease and can be used as a model mammal for the disease state. For example, using the mammal having the abnormal DNA of the present invention, it is possible to elucidate the pathological mechanism of the function-inactive refractory of the polypeptide of the present invention and to examine a method for treating this disease. Also, as a specific possibility, the abnormal DNA overexpressing mammal of the present invention,
This is a model for elucidating the functional inhibition (dominant negative action) of the normal polypeptide by the abnormal polypeptide of the present invention in the function-inactive refractory state of the polypeptide of the present invention. In addition, since the mammal into which the foreign abnormal DNA of the present invention has been introduced has an increased symptom of the released polypeptide of the present invention, it is also used in a therapeutic drug screening test for a functionally inactive refractory disease of the polypeptide of the present invention. Available.

The other two uses of the above-described two kinds of the DNA-transfected mammals of the present invention include, for example, use as a cell source for tissue culture, and DNA or DNA in the tissues of the DNA-transfected mammal of the present invention. Analysis of the relevance to proteins specifically expressed or activated by the polypeptide of the present invention by directly analyzing RNA or analyzing protein tissues expressed by DNA, cells of tissue having DNA Is cultured using standard tissue culture techniques, and using these, studies on the function of cells from tissues that are generally difficult to culture, screening of drugs that enhance the function of cells by using the cells described above, and the present invention Isolation and purification of the mutant polypeptide and production of its antibody can be considered. Furthermore, using the DNA-transfected mammal of the present invention, it is possible to examine clinical symptoms of diseases related to the polypeptide of the present invention, including refractory inactive type of the polypeptide of the present invention. More detailed pathological findings in each organ of a disease model related to the polypeptide of the present invention can be obtained, which can contribute to the development of a new treatment method, and further to the study and treatment of a secondary disease caused by the disease. In addition, each organ is removed from the DNA-introduced mammal of the present invention, and after minced, obtaining a DNA-introduced cell released by a protease such as trypsin,
It is possible to carry out the culture or systematization of the cultured cells. Furthermore, it is possible to examine the specificity of the polypeptide-producing cell of the present invention, its relationship with apoptosis, differentiation or proliferation, or its signal transduction mechanism, and its abnormalities. It is an effective research material for elucidation. Furthermore, in order to develop a therapeutic agent for a disease associated with the polypeptide of the present invention, including the inactive refractory type of the polypeptide of the present invention, using the DNA-transfected mammal of the present invention, It is possible to provide an effective and rapid screening method for a therapeutic agent for the disease by using the method and the quantification method. In addition, using the DNA-transfected mammal of the present invention or the DNA expression vector of the present invention, it is possible to examine and develop a DNA treatment method for a disease associated with the polypeptide of the present invention.

(6) Preparation of Knockout Mammals Further, the present invention relates to non-human animal (preferably mammalian) cells (preferably embryonic stem cells) in which the DNA encoding the ligand polypeptide of the present invention has been inactivated. Non-human animal (preferably mammal) deficient in expression of the DNA of the present invention
(So-called knockout animals (preferably mammals))
I will provide a. That is, the present invention relates to (a) a non-human animal (preferably a mammal) cell (preferably an embryonic stem cell) carrying a DNA encoding an inactivated ligand polypeptide of the present invention; a cell (preferably an embryonic stem cell) according to the above (a) which is a cell having a β-galactosidase gene; (c) a cell according to the above (a) (preferably an embryonic stem cell) resistant to neomycin; (d) a non-human animal The cell (preferably embryonic stem cell) according to the above (a), wherein the (preferably mammal) is a rodent, the embryonic stem cell according to the above (d), wherein the rodent is a mouse,
(F) a non-human animal (preferably a mammal) deficient in expression of the DNA of the present invention;
(H) the animal (preferably mammal), wherein the reporter gene is a β-galactosidase gene derived from Escherichia coli;
(F) the non-human animal (preferably a mammal) is a rodent mammal; (j) the animal (i) wherein the rodent mammal is a mouse; (k) the (g) A method of screening for a compound or a salt thereof which promotes the promoter activity of the polypeptide of the present invention, which comprises administering a test compound to the mammal described above, and detecting the expression of a reporter gene. And (c) introducing a DNA encoding the ligand polypeptide of the present invention into a non-human animal (preferably mammalian) cell (preferably embryonic stem cell) and (m).
A method for producing a non-human animal (preferably mammalian) cell (preferably embryonic stem cell) according to the above (k), which comprises introducing a DNA encoding the inactivated ligand polypeptide of the present invention. I do.

The non-human animal (preferably mammalian) cells (preferably embryonic stem cells) in which the DNA encoding the ligand polypeptide of the present invention has been inactivated is defined as the DNA of the present invention that the non-human mammal has. By artificially adding a mutation to the DNA, the expression of the DNA is suppressed, or the activity of the polypeptide of the present invention encoded by the DNA is substantially lost. Non-human animal (preferably mammalian) cells (preferably embryonic stem cells (hereinafter abbreviated as ES cells)) that have substantially no peptide expression ability (hereinafter sometimes referred to as the knockout DNA of the present invention) ]. Examples of the non-human mammal include the same ones as described above. In order to artificially add a mutation to the DNA of the present invention, for example, a part or all of the DNA base sequence may be deleted, and another DNA may be inserted or substituted by a known genetic engineering technique. By these mutations, the knockout DNA of the present invention can be produced, for example, by shifting the reading frame of codons in the DNA encoding the ligand polypeptide or disrupting the function of the promoter or exon. Non-human animal (preferably mammalian) cells (preferably embryonic stem cells) in which the DNA of the present invention has been inactivated (hereinafter referred to as non-human mammalian embryonic stem cells of the present invention)
The inactivated ES cell or the knockout ES cell of the present invention is specifically described as, for example, (1) the D non-human animal (preferably mammal) of the present invention which
NA is isolated and its exon portion is a known drug resistance gene represented by a neomycin resistance gene or a hygromycin resistance gene, or lacZ (β-galactosidase gene) or cat (a chloramphenicol acetyltransferase gene). The exon function is destroyed by inserting a reporter gene or the like, or (2) a DNA sequence (for example, a polyA addition signal) that terminates the transcription of the gene is inserted into the intron portion between the exons to complete the messenger RNA.
, A DNA strand (hereinafter abbreviated as a targeting vector) containing a DNA sequence constructed so as to destroy DNA (gene) encoding the ligand polypeptide of the present invention as a result, For example, it is introduced into the chromosome of the animal (preferably a mammal) by a known homologous recombination method, and the obtained ES cells are subjected to Southern hybridization analysis or targeting vector using the DNA sequence on or near the DNA of the present invention as a probe. It can be obtained by analyzing and selecting by a PCR method using the above DNA sequence and the DNA sequence of the neighboring region other than the DNA of the present invention used for the preparation of the targeting vector as primers.

Further, the DN of the present invention may be
As the original ES cells that inactivate A, for example, the above-mentioned established ES cells may be used, or a known method [Robertson, ET, Teratocarcinomas and
Embryonic Stem Cells: A Practical Approach (ed.
EJ Robertson), IBL Press, Oxford., Etc.]. For example, in the case of mouse ES cells, currently, 129 line ES cells are generally used. However, since the immunological background is not clear, a pure line instead of this is used as an immunological genetic background. For example, to obtain ES cells in which C57BL is known, for example, C57BL
/ A mouse and the low number of eggs collected by C57BL / 6
BDF1 mice (C57B
L / 6 and cells F ₁₎ were established using the DBA / 2, etc. is also preferably used. BDF ₁ mice have the advantage of high egg collection and robust eggs,
Since a 7BL / 6 mouse is used as a background, ES cells obtained using the same can be used to generate C5
It is advantageously used in that the genetic background can be replaced by C57BL / 6 mice by backcrossing with 7BL / 6 mice. When ES cells are established, blastocysts 3.5 days after fertilization are generally used.
In addition, a large number of early embryos can be obtained efficiently by collecting and culturing the 8-cell stage embryos up to the blastocysts. Further, either male or female ES cells may be used,
Usually, male ES cells are preferred for generating germline chimeras. It is also desirable to discriminate between males and females as soon as possible in order to reduce cumbersome culture labor.
As a method for determining the sex of ES cells, for example,
Amplify the sex determining region gene on Y chromosome by CR method,
The detection method can be cited as an example.
If this method is used, it is conventionally necessary to perform about one karyotype analysis.
Against 0 G-banding method, requires ^six cell number, since suffices ES cell number of about 1 colony (about 50), be performed the first selection of ES cells at the early stage of culture on sex identification It is possible, and by enabling the selection of male cells at an early stage, the labor at the initial stage of culture can be greatly reduced.

The secondary selection can be performed, for example, by confirming the number of chromosomes by a known G-banding method. The number of chromosomes in the obtained ES cells is desirably 100% of the normal number. However, when it is difficult due to physical operations or the like at the time of establishment, after knocking out the gene of the ES cells, the cells can be knocked out of normal cells (for example, chromosome in mice). It is preferred to clone again into cells with a number of 2n = 40). The embryonic stem cell line obtained in this way usually has a very good proliferation property, but it is liable to lose its ontogenic ability, so that it must be carefully subcultured.
For example, on a suitable feeder cell such as STO fibroblast, in the presence of LIF (1-10000 U / ml) in a carbon dioxide incubator (preferably 5% carbon dioxide, 95% air or 5% oxygen, 5% The cells are cultured by a method such as culturing at about 37 ° C. in carbon dioxide gas and 90% air. At the time of subculture, for example, trypsin / EDTA solution (usually 0.001-0.5% trypsin / 0.1-5 mM EDTA, Preferably about 0.1
% Trypsin / 1 mM EDTA), and seeding on freshly prepared feeder cells. Such passage is usually performed every 1 to 3 days. At this time, it is desirable to observe the cells and, if any morphologically abnormal cells are found, discard the cultured cells. ES cells are differentiated into various types of cells, such as parietal, visceral, and cardiac muscles, by monolayer culture up to high density or suspension culture until cell clumps are formed under appropriate conditions. (M.
J. Evans and MH Kaufman, Nature
292, 154, 1981; GR Martin Proceedings of National Academy of Science USA (Proc. Natl. Acad. Sci. USA)
78, 7634, 1981; TC Doetschman et al., Journal of Embryology and Experimental Morphology, 87, 27, 1985], obtained by differentiating the ES cells of the present invention. The cells deficient in expressing the DNA of the present invention are useful in in vitro cell biology of the polypeptide of the present invention. D of the present invention
Non-human animals deficient in NA expression (preferably mammals) can be distinguished from normal mammals by measuring the mRNA level of the mammal using known methods and comparing the expression levels indirectly. It is. As the non-human mammal, those similar to the aforementioned can be used.

The DNA-deficient non-human animal (preferably mammal) of the present invention can be obtained, for example, by introducing the targeting vector prepared as described above into a mouse embryonic stem cell or mouse egg cell, By knocking out the DNA of the present invention by homologous recombination in which the DNA inactivated DNA sequence replaces the DNA of the present invention on the chromosome of mouse embryonic stem cells or mouse egg cells by gene homologous recombination, ). Cells in which the DNA of the present invention has been knocked out can be analyzed by Southern hybridization analysis using a DNA sequence on or near the DNA of the present invention as a probe, or a DNA on a targeting vector.
The determination can be made by PCR analysis using the NA sequence and the DNA sequence of the neighboring region other than the DNA of the present invention derived from the mouse used for the targeting vector as primers. When a non-human mammalian embryonic stem cell is used, a cell line in which the DNA of the present invention has been inactivated by gene homologous recombination is cloned, and the cell is cultured at an appropriate time, for example, at the 8-cell stage of a non-human mammalian stem cell. The chimeric embryo is injected into an animal embryo or a blastocyst, and the produced chimeric embryo is transplanted into the uterus of the pseudopregnant non-human mammal. The produced mammal is a cell having a normal DNA locus of the present invention and a DN of the present invention artificially mutated.
It is a chimeric mammal composed of both cells having the A locus. When a part of the germ cells of the chimeric mammal has the mutated DNA locus of the present invention, all tissues are artificially mutated from the population obtained by crossing such a chimeric individual with a normal individual. Can be obtained by, for example, selecting an individual composed of cells having the DNA locus of the present invention, to which a coat color has been added. The individual thus obtained is usually an individual heterozygously deficient in expression of the polypeptide of the present invention, and mated with an individual heterozygously deficient in expression of the polypeptide of the present invention. Can be obtained.
When an egg cell is used, for example, a transgenic non-human mammal having a targeting vector introduced into a chromosome can be obtained by injecting a DNA solution into an egg cell nucleus by a known microinjection method, and gene homologous recombination can be performed. Thus, those having a mutation in the DNA locus of the present invention can be selected.

In the individual in which the DNA of the present invention has been knocked out in this manner, the mammalian individual obtained by mating is confirmed to have knocked out the DNA, and then subcultured in a normal breeding environment. Can do it.
Furthermore, the acquisition and maintenance of the germ line may be performed according to a conventional method. That is, by mating male and female mammals having the inactivated DNA, a homozygous mammal having the inactivated DNA on both homologous chromosomes can be obtained.
The obtained homozygote mammal can be efficiently obtained by rearing the mother mammal in such a manner that one normal individual and one or more homozygote are obtained. By mating male and female heterozygous mammals,
Homozygous and heterozygous mammals having the inactivated DNA are bred and passaged. Non-human animal (preferably mammalian) cells (preferably embryonic stem cells) in which the DNA of the present invention has been inactivated are very important in producing a non-human animal (preferably mammal) deficient in expressing the DNA of the present invention. Useful for Further, since the mouse deficient in expression of the polypeptide of the present invention lacks various biological activities that can be induced by the polypeptide of the present invention, a model of a disease caused by inactivation of the biological activity of the polypeptide of the present invention. It is useful for investigating the cause of these diseases and studying treatment methods.

In an animal (preferably a mammal) expressing the polypeptide of the present invention in which the structural gene of the polypeptide of the present invention is replaced with a reporter gene, the reporter gene is present under the control of the promoter of the polypeptide of the present invention. Therefore, by tracing the expression of the substance encoded by the reporter gene, the activity of the promoter of the polypeptide of the present invention can be detected. For example, when a part of the DNA region encoding the polypeptide of the present invention is replaced with a β-galactosidase gene (lacZ) derived from Escherichia coli, the tissue expressing the polypeptide of the present invention originally should Β-galactosidase is expressed instead of the peptide. Therefore, for example, the present invention can be easily performed by staining with a reagent serving as a substrate for β-galactosidase such as 5-bromo-4-chloro-3-indolyl-β-galactopyranoside (X-gal). Of the polypeptide in vivo in a mammal can be observed. Specifically, the polypeptide-deficient mouse of the present invention or a tissue section thereof is fixed with glutaraldehyde or the like, and then added to Dulbecco's phosphate buffered saline (P
BS), and reacted with a staining solution containing X-gal at room temperature or around 7 ° C. for about 30 minutes to 1 hour. Then, the tissue specimen was washed with a 1 mM EDTA / PBS solution to obtain β-galactosidase. The reaction may be stopped and the color may be observed. Further, mRNA encoding lacZ may be detected according to a conventional method. Such a mammal deficient in expression of the polypeptide of the present invention is extremely useful for screening for a substance that activates or inactivates the promoter of the polypeptide of the present invention. It can greatly contribute to investigating the cause of a disease or developing a therapeutic drug.

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the full-length amino acid sequence of the mouse-derived ligand polypeptide contained in plasmid pmGB3. [SEQ ID NO: 2] mouse-derived ligand polypeptide c
1 shows the entire nucleotide sequence of DNA. [SEQ ID NO: 3] This shows the base sequence of genomic DNA of mouse-derived ligand polypeptide. [SEQ ID NO: 4] This shows the full-length amino acid sequence of the mature form of the mouse-derived ligand polypeptide contained in plasmid pmGB3. [SEQ ID NO: 5] This shows the amino acid sequence of an antigen that can be used for preparing the anti-ligand polypeptide antibody of the present invention. [SEQ ID NO: 6] This shows the amino acid sequence of the antigen that can be used for preparing the anti-ligand polypeptide antibody of the present invention. [SEQ ID NO: 7] This shows the amino acid sequence of an antigen that can be used for preparing the anti-ligand polypeptide antibody of the present invention. [SEQ ID NO: 8] This shows the amino acid sequence of the antigen which can be used for preparing the anti-ligand polypeptide antibody of the present invention. [SEQ ID NO: 9] This shows the amino acid sequence of the antigen which can be used for preparing the anti-ligand polypeptide antibody of the present invention. [SEQ ID NO: 10] This shows the partial amino acid sequence of human pituitary G protein-coupled receptor protein encoded by the human pituitary G protein-coupled receptor protein cDNA fragment contained in p19P2. [SEQ ID NO: 11] This shows the partial amino acid sequence of the human pituitary G protein-coupled receptor protein encoded by the human pituitary G protein-coupled receptor protein cDNA fragment contained in p19P2. [SEQ ID NO: 12] This shows the entire amino acid sequence of human pituitary G protein-coupled receptor protein encoded by human pituitary G protein-coupled receptor protein cDNA contained in phGR3. [SEQ ID NO: 13] Mouse having a nucleotide sequence (SEQ ID NO: 18) derived from the nucleotide sequence of a G protein-coupled receptor protein cDNA fragment derived from mouse pancreatic β cell line MIN6 contained in pG3-2 and pG1-10, respectively Mouse pancreatic β cell line M encoded by cDNA fragment of G protein-coupled receptor protein derived from pancreatic β cell line MIN6
1 shows a partial amino acid sequence of an IN6-derived G protein-coupled receptor protein. [SEQ ID NO: 14] This shows the partial amino acid sequence of G protein-coupled receptor protein derived from mouse pancreatic β cell line MIN6-encoded by p5S38. [SEQ ID NO: 15] This shows the base sequence of human pituitary G protein-coupled receptor protein cDNA fragment contained in p19P2. [SEQ ID NO: 16] This shows the base sequence of human pituitary G protein-coupled receptor protein cDNA fragment contained in p19P2. [SEQ ID NO: 17] This shows the entire base sequence of human pituitary-derived G protein-coupled receptor protein cDNA contained in phGR3. [SEQ ID NO: 18] G protein derived from mouse pancreatic β cell line MIN6 derived from mouse pancreatic β cell line MIN6-derived G protein-coupled receptor protein cDNA fragment cDNA fragment contained in pG3-2 and pG1-10, respectively 1 shows the nucleotide sequence of a cDNA fragment of a coupled receptor protein. [SEQ ID NO: 19] Mouse pancreas β contained in p5S38
Cell line MIN6-derived G protein-coupled receptor protein c
1 shows the nucleotide sequence of a DNA fragment. [SEQ ID NO: 20] Synthetic D used for screening cDNA encoding G protein-coupled receptor protein
NA [SEQ ID NO: 21] Synthetic D used for screening cDNA encoding G protein-coupled receptor protein
NA [SEQ ID NO: 22] Synthetic D used for screening cDNA encoding G protein-coupled receptor protein
NA [SEQ ID NO: 23] Synthetic D used for screening cDNA encoding G protein-coupled receptor protein
NA [SEQ ID NO: 24] Synthetic D used for screening cDNA encoding G protein-coupled receptor protein
NA [SEQ ID NO: 25] Synthetic D used for screening cDNA encoding G protein-coupled receptor protein
NA [SEQ ID NO: 26] This shows the amino acid sequence obtained by purifying bovine hypothalamus-derived ligand polypeptide and analyzing the N-terminal sequence of P-3 fraction. 23rd to 5th of SEQ ID NO: 1
It corresponds to the first amino acid sequence. [SEQ ID NO: 27] This shows the amino acid sequence obtained by purifying bovine hypothalamus-derived ligand polypeptide and analyzing the N-terminal sequence of P-2 fraction. 34th to 52nd of SEQ ID NO: 1
It corresponds to the amino acid sequence of the th. [SEQ ID NO: 28] This shows the full length amino acid sequence of bovine hypothalamus-derived ligand polypeptide contained in pBOV3. [SEQ ID NO: 29] Synthetic DNA (P5-1) used for screening of cDNA encoding the bovine hypothalamus-derived ligand polypeptide of the present invention [SEQ ID NO: 30] Encoding bovine hypothalamic-derived polyligand polypeptide of the present invention DNA (P3-1) [SEQ ID NO: 31] Synthetic DNA (P3-2) used for screening cDNA encoding the bovine hypothalamus-derived ligand polypeptide of the present invention [SEQ ID NO: 31] 32] Synthetic DNA (PE) used for screening cDNA encoding the bovine hypothalamus-derived ligand polypeptide of the present invention [SEQ ID NO: 33] Used for screening cDNA encoding the bovine hypothalamic-derived ligand polypeptide of the present invention Synthetic DNA (PDN) [SEQ ID NO: 34] Synthetic DNA (FB) used for screening cDNA encoding bovine hypothalamus-derived ligand polypeptide of the present invention [SEQ ID NO: 35] Synthetic DNA used for screening cDNA encoding bovine hypothalamic-derived ligand polypeptide of the present invention (FC) [SEQ ID NO: 36] Synthetic DNA (BOVF) used for screening cDNA encoding bovine hypothalamus-derived ligand polypeptide of the present invention [SEQ ID NO: 37] Bovine hypothalamic-derived ligand polypeptide of the present invention Synthetic DNA (BOVR) used for screening of the encoding cDNA [SEQ ID NO: 38] This shows the full length amino acid sequence of the bovine genome-derived ligand polypeptide. [SEQ ID NO: 39] This shows the amino acid sequence of bovine hypothalamus-derived ligand polypeptide. 23rd to 5th of SEQ ID NO: 1
It corresponds to the third amino acid sequence. [SEQ ID NO: 40] This shows the amino acid sequence of bovine hypothalamus-derived ligand polypeptide. 23rd to 5th of SEQ ID NO: 1
It corresponds to the fourth amino acid sequence. [SEQ ID NO: 41] This shows the amino acid sequence of bovine hypothalamus-derived ligand polypeptide. 23rd to 5th of SEQ ID NO: 1
This corresponds to the fifth amino acid sequence. [SEQ ID NO: 42] This shows the amino acid sequence of bovine hypothalamus-derived ligand polypeptide. 34th to 5th of SEQ ID NO: 1
It corresponds to the third amino acid sequence. [SEQ ID NO: 43] This shows the amino acid sequence of bovine hypothalamus-derived ligand polypeptide. 34th to 5th of SEQ ID NO: 1
It corresponds to the fourth amino acid sequence. [SEQ ID NO: 44] This shows the amino acid sequence of bovine hypothalamus-derived ligand polypeptide. 34th to 5th of SEQ ID NO: 1
This corresponds to the fifth amino acid sequence. [SEQ ID NO: 45] Synthetic DNA (RA) used for screening cDNA encoding rat-type ligand polypeptide of the present invention [SEQ ID NO: 46] Used for screening cDNA encoding rat-type ligand polypeptide of the present invention Synthetic DNA (RC) [SEQ ID NO: 47] Synthetic DNA (rF) used for screening of cDNA encoding rat-type ligand polypeptide of the present invention [SEQ ID NO: 48] Encoding rat-type ligand polypeptide of the present invention Synthetic DNA (rR) used for screening of cDNA to be synthesized [SEQ ID NO: 49] Synthetic DNA (R1) used for screening of cDNA encoding human type ligand polypeptide of the present invention [SEQ ID NO: 50] Human of the present invention CDNA encoding the type ligand polypeptide Synthetic DNA (R3) used for cleaning [SEQ ID NO: 51] Synthetic DNA (R4) used for screening of cDNA encoding the human ligand polypeptide of the present invention [SEQ ID NO: 52] Human ligand ligand of the present invention Synthetic DNA (HA) used for screening cDNA encoding peptide [SEQ ID NO: 53] Synthetic DNA (HB) used for screening cDNA encoding human ligand polypeptide of the present invention [SEQ ID NO: 54] Synthetic DNA (HE) used for screening of cDNA encoding the human ligand polypeptide of the invention [HE] [SEQ ID NO: 55] Synthetic DNA (HF) used for screening of cDNA encoding the human ligand polypeptide of the present invention [HE] SEQ ID NO: 56] Human ligand of the present invention Synthetic DNA (5H) used for screening of cDNA encoding repeptide [SEQ ID NO: 57] Synthetic DNA (3HN) used for screening of cDNA encoding human ligand polypeptide of the present invention [SEQ ID NO: 58] Bovine 1 shows the entire nucleotide sequence of hypothalamus-derived ligand polypeptide cDNA. [SEQ ID NO: 59] rat type ligand polypeptide cD
1 shows the entire nucleotide sequence of NA. [SEQ ID NO: 60] Human ligand polypeptide cDN
1 shows the entire nucleotide sequence of A. [SEQ ID NO: 61] This shows the synthetic DNA (rFBG) used for screening of cDNA encoding mouse-type ligand polypeptide of the present invention. [SEQ ID NO: 62] This shows the synthetic DNA (rRSA) used for screening of cDNA encoding mouse-type ligand polypeptide of the present invention.

The transformant Escherichia coli INVαF ′ / p obtained in Example 2 described below was used.
19P2 and the transformant Escherichia coli INVαF ′ / pG3- obtained in Example 4
No. 2 were deposited on August 9, 1994 with the Ministry of International Trade and Industry at the National Institute of Advanced Industrial Science and Technology (NIBH) under deposit numbers FERM BP-4776 and FERM BP, respectively.
-4775, and August 2, 1994
From the 2nd IF to the Institute of Fermentation (IFO)
O15739 and IFO15740. The transformant Escherichia coli JM109 / phG obtained in Example 5 described later.
R3 was deposited on September 27, 1994 with the Ministry of International Trade and Industry at the National Institute of Advanced Industrial Science and Technology (NIBH).
MBP-4807, and
To the Fermentation Research Institute (IFO) from September 22, 2015
It has been deposited as O 15748. Example 8 to be described later
Escherichia coli transformed with Escherichi
a.) JM109 / p5S38 was purchased from October 2, 1994.
It has been deposited with the National Institute of Advanced Industrial Science and Technology (NIBH) as the deposit number FERM BP-4856 from 7th, and the IFO has been deposited with the Fermentation Research Institute (IFO) since October 25, 1994. No. 15754. The transformant Escherichia coli JM109 obtained in Example 20 described later.
/ PBOV3 has been deposited with the National Institute of Advanced Industrial Science and Technology (NIBH) under the deposit number FERM BP-5391 since February 13, 1996, and from January 25, 1996. Corporate Fermentation Research Institute (IF
O) and deposited as IFO 15910. The transformant Escherichia coli JM109 / pRAV3 obtained in Example 29 described below was deposited on September 12, 1996 with the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH) under the deposit number FERM. BP-5
665 and deposited with the Fermentation Research Institute (IFO) on September 3, 1996.
Has been deposited as The transformant Escherichia coli JM obtained in Example 32 described later.
109 / pHOV7 has been deposited with the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH) under the deposit number FERM BP-5666 from September 12, 1996, and from September 5, 1996. Fermentation Research Institute (I
FO) as IFO 16013. The transformant Escherichia coli JM109 / pmGB3 obtained in Example 33 to be described later was deposited on March 5, 1997 with the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology (NIBH) under the deposit number FERM. BP-5
852, and from February 19, 1997 to the Fermentation Research Institute (IFO).
9 has been deposited. The transformant Escherichia coli J obtained in Example 34 described later is used.
M109 / pmGFE1 has been available on March 18, 1998 from the National Institute of Advanced Industrial Science and Technology
H) has been deposited under accession number FERM BP-6298.

[0075]

The present invention will be described in more detail with reference to the following Examples, which do not limit the scope of the present invention.

[0076]

[Reference Example 1] Production of synthetic DNA primer for amplifying DNA encoding G protein-coupled receptor protein Known human-derived TRH receptor protein (HTHR)
R), human-derived RANTES receptor protein (L10
918, HUMRANTES), a human Burkitt lymphoma-derived ligand unknown receptor protein (X68149,
HSBLR1A), human-derived somatostatin receptor protein (L14856, HUMSOMAT), rat-derived μ-opioid receptor protein (U02083, R
NU02083), rat-derived κ-opioid receptor protein (U00442, U00442), human-derived neuromedin B receptor protein (M73482, HU
MNMBR), human-derived muscarinic acetylcholine receptor protein (X15266, HSHM4), rat-derived adrenergic α ₁ B receptor protein (L08
609, RATAADRE01), human-derived somatostatin 3 receptor protein (M9688, HUMSST)
R3X), human-derived C ₅ a receptor protein (HUMC
5AAR), human-derived ligand unknown receptor protein (HUMRDC1A), human-derived ligand unknown receptor protein (M84605, HUMOPIODRE) and rat-derived adrenaline α ₂ B (M91466, RA
The nucleotide sequence of the cDNA encoding the amino acid sequence near the first transmembrane region of TA2BAR) was compared, and a portion with high similarity was found.

Further, a known mouse-derived ligand unknown receptor protein (M80481, MUSGIR) and a human-derived bombezin receptor protein (L08893, HUM)
BOMB3S), human-derived adenosine A2 receptor protein (S46950, S46950), mouse-derived ligand unknown receptor protein (D21061, MUSGP)
CR), a mouse-derived TRH receptor protein (S433)
87, S43387), rat-derived neuromedin K receptor protein (J05189, RATNEURA),
Rat derived adenosine A1 receptor protein (M690
45, RATA1ARA), human-derived neurokinin A
Receptor protein (M57414, HUMNEKA
R), rat-derived adenosine A3 receptor protein (M
94152, RATADENREC), human somatostatin 1 receptor protein (M81829, HUMS)
RI1A), human-derived neurokinin 3 receptor protein (S86390, S86371S4), rat-derived ligand unknown receptor protein (X61496, RNCG)
PCR), human-derived somatostatin 4 receptor protein (L07061, HUMSSTR4Z) and rat-derived GnRH receptor protein (M31670, RATG)
The nucleotide sequence of cDNA encoding the amino acid sequence near the sixth transmembrane region of NRHA) was compared, and a portion with high similarity was found.

Abbreviations in parentheses above are DNASIS Gene / Prot.
GenBank / EMBL Da using ein sequence database (CD019, Hitachi Software Engineering)
It is a reference number shown when searching for ta Bank, and is usually called an Accession Number and an entry name, respectively. However, HTRHR is disclosed in JP-A-7-3
No. 04797. In particular, the introduction of mixed bases was planned in order to enhance the sequence matching with as many receptor cDNAs as possible in other portions, based on the base portion that matches in cDNAs encoding many receptor proteins. Based on this sequence, two synthetic DNAs having a base sequence represented by SEQ ID NO: 20 or SEQ ID NO: 21 complementary to the common base sequence were prepared. [Synthetic DNA] 5′-CGTGG (G or C) C (A or C) T (G or C) (G or C) TGGGCAAC (A, G, C or T) (C or T) CCTG-3 ′ ( SEQ ID NO: 20) 5'-GT (A, G, C or T) G (A or T) (A or G) (A or G) GGCA (A, G, C or T) CCAGCAGA (G or T) GGCA AA-3 '(SEQ ID NO: 21) Parentheses are mixed with a plurality of bases during synthesis.

[0079]

Example 1 Amplification of Receptor cDNA by PCR Using Human Pituitary Derived cDNA PCR using human pituitary derived cDNA (QuickClone, Clontech) as a template and the DNA primer synthesized in Reference Example 1 Was performed. The composition of the reaction solution was 1 μM each of synthetic DNA primers (sequence: 5 ′ primer sequence and 3 ′ primer sequence), template cDN
A 1 ng, 0.25 mM dNTPs, Taq DNA
With 1 μl of polymerase and the buffer attached to the enzyme,
The total reaction solution volume was 100 μl. The cycle for amplification was carried out using a thermal cycler (Perkin Elmer), and a cycle of 95 ° C. for 1 minute, 55 ° C. for 1 minute, and 72 ° C. for 1 minute was repeated 30 times. Taq DNA polymerase
Mix the remaining reaction mixture before adding
For 5 minutes at 65 ° C. Confirmation of the amplification product was performed by 1.2% agarose gel electrophoresis and ethidium bromide staining.

[0080]

Example 2 Subcloning of PCR product into plasmid vector and selection of novel receptor protein candidate clone by decoding base sequence of inserted cDNA portion Reaction product after PCR performed in Example 1 was 0.8% low melting point agarose Separation was performed using a gel, and the band was cut out with a razor, followed by heat melting, phenol extraction, and ethanol precipitation to recover DNA. The recovered DNA was subcloned into a plasmid vector pCR ^™ II (TM means a registered trademark) according to the recipe of TA Cloning Kit (Invitrogen). This was introduced into Escherichia coli INVαF 'competent cell (Invitrogen) for transformation, and clones having cDNA inserts were selected in LB agar medium containing ampicillin and X-gal, and only white clones were sterilized. The resulting mixture was separated using a toothpick to obtain a transformant Escherichia coli INVαF ′ / p19P2. Individual clones were cultured overnight in an LB medium containing ampicillin, and plasmid DNA was prepared using an automatic plasmid extractor (Kurabo). A portion of the prepared DNA was digested with EcoRI to confirm the size of the inserted cDNA fragment. A part of the remaining DNA was further treated with RNase, extracted with phenol / chloroform, and concentrated by ethanol precipitation. The reaction for base sequence determination is DyeDeoxy Terminator Cycle Seq
Using a uencing Kit (ABI), decoding was performed using a fluorescent automatic sequencer, and the obtained nucleotide sequence information was obtained using DNASIS (Hitachi System Engineering). The underlined portion corresponds to the synthetic primer. The determined nucleotide sequence [SEQ ID NO: 15
As a result of performing a homology search based on (base sequence obtained by removing the underlined portion from the base sequence in FIG. 1) and SEQ ID NO: 16 (base sequence obtained by removing the underlined portion from the base sequence in FIG. 2), the transformant was obtained. E. Coli INVαF '/ p19P
2 inserted into plasmid p19P2
The A fragment was found to encode a novel G protein-coupled receptor protein. To confirm it further, D
The nucleotide sequence was converted to an amino acid sequence using NASIS (Hitachi System Engineering Co., Ltd.) [SEQ ID NO: 1
0 (amino acid sequence obtained by removing the underlined portion from the amino acid sequence of FIG. 1) and SEQ ID NO: 11 (amino acid sequence obtained by removing the underlined portion from the amino acid sequence of FIG. 2)]. A homology search based on the hydrophobicity plot (FIGS. 3 and 4) and the amino acid sequence was performed to find homology with the neuropeptide Y receptor and the like (FIG. 5).

[0081]

Example 3 Poly from mouse pancreatic β cell line MIN6
(A) ⁺ RNA fraction preparation and cDNA synthesis Mouse pancreatic β cell line MIN6 (Jun-ichi Miyazaki et al.
Endocrinology, Vol.127, No.1, p126-132), after preparing total RNA by the guanidine isothiocyanate method (Kaplan BB et al., Biochem. J. 183, 181-184)
(1979)) and a poly (A) ⁺ RNA fraction was prepared using an mRNA purification kit (Pharmacia). Then, poly
(A) Random D as primer for 5 μg of ⁺ RNA fraction
NA hexamer (BRL) was added, and complementary DNA was synthesized with Moroni murine leukemia virus reverse transcriptase (BRL) using the attached buffer. The product after the reaction was extracted with phenol: chloroform (1: 1), precipitated with ethanol, and then dissolved in 30 μl of TE.

[0082]

Example 4 Amplification of Receptor cDNA by PCR Using MIN6-Derived cDNA and Determination of Base Sequence cD prepared from mouse pancreatic β cell line MIN6 in Example 3
Using 5 μl of NA as a template, PCR was performed under the same conditions as in Example 1 using the DNA primers synthesized in Reference Example 1. The obtained PCR product was subcloned into a plasmid vector pCR ^™ II in the same manner as described in Example 2 to obtain a plasmid pG3-2. Escherichia coli INVαF ′ is transformed with this plasmid, and the transformant Escherichia coli INVαF ′ is transformed.
/ PG3-2. In addition, mouse pancreatic β cell line MIN6
Using 5 μl of the prepared cDNA as a template, Lib
(Science 244: 569-572, 1989), ie, 5'-CTGTG (C or T) G (C or T) (G or C) AT (C or C) T) GCIIT (G or T) GA (C or T) (A or C) G (G or C) TAC-3 ′ (SEQ ID NO: 22) [I represents inosine. And 5′-A (G or T) G (A or T) AG (A or T) AGGGCAGC CAGCAGAI (G or C) (A or G) (C or T) GAA-3 ′ (SEQ ID NO: 23) [I represents inosine. PCR was performed under the same conditions as in Example 1 using the synthetic primers represented by The obtained PCR product was subcloned into the plasmid vector pCR ^™ II in the same manner as described in Example 2 to obtain a plasmid pG1-10.

The reaction for determining the nucleotide sequence was performed by DyeDeoxy
This was carried out using a Terminator Cycle Sequencing Kit (ABI), decoded using a fluorescent automatic sequencer, and the obtained nucleotide sequence information was carried out using DNASIS (Hitachi System Engineering). pG3-2 and p
DN encoding G protein-coupled receptor protein derived from mouse pancreatic β cell line MIN6 based on G1-10 sequence
The nucleotide sequence of A (SEQ ID NO: 18) and the amino acid sequence encoded thereby (SEQ ID NO: 13) are shown in FIG. The underlined portion corresponds to the synthetic primer. As a result of homology search based on the determined base sequence (FIG. 6), it was found that the obtained cDNA fragment encodes a novel G protein-coupled receptor protein. To further confirm that, using DNASIS (Hitachi System Engineering Co., Ltd.), the base sequence was converted to an amino acid sequence (FIG. 6), and a hydrophobicity plot was performed. The presence of six hydrophobic regions was confirmed. It was completed (Fig. 8). Further, the amino acid sequence of p19P2 obtained in Example 2 was
As a result, high homology was found as shown in FIG. As a result, pG3-2 and pG1-10
Is a G protein-coupled receptor protein derived from mouse pancreatic β-cell line MIN6 and a G protein-coupled receptor protein encoded by human pituitary gland p19P2, which are derived from different animal species but recognize the same ligand It was strongly suggested that

[0084]

Example 5 Cloning of cDNA Containing the Entire Coding Region of Receptor Protein from Human Pituitary Derived cDNA Library As a human pituitary derived cDNA library, a library using a Clontech λgt11 phage vector was used. (Clontech, CLHL113
9b). 2 × 10 ⁶ pfu (plaque forming)
Mixed with, ^- a human pituitary cDNA library unit) minutes, E. coli Y1090 treated with magnesium sulfate
After incubating at 37 ° C. for 15 minutes, 0.5% agarose (Pharmacia) LB was added, and the cells were plated on 1.5% agar (Wako Pure Chemical Industries) LB plate (containing 50 μg / ml Ampicilin). A nitrocellulose filter was placed on the plate with the plaque, and the plaque was transferred onto the filter. The filter was denatured by alkali treatment, and then heated at 80 ° C. for 3 hours.
Was fixed. 50% formamid
e, 5 × SSPE, 5 × Denhardt's solution, 0.1% SD
The probe was hybridized with a probe described below in a buffer containing 100 μg / ml salmon sperm DNA at 42 ° C. overnight. The probe used was D inserted into the plasmid p19P2 obtained in Example 2.
The NA fragment was digested with EcoRI, collected, and labeled by incorporating [ ³² P] dCTP (DuPont) using a random primed DNA labeling kit (Amersham). Washing is 2 × SSC, 0.1%
SDS was performed at 55 ° C. for 1 hour, and then autoradiography was performed at −80 ° C. to detect hybridizing plaques.

As a result of the screening, a hybridization signal was observed in three independent plaques. DNA was prepared from each of the three clones, digested with EcoRI, subjected to agarose electrophoresis, and analyzed by Southern blot using the same probe as that used for screening. Hybridizing bands were generated at 0.8 kb and 2.0 kb, respectively, of which about 2.0 kb
Those that produced band b (λhGR3) were selected. λ
After subcloning an EcoRI fragment of a size that allows hybridization of hGR3 into the EcoRI site of plasmid pUC18, Escherichia coli JM109 was transformed with this plasmid, and the transformant E. coli JM109 / p was used.
hGR3 was obtained. When a restriction map of this plasmid phGR3 was prepared based on the restriction map predicted from the nucleotide sequence shown in Example 2, it was predicted from the DNA encoding the receptor protein shown in Example 2. It was found that the DNA retained the DNA encoding the full length of the receptor protein.

[0086]

Example 6 Human pituitary-derived receptor protein cDNA
Determination of the base sequence of E inserted into the plasmid phGR3 obtained in Example 5.
Among the coRI fragments, the nucleotide sequence of about 1330 bp from the EcoRI site to the NheI site, which is considered to encode the receptor protein, was determined. Specifically, an unnecessary portion was removed or a necessary fragment was subcloned using a restriction enzyme site present in the EcoRI fragment to prepare a template plasmid for sequence analysis. The reaction for sequencing is Dye Deoxy Termina
Using the tor Cycle Sequencing Kit (ABI)
Decoding was performed using a fluorescent DNA sequencer (ABI), and DNASIS (Hitachi Software Engineering) was used for data analysis. The nucleotide sequence from immediately after the EcoRI site encoded by phGR3 to the NheI site is shown in FIG. And the nucleotide sequence of the DNA encoding the human pituitary-derived receptor protein is:
This corresponds to the 118th to 1227th base sequence (SEQ ID NO: 17) of the base sequence in FIG. The amino acid sequence of the receptor protein encoded thereby was found to be the amino acid sequence represented by SEQ ID NO: 12.

[0087]

Example 7 Northern Hybridization Using phGR3 Encoding a Human Pituitary Derived Receptor Protein The pituitary expression of the human pituitary-derived receptor protein encoded by the plasmid phGR3 obtained in Example 5 was determined at the mRNA level. Northern blots were performed for detection. As the mRNA, 2.5 μg of human pituitary mRNA (Clontech) was used, and the same probe as that used in Example 5 was used. In addition, a filter for Northern blot was prepared using Nylon membrane (Pall Biodyne, U.S.A.).
Using SA), the absorption of mRNA to the electrophoresis filter is performed by Molecular cloning, Cold Spring Harbor Laborator
It was prepared according to the method of y Press (1989). Hybridization is performed using the filter and probe described above for 5 minutes.
0% formamide, 5 × SSPE, 5 × Denhardt's solution,
The mixture was incubated overnight at 42 ° C. in a buffer containing 0.1% SDS and 100 μg / ml salmon sperm DNA.
Wash the filter with 0.1 x SSC, 0.1% SDS
The test was performed at 0 ° C., and exposed to an X-ray film (XAR5, Kodak) at −80 ° C. for 3 days after air drying. The results are shown in FIG. From FIG. 10, it is considered that the receptor gene encoded by phGR3 is expressed in human pituitary.

[0088]

Example 8 Amplification of Receptor cDNA by PCR Using MIN6-Derived cDNA and Determination of Nucleotide Sequence cD prepared in Example 3 from mouse pancreatic β cell line MIN6
L synthesized in Example 4 using 5 μl of NA as a template
(Science 244: 569-572, 1989), i.e., 5'-CTGTG (C or T) G (C or T) (G or C) AT (C or Is T) GCIIT (G or T) GA (C or T) (A or C) G (G or C) TAC-3 ′ (SEQ ID NO: 22) [I represents inosine. And 5′-A (G or T) G (A or T) AG (A or T) AGGGCAGC CAGCAGAI (G or C) (A or G) (C or T) GAA-3 ′ (SEQ ID NO: 23) [I represents inosine. PCR was performed under the same conditions as in Example 1 using the synthetic primers represented by The obtained PCR product was subcloned into a plasmid vector pCR ^™ II in the same manner as described in Example 2 to obtain a plasmid p5S38. Escherichia coli J
M109 was transformed to obtain a transformant Escherichia coli JM109 / p5S38.

The reaction for determining the nucleotide sequence was performed by DyeDeoxy
This was carried out using a Terminator Cycle Sequencing Kit (ABI), decoded using a fluorescent automatic sequencer, and the obtained nucleotide sequence information was carried out using DNASIS (Hitachi System Engineering). Based on the sequence of p5S38, the nucleotide sequence of a DNA encoding a G protein-coupled receptor protein derived from mouse pancreatic β cell line MIN6 (SEQ ID NO: 19) and the amino acid sequence encoded thereby (SEQ ID NO: 14) were determined as follows: FIG. 12]. The underlined portion corresponds to the synthetic primer. A homology search was performed based on the determined base sequence (FIG. 12), and it was found that the obtained cDNA fragment encodes a novel G protein-coupled receptor protein. To further confirm that, using DNASIS (Hitachi System Engineering Co., Ltd.), the base sequence was converted to an amino acid sequence (FIG. 12), and a hydrophobicity plot was performed. The presence of four hydrophobic regions was confirmed. It was completed (Fig. 14).
In addition, when the amino acid sequence was compared with p19P2 obtained in Example 2 and pG3-2 obtained in Example 4, [FIG.
As shown in [3], high homology was found. as a result,
The mouse pancreatic β-cell line MIN6-derived G protein-coupled receptor protein encoded by p5S38 and the human pituitary-derived G protein-coupled receptor protein encoded by p19P2 recognize different ligands but different animal species. It was strongly suggested that it was a receptor protein.
In addition, the mouse pancreatic β cell line MI encoded by p5S38
N6-derived G protein-coupled receptor protein and pG3-2
And mouse pancreatic β cell line M encoded by pG1-10
The IN6-derived G protein-coupled receptor protein is a receptor protein that recognizes the same ligand, suggesting that it is a closely related receptor protein (a so-called subtype).

[0090]

Example 9 Preparation of phGR3-expressing CHO cells Plasmid phGR3 (Example 5) into which cDNA encoding the full-length amino acid sequence of the human pituitary-derived receptor protein was cut with the restriction enzyme NcoI, and subjected to agarose gel electrophoresis. A 1 kb fragment was recovered. After both ends of the recovered fragment were blunted using a DNA blunting kit (Takara Shuzo), a Sal I linker was added, and the mixture was further treated with Sal I.
Plasmid S10 was obtained by integration into SalI site of pUC119. Approximately 700 by treating S10 with SalI and SacII
A bp fragment (including the N-terminal coding region) was prepared.
Next, an approximately 700 bp fragment (including a C-terminal coding region including a termination codon) cut out from phGR3 with SacII and NheI was prepared. These two fragments were treated with SalI and NheI and treated with animal cell expression vector plasmid pAKKO-111H (Biochim. Biophys. Acta, Hinu).
pAKK described in ma, S., et al. 1219, 251-259, 1994.
Ligation in addition to the same vector plasmid as O1.11H)
PAKKK for expressing the full-length receptor protein
O-19P2 was constructed. After culturing the Escherichia coli transformed with pAKKO-19P2, a large amount of pAKKO-19P2 plasmid DNA was prepared using QUIAGEN Maxi. After dissolving 20 μg of the plasmid DNA in 1 ml of sterile PBS, the solution was placed in a vial of Gene Transfer (Wako Pure Chemical Industries) and vortexed sufficiently to form liposomes. 24 hours before, 1 × 10 ⁶ cells were passaged into a 10 cm-diameter dish, and 125 μl of the liposome solution was added to the CHOdhfr ⁻ cells, which had been replaced with a fresh medium, and cultured overnight. The medium was replaced with a fresh medium and cultured for another day, and then replaced with a selective medium and cultured for one day. In order to efficiently select transformants, the cells were passaged at a low cell density, and only cells growing in a selection medium were selected, and a CHO cell line expressing a full-length receptor protein, CHO-1
9P2 was established.

[0091]

Example 10 Confirmation of Transcription Level of Expression of Full-length Receptor Protein in CHO-19P2 Cell Line CHO transformed by introducing pAKKO-19P2 using Fast Track kit (Invitrogen) according to the kit's prescription. Poly (A) ⁺ RN from cells and mock CHO cells
A was prepared. Using 0.02 μg of this poly (A) ⁺ RNA, RNA PC
CDNA was synthesized using R Kit (Takara Shuzo). The type of primer used was a random 9mer, and the total volume of the reaction solution was 40 μl. As a negative control for cDNA synthesis, a reaction solution to which no reverse transcriptase was added was also prepared. First, an extension reaction from the primer was performed to some extent by incubation at 30 ° C. for 10 minutes. Thereafter, the mixture was incubated at 42 ° C. for 30 minutes to sufficiently advance the reverse transcription reaction, heated at 99 ° C. for 5 minutes to inactivate the enzyme, and further cooled at 5 ° C. for 5 minutes. After the completion of the reverse transcription reaction, a part of the reaction solution was recovered, diluted with distilled water, and then subjected to phenol / chloroform extraction and diethyl ether extraction. This was precipitated with ethanol and dissolved in a fixed amount of distilled water to obtain a cDNA sample. This cD
NA solution and plasmid DNA (pAKKO-19P)
2) was prepared by serially diluting it, and PCR was performed using primers specific to the full-length receptor protein.
The primer sequence prepared based on the nucleotide sequence of the coding region of the full-length receptor protein has CTGACT on the 5 'side.
TATTTTCTGGGCTGCCGC (SEQ ID NO: 2
4) AACACCGACACATAGACG on 3 'side
GTGACC (SEQ ID NO: 25). The PCR reaction was performed using 1 μM of each primer and 0.5 μl of Taq DNA polymerase (Takara Shuzo), reaction buffer attached to the enzyme, and dNTPs.
And 10 μl of template DNA (cDNA or plasmid solution) in a total volume of 100 μl. First heat treatment at 94 ° C for 2 minutes to sufficiently denature the template DNA, and then cycle at 95 ° C for 30 seconds, 65 ° C for 30 seconds, and 72 ° C for 60 seconds.
I went 25 times. After completion of the reaction, agarose gel electrophoresis was performed using 10 μl of the reaction solution to detect amplification products and quantitatively compare them. As a result, a PCR product having a size (400 bp) estimated from the sequence of the cDNA encoding the full-length receptor protein was detected (FIG. 15). No specific band was detected in the lane of the PCR reaction solution using the reverse transcription reaction product to which no reverse transcriptase was added as a template, excluding the possibility of a PCR product derived from genomic DNA of CHO cells, In addition, since no specific band appeared in the lane of mock cells, it was confirmed that it was not derived from mRNA originally expressed in CHO cells [FIG. 15].

[0092]

Example 11 CHO-1 contained in rat whole brain extract
Detection of activity that specifically promotes release of arachidonic acid metabolite from 9P2 cell line A crude peptide fraction was prepared from whole rat brain by the following method. Immediately after sacrifice, the whole rat brain removed was frozen in liquid nitrogen and stored at -80 ° C. 20g of cryopreserved whole rat brain
(10 rats) were finely ground and boiled with 80 ml of distilled water for 10 minutes. After boiling, the mixture was rapidly cooled on ice, 4.7 ml of acetic acid was added to a final concentration of 1.0 M, and homogenized using a polytron (20,000 rpm, 6 min). After the homogenate was stirred overnight, the supernatant was collected by centrifugation (10,000 rpm, 20 min), the precipitate was homogenized with 40 ml of 1.0 M acetic acid, and the supernatant was obtained again by centrifugation. Combine the supernatants, add 3 volumes of acetone, and place on ice
After standing for 0 minutes, the supernatant was recovered by centrifugation (10,000 rpm, 20 minutes). The collected acetone supernatant was subjected to deacetone and concentration by evaporation. A two-fold volume of 0.05% trifluoroacetic acid (TFA) / H ₂ O was added to the concentrated deacetone supernatant, and a reversed-phase C18 column (Prep C18 1) packed in a glass column was added.
25Å 10 ml: Millipore). After adding the supernatant, 0.05
% TFA / H ₂ O washing the column with 10%, 20%, 30%, 40%, 50%,
Elution was performed stepwise with 60% CH ₃ CN / 0.05% TFA / H ₂ O, and each fraction was divided into 10 equal parts and freeze-dried. A dry sample from one whole brain was dissolved in 20 μl of dimethyl sulfoxide (DMSO), suspended in 1 ml of Hanks's solution (HBSS) containing 0.05% bovine serum albumin (BSA), and the peptide crude fraction And Full length receptor protein expressing CHO cells and mock CHO
Cells were seeded in a 24 well plate at 0.5 x 10 ⁵ cells / well and 2
After culturing for 4 hours, [ ³ H] arachidonic acid was added at 0.25 μCi / well. 16 hours after the addition of [ ³ H] arachidonic acid, the cells were washed with HBSS containing 0.05% BSA, and the above-mentioned crude peptide fraction was collected.
Added at 400 μl / well. After incubating at 37 ° C for 30 minutes, 300 μl of the reaction solution (400 μl) is added to 4 ml of a scintillator.
In addition, the amount of [ ³ H] arachidonic acid metabolite released in the reaction solution was monitored by a scintillation counter. As a result, the arachidonic acid metabolite-releasing activity specific to CHO cells (CHO-19P2) expressing the full-length receptor protein was detected in the fraction eluted with 30% CH ₃ CN [FIG. 16].

[0093]

Example 12 CHO- contained in bovine hypothalamus extract
Detection of activity specifically promoting release of arachidonic acid metabolite from 19P2 cell line Brain explant containing bovine hypothalamus in the same manner as in Example 11
A crude peptide fraction was prepared from 360 g (10 animals). The dry peptide preparation from 0.5 animals was dissolved in 40 μl of DMSO, and 0.05
The suspension was suspended in 2 ml of HBSS containing% BSA, and the detection of arachidonic acid metabolite releasing activity was attempted in the same manner as in Example 11. As a result, C18 column 30% CH ₃ C
The activity of specifically promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line was detected in the N-eluted fraction (FIG. 17).

[0094]

Example 13 Purification of Active Substance (Peptide) That Promotes Specific Release of Arachidonic Acid Metabolite from CHO-19P2 Cell Line from Bovine Hypothalamus Release of Specific Arachidonic Acid Metabolite from CHO-19P2 Cell Line Representative examples of purified active substances from bovine hypothalamus are specifically described below. 4.0 kg (80 heads) of frozen brain tissue pieces including the hypothalamus were cut into small pieces and boiled in 8.0 L of distilled water for 20 minutes. After quenching on ice, 540 ml of acetic acid was added to a final concentration of 1.0 M, and polytron (10,000 rpm, 1
2 min). After the homogenate was stirred overnight, the supernatant was obtained by centrifugation (9,500 rpm, 20 min). The precipitate was suspended in 4.0 L of 1.0 M acetic acid, homogenized with a polytron, and centrifuged to obtain a supernatant again. Combine the supernatants,
TFA was added to a final concentration of 0.05%, and a reversed-phase C18 column packed in a glass column (PrepC18 125Å 160 ml: Millipore)
Was added. After the addition, the column was washed with _{0.05% TFA / H 2 0 320ml} , 10%, 30%, and eluted in three steps in _{50% CH 3 CN / 0.05%} TFA / H 2 O. 30% CH ₃ CN / 0.05% TFA / H ₂ O Eluted fractions were added with 2 volumes of 20 mM CH ₃ COONH ₄ / H ₂ O, and the cation exchange column H
It was added to iPrep CM-Sepharose FF (Pharmacia). 20mM
After washing the column with CH ₃ COONH ₄ /10% CH ₃ CN / H ₂ O, 100 mM,
Elution was performed in four steps with 200 mM, 500 mM, and 1000 mM CH ₃ COONH ₄ /10% CH ₃ CN / H ₂ O. CHO-1 in 200 mM CH ₃ COONH ₄ eluted fraction
Since the activity of specifically promoting the release of arachidonic acid metabolites was found from the 9P2 cell line, three times the volume of acetone was added to this eluted fraction, centrifuged to remove proteins, and concentrated by evaporation. went. TFA (final concentration 0.1%) was added to the concentrated fraction, and then acetic acid was added.
Adjust to pH 4 and reverse-phase column RESOURCE RPC 3 ml (Pharmaci
Added to a). Elution with 15% -30% CH ₃ CN gradient,
The activity of specifically promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line was detected in the 19% -21% CH ₃ CN fraction. After freeze-drying the active fraction of RESOURCE RPC, DMSO
, And suspended in 50 mM MES pH 5.0 / 10% CH ₃ CN, and added to 1 ml of cation exchange column RESOURCE S (Pharmacia). Elution with 0M-0.7M NaCl gradient, 0.32M
The activity of specifically promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line was detected in the -0.46 M NaCl fraction. After freeze-drying the active fraction of RESOURCE S, dissolving it in DMSO, suspending it in 0.1% TFA / H ₂ O,
18TP5415 (Vydac). Elution with 20% -30% CH ₃ CN gradient, ₃ fractions of 22.5%, 23%, 23.5% CH ₃ CN (active fractions are P-1, P-2, P-3, respectively) In each case, the activity of specifically promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line was detected (FIG. 18). 3
Fraction of 23.5% CH ₃ CN of the separated activities (p-3)
After freeze-drying, it was dissolved in DMSO, suspended in 0.1% TFA / H ₂ O, and added to a reversed-phase column diphenyl 219TP5415 (Vydac). Elution with a 22% -25% CH ₃ CN gradient yields 23% CH ₃ C
The activity of specifically promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line converged to one peak eluted with N [FIG. 19]. Reversed phase column diphenyl 219TP5415
After freeze-drying the fraction of the peak corresponding to the activity in 0.1% TFA
/ H ₂ O, and reverse-phase column μRPC C2 / C18 SC 2.1 / 10 (P
harmacia). The two peaks eluted with 23.0% and 23.2% CH ₃ CN when eluted with a 22% -23.5% CH ₃ CN concentration gradient show the activity of specifically promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line, respectively. It was detected (FIG. 20).

[0095]

Example 14 CHO-19 purified from bovine hypothalamus
Amino acid sequencing of active peptide specifically promoting arachidonic acid metabolite release from P2 cell line Active peptide specifically promoting arachidonic acid metabolite release from CHO-19P2 cell line purified in Example 13 ( The amino acid sequence of P-3) was determined. Reversed phase column μ
The fraction having a peak corresponding to the activity of RPC C2 / C18 SC 2.1 / 10 was lyophilized, dissolved in 20 μl of 70% CH ₃ CN, and analyzed for amino acid sequence using a peptide sequencer (ABI.491). As a result, SEQ ID NO: 26 was obtained. However,
The 7th and 19th sequences have not been determined solely by amino acid sequence analysis.

[0096]

Example 15 Purification of an Active Substance (Peptide) That Promotes Specific Release of Arachidonic Acid Metabolite from CHO-19P2 Cell Line from Bovine Hypothalamus In Example 13, Vydac C18 218TP5415
Further purification of the active fraction (P-2) of 23.0% CH ₃ CN among the three activities separated in the above was performed. This active fraction was lyophilized, dissolved in DMSO and then 0.1% TFA.
/ Suspended in distilled water, reverse-phase column diphenyl 219TP5
415 (Vydac). 21.0% -24.0% C
In the elution with the H ₃ CN concentration gradient, the activity of specifically promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line was detected in one peak eluted with 21.9% CH ₃ CN. This fraction was lyophilized, dissolved in DMSO and suspended in 0.1% TFA / distilled water.
C2 / C18 SC 2.1 / 10 (Pharmacia). One peak eluted with 22.0% CH ₃ CN promotes the release of arachidonic acid metabolites specifically from the CHO-19P2 cell line, with a 21.5% to 23.0% CH ₃ CN gradient elution. Activity converged (FIG. 21).

[0097]

Example 16 CHO-1 purified from bovine hypothalamus
Amino acid sequencing of peptide (P-2) that specifically promotes the release of arachidonic acid metabolites from 9P2 cell line Specific release of arachidonic acid metabolites from CHO-19P2 cell line purified in Example 15 The amino acid sequence of the peptide (P-2) was determined. The fraction of the peak corresponding to the activity on the reversed-phase column μRPC C2 / C18 SC 2.1 / 10 was lyophilized, and then 70% CH ₃ CN 2
After dissolving in 0 μl, the peptide sequencer (ABI, 4
92) was performed (SEQ ID NO: 92).
27).

[0098]

Example 17 Preparation of Poly (A) ⁺ RNA Fraction from Bovine Hypothalamus and Synthesis of cDNA Total RNA was prepared from the hypothalamus of one bovine with Isogen (Nippon Gene), followed by FastTrack (Invitr).
ogen) to prepare a poly (A) ⁺ RNA fraction. Next, from 1 μg of the poly (A) ⁺ RNA fraction, 3 ′ RACE
system (GIBCO BRL) and Marathon cDNA amplifica
cD according to the manual by Option kit (Clontech)
NA was synthesized and dissolved in 20 and 10 μl, respectively.

[0099]

Example 18 Obtaining cDNA Encoding the Amino Acid Sequence Revealed in Example 14 In order to obtain cDNA encoding the polypeptide containing the amino acid sequence revealed in Example 14, first, SEQ ID NO: 28 The aim was to obtain a nucleotide sequence encoding Therefore, primers P5-1 (SEQ ID NO: 29), P3-1
(SEQ ID NO: 30) and P3-2 (SEQ ID NO: 31) were synthesized (I represents inosine in the sequence listing). CDNA prepared using 3 'RACE system in Example 17
Using 0.5 μl as a template and DNA polymerase as E
Using XTaq (Takara Shuzo), attached buffer 2.5μ
l, 200 μM dNTPs and primers P5-1 and P3
-1 to 200 nM each, and add 25μ with water.
After 1 minute at 94 ° C, 98 ° C for 10 seconds, 50 ° C
A cycle of 30 seconds at 68 ° C. for 10 seconds was repeated 30 times. This reaction solution is treated with Tricine / EDTA buffer for 50 minutes.
Using 2.5 μl of the 1: 2 dilution as a template, the primer was changed to a combination of P5-1 and P3-2, and the reaction was carried out under the same conditions except for the above. Thermal cycler is GeneAmp96
00 (Perkin Elmer) was used. The amplified product was subjected to 4% agarose electrophoresis and ethidium bromide staining to about 70%.
bp band, heat melting, phenol extraction,
Ethanol precipitated. The recovered DNA was subcloned into a plasmid vector pCR ^™ II according to the manual of a TA cloning kit (Invitrogen). This was introduced into Escherichia coli JM109, and the obtained transformant was cultured in an LB medium containing ampicillin, and then a plasmid was prepared using an automatic plasmid extractor (Kurabo Industries). This plasmid is used in the Dye Terminator Cycle Sequencing Kit (AB
The reaction was carried out in I) according to the manual, and the reaction was performed using a fluorescent automatic DNA sequencer (ABI). The result (Fig. 22)
Was obtained, and it was confirmed that this was a part of the nucleotide sequence encoding SEQ ID NO: 28.

[0100]

Example 19 Acquisition of Bioactive Polypeptide cDNA by RACE Using the Sequence Revealed in Example 18 First, to amplify the 5 'sequence (5' RACE), see FIG. Using the sequence shown, PE (SEQ ID NO: 3)
2) and two primers, PDN (SEQ ID NO: 33), were synthesized. In Example 17, Marathon cDNA amplification
A reaction solution was prepared in the same manner as in Example 2 using 2.5 μl of the cDNA prepared by the kit prepared by diluting the cDNA 100-fold with Tricine / EDTA buffer as a template. After 1 minute at 94 ° C., a cycle of 98 ° C. for 10 seconds and 68 ° C. for 5 minutes was repeated 30 times. Further, this reaction solution was diluted 50 times with Tricine / EDTA buffer.2.
Using 5 μl as a template, the primer was changed to a combination of AP1 and PDN.
4 cycles of 2 ° C for 5 minutes, 98 ° C for 10 seconds, 70 ° C
4 cycles of 5 minutes, 98 ° C for 10 seconds, 68 ° C for 5 seconds
The minute cycle was repeated 26 times. 1.2% amplification product
Agarose gel electrophoresis, ethidium bromide stain
A 50 bp band was cut out and centrifugally filtered through a centrifugal filtration tube (Millipore), followed by phenol extraction and ethanol precipitation. The recovered DNA was subcloned into a plasmid vector pCR ^™ II according to the manual of a TA cloning kit (Invitrogen). This is E. coli J
M109, and the resulting transformant was cultured in Example 18
The sequence of the inserted cDNA fragment was analyzed in the same manner as described above. As a result, the sequence shown in FIG. 23 was obtained. Further, based on this sequence, primer FB (SEQ ID NO: 34),
FC (SEQ ID NO: 35) was synthesized, and a 3′-side sequence was obtained (3′RACE). The same amount of template as that of 5'RACE was used, and the adapter primer AP
After 1 minute at 94 ° C, 98 ° C / 1
0 seconds, 5 cycles of 72 ° C / 5 minutes, 98 ° C / 10
5 seconds at 70 ° C for 5 seconds, 98 ° C for 10 seconds,
A cycle of 68 ° C. for 5 minutes was repeated 25 times. Further, using 2.5 μl of the reaction solution diluted 50-fold with Tricine / EDTA buffer as a template, the primer was changed to a combination of AP2 and FB also attached to the kit, and
After 1 minute at 4 ° C, 4 cycles of 98 ° C for 10 seconds, 72 ° C for 5 minutes, 4 cycles of 98 ° C for 10 seconds, 70 ° C for 5 minutes, 98 ° C for 10 seconds, 68 ° C 5 minute cycle 27
Repeated times. The amplified product was subjected to 1.2% agarose electrophoresis and ethidium bromide staining, and a band of about 400 bp was cut out. DNase was obtained in the same manner as in 5'RACE.
A was recovered. This DNA fragment is converted into a plasmid vector p.
After subcloning into CR ^™ II, the fragment was introduced into E. coli JM109, and the sequence of the cDNA fragment inserted into the obtained transformant was analyzed. From the 5 ′ and 3 ′ RACE results, a cDNA sequence encoding the entire coding region of the physiologically active polypeptide shown in SEQ ID NO: 28 (FIG. 24) was obtained. Specifically, in FIGS. 24 (a) and (b),
The base at position 134 was G, the base at position 184 was T and C, and the base at position 245 was T and C. The cDNA shown in FIG.
It encoded a polypeptide consisting of 8 amino acids. Considering that the first to 22nd amino acids are composed of hydrophobic amino acids and that the N-terminus of the active peptide starts from the 23rd Ser, as shown in Example 14, The amino acids 1 to 22 were deduced to be a secretory signal sequence. On the other hand, it was found that the GlyArgArgArg sequence present at positions 54 to 57 of the polypeptide is a typical amino acid sequence motif present when the bioactive peptide is cleaved. In the case of this cleavage motif, it is known that the presence of Gly causes amidation of the C-terminus of the frequently generated peptide. N-terminal sequence of P-3 of Example 14 and Example 1
Considering the N-terminal sequence information of P-2 of No. 6 and this GlyArgArgArg sequence, at least a part of the physiologically active peptide cut out from the polypeptide encoded by this cDNA contains at least a part of SEQ ID NO: 26, SEQ ID NO: 27, Number: 3
9, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 4
2, was considered to be SEQ ID NO: 43 or SEQ ID NO: 44.

[0101]

Example 20 Acquisition of DNA Fragment Containing the Entire Coding Region of Bovine Bioactive Polypeptide cDNA by PCR Method Using the cDNA prepared by the Marathon cDNA amplification kit in Example 17 as a template, the entire coding region of the bioactive polypeptide cDNA was The obtained DNA fragment was obtained. First, two primers having the nucleotide sequences represented by SEQ ID NO: 36 and SEQ ID NO: 37 were synthesized based on the sequence of the cDNA revealed in Example 19. BOVF 5'-GTGTCGACGAATGAAGGCGGTGGGGGCCTGGC-3 '(SEQ ID NO: 36) BOVR (24mer) 5'-AGGCTCCCCGCTGTATTCCTGCGC-3' (SEQ ID NO: 37) Done -2 to +
22 (the start codon ATG of ATG is set to +1), and BOVR is a bioactive polypeptide c
Antisense sequence corresponding to +285 to +309 including stop codon of DNA. The PCR reaction was performed in Example 1.
A reaction solution was prepared in the same manner as in Example 2 using 2.5 μl of the cDNA prepared by the Marathon cDNA amplification kit diluted 100 times with Tricine / EDTA buffer as a template in step 7, and 94 ° C. for 1 minute. 98 ℃ ・
3 cycles of 5 seconds at 72 ° C for 10 seconds, 98 ° C at 10
Seconds, 70 ° C., 5 minutes 3 times, 98 ° C., 10 seconds,
A cycle of 68 ° C. for 5 minutes was repeated 27 times. The amplified product was subjected to 2% agarose electrophoresis and ethidium bromide staining to cut out a band of about 320 bp, DNA was recovered in the same manner as in Example 3, and plasmid vector pCR ^™ II was used.
Subcloned. This was introduced into Escherichia coli JM109, and the transformant Escherichia coli was used.
oli) JM109 / pBOV3 was obtained. The sequence of the cDNA fragment inserted into the obtained transformant was analyzed. As a result, it was confirmed that this DNA fragment was a fragment containing the entire coding region of the physiologically active polypeptide cDNA.

[0102]

Example 21 Ser-Arg-Ala-His-Gln-His-Ser-Met-Glu-
Ile-Arg-Thr-Pro-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Ala-Gl
y-Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe-NH ₂ (19P
2-L31) Synthesis. 1) Ser (Bzl) -Arg (Tos) -Ala-His (Bom) -Gln-His (Bom) -Se
r (Bzl) -Met-Glu (OcHex) -Ile-Arg (Tos) -Thr (Bzl) -Pro-As
p (OcHex) -Ile-Asn-Pro-Ala-Trp (CHO) -Tyr (Br-Z) -Ala-Gl
y-Arg (Tos) -Gly-Ile-Arg (Tos) -Pro-Val-Gly-Arg (Tos) -P
Synthesis of he-pMBHA-resin. 0.71 g (0.5 mmole) of a commercially available p-methyl BHA resin (Applied Biosystems, currently manufactured by Perkin Elmer) was added to a peptide synthesizer (430 manufactured by Applied Biosystems).
In the reactor of A), after swelling with DCM, the first amino acid Boc-Phe was activated by the HOBt / DCC method and p-methyl BH
A resin was introduced. The resin was treated with 50% TFA / DCM to remove the Boc group to release the amino group and neutralized with DIEA. The next amino acid Boc-Arg (Tos) is added to this amino group by HOBt
/ Condensed by DCC method. The presence of unreacted amino groups is checked by a ninhydrin test to confirm the completion of the reaction. Similarly, Boc-Gly, Boc-
Val, Boc-Pro, Boc-Arg (Tos), Boc-Ile, Boc-Gly, Boc-Arg (T
os), Boc-Gly, Boc-Ala, Boc-Tyr (Br-Z) sequentially condensed, Boc-Al which was found to be insufficiently condensed by the ninhydrin test
a, Boc-Tyr (Br-Z) was recondensed and the reaction was completed. Boc-Trp (CHO), Boc-Trp (CHO)
oc-Ala, Boc-Pro, Boc-Asn, Boc-Ile, Boc-Asp (OcHex), Boc-
Pro, Boc-Thr (Bzl), Boc-Arg (Tos), Boc-Ile, Boc-Glu (OcHe
x), Boc-Met, Boc-Ser (Bzl), Boc-His (Bom), Boc-Gln, Boc-H
Is (Bom), Boc-Ala, Boc-Arg (Tos), and Boc-Ser (Bzl) were similarly re-condensed until a sufficient condensation was obtained by the ninhydrin test. After the entire amino acid sequence of 19P2-L31 was introduced, the resin was treated with 50% TFA / DCM to remove the Boc group on the resin, and the resin was dried to synthesize 1.28 g of a peptide resin. 2) Ser-Arg-Ala-His-Gln-His-Ser-Met-Glu-Ile-Arg-Th
r-Pro-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Ala-Gly-Arg-Gly-
Ile-Arg-Pro-Val-Gly-Arg-Phe-NH ₂ (19P2-L3
Synthesis of 1). The resin obtained in 1) was reacted with 3.8 g of p-cresol, 1 ml of 1,4-butanedithiol and 10 ml of hydrogen fluoride in a hydrogen fluoride reactor made of Teflon at 0 ° C. for 60 minutes. Hydrogen fluoride and 1 ml of 1,4-butanedithiol were distilled off under reduced pressure, 100 ml of diethyl ether was added to the residue, and the mixture was stirred, filtered on a glass filter and dried. This was suspended and stirred in 50 ml of a 50% aqueous acetic acid solution, and after extracting the peptide, it was separated from the resin.
After concentrating to 2 ml, Sephadex G-25 (2x90c
m) and eluted with 50% acetic acid aqueous solution.
Was collected and freeze-dried to obtain 290 mg of a white powder containing 19P2-L31. This is LiChroprep RP-18 (MER
0.1% TFA on a reversed phase column packed with CK
Purification by gradient elution using water and a 30% acetonitrile aqueous solution containing 0.1% TFA was repeated, and a portion eluted at around 25% acetonitrile concentration was collected and freeze-dried to obtain 71 mg of a white powder. (M + H) ⁺ 3574.645 by mass spectrometry HPLC elution time 18.2 minutes Column conditions Column: Wakosil 5C18 (4.6 × 100 mm) Eluent: Solution A (0.1% TFA water) Solution B (50% acetonitrile water containing 0.1% TFA) ) Using a linear concentration gradient elution from solution A to solution B (25 minutes) Flow rate: 1.0 ml / min

[0103]

Example 22 Ser-Arg-Ala-His-Gln-His-Ser-Met (O) -G
lu-Ile-Arg-Thr-Pro-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-Ala
-Gly-Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe-NH ₂ (19
Synthesis of P2-L31 (O)). Synthetic 19P2-L31 6mg 5% -acetic acid aqueous solution 20
and added with 40 μl of 30% -hydrogen peroxide solution.
LiChroprep RP-18
The product was applied to a reverse phase column packed with (MERCK) and purified to obtain 5.8 mg of the desired product. Mass spectrometry (M + H) ⁺ 3590.331 HPLC elution time 17.9 min Column conditions Column: Wakosil 5C18 (4.6 x 100 mm) Eluent: Solution A (0.1% TFA water) Solution B (50% acetonitrile water containing 0.1% TFA) ) Using a linear concentration gradient elution from solution A to solution B (25 minutes) Flow rate: 1.0 ml / min

[0104]

Example 23 Thr-Pro-Asp-Ile-Asn-Pro-Ala-Trp-Tyr-
Ala-Gly-Arg-Gly-Ile-Arg-Pro-Val-Gly-Arg-Phe-NH
₂ Synthesis of (19P2-L20). Boc-Trp (CHO), Boc-Ala, Boc-Pro, Boc-Asn, Boc-I are further added to the resin condensed up to Boc-Tyr (Br-Z) in 1) of Example 21.
le, Boc-Asp (OcHex), Boc-Pro, Boc-Thr (Bzl) are similarly condensed, and Boc-Thr (Bzl) -Pro-Asp (OcHex) -Ile-Asn-Pro-Ala-T
rp (CHO) -Tyr (Br-Z) -Ala-Gly-Arg (Tos) -Gly-Ile-Arg (To
s) -Pro-Val-Gly-Arg (Tos) -Phe-pMBHA-resin 1.14 g
I got This was treated with hydrogen fluoride and subjected to column purification in the same manner as in 2) of Example 21 to obtain 60 mg of a white powder. (M + H) ⁺ 224.149 by mass spectrometry HPLC elution time 10.4 minutes Column conditions Column: Wakosil 5C18 (4.6 x 100 mm) Eluent: Solution A (15% acetonitrile water containing 0.1% TFA) Solution B (containing 0.1% TFA) 45% acetonitrile water) using a linear concentration gradient elution from solution A to solution B (15 minutes) Flow rate: 1.0 ml / min

[0105]

Example 24 Measurement of Arachidonic Acid Metabolite Release Activity by Synthetic Peptide (19P2-L31) Similar to Example 11, Specificity from CHO-19P2 Cell Line by Peptide (19P2-L31) Synthesized in Example 21 Release of typical arachidonic acid metabolites was measured. The synthetic peptide was dissolved in degassed distilled water at a concentration of 10 ⁻³ M, diluted with HBSS containing 0.05% BSA,
The release of arachidonic acid metabolites from the CHO-19P2 cell line at each concentration was measured using the amount of [ ³ H] arachidonic acid metabolite as an index. As a result, 10 ^-12 M to 10
^{At -6} M, a concentration-dependent arachidonic acid metabolite release activity was detected (FIG. 25). Furthermore, peptide 1 which is a methionine oxidized form of 19P2-L31 synthesized in Example 22
As a result of comparing the arachidonic acid metabolite releasing activity of 9P2-L31 (O) with that of 19P2-L31, [FIG.
6], 19P2-L31 (O) is
It was found to show the same activity as L31.

[0106]

Example 25 Measurement of Arachidonic Acid Metabolite Release Activity by Synthetic Peptide (19P2-L20) As in Example 11, natural product P synthesized in Example 23
C by peptide (19P2-L20) corresponding to -2
The release of specific arachidonic acid metabolites from the HO-19P2 cell line was measured. The synthetic peptide was dissolved at a concentration of 10 ⁻³ M in degassed distilled water, diluted with HBSS containing 0.05% BSA, and CHO at each concentration was dissolved.
Release of arachidonic acid metabolites from the -19P2 cell line
The amount of [ ³ H] arachidonic acid metabolite was measured as an index. As a result, the concentration-dependent arachidonic acid metabolite release activity was detected at 10 ⁻¹² to 10 ⁻⁶ M to almost the same level as 19P2-L31 (FIG. 27).

[0107]

Example 26 Analysis of base sequence of coding region in bovine genomic DNA pBOV3 was digested with restriction enzyme EcoRI, separated by agarose gel electrophoresis, and the DNA of the cDNA fragment was recovered to prepare a probe. This was labeled with ³² P using a multiprime DNA labeling kit (Amersham). Bovine Gen constructed using cloning vector EMBL3 SP6 / T7
About 2.0 × 10 ⁶ phages from omic Library (BL1015j, CLONTECH) were seeded on an LB agar plate using Escherichia coli K802 as a host, and cultured overnight to form plaques. This is transferred to a nitrocellulose filter and denatured with alkali.
After neutralization, heat treatment (80 ° C, 2 hours)
NA was immobilized. The filter was washed with a hybridization buffer containing 50% formamide (50% formamide, 5 x Den
hardt's solution, 4 x SSPE, 0.1mg / ml Salmon sperm DN
A, 0.1% SDS) and hybridized with labeled probe at 42 ° C. overnight. After hybridization, the filter was washed in 2 × SSC, 0.1% SDS for 1.5 hours at room temperature, and further washed in the same buffer at 55 ° C. for 30 minutes. Detection of clones that hybridize with the probe was performed using Kodak X-ray film (X-OMAT ^™ A
R) and an intensifying screen, and exposure was performed at -80 ° C for 4 days. After the X-ray film was developed, the phage in the hybridized portion was collected while the position of the film and the plate corresponded. Further, replating and hybridization were repeated by the above-mentioned method to clone the phage. After a large amount of cloned phage was prepared by the plate lysate method and phage DNA was extracted, the restriction enzymes SalI and BamH at both ends of the cloning site of the vector were used.
Detection of the insert fragment derived from bovine genomic DNA by cleavage at the I cleavage site was performed by 1.2% agarose gel electrophoresis [FIG. 28]. As a result, in the BamHI digestion, three fragments were detected in addition to the phage-derived band. In SalI digestion, one band was detected overlapping with the band derived from the phage. Think that the SalI digested fragment retains the full length,
In order to subclone this fragment into a plasmid vector, a ligation reaction was performed with a plasmid vector pUC18 (Pharmacia) treated with BAP (alkaline phosphatase derived from Escherichia coli) after digestion with SalI.
Introduced in 9. A large amount of plasmid DNA with a SalI fragment derived from the genomic DNA was prepared from this strain, and the base sequence near the coding region was analyzed using a 370A fluorescent sequencer from PerkinElmer Applied Biosystems and its kit. . As a result, an array as shown in FIG. 29 was obtained. Compared with the cDNA coding region, the coding region is divided into two by an intron of 472 bp because it is derived from genomic DNA [FIG.
0]. [FIG. 31] and SEQ ID NO: 38 show the coding region of this bovine genome (excluding the intron portion).
Shows the amino acid sequence deduced from.

[0108]

Example 27 Preparation of Poly (A) ⁺ RNA Fraction of Rat Dorsal Medulla and Synthesis of cDNA Total RNA was prepared from rat dorsal medulla using Isogen (Nippon Gene), and then FastTrack (Invitrogen) was used.
) Was used to prepare a poly (A) ⁺ RNA fraction. Next, a random DNA hexamer (BRL) was added as a primer to 5 μg of the poly (A) ⁺ RNA, and complementary DNA was synthesized using Moloney mouse leukemia reverse transcriptase (BRL) using the attached buffer. The product after the reaction was subjected to ethanol precipitation and then dissolved in 12 μl of distilled water.
From 1 μg of this poly (A) ⁺ RNA, Marathon cD
CDNA was synthesized by NA amplification kit (Clontech) according to the manual and dissolved in 10 μl.

[0109]

Example 28: Acquisition of cDNA of rat-type bioactive polypeptide by RACE method In order to obtain the entire coding region of rat-type bioactive polypeptide cDNA, an experiment was performed according to the method of obtaining bovine type. First, the primer P5-1 used in Example 18
(SEQ ID NO: 29), P3-1 (SEQ ID NO: 30) as primers, random DNA hexamer (BRL) as a primer in Example 27 as a template, and Moloney mouse leukemia reverse transcriptase (BRL) PCR was performed using the complementary DNA synthesized by the above as a template. The reaction solution used was 1.25 µl of template cDNA, 200 µM of dNTP, 1 µM of each primer, ExTaq (Takara Shuzo) as DNA polymerase, and 2.5 µl of the attached buffer.
Further, the total volume was adjusted to 25 μl with water. After 1 minute at 94 ° C., the cycle of 98 ° C. for 10 seconds, 50 ° C. for 30 seconds, and 72 ° C. for 5 seconds was repeated 40 times, and then left at 72 ° C. for 20 seconds. GeneAmp2400 (PerkinElmer) was used as a thermal cycler. The amplified product was subjected to 4% agarose electrophoresis and ethidium bromide staining to cut out a band of about 80 bp. DNA was recovered by the method described in Example 19, subcloned into a plasmid vector pCR ^™ II, introduced into Escherichia coli JM109, and inserted cDNA fragment. Was analyzed. As a result, a partial sequence of the rat-type bioactive polypeptide could be obtained. 3 'RAC based on this sequence
RA for E (SEQ ID NO: 45), RC for 5 'RACE
(SEQ ID NO: 46) were synthesized and 5 ′
And 3 'RACE was performed. RA: 5'-CARCAYTCCATGGAGACAAGAACCCC-3 '(where R represents A or G, Y represents T or C) (SEQ ID NO: 45) RC: 5'-TACCAGGGCAGATTGATACAGGGGG-3' (SEQ ID NO: 46) In Example 27, Marathon cDNA amplification
2.5 μl obtained by diluting the product synthesized with kit (Clontech) 40-fold with the attached Tricine-EDTA buffer
1 was used. The primer was 3 'RACE, RA and adapter primer AP1 included in the kit, and 5' RACE.
A reaction solution was prepared in the same manner as above except that RC and AP1 were used for RACE. The reaction conditions were as follows: 1 minute at 94 ° C, a cycle of 98 ° C for 10 seconds,
Cycle of 98 ° C for 10 seconds and 70 ° C for 45 seconds
Cycle of 98 ° C for 10 seconds and 68 ° C for 45 seconds
Repeated times. As a result, about 400b from 3 'RACE
p and 5 'RACE gave bands of about 400 bp and 250 bp. These are collected in the same manner as above,
Dye Term is used as a template with these primers.
The sequence was analyzed by reacting with the inator Cycle Sequencing Kit (ABI). As a result, a sequence from the portion presumed to be the 5 'non-coding region to polyA could be obtained.

[0110]

Example 29: Acquisition of full-length cDNA of rat-type bioactive polypeptide by PCR Based on the sequence obtained in Example 28, rF (SEQ ID NO: 47) was added to the region containing the start codon, and 3 'to the stop codon. And two primers of rR (SEQ ID NO: 48) were synthesized to amplify a fragment containing full-length cDNA. rF: 5′-GGCATCATCCAGGAAGACGGAGCAT-3 ′ (SEQ ID NO: 47) rR: 5′-AGCAGAGGAGAGGGGAGGGGAGAGGA-3 ′ (SEQ ID NO: 48) cDNA prepared using the reverse transcriptase of Moloney mouse leukemia in Example 27 was used as a template. Using ExTaq (Takara Shuzo), a cycle of 95 ° C for 30 seconds and 68 ° C for 60 seconds
PCR was repeated 0 times. The amplified product was subjected to agarose electrophoresis and ethidium bromide staining to cut out a band of about 350 bp. The DNA was recovered by the method described in Example 19, subcloned into a plasmid vector pCR ^™ II, and introduced into Escherichia coli JM109. A plasmid was extracted from the resulting transformant, and the nucleotide sequence was determined.
coli JM109 / pRAV3 was obtained (FIG. 32).

[0111]

From Example 30 Human Brain poly (A) ⁺ synthetic human Brain poly of cDNA from RNA fraction (A) ⁺ RNA fraction (Clontech) 1μg, Marathon cDNA amplification kit (Clontec
According to h), cDNA is synthesized according to the manual, and 1
Dissolved in 0 μl. 5 μg of the poly (A) ⁺ RNA fraction
Random DNA hexamer (BRL) as primer
) And Moloney mouse leukemia reverse transcriptase (BR
L) using the attached buffer to synthesize complementary DNA. The product after the reaction is subjected to ethanol precipitation and then 3
Dissolved in 0 μl TE.

[0112]

Example 31 Acquisition of cDNA of Human Bioactive Polypeptide by RACE Method From the amino acid sequence of rat bioactive polypeptide revealed in Example 28, as shown in FIG. A region having high conservation by type was selected, and the following R1 (SEQ ID NO: 49), R3 (SEQ ID NO: 50), and R
4 (SEQ ID NO: 51) were synthesized, and PCR was carried out using human cDNA as a template to try to amplify the region between these primers. Here, in FIG. 33, bovine.aa is the amino acid sequence of the bovine polypeptide, b
ovine.seq indicates the nucleotide sequence of the DNA encoding the bovine polypeptide, and rat.seq indicates the nucleotide sequence of the DNA encoding the rat polypeptide. R1: 5'-ACGTGGCTTCTGTGCTTGCTGC-3 '(SEQ ID NO: 49) R3: 5'-GCCTGATCCCGCGGCCCGGTGTACCA-3' (SEQ ID NO: 50) R4: 5'-TTGCCCTCTCCTGCCCGAAGCGGCCC-3 '(SEQ ID NO: 30 on) Example cDNA amplification kit (C
lontech) and cDNA prepared by Tricine-EDT
2.5 μl of a 30-fold dilution in A buffer was used as a template. The reaction solution was 200 µM dNTP, the primers were R1 and R4 at 0.2 µM each, and Taq Start Antibody.
DNA polymerase ExTaq mixed with an equal amount (Clontech)
Using (Takara Shuzo), 2.5 μl of the attached buffer was added, and the total volume was further adjusted to 25 μl with water. Reaction at 94 ° C
One minute later, a cycle of 98 ° C. for 10 seconds and 68 ° C. for 40 seconds was repeated 42 times, and then left at 72 ° C. for 1 minute. Further, this reaction solution was diluted 100-fold with Tricine-EDTA buffer. Using 1 μl as a template, a reaction solution similar to the above was prepared except that the combination of primers was changed to R1 and R3. 98 ° C for 10 seconds, 68 ° C
The 40 second cycle was repeated 25 times. 4% amplification product
When agarose electrophoresis and ethidium bromide staining were performed, an expected band of about 130 bp was obtained. The band was recovered in the same manner as in Example 28, and the recovered fragment was used as a template in Dye Terminator Cycle Sequenc
As a result of analyzing the sequence by reacting with the ing Kit (ABI), a partial sequence of the human bioactive polypeptide could be obtained. Therefore, based on this sequence, primers HA (SEQ ID NO: 52) and HB (SEQ ID NO: 5) were used for 3′RACE.
3) using the primer HE (SEQ ID NO:
54) and HF (SEQ ID NO: 55) were synthesized and subjected to 5 'and 3' RACE. HA: 5'-GGCGGGGGCTGCAAGTCCGTACCCATCG-3 '(SEQ ID NO: 52) HB: 5'-CGGCACTCCATGGAGATCCGCACCCCT-3' (SEQ ID NO: 53) HE: 5'-CAGGCAGGATTGATGTCCAGGGGTGG-5-F: Sequence number: CATGGAGTGCCCGATGGGTACGACTTGC-3 ′ (SEQ ID NO: 55) The template prepared in Example 30 was used as Tricine-EDTA
2.5 μl of a 20-fold dilution in buffer was used. In the first PCR, HA and adapter primer AP1 were used for 3 ′ RACE, and HE and AP1 were used for 5 ′ RACE.
Was used to prepare a reaction solution in the same manner as before. The reaction conditions were 94 ° C for 1 minute, 98 ° C for 10 seconds, 72 ° C for 35 seconds 5 times, 98 ° C for 10 seconds, 70 ° C for 35 seconds 5 times, 98 ° C for 10 seconds, A cycle of 68 ° C. and 35 seconds was repeated 40 times. Further, the reaction solution was treated with Tricine-
Using 1 μl of a 100-fold dilution in EDTA buffer as a template, 2
A second PCR was performed. However, 3 ′ RACE changes primers to HB and AP1, 5 ′ RACE changes to HF and AP2, and Klen Taq (Clontech) as DNA polymerase.
Was used to prepare a reaction solution with the attached buffer. As a result, in 3 'RACE, a band of about 250 bp or 5'
In RACE, a band of about 150 bp was obtained, the sequence of which was read in the same manner as described above, and combined with the previously obtained partial sequence, a portion presumed to be the 5 'non-coding region of the human-type bioactive polypeptide. From polyA to polyA.

[0113]

Example 32 Acquisition of Full-length cDNA of Human Bioactive Polypeptide by PCR Method Based on the sequence obtained in Example 31, 5H (SEQ ID NO: 5)
6) and 3HN (SEQ ID NO: 57) were synthesized to amplify a fragment containing full-length cDNA. 5H: 5'-GGCCTCCTCGGAGGGACCAAGGGATGA-3 '(SEQ ID NO: 56) 3HN: 5'-GGGAAAGGGAGCCCGAAGGAGAGGAGAG-3' (SEQ ID NO: 57) In Example 30, the Moloney mouse leukemia reverse transcriptase (BR
Using 2.5 μl of the cDNA prepared by L. Co., Ltd. as a template, a reaction solution using Klen Taq DNA polymerase (Clontech) at 94 ° C. for 1 minute, 98 ° C. for 10 seconds, 68 ° C.
The 30 second cycle was repeated 40 times. About 36 obtained
The 0 bp fragment was recovered and subcloned in the same manner as in Example 29 (provided that pCR ^™ 2.1 was used as the vector), the plasmid was recovered, and the nucleotide sequence was determined. E. coli JM109 / pHOV7 having full-length cDNA was obtained [FIG.
4]. The human bioactive polypeptide and Example 2
The amino acid sequences of the bovine type translation region shown in FIG. 0 and the rat type translation region shown in Example 29 were compared [FIG.
5].

[0114]

Example 33 Acquisition and Sequencing of DNA Containing the Ligand Polypeptide Coding Region from Mouse Genomic DNA The cDNA sequence encoding rat-derived ligand polypeptide obtained in Example 29 (FIG. 32) was also used. Then, the following two primers were synthesized. rFBG: 5′-AGATTGGCATCATCCAGGAAGACGGAG CAT-3 ′ [SEQ ID NO: 61] rRSA: 5′-GTCGACTCAGCAGCACTGTCTTCTCGA GCTG-3 ′ [SEQ ID NO: 62] Mouse genomic DNA using these two primers
(Mouse BALB / c genomic DNA) PC using 0.5 ng as template
Amplification by the R method was performed. The composition of the reaction solution is synthetic DNA
Primer 200nM, template DNA 0.5ng, 0.25mM dNTP
s ExTaq polymerase 0.5 μl and the buffer attached to the enzyme, and the total reaction solution was 50 μl. The cycle for amplification was performed using a thermal cycler (PerkinElmer) at 95 ° C. for 30 seconds and 67 ° C. for 60 seconds for 30 cycles.
e repeated. Confirmation of the amplification product was performed by 1.2% agarose gel electrophoresis and excidium bromide staining. The resulting band of about 1 kb was recovered and subcloned using a TA cloning kit (invitrogen). E.coli. JM109
The clone having the inserted fragment was selected in an LB agar medium containing ampicillin and X-gal, the white clone was isolated, and the transformant Escher
ichia coli JM109 / pmGB3 was obtained. This clone was cultured overnight in an LB medium containing ampicillin, and plasmid DNA was prepared using an automatic plasmid extraction device. ABI Dye Terminator Cycle Seque
ncing Kit (ABI), and decoding using an automatic fluorescent sequencer.
This was performed using NASIS (Hitachi System Engineering Co., Ltd.) (FIG. 36). The underlined portion corresponds to the sequence of the primer. As a result of comparison with the sequence represented by SEQ ID NO: 58, 59 or 60 based on the determined base sequence, the DNA fragment inserted into the plasmid pmGB3 carried by Escherichia coli JM109 / pmGB3 was converted to a novel mouse ligand polypeptide. It was found to code (Fig. 37).

[0115]

Example 34 Obtaining and Sequencing the DNA of the Entire Transformation Region of the Ligand Polypeptide Coding Region from Mouse Genomic DNA The inserted D of plasmid pmGB3 obtained in Example 33 was inserted.
The NA fragment was prepared and sent to Genome Systems, and this fragment was used as a probe to control mouse ES129 / SuJ BA
Hybridization screening (catalogue from C library)
BAC 4921). From the BAC clone returned from Genome Systems, a DNA fragment containing the ligand peptide
Subcloning into EcoRI site of 18 Vector, JM
109 / pmGFE1 was obtained, and the sequence of the peripheral region was similarly determined. The determined sequences are shown in FIG. 39 and FIG.
0] and encoded the amino acid sequence shown. In FIG. 39 and FIG. 40, the region surrounded by () is a sequence different from the sequence obtained in Example 33,
This sequence, which used to be a primer for PCR, is 5 amino acids shorter by 5 residues.

Example 35 Construction of Targeting Vector for Production of Knockout Mouse The targeting vector was constructed using pmGFE1 obtained in Example 34 and pGT-N28 (NEB). Vs of BamHI site and HindIII site of pmGFE1 between BamHI site and HindIII site of pGT-N28
A fragment containing the pI site was introduced (5 ′ upstream region of the present peptide gene), and then pmGF was inserted between the XhoI site and the NotI site.
The fragments of the HpaI site and the SaII site of E1 (3 ′ downstream region of the present peptide gene) were X-linked by linker ligation.
pmGFEN by introducing after modification to hoI and NotI
28 was obtained (FIG. 41).

[Example 36] Acquisition of homologous recombinant of ES cell Regarding acquisition of homologous recombinant of ES cell, use of Genome Syst
The procedure was performed according to ES cells (RW-4) purchased from ems and its attached manual. More specifically, Example 3
After a DNA fragment of about 13 Kbp produced by digesting pmGFEN28 obtained in Step 5 with VspI and NotI was collected by agarose gel electrophoresis, the RW-4 cells were transferred to RW-4 cells using a GenePulser from Bio-Rad. ) To obtain a recombinant. The same DNA fragment was sent to Genome Systems, and electroporation was requested to obtain a recombinant. That is, [FIG.
As shown in 2], 12K with 5 '
bp, 5.5 Kbp, 7.5 Kbp, 5.5 Kbp with 3 'probe
Band can be detected. Clone No. 92 Hinuma, 56F from which DNAs passed through lane1, lane6 and lane7 were extracted
Clones F and 81FF are homologous recombinants sought.
Using these ES clones, chimeric mice can be produced in the future.

[0116]

Industrial Applicability The present invention relates to a mouse-derived ligand polypeptide for a G protein-coupled receptor protein, a DNA containing the DNA encoding the same and a use thereof. The polypeptide of the present invention or a DNA encoding the polypeptide is useful as a pituitary function regulator, a central function regulator, a pancreatic function regulator, or the like, and uses a recombinant receptor protein expression system. Development of receptor binding assay system and screening of drug candidate compounds, development of drugs such as pituitary function regulators, central function regulators or pancreatic function regulators, and non-human transgenics for analyzing their gene functions It is useful for producing animals (especially useful knockout mice).

[0117]

[Sequence list]

[SEQ ID NO: 1] Sequence length: 82 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Ala Pro Arg Thr Trp Leu Leu Cys Leu Leu Leu Leu Gly Leu Val Leu 1 5 10 15 Pro Gly Ala Ser Ser Arg Ala His Gln His Ser Met Glu Thr Arg Thr 20 25 30 Pro Asp Ile Asn Pro Ala Trp Tyr Thr Gly Arg Gly Ile Arg Pro Val 35 40 45 Gly Arg Phe Gly Arg Arg Arg Ala Ala Leu Arg Asp Val Thr Gly Pro 50 55 60 Gly Leu Arg Cys Arg Leu Ser Cys Phe Pro Leu Asp Gly Ser Ala Lys 65 70 75 80 Phe Ser 85

[0118]

[SEQ ID NO: 2] Sequence length: 249 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence GGCACCGAGG ACCTGGCTTC TGTGCTTGCT GCTGCTAGGC TTAGTCCTCC CAGGAGCTTC 60 CAGCCGAGCC CACCAGCACT CCATGGAGAC CCGCACCCCT GACATCAATC CTGCCTGGTA 120 CACGGGTCGT GGGATCAGGC CTGTGGGCCG CTTCGGGAGG AGGAGGGCAG CCCTGAGGGA 180 TGTCACCGGA CCTGGCCTGC GGTGCCGGCT AAGCTGCTTC CCACTGGATG GAAGTGCCAA 240 GTTCTCTCA

[0119]

[SEQ ID NO: 3] Sequence length: 893 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: genomic DNA Method for determining characteristics: S sequence GGCACCGAGG ACCTGGCTTC TGTGCTTGCT GCTGCTAGGC TTAGTCCTCC CAGGAGCTTC 60 CAGCCGAGCC CACCAGCACT CCATGGAGAC CCGCAGTGAG TGCCTGGCAT ATGGAGGACA 120 GCCACTGTCA CCTCCCATCC ATATGCTTCC CAAATGCCTT GAGTACCCAG CCCCTGAATG 180 GGAGGTTAGC CATCTCCTAA GCCAGTGGTT TCCAACCTTC CTAATACAGA ACTTTTAATA 240 CAGATCCTTA TGTTGTGGTG ACCCCCAGCC AGAAAATTAT TGTGATGCTG TTTTCATAGT 300 TGTAAGTTTT GCTACTGTTA TGGATCATAA TGTTAATATC TGAAATGCAG GATGTCTGAT 360 ATGCGCCCTT CCCCCCAAAC AAAAGGGACA CAACCCACAG GTTGAGAGCC TCTGGGATCT 420 AAGCAAAAGC TACCTTACCA TGCAGTCAGT TGGGAGATTG GTCCTGTTAA GATCTCCCCA 480 GAATGGTCCT GTTTCCTGTC CTCATCATTC CCCTAACCCA TCTTTGTGGG GTCCCTTAAG 540 ACTTTGGAGG ATGACAGTCA GACAGGAAGA GAATACTGAT CCTGGCATAT GTCTAAATAA 600 ATTCCCTAAA GCCACACCAC TGCCCAGATA TGCCCAGCCA GTGTAATCAG GGTGGGTCGGCT TTAG CAG CTTAGGGGCT CCCGTGTCCC ATACGCTGCT 720 CTGACTCTTT CCTTTCCAGC CCCTGACATC AATCCTGCCT GGTACACGGG TCGTGGGATC 780 AGGCCTGTGG GCCGCTTCGG GAGGAGGAGG GCAGCCCTGA GGGATGTCAC CGGACCTGGC 840 CTGCGGTCGATCGATCTCTCTC

[0120]

[SEQ ID NO: 4] Sequence length: 31 Sequence type: amino acid Topology: linear Sequence type: peptide Sequence Ser Arg Ala His Gln His Ser Met Glu
Thr Arg Thr Pro Asp Ile Asn 15
10 15 Pro Ala Trp Tyr Thr Gly Arg Gly Ile
Arg Pro Val Gly Arg Phe 20 25
30

[0121]

[SEQ ID NO: 5] Sequence length: 31 Sequence type: amino acid Topology: linear Sequence type: peptide Sequence Ser Arg Ala His Gln His Ser Met Glu
Thr Arg Thr Pro Asp Ile Asn 15
10 15 Pro Ala Trp Tyr Thr Gly Arg Gly Ile
Arg Pro Val Gly Arg Phe 20 25
30

[0122]

[SEQ ID NO: 6] Sequence length: 20 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Thr Pro Asp Ile Asn Pro Ala Trp Tyr Thr Gly Arg Gly Ile Arg Pro 1 5 10 15 Val Gly Arg Phe 20 25 30

[0123]

[SEQ ID NO: 7] Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide Sequence Ser Arg Ala His Gln His Ser Met Glu 1 5 10 15

[0124]

[SEQ ID NO: 8] Sequence length: 9 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Thr Pro Asp Ile Asn Pro Ala Trp Tyr 1 5 10 15

[0125]

[SEQ ID NO: 9] Sequence length: 10 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Gly Arg Gly Ile Arg Pro Val Gly Arg Phe 1 5 10 15

[0126]

[SEQ ID NO: 10] Sequence length: 91 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Leu Val Leu Val Ile Ala Arg Val Arg Arg Leu His Asn Val Thr Asn 1 5 10 15 Phe Leu Ile Gly Asn Leu Ala Leu Ser Asp Val Leu Met Cys Thr Ala 20 25 30 Cys Val Pro Leu Thr Leu Ala Tyr Ala Phe Glu Pro Arg Gly Trp Val 35 40 45 Phe Gly Gly Gly Leu Cys His Leu Val Phe Phe Leu Gln Pro Val Thr 50 55 60 Val Tyr Val Ser Val Phe Thr Leu Thr Thr Ile Ala Val Asp Arg Tyr 65 70 75 80 Val Val Leu Val His Pro Leu Arg Arg Arg Ile 85 90

[0127]

[SEQ ID NO: 11] Sequence length: 59 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Gly Leu Leu Leu Val Thr Tyr Leu Leu Pro Leu Leu Val Ile Leu Leu 1 5 10 15 Ser Tyr Val Arg Val Ser Val Lys Leu Arg Asn Arg Val Val Pro Gly 20 25 30 Cys Val Thr Gln Ser Gln Ala Asp Trp Asp Arg Ala Arg Arg Arg Arg 35 40 45 Thr Phe Cys Leu Leu Val Val Val Val Val Val 50 55

[0128]

[SEQ ID NO: 12] Sequence length: 370 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Met Ala Ser Ser Thr Thr Arg Gly Pro Arg Val Ser Asp Leu Phe Ser 1 5 10 15 Gly Leu Pro Pro Ala Val Thr Thr Pro Ala Asn Gln Ser Ala Glu Ala 20 25 30 Ser Ala Gly Asn Gly Ser Val Ala Gly Ala Asp Ala Pro Ala Val Thr 35 40 45 Pro Phe Gln Ser Leu Gln Leu Val His Gln Leu Lys Gly Leu Ile Val 50 55 60 Leu Leu Tyr Ser Val Val Val Val Val Gly Leu Val Gly Asn Cys Leu 65 70 75 80 Leu Val Leu Val Ile Ala Arg Val Arg Arg Leu His Asn Val Thr Asn 85 90 95 Phe Leu Ile Gly Asn Leu Ala Leu Ser Asp Val Leu Met Cys Thr Ala 100 105 110 Cys Val Pro Leu Thr Leu Ala Tyr Ala Phe Glu Pro Arg Gly Trp Val 115 120 125 Phe Gly Gly Gly Leu Cys His Leu Val Phe Phe Leu Gln Pro Val Thr 130 135 140 Val Tyr Val Ser Val Phe Thr Leu Thr Thr Ile Ala Val Asp Arg Tyr 145 150 155 160 Val Val Leu Val His Pro Leu Arg Arg Arg Ile Ser Leu Arg Leu Ser 165 170 175 Ala Tyr Ala Val Leu Ala Ile Trp Ala Leu Ser Ala Val Leu Ala Leu 180 185 190 Pro Ala Ala Val His Thr Tyr His Val Glu Leu Lys Pro His Asp Val 195 200 205 Arg Leu Cys Glu Glu Phe Trp Gly Ser Gln Glu Arg Gln Arg Gln Leu 210 215 220 Tyr Ala Trp Gly Leu Leu Leu Val Thr Tyr Leu Leu Pro Leu Leu Val 225 230 235 240 Ile Leu Leu Ser Tyr Val Arg Val Ser Val Lys Leu Arg Asn Arg Val 245 250 255 Val Pro Gly Cys Val Thr Gln Ser Gln Ala Asp Trp Asp Arg Ala Arg 260 265 270 Arg Arg Arg Thr Phe Cys Leu Leu Val Val Val Val Val Val Phe Ala 275 280 285 Val Cys Trp Leu Pro Leu His Val Phe Asn Leu Leu Arg Asp Leu Asp 290 295 300 Pro His Ala Ile Asp Pro Tyr Ala Phe Gly Leu Val Gln Leu Leu Cys 305 310 315 320 His Trp Leu Ala Met Ser Ser Ala Cys Tyr Asn Pro Phe Ile Tyr Ala 325 330 335 Trp Leu His Asp Ser Phe Arg Glu Glu Leu Arg Lys Leu Leu Val Ala 340 345 350 Trp Pro Arg Lys Ile Ala Pro His Gly Gln Asn Met Thr Val Ser Val 355 360 365 Val Ile 370

[0129]

[SEQ ID NO: 13] Sequence length: 206 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Leu Val Leu Val Ile Ala Arg Val Arg Arg Leu Tyr Asn Val Thr Asn 1 5 10 15 Phe Leu Ile Gly Asn Leu Ala Leu Ser Asp Val Leu Met Cys Thr Ala 20 25 30 Cys Val Pro Leu Thr Leu Ala Tyr Ala Phe Glu Pro Arg Gly Trp Val 35 40 45 Phe Gly Gly Gly Leu Cys His Leu Val Phe Phe Leu Gln Ala Val Thr 50 55 60 Val Tyr Val Ser Val Phe Thr Leu Thr Thr Ile Ala Val Asp Arg Tyr 65 70 75 80 Val Val Leu Val His Pro Leu Arg Arg Arg Ile Ser Leu Arg Leu Ser 85 90 95 Ala Tyr Ala Val Leu Ala Ile Trp Val Leu Ser Ala Val Leu Ala Leu 100 105 110 Pro Ala Ala Val His Thr Tyr His Val Glu Leu Lys Pro His Asp Val 115 120 125 Arg Leu Cys Glu Glu Phe Trp Gly Ser Gln Glu Arg Gln Arg Gln Leu 130 135 140 Tyr Ala Trp Gly Leu Leu Leu Val Thr Tyr Leu Leu Pro Leu Leu Val 145 150 155 160 Ile Leu Leu Ser Tyr Ala Arg Val Ser Val Lys Leu Arg Asn Arg Val 165 170 175 Val Pro Gly Arg Val Thr Gln Ser Gln Ala Asp Trp Asp Arg Ala Arg 180 185 190 Arg Arg Arg Thr Phe Cys Leu Leu Val Val Val Val Val Val 195 200 205

[0130]

[SEQ ID NO: 14] Sequence length: 126 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Val Val Leu Val His Pro Leu Arg Arg Arg Ile Ser Leu Arg Leu Ser 1 5 10 15 Ala Tyr Ala Val Leu Gly Ile Trp Ala Leu Ser Ala Val Leu Ala Leu 20 25 30 Pro Ala Ala Val His Thr Tyr His Val Glu Leu Lys Pro His Asp Val 35 40 45 Ser Leu Cys Glu Glu Phe Trp Gly Ser Gln Glu Arg Gln Arg Gln Ile 50 55 60 Tyr Ala Trp Gly Leu Leu Leu Gly Thr Tyr Leu Leu Pro Leu Leu Ala 65 70 75 80 Ile Leu Leu Ser Tyr Val Arg Val Ser Val Lys Leu Arg Asn Arg Val 85 90 95 Val Pro Gly Ser Val Thr Gln Ser Gln Ala Asp Trp Asp Arg Ala Arg 100 105 110 Arg Arg Arg Thr Phe Cys Leu Leu Val Val Val Val Val Val 115 120 125

[0131]

[SEQ ID NO: 15] Sequence length: 273 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence CTGGTGCTGG TGATCGCGCG GGTGCGCCGG CTGCACAACG TGACGAACTT CCTCATCGGC 60 AACCTGGCCT TGTCCGACGT GCTCATGTGC ACCGCCTGCG TGCCGCTCAC GCTGGCCTAT 120 GCCTTCGAGC CACGCGGCTG GGTGTTCGGC GGCGGCCTGT GCCACCTGGT CTTCTTCCTG 180 CAGCCGGTCA CCGTCTATGT GTCGGTGTTC ACGCTCACCA CCATCGCAGT GGACCTGCG TGT 240 GTCGTGCTGG

[0132]

[SEQ ID NO: 16] Sequence length: 177 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence GGCCTGCTGC TGGTCACCTA CCTGCTCCCT CTGCTGGTCA TCCTCCTGTC TTACGTCCGG 60 GTGTCAGTGA AGCTCCGCAA CCGCGTGGTG CCGGGCTGCG TGACCCAGAG CCAGGCCGAC 120 TGGGACCGCG CTCGGCGCCG GCGCACCTTC TGCTTGCTGG TGGTGGTCGT GGTGGTG 177

[0133]

[SEQ ID NO: 17] Sequence length: 1110 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence ATGGCCTCAT CGACCACTCG GGGCCCCAGG GTTTCTGACT TATTTTCTGG GCTGCCGCCG 60 GCGGTCACAA CTCCCGCCAA CCAGAGCGCA GAGGCCTCGG CGGGCAACGG GTCGGTGGCT 120 GGCGCGGACG CTCCAGCCGT CACGCCCTTC CAGAGCCTGC AGCTGGTGCA TCAGCTGAAG 180 GGGCTGATCG TGCTGCTCTA CAGCGTCGTG GTGGTCGTGG GGCTGGTGGG CAACTGCCTG 240 CTGGTGCTGG TGATCGCGCG GGTGCGCCGG CTGCACAACG TGACGAACTT CCTCATCGGC 300 AACCTGGCCT TGTCCGACGT GCTCATGTGC ACCGCCTGCG TGCCGCTCAC GCTGGCCTAT 360 GCCTTCGAGC CACGCGGCTG GGTGTTCGGC GGCGGCCTGT GCCACCTGGT CTTCTTCCTG 420 CAGCCGGTCA CCGTCTATGT GTCGGTGTTC ACGCTCACCA CCATCGCAGT GGACCGCTAC 480 GTCGTGCTGG TGCACCCGCT GAGGCGGCGC ATCTCGCTGC GCCTCAGCGC CTACGCTGTG 540 CTGGCCATCT GGGCGCTGTC CGCGGTGCTG GCGCTGCCCG CCGCCGTGCA CACCTATCAC 600 GTGGAGCTCA AGCCGCACGA CGTGCGCCTC TGCGAGGAGT TCTGGGGCTC CCAGGAGCGC TGCAGCTCCCG GCTG CTGGTCACCT ACCTGCTCCC TCTGCTGGTC 720 ATCCTCCTGT CTTACGTCCG GGTGTCAGTG AAGCTCCGCA ACCGCGTGGT GCCGGGCTGC 780 GTGACCCAGA GCCAGGCCGA CTGGGACCGC GCTCGGCGCC GGCGCACCTT CTGCTTGCTG 840 GTGGTGGTCG TGGTGGTGTT CGCCGTCTGC TGGCTGCCGC TGCACGTCTT CAACCTGCTG 900 CGGGACCTCG ACCCCCACGC CATCGACCCT TACGCCTTTG GGCTGGTGCA GCTGCTCTGC 960 CACTGGCTCG CCATGAGTTC GGCCTGCTAC AACCCCTTCA TCTACGCCTG GCTGCACGAC 1020 AGCTTCCGCG AGGAGCTGCG CAAACTGTTG GTCGCTTGGC CCCGCAAGAT AGCCCCCCAT 1080 GGCCAGAATA TGACCGTCAG CGTGGTCATC 1110

[0134]

[SEQ ID NO: 18] Sequence length: 618 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence CTGGTGCTGG TGATCGCGCG GGTGCGCCGG CTGTACAACG TGACGAATTT CCTCATCGGC 60 AACCTGGCCT TGTCCGACGT GCTCATGTGC ACCGCCTGCG TGCCGCTCAC GCTGGCCTAT 120 GCCTTCGAGC CACGCGGCTG GGTGTTCGGC GGCGGCCTGT GCCACCTGGT CTTCTTCCTG 180 CAGGCGGTCA CCGTCTATGT GTCGGTGTTC ACGCTCACCA CCATCGCAGT GGACCGCTAC 240 GTCGTGCTGG TGCACCCGCT GAGGCGGCGC ATCTCGCTGC GCCTCAGCGC CTACGCTGTG 300 CTGGCCATCT GGGTGCTGTC CGCGGTGCTG GCGCTGCCCG CCGCCGTGCA CACCTATCAC 360 GTGGAGCTCA AGCCGCACGA CGTGCGCCTC TGCGAGGAGT TCTGGGGCTC CCAGGAGCGC 420 CAGCGCCAGC TCTACGCCTG GGGGCTGCTG CTGGTCACCT ACCTGCTCCC TCTGCTGGTC 480 ATCCTCCTGT CTTACGCCCG GGTGTCAGTG AAGCTCCGCA ACCGCGTGGT GCCGGGCCGC 540 GTGACCCAGA GCCAGGCCGA CTGGGACCGC GCTCGGCGCC GGCGCACCTT CTGCTTGCTG 600 GTGGTGGTCG TGGTGGTG 618

[0135]

[SEQ ID NO: 19] Sequence length: 378 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence GTGGTTCTGG TGCACCCGCT ACGTCGGCGC ATTTCACTGA GGCTCAGCGC CTACGCGGTG 60 CTGGGCATCT GGGCTCTATC TGCAGTGCTG GCGCTGCCGG CCGCGGTGCA CACCTACCAT 120 GTGGAGCTCA AGCCCCACGA CGTGAGCCTC TGCGAGGAGT TCTGGGGCTC GCAGGAGCGC 180 CAACGCCAGA TCTACGCCTG GGGGCTGCTT CTGGGCACCT ATTTGCTCCC CCTGCTGGCC 240 ATCCTCCTGT CTTACGTACG GGTGTCAGTG AAGCTGAGGA ACCGCGTGGT GCCTGGCAGC 300 GTGACCCAGA GTCAAGCTGA CTGGGACCGA GCGCGTCGCC GCCGCACTTT CTGTCTGCTG 360 GTGGTGGTGG TGGTAGTG 378

[0136]

[SEQ ID NO: 20] Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CGTGGSCMTS STGGGCAACN YCCTG 25

[0137]

[SEQ ID NO: 21] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTNGWRRGGC ANCCAGCAGA KGGCAAA 27

[0138]

[SEQ ID NO: 22] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CTGTGYGYSA TYGCNNTKGA YMGSTAC 27

[0139]

[SEQ ID NO: 23] Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AKGWAGWAGG GCAGCCAGCA GANSRYGAA 29

[0140]

[SEQ ID NO: 24] Sequence length: 24 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CTGACTTATT TTCTGGGCTG CCGC 24

[0141]

[SEQ ID NO: 25] Sequence length: 24 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AACACCGACA CATAGACGGT GACC 24

[0142]

[SEQ ID NO: 26] Sequence length: 29 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ser Arg Ala His Gln His Ser Met Glu Ile Arg Thr Pro Asp Ile Asn 1 5 10 15 Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro Val Gly 20 25

[0143]

[SEQ ID NO: 27] Sequence length: 19 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Thr Pro Asp Ile Asn Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro 1 5 10 15 Val Gly Arg 19

[0144]

[SEQ ID NO: 28] Sequence length: 98 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Met Lys Ala Val Gly Ala Trp Leu Leu Cys Leu Leu Leu Leu Gly Leu 1 5 10 15 Ala Leu Gln Gly Ala Ala Ser Arg Ala His Gln His Ser Met Glu Ile 20 25 30 Arg Thr Pro Asp Ile Asn Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg 35 40 45 Pro Val Gly Arg Phe Gly Arg Arg Arg Ala Ala Pro Gly Asp Gly Pro 50 55 60 Arg Pro Gly Pro Arg Arg Val Pro Ala Cys Phe Arg Leu Glu Gly Gly 65 70 75 80 Ala Glu Pro Ser Arg Ala Leu Pro Gly Arg Leu Thr Ala Gln Leu Val 85 90 95 Gln Glu

[0145]

[SEQ ID NO: 29] Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GCICAYCARC AYTGYATGGA 20

[0146]

[SEQ ID NO: 30] Sequence length: 26 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CCIACGGGIC KDATGCCICK GCCIGC 26

[0147]

[SEQ ID NO: 31] Sequence length: 26 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence ACGGGCCKDA TGCCICKGCC IGCRTA 26

[0148]

[SEQ ID NO: 32] Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CCGGCGTACC AGGCAGGGTT 20

[0149]

[SEQ ID NO: 33] Sequence length: 28 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AGGCAGGGTT GATGTCGGGG GTGCGGAT 28

[0150]

[SEQ ID NO: 34] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CTGCCAGCAG AGCCCACCAG CAC
TCCA 27

[0151]

[SEQ ID NO: 35] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTGGGGGCCT GGCCCTCTCTG CCT
GCTG 27

[0152]

[SEQ ID NO: 36] Sequence length: 32 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTGTCGACGA ATGAAGGCGG TGGGGGCCTG GC 32

[0153]

[SEQ ID NO: 37] Sequence length: 24 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AGGCTCCCGCTGTTATTCCT GGA
C 24

[0154]

[SEQ ID NO: 38] Sequence length: 98 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Met Lys Ala Val Gly Ala Trp Leu Leu
Cys Leu Leu Leu Leu Gly Leu 15
10 15 Ala Leu Gln Gly Ala Ala Ser Arg Ala
His Gln His Ser Met Glu Ile 20 25
30 Arg Thr Pro Asp Ile Asn Pro Ala Trp
Tyr Ala Gly Arg Gly Ile Arg 35 40
45 Pro Val Gly Arg Phe Gly Arg Arg Arg
Ala Ala Leu Gly Asp Gly Pro 50 55
60 Arg Pro Gly Pro Arg Arg Val Pro Ala
Cys Phe Arg Leu Glu Gly Gly 65 70
7580 Ala Glu Pro Ser Arg Ala Leu Pro Gly
Arg Leu Thr Ala Gln Leu Val 85
90 95 Gln Glu

[0155]

[SEQ ID NO: 39] Sequence length: 31 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Ser Arg Ala His Gln His Ser Met Glu Ile Arg Thr Pro Asp Ile Asn 1 5 10 15 Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro Val Gly Arg Phe 20 25 30

[0156]

[SEQ ID NO: 40] Sequence length: 32 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Ser Arg Ala His Gln His Ser Met Glu Ile Arg Thr Pro Asp Ile Asn 1 5 10 15 Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro Val Gly Arg Phe Gly 20 25 30

[0157]

[SEQ ID NO: 41] Sequence length: 33 Sequence type: amino acid Topology: Linear Sequence type: Peptide sequence Ser Arg Ala His Gln His Ser Met Glu Ile Arg Thr Pro Asp Ile Asn 1 5 10 15 Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro Val Gly Arg Phe Gly 20 25 30 Arg 33

[0158]

[SEQ ID NO: 42] Sequence length: 20 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Thr Pro Asp Ile Asn Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro 1 5 10 15 Val Gly Arg Phe 20

[0159]

[SEQ ID NO: 43] Sequence length: 21 Sequence type: Amino acid Topology: Linear Sequence type: Peptide sequence Thr Pro Asp Ile Asn Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro 1 5 10 15 Val Gly Arg Phe Gly 20

[0160]

[SEQ ID NO: 44] Sequence length: 22 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Thr Pro Asp Ile Asn Pro Ala Trp Tyr Ala Gly Arg Gly Ile Arg Pro 1 5 10 15 Val Gly Arg Phe Gly Arg 20

[0161]

[SEQ ID NO: 45] Sequence length: 26 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CARCAYTCCA TGGAGACAAG AACCCC 26

[0162]

[SEQ ID NO: 46] Sequence length: 24 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TACCAGGCAG GATTGATACA GGGG 24

[0163]

[SEQ ID NO: 47] Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGCATCATCC AGGAAGACGG AGC
AT 25

[0164]

[SEQ ID NO: 48] Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AGCAGAGGAG AGGGAGGGGTA GAG
GA 25

[0165]

[SEQ ID NO: 49] Sequence length: 22 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence ACGTGGCTTC TGTGCTTGCT GC 22

[0166]

[SEQ ID NO: 50] Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GCCTGATCCC GCCGCCCGTG TAC
CA 25

[0167]

[SEQ ID NO: 51] Sequence length: 26 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TTGCCCTTCCT CCTGCCGAAG CGG
CCC 26

[0168]

[SEQ ID NO: 52] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGCGGGGGCT GCAAGTCGTA CCCATCG 27

[0169]

[SEQ ID NO: 53] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CGGCACTCCA TGGAGATCCG CAC
CCCT 27

[0170]

[SEQ ID NO: 54] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CAGGCAGGAT TGATGTCAGG GGT
GCGG 27

[0171]

[SEQ ID NO: 55] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence CATGGAGTGC CGATGGGTAC GACTTGC 27

[0172]

[SEQ ID NO: 56] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGCCTCCTCG GAGGGACCAA GGG
ATGA 27

[0173]

[SEQ ID NO: 57] Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GGGAAAGGAG CCCGAAGGAGG AGG
AGAG 27

[0174]

[SEQ ID NO: 58] Sequence length: 294 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence ATGAAGGCGG TGGGGGCCTG GCTCCTCTGC CTGCTGCTGC TGGGCCTGGC CCTGCAGGGG 60 GCTGCCAGCA GAGCCCACCA GCACTCCATG GAGATCCGCA CCCCCGACAT CAACCCTGCC 120 TGGTACGCRG GCCGTGGGAT CCGGCCCGTG GGCCGCTTCG GCCGGCGAAG AGCTGCCCYG 180 GGGGACGGAC CCAGGCCTGG CCCCCGGCGT GTGCCGGCCT GCTTCCGCCT GGAAGGCCGCCCCCCCCGCCT GGAAGGCCCCCCC

[0175]

[SEQ ID NO: 59] Sequence length: 249 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence ATGGCCCTGA AGACGTGGCT TCTGTGCTTG CTGCTGCTAA GCTTGGTCCT CCCAGGGGCT 60 TCCAGCCGAG CCCACCAGCA CTCCATGGAG ACAAGAACCC CTGATATCAA TCCTGCCTGG 120 TACACGGGCC GCGGGATCAG GCCTGTGGGC CGCTTCGGCA GGAGAAGGGC AACCCCGAGG 180 GATGTCACTG GACTTGGCCA ACTCAGCTGC CTCCCACTGG ATGGACGCAC CAAGTTCTCT 240 CAGCGTGGA 249

[0176]

[SEQ ID NO: 60] Sequence length: 261 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Method for determining characteristics: S sequence ATGAAGGTGC TGAGGGCCTG GCTCCTGTGC CTGCTGATGC TGGGCCTGGC CCTGCGGGGA 60 GCTGCAAGTC GTACCCATCG GCACTCCATG GAGATCCGCA CCCCTGACAT CAATCCTGCC 120 TGGTACGCCA GTCGCGGGAT CAGGCCTGTG GGCCGCTTCG GTCGGAGGAG GGCAACCCTG 180 GGGGACGTCC CCAAGCCTGG CCTGCGACCC CGGCTGACCT GCTTCCCCCT GGAAGGCGGT 240 GCTATGTCGT

[0177]

[SEQ ID NO: 61] Sequence length: 30 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AGATTGGCAT CATCCAGGAA GACGGAGCAT 30

[0178]

[SEQ ID NO: 62] Sequence length: 31 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GTCGACTCAG CAGCACTGTC TTCTCGAGCT G31

[0179]

[Brief description of the drawings]

FIG. 1. Human pituitary G protein-coupled receptor protein cDNA contained in cDNA clone p19P2 isolated by PCR using human pituitary cDNA
The nucleotide sequence of the fragment and the amino acid sequence encoded thereby are shown. The primer used for sequencing is -21M13. The underlined portion corresponds to the synthetic primer.

FIG. 2: cDNA of human pituitary-derived G protein-coupled receptor protein contained in cDNA clone p19P2 isolated by PCR using human pituitary-derived cDNA
The nucleotide sequence of the fragment and the amino acid sequence encoded thereby are shown. The primer used for sequencing was M13RV-N
(Takara). The underlined portion corresponds to the synthetic primer.

FIG. 3 was prepared based on the amino acid sequence shown in FIG.
3 shows a partial hydrophobicity plot of the protein encoded by the human pituitary G protein-coupled receptor protein cDNA fragment contained in p19P2.

FIG. 4 was prepared based on the amino acid sequence shown in FIG.
3 shows a partial hydrophobicity plot of the protein encoded by the human pituitary G protein-coupled receptor protein cDNA fragment contained in p19P2.

5 is a human pituitary G protein-coupled receptor protein cDN contained in p19P2 shown in FIG. 1 and FIG.
The partial amino acid sequence of the protein encoded by the A fragment was converted to a known G protein-coupled receptor protein, S1286.
3 shows a diagram in comparison with FIG. The portions painted black indicate the matching portions. The 1st to 99th amino acid sequences of p19P2 correspond to the 1st to 99th amino acid sequences in FIG. 1, and the 156th to 230th amino acid sequences correspond to the 1st to 68th amino acid sequences in FIG. Corresponds to the th amino acid sequence.

FIG. 6 shows cDNA clones pG3-2 and pG1-isolated by PCR using MIN6-derived cDNA.
10 shows the nucleotide sequence of the MIN6-derived G protein-coupled receptor protein cDNA fragment derived based on the nucleotide sequence of the MIN6-derived G protein-coupled receptor protein cDNA fragment and the amino acid sequence encoded thereby. The underlined portion corresponds to the synthetic primer.

FIG. 7 is a partial amino acid sequence (pG3-2 / pG) of the MIN6-derived G protein-coupled receptor protein shown in FIG.
1-10) is a diagram comparing the partial amino acid sequence of the protein encoded by p19P2 shown in FIGS. 1 and 2. Black portions indicate portions where the sequences match. p
The first to 99th amino acid sequences of 19P2 are shown in FIG.
Corresponding to the first to 99th amino acid sequences of
The 56th to 223rd amino acid sequences correspond to the 1st to 68th amino acid sequences in FIG. pG3-2
The first to 223rd amino acid sequences of / pG1-10 correspond to the first to 223rd amino acid sequences in FIG.

8 shows a partial hydrophobicity plot of a MIN6-derived G protein-coupled receptor protein created based on the partial amino acid sequence shown in FIG.

FIG. 9 shows a human pituitary G protein-coupled receptor protein contained in a cDNA clone phGR3 isolated from a human pituitary cDNA library by plaque hybridization using a DNA fragment inserted into p19P2 as a probe. 1 shows the entire nucleotide sequence of cDNA and the amino acid sequence encoded thereby.

FIG. 10: cDNA clone phGR derived from human pituitary gland
Human pituitary mRNA of the receptor gene encoded by 3
2 shows the results of Northern blotting for the present invention.

11 shows a hydrophobicity plot of a protein encoded by human pituitary G protein-coupled receptor protein cDNA contained in phGR3, which was created based on the amino acid sequence shown in FIG.

FIG. 12: M contained in cDNA clone p5S38 isolated by PCR using MIN6-derived cDNA
G protein-coupled receptor protein cDNA derived from IN6
The nucleotide sequence of the fragment and the amino acid sequence encoded thereby are shown. The underlined portion corresponds to the synthetic primer.

FIG. 13 shows a partial amino acid sequence of the MIN6-derived G protein-coupled receptor protein shown in FIG. 12 (p5S38).
With the cD contained in p19P2 shown in FIG. 1 and FIG.
The partial amino acid sequence of the G protein-coupled receptor protein encoded by the NA fragment, and pG3-2 shown in FIG.
And a diagram comparing the partial amino acid sequence of the G protein-coupled receptor protein encoded by the nucleotide sequence derived from the nucleotide sequence of the cDNA fragment contained in each of pG1-10. Black portions indicate portions where the sequences match. The 1st to 144th amino acid sequences of p5S38 correspond to the 1st to 144th amino acid sequences in FIG. The 1st to 99th amino acid sequences of p19P2 correspond to the 1st to 99th amino acid sequences in FIG. 1, and the 156th to 223rd amino acid sequences correspond to the 1st to 68th amino acid sequences in FIG. Corresponds to the th amino acid sequence. 1st to 223rd of pG3-2 / pG1-10
The third amino acid sequence corresponds to the first to 223rd amino acid sequences in FIG.

14 shows a partial hydrophobicity plot of a protein encoded by a MIN6-derived G protein-coupled receptor protein cDNA fragment contained in p5S38, which was created based on the partial amino acid sequence shown in FIG. 12.

FIG. 15: RT-PCR was performed to confirm that mRNA was expressed in CHO cells into which pAKKO-19P2 had been introduced. Lanes 1 to 7 show the serial dilution of pAKKO-19P2 for comparison.
PCR was performed, and 10 μg / μl of plasmid was used as a stock solution (lane 1), 1/2 dilution (lane 2), 1/4 dilution (lane 3), 1/64 dilution (lane 4), 1/256 It is the result of analyzing by 1.2% agarose gel electrophoresis about what performed PCR using the template which diluted (lane 5), 1/1024 dilution (lane 6), and 1/4096 dilution (lane 7). Lanes 8 to 11 were prepared from the CHO-19P2 cell line
PCR was performed using the cDNAs diluted 1/10 (lane 8), 1/100 (lane 9), and 1/1000 (lane 10) as templates, and electrophoresed. In lane 11, PCR was performed using a cDNA synthesized without reverse transcriptase as a template, followed by electrophoresis. Lanes 12 and 13 are reverse transcriptas from mock CHO cells, respectively.
e. PCR was performed using the cDNA prepared with and without addition as a template, and electrophoresed. M is a DNA size marker and lanes at both ends are λ / Sty I digest (Nippon Gene)
On the second from the right, 1 μg of φχ174 / Hinc II digest (Nippon Gene) was electrophoresed. Arrow is about 400bp
Shows the position of the band amplified by PCR.

FIG. 16 shows the activity of the crude ligand peptide fraction extracted from whole rat brain, which promotes the release of arachidonic acid metabolites from the CHO-19P2 cell line. The activity of promoting the release of arachidonic acid metabolites is defined as 100% of the amount of [ ³ H] arachidonic acid metabolite released when HBSS containing 0.05% BSA is added.
The amount of arachidonic acid metabolite released when the crude ligand peptide fraction was added was expressed as%. The activity of promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line was observed in the 30% CH ₃ CN fraction.

FIG. 17 shows the activity of a crude ligand peptide fraction extracted from bovine hypothalamus that promotes the release of arachidonic acid metabolites from the CHO-19P2 cell line. The activity to promote the release of arachidonic acid metabolites is 100% of the amount of [ ³ H] arachidonic acid metabolites released when HBSS containing 0.05% BSA is added.
The amount of arachidonic acid metabolite released when the ligand peptide crude fraction was added was expressed as%. 30% CH as well as crude ligand peptide fraction extracted from whole rat brain
_The activity of promoting the release of arachidonic acid metabolites from the CHO-19P2 cell line was observed in the 3CN fraction.

FIG. 18: The activity of promoting the release of arachidonic acid metabolites specific to the CHO-19P2 cell line was measured for the fraction purified by the reverse-phase column C18 218TP5415. The active fraction of RESOURCE S was separated on C18 218TP5415. Flow rate 1ml / min, 20% -3
Chromatography is performed with a concentration gradient of 0% CH ₃ CN / 0.1% TFA / H ₂ O.Eluate is collected in 1 ml aliquots, lyophilized, and arachidone specific to the CHO-19P2 cell line contained in each fraction. The acid metabolite release promoting activity was measured. As a result, the activities were separated into three (called P-1, P-2, and P-3, respectively, in the order of elution).

[FIG. 19] The activity of promoting the release of arachidonic acid metabolites specific to the CHO-19P2 cell line was measured for the fraction purified with the reverse phase column diphenyl 219TP5415. C18 218TP5415
The P-3 active fraction was separated with diphenyl 219TP5415. Chromatographed with a gradient of a flow rate of 1ml / min, 22% -25% CH 3 CN / 0.1% TFA / H 2 O, aliquots of the eluate were collected 1 ml,
After freeze-drying, the arachidonic acid metabolite release promoting activity specific to the CHO-19P2 cell line contained in each fraction was measured. As a result, the activity converged to one peak.

[FIG. 20] The activity of promoting the release of arachidonic acid metabolite specific to the CHO-19P2 cell line was measured for the fraction purified by the reversed-phase column μRPC C2 / C18 SC 2.1 / 10. diphenyl 2
The fraction of the peak corresponding to the activity at 19TP5415 was
Separated at 18 SC 2.1 / 10. Flow rate 100μl / min, 22% -23.5
Perform chromatography with a concentration gradient of% CH ₃ CN / 0.1% TFA / H ₂ O, fractionate 100 μl of the eluate, freeze-dry, and arachidonic acid specific to the CHO-19P2 cell line contained in each fraction. The metabolite release promoting activity was measured. As a result, the activity coincided with two peaks which seemed to be a single substance (peptide).

FIG. 21. Reversed phase column μRPC C2 / C18 SC 2.
CHO-19P2 for P-2 fraction purified by 1/10
The activity of specifically promoting the release of arachidonic acid metabolites from the cell line was measured. Flow rate 100 μl / min, 21.5% -2
Chromatography was performed with a concentration gradient of 3.0% CH ₃ CN / 0.1% TFA / distilled water, and 100 μl of the eluate was collected, lyophilized, and then CH contained in each fraction.
The activity of specifically promoting the release of arachidonic acid metabolites from the O-19P2 cell line was measured. As a result, the activity coincided with the peak of the peptide considered to be a single peptide.

FIG. 22: Ligand polypeptide c that specifically promotes release of arachidonic acid metabolites from bovine hypothalamus-derived CHO-19P2 cell line contained in cDNA clones isolated by PCR using bovine hypothalamus-derived cDNA
2 shows the nucleotide sequence of the bovine hypothalamus-derived ligand polypeptide cDNA fragment derived based on the nucleotide sequence of the DNA fragment, and the amino acid sequence encoded thereby. The part indicated by the arrow is a part corresponding to the synthetic primer.

FIG. 23: Ligand polypeptide c specifically promoting the release of arachidonic acid metabolites from bovine hypothalamus-derived CHO-19P2 cell line contained in cDNA clones isolated by PCR using bovine hypothalamus-derived cDNA
2 shows the nucleotide sequence of the bovine hypothalamus-derived ligand polypeptide cDNA fragment derived based on the nucleotide sequence of the DNA fragment, and the amino acid sequence encoded thereby. The part indicated by the arrow is a part corresponding to the synthetic primer.

FIG. 24 shows the amino acid sequences (a) and (b) of the ligand polypeptide that specifically promotes the release of arachidonic acid metabolites from the bovine hypothalamus-derived CHO-19P2 cell line, and SEQ ID NO: 1 and SEQ ID NO: 44. 2 is a cDNA sequence encoding the entire coding region of the indicated ligand polypeptide.

FIG. 25: Synthetic ligand polypeptide (19P2-L3)
For 1), the specific arachidonic acid metabolite release activity from the CHO-19P2 cell line was measured in a concentration-dependent manner. The synthetic peptide was dissolved in degassed distilled water at a concentration of 10 ⁻³ M, and then dissolved in HBSS containing 0.05% BSA at a concentration of 10 ⁻¹² M.
Diluted to a concentration of 〜１０10 ^-6 M. The arachidonic acid metabolite releasing activity was represented by the measured radiation dose of [ ³ H] arachidonic acid metabolite released into the supernatant when a diluent was added to the cells.
As a result, arachidonic acid metabolite releasing activity specific to the CHO-19P2 cell line by 19P2-L31 was observed in a concentration-dependent manner.

FIG. 26. Synthetic ligand polypeptide (19P2-L3)
1 (O)), the specific arachidonic acid metabolite releasing activity from the CHO-19P2 cell line was measured in a concentration-dependent manner. Synthetic ligand polypeptide was dissolved in degassed distilled water at a concentration of 10 ^-3 M, and H-containing 0.05% BSA was dissolved.
Diluted with BSS to a concentration of 10 ⁻¹² M to 10 ⁻⁶ M. The arachidonic acid metabolite releasing activity was represented by the measured radiation dose of [ ³ H] arachidonic acid metabolite released into the supernatant when a diluent was added to the cells. As a result, 19P2-L31 (O)
Arachidonic acid metabolite-releasing activity specific to CHO-19P2 cell line was observed in a concentration-dependent manner.

FIG. 27. Synthetic ligand polypeptide 19P2-L20
The specific arachidonic acid metabolite release activity from the CHO-19P2 cell line was measured in a concentration-dependent manner. Synthetic peptide was dissolved in degassed distilled water at a concentration of 10 ⁻³ M, and 10 ⁻¹² M to 1 ⁻¹² M in HBSS containing 0.05% BSA.
0 ^-6 diluted to a concentration of M. The arachidonic acid metabolite releasing activity is released into the supernatant when the diluent is added to the cells [ ³
H] Arachidonic acid metabolite was represented by the measured radiation dose. As a result, arachidonic acid metabolite releasing activity specific to the CHO-19P2 cell line by 19P2-L20 was observed in a concentration-dependent manner.

FIG. 28. The DNA of the phage cloned from the bovine genomic library was analyzed using restriction enzymes BamHI (B) and SalI.
The pattern cut | disconnected by (S) and performing 1.2% agarose gel electrophoresis is shown. As a DNA size marker (M), a StyI digest of λ phage DNA was used. In lane B, two bands derived from the vector were detected at positions corresponding to positions between the first (19,329 bp) and second (7,743 bp) bands of the marker, and the other three bands from the third (6,223 bp) to the fifth (3,
472 bp), three bands derived from the inserted fragment were detected. Similarly, two bands derived from the vector are detected in the lane S, but the upper band is thicker than the lane B because the bands derived from the insert overlap.

FIG. 29 shows a base sequence in the vicinity of a coding region decoded from bovine genomic DNA. The 1st to 3rd bases (ATG) correspond to the translation initiation codon, and the 767th to 769th bases (T
AA) corresponds to the translation stop codon.

FIG. 30 shows the results of comparing the nucleotide sequence (genome) near the coding region decoded from bovine genomic DNA with the nucleotide sequence (cDNA) of bovine cDNA cloned by PCR. Matching parts of the sequence are shaded. 101
The 〜th to 572 番 目 th parts had no corresponding portion in the cDNA base sequence, and were found to be introns.

FIG. 31 shows the result of translating into a coded amino acid sequence by removing an intron from a base sequence in the vicinity of a coding region decoded from bovine genomic DNA.

FIG. 32 shows the full-length amino acid sequence of the rat ligand polypeptide and the cDNA sequence encoding the entire coding region.

FIG. 33 shows the amino acid sequence of a bovine ligand polypeptide and the nucleotide sequences of DNAs encoding a bovine polypeptide and a rat polypeptide. The part indicated by the arrow is a part corresponding to the synthetic primer.

FIG. 34 shows the full length amino acid sequence of the human ligand polypeptide and the cDNA sequence encoding the entire coding region.

FIG. 35 is a comparison of the amino acid sequences of the translation regions of the bovine ligand polypeptide, rat ligand polypeptide and human ligand polypeptide.

FIG. 36 shows the nucleotide sequence of the inserted fragment of plasmid pmGB3. → is the part corresponding to the primer.

FIG. 37 shows predicted cDNA and translated protein based on the nucleotide sequence of plasmid pmGB3. → is the part corresponding to the primer. The portion between ↓↓ is the sequence expected to be an intron.

FIG. 38 shows a restriction map of the ligand polypeptide of the present invention.

FIG. 39 shows the DNA sequence of the ligand polypeptide region obtained in Example 34 and its surrounding regions (first to first).
026) and the amino acid sequence of the translationally encoded ligand polypeptide (continued from FIG. 40).

FIG. 40 shows the DNA sequence (the 1027th to 1574th) of the ligand polypeptide region and its peripheral region obtained in Example 34, and the amino acid sequence of the translationally encoded ligand polypeptide (continued from FIG. 39). .

FIG. 41 shows a construction diagram of the targeting vector pmGFEN28 obtained in Example 35.

FIG. 42 shows the results of agarose gel electrophoresis performed in Example 36 and a comparison diagram of wild-type and recombinant (knockout) genes.

──────────────────────────────────────────────────の Continued on front page (51) Int.Cl. ⁶ Identification code FI C07K 16/18 C12P 21/02 C C12N 1/21 G01N 33/53 D 5/10 33/577 B C12P 21/02 C12P 21 / 08 G01N 33/53 A61K 37/02 AAB 33/577 ADP // C12P 21/08 C12N 5/00 B (C12N 15/09 ZNA C12R 1:91) (C12N 1/21 C12R 1:19) (C12N 5 / 10 C12R 1:91) (C12P 21/02 C12R 1:19)

Claims (12)

[Claims] 1. A polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or an amide, ester or salt thereof. 2. A DNA containing a DNA having a nucleotide sequence encoding the polypeptide according to claim 1. 3. The DNA according to claim 2, which has the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3. 4. A recombinant vector containing the DNA according to claim 2. [5] A transformant transformed with the DNA according to [2] or the recombinant vector according to [4]. 6. A method for producing a non-human knockout animal having the inactivated DNA according to claim 2. 7. A non-human transgenic animal carrying the DNA of claim 2 or a mutant thereof or the recombinant vector of claim 4. 8. A non-human animal cell carrying the inactivated DNA according to claim 2. 9. The method for producing a non-human animal cell according to claim 8, wherein the inactivated DNA according to claim 2 is introduced. 10. A method for producing the polypeptide according to claim 1, or an amide, ester or salt thereof, wherein the transformant according to claim 5 is cultured. [11] a pharmaceutical comprising the polypeptide of [1] or an amide, ester or salt thereof; 12. An antibody against the polypeptide according to claim 1, or an amide, ester or salt thereof.