JPH1175855A - Heat-resistant f type atpase and gene coding for the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new enzyme, composed of protein having a plurality of ATPase sub-units containing a specific amino acid sequence, resistant to heat, and useful as the ATP supply source or the like for reagents and bio-reactors to be supplied with ATP. SOLUTION: This new heat-resistant enzyme of F type ATPase is composed of 3 types of protein having an amino acid sequence shown by formula I, II or III, one or more amino acid types of which may be lost, substituted or added, and functioning as the sub-units for ATPase. It has the most suitable reaction temperature of around 80 deg.C, is retarded by NBD-Cl, DCCD or an azide, and useful as the ATP-supplying enzyme or the like for heat-resistant reagents and bioreactors. It is obtained by a series of steps of (1) culturing a Thermotoga neapolitana DSM4359 strain, (2) collecting and crushing the bacteria grown by a ultrasonic crusher, (3) centrifugal separation of the effluent, (4) ultracentrifugal separation of the supernatant liquid, and (5) recovering the precipitates corresponding to the membrane fractions.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a gene which constitutes a subunit of ATPase which is highly resistant to heat and which is useful for producing ATP in a reagent or an ATP-supplying bioreactor. Microorganisms and cultured cells containing recombinant DNA incorporating the gene encoding this subunit are cultured in a culture medium, and the protein obtained from the culture is a highly stable reagent and a source of ATP for bioreactors. It is expected to be used as

[0002]

2. Description of the Related Art There are four types of ATPase that are commercially available, for example, from Sigma (see Sigma 19).
64 pages in the 1997 catalog), the optimum reaction temperature will be 37 ℃
It had to be stored at a low temperature of 4 ° C or -20 ° C. In addition, all are prepared from animal organs, and there is a problem in securing a supply source. Furthermore, various ATP-conjugated bioreactors have been devised (for example, Toda
Kiyoshi, Biotechnology, pp153-154, Nikkan Kogyo Shimbun, 1983, or Kazuhiko Nagata, Hiroshi Nakajima, New Use of Thermostable Enzymes, Chemistry and Biology, 32, 120-124, (199
4)), there is no ATPase with excellent stability and inefficiency, so there was a problem in its practicality.

The present inventors have proposed an enzyme (Koni) derived from Sulfolobus acidocaldarius having the highest optimal temperature reported so far.
Shiet al. J.Biochem., 102, 1379-1387 (1987))
ATPase was found in the genus Thermococcus classified as a hyperthermophilic sulfur-dependent bacterium (Japanese Patent Application Laid-Open No. 8-131167), and further, genes encoding its α and β subunits were obtained (Japanese Patent Application No. -49261), making it possible to obtain the present enzyme using an expression system. However, although this enzyme is classified into type V based on analysis of genes and the like (Iida et al., Biochemistry, 68, 779 (1996)), there is no suitable inhibitor.
There was a problem in controlling this enzymatic reaction.

[0004]

As described above, an ATPase having heat resistance and being inhibited by a specific substance has not been known. An object of the present invention is to provide a gene that is a source of the production in order to produce a novel ATPase having such properties.

[0005]

Means for Solving the Problems To solve the above-mentioned problems, the present inventors have developed ATPa having heat resistance and having an inhibitor.
We proceeded to search for se and added NBD-Cl, DCCD, and the like to thermotoga neapolitana, which is a hyperthermophilic bacterium.
The present inventors have found an F-type ATPase inhibited by azide, obtained the gene, and completed the present invention. That is, the present invention is a thermostable F-type ATPase having the following proteins (A), (B) and (C) as subunits.

(A) a protein comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 1; Protein functioning as a unit

(B) a protein comprising the amino acid sequence of SEQ ID NO: 2, or an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2; Protein functioning as a unit

(C) a protein comprising the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence in which one or several amino acids have been deleted, substituted or added in the amino acid sequence of SEQ ID NO: 3; The present invention provides a protein having a function as a unit.
A gene encoding the protein of (A), (B) or (C).

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION

(1) Thermostable F-type ATPase The ATPase of the present invention comprises three types of subunits, α, β, and γ. The α subunit is a protein consisting of the amino acid sequence of SEQ ID NO: 1, or one or several amino acids are deleted in the amino acid sequence of SEQ ID NO: 1,
Consisting of a substituted or added amino acid sequence and AT
It is a protein having a function as a subunit of Pase, the β subunit is a protein consisting of the amino acid sequence of SEQ ID NO: 2, or one or several amino acids are deleted in the amino acid sequence of SEQ ID NO: 2,
Consisting of a substituted or added amino acid sequence and AT
A protein having a function as a subunit of Pase, and the γ subunit is a protein consisting of the amino acid sequence of SEQ ID NO: 3, or one or several amino acids are deleted or substituted in the amino acid sequence of SEQ ID NO: 3. Or ATPase consisting of an added amino acid sequence
Is a protein having a function as a subunit of

[0010] Here, "one or several amino acids" refers to a technique commonly used at the time of filing the present application, for example, site-directed mutagenesis (Nucleic Acids Res. 10, 6487-65).
00, 1982) by the number of amino acids that can be deleted, substituted or added. Further, “a protein having a function as an ATPase subunit” refers to a protein in which an aggregate of the protein and another subunit has ATPase activity.

The ATPase of the present invention has an optimum reaction temperature around 80 ° C. and has the property of being inhibited by NBD-Cl, DCCD and azide. As the ATPase having an optimum reaction temperature around 80 ° C., the aforementioned ATPase derived from Thermococcus is known (JP-A-8-131167), but this enzyme is not inhibited by NBD-Cl or the like. Has an optimum reaction temperature around 80 ° C,
ATPase inhibited by NBD-Cl or the like has not been known so far, and the ATPase of the present invention is a novel enzyme.

The ATPase of the present invention is a microorganism belonging to Thermotoga neapolitana, or an ATPase of the present invention described later.
Is obtained by culturing a microorganism into which a gene encoding the subunit has been introduced, and collecting the culture. The ATPase of the present invention can be used as a highly stable reagent or a source of ATP for a bioreactor.

(2) Gene encoding subunit of thermostable F-type ATPase The thermostable F-type ATPase α subunit gene of the present invention encodes the following protein (a) or (b). (a) a protein comprising the amino acid sequence of SEQ ID NO: 1 (b) an amino acid sequence of SEQ ID NO: 1 in which one or several amino acids have been deleted, substituted or added, and as a subunit of ATPase Protein with the function of

The thermostable F-type ATPase β subunit gene of the present invention encodes the following protein (a) or (b): (a) a protein comprising the amino acid sequence of SEQ ID NO: 2 (b) an amino acid sequence of SEQ ID NO: 2 wherein one or several amino acids are deleted, substituted or added, and as a subunit of ATPase Protein with the function of

The thermostable F-type ATPaseγ subunit gene of the present invention encodes the following protein (a) or (b): (a) a protein comprising the amino acid sequence of SEQ ID NO: 3 (b) an amino acid sequence of SEQ ID NO: 3 in which one or several amino acids have been deleted, substituted or added, and as a subunit of ATPase Protein with the function of

"One or several amino acids" and "ATPa
A protein that functions as a subunit of se "
Has the same meaning as described above. The gene encoding each subunit can be obtained by the following procedure. A primer is appropriately synthesized from an amino acid sequence in a region having a high homology between ATPase genes, a DNA fragment is obtained by a PCR method, and the obtained DNA fragment is used as a probe. Alternatively, a membrane fraction is prepared from a microorganism belonging to Thermotoga neapolitana, ATPase is purified by various chromatography after solubilization, separated by SDS polyacrylamide gel electrophoresis, and transferred to a PVDF membrane or the like. After a band detected by a dye such as Coomassie brilliant blue R-250 is cut out, an amino acid sequence from the N-terminal may be determined by a protein sequencer, and a probe may be synthesized based on the sequence. On the other hand, genomic DNA of a microorganism belonging to Thermotoga neapolitana is prepared, cut with an appropriate restriction enzyme, and ligated to an appropriate vector to prepare a genomic DNA library. Various vectors derived from λ phage such as λgt10 and λZapI
I or a plasmid vector such as pUC18 or pBR322 can be used. To select a clone holding the target gene, hybridization may be performed using the probe, and a clone that strongly binds to the probe may be selected. The nucleotide sequence can be determined by a general method such as the Sanger method or the Maxam-Gilbert method. ATPase containing translation start codon to stop codon by the above procedure
The full length of the DNA encoding the α, β, γ subunit can be isolated. The isolated DNA can be inserted into an appropriate expression vector, introduced into a microorganism or cultured cells, and expressed, whereby a large amount of the protein can be prepared.

[0017]

The present invention will be described below with reference to examples, but the scope of the present invention is not limited to these examples. Example 1 Measurement of Membrane ATPase Activity of Thermotoga neapolitana Thermotoga neapolitana DSM4359 strain was cultured in a 5 L container. The medium used had a composition of 2 g of yeast extract, 2 g of tryptone, 6 g of glucose, 5 g of biotin, 3 g of PIPES, 2/3 of filtered seawater, and 1/3 of pure water (adjusted to pH 7.5) per liter at 70 ° C. The cells were cultured for 15 hours. After collecting cells by centrifugation,
100m containing 10% glycerol and 2mM magnesium chloride
The cells were suspended in M Tris-HCl buffer (pH 7.2), and the cells were disrupted by an ultrasonic disrupter (Branson 250, Branson).
The residue was removed by centrifugation, and the supernatant was ultracentrifuged (88.000
xg, 1.5 hours, applied to Hitachi SCP85H2) to collect a precipitate portion corresponding to the membrane, and further washed twice with the same buffer to prepare a membrane fraction. Using this fraction as a sample, ATPase activity was measured. Measurement was performed at 2mM in 80mM Tris-HCl buffer (pH 7.2).
The reaction is carried out at 70 ° C. for 10 minutes in the presence of M magnesium sulfate and 2 mM ATP.
(Fiske-Subbarow method). As a result, activity was observed, and the specific activity was 2.9 ± 0.4 u / mg. The optimum temperature was 80 ° C. as shown in FIG. In addition, as shown in Table 1, inhibition was caused by NBD-Cl, DCCD, and azide.

[0018]

[Table 1]

Example 2 Preparation of genomic DNA of Thermotoga neapolitana DSM4359 strain was cultured in a 1 L container in the same manner as in Example 1.
1 g of the cells was added to 10 ml of TNE buffer (100 mM NaCl, 20 mM EDTA).
In 20 mM Tris-HCl buffer, pH 8.0).
1 ml each of a 10% SDS solution and a 1% Triton X-100 solution was added, and the mixture was allowed to stand at 4 ° C. overnight. Then, the temperature was raised to 50 ° C., 50 ml of a proteinase K solution (20 mg / ml) was added, and the mixture was shaken for 4 hours. After phenol treatment and chloroform treatment, RNase
50 ml of the A solution (0.5 mg / ml) was added, and the mixture was left at 37 ° C. for 1 hour. After phenol treatment and chloroform treatment (solution volume 10 m
l), 1 ml of 3 M sodium acetate solution (pH 5.2), 25 m
l of ethanol was added and left at -20 ° C for 2 hours. Thereafter, the DNA was precipitated by centrifugation with a high-speed centrifuge, washed with 3 ml of a 70% ethanol solution, dried by a centrifugal evaporator, and dissolved in 0.5 ml of TE buffer. About 1.5
mg of genomic DNA was obtained.

Example 3 Amplification of ATPase β Subunit Fragment by PCR and Determination of Its Base Sequence Homologous regions located in the central part of β subunits of various F-type ATPases and homology to V-type ATPase α subunit The following DNA primers were synthesized from the low region. FL2: GA (AG) (CA) GNACN (CA) GNGA (AG) GGNAA (TC) GA FR: TCNGT (TGC) AG (AG) TC (AG) TCNGCNGGNAC (AG) TA

Using the DNA of the DSM4359 strain prepared in Example 2 as a template, PCR was performed using a PCR Amplification kit (Takara Shuzo).
Was done. Conditions were initial denaturation at 94 ° C for 4 minutes, then denaturation at 94 ° C.
A cycle of 0.5 minutes, annealing at 58 ° C. for 1 minute, and extension at 72 ° C. for 1 minute was performed 35 times. As a result of electrophoresis, the expected length (about
370 bp) fragment was amplified. Electrophoresis was performed on low melting point agarose, DNA fragments were cut out, transferred to an Eppendorf tube, and kept at 70 ° C. for 3 minutes to melt the gel and extract DNA. After phenol treatment and then chloroform treatment, ethanol precipitation was performed. The precipitate was washed with 70% ethanol, dried under reduced pressure, and dissolved in a TE buffer.

The DNA fragment prepared as described above was digested with pT7-Blue
Vector (Novagen) to Takara ligation kit Ver.1
(Takara Shuzo) and competent cells E. coli
Transformation was performed using JM109 (Takara Shuzo). After selecting positive clones and confirming the presence of the inserted fragment, inoculate 25 ml of LB medium (containing 50 mg / ml of ampicillin) and incubate overnight for 3 hours.
Shaking culture was performed at 7 ° C. The culture solution was centrifuged to collect the bacteria, and then a plasmid DNA was prepared mainly according to the method described in Lab Manual Genetic Engineering Enhancement Edition, pp51-52 (Masamatsu Muramatsu, Maruzen, 1990). By this operation, about 20 mg of DNA was prepared. Using 0.3 mg of DNA per sample as a template, Dye Te
A sequencing reaction was performed using an rminator cycle sequencing kit (Perkin Elmer), and the nucleotide sequence was determined using a DNA sequencer (373A, Applied Biosystems). As a result, the amino acid encoded by the amplified fragment showed homology to the amino acid sequence of the ATPase β subunit, and thus it was revealed that it was part of the ATPase gene.

Example 4 Preparation of Thermotoga Neapolitana Genomic DNA Library To 20 mg of genomic DNA prepared according to Example 2 was added 20 units of restriction enzyme BamHI or HindIII for 15 hours 37
The reaction was carried out at a temperature of 10 ° C. for cleavage. The solution after the cleavage reaction was subjected to phenol treatment and ethanol precipitation to obtain DNA. Meanwhile, Bam
HI or HindIII and dephosphorylated pUC18 were purchased from Pharmacia, and the genomic DNA fragment was ligated to that position using Takara ligation kit Ver.
Transformation was performed using oli JM109 to obtain a genomic DNA library.

Example 5 Selection of Recombinant Clones Containing ATPase Gene (1) Using the DNA fragment of about 370 bp prepared in Example 3 as a template, and labeling using a PCR DIG pobe synthesis kit (Boehringer Mannheim), A probe was used. On the other hand, the transformant prepared according to Example 4 was spread on an LB plate (containing ampicillin and X-gal) and cultured overnight, and then fixed on a nylon membrane Hybond N (Amersham) to perform colony hybridization. . The method mainly followed the protocol attached to the kit, and prehybridization and hybridization were performed at 65 ° C. In the BamHI library, two colonies binding to the probe were obtained from about 3,000 clones, and in the HindIII library, four colonies binding to the probe were obtained from about 3,000 clones. As a result of examining the DNA fragment inserted in the plasmid of these colonies, the clone FA1-1 obtained from the BamHI library showed that the clone FA1-1 from the C-terminal site of the ATPase α subunit to the entire γ subunit and the middle of the β subunit And clone FA3-4 obtained from the Hind III library was found to contain the entire α and γ subunits and halfway through the C-terminal part of the β subunit. Clone FA3-4 was awarded to the National Institute of Advanced Industrial Science and Technology by the National Institute of Advanced Industrial Science and Technology under the accession number FERM P-16333.
(Deposit date: July 17, 1997).

Example 6 Selection of Recombinant Clones Containing ATPase Gene (2) As a result of Examples 2 to 5, the sequence of the entire C-terminal part of the β subunit could not be obtained. Therefore, primers (TnF-10F and TnF-11R) were designed at about 400 bp between the BamHI site in the middle of the β subunit and the Hind III site in the middle of the C-terminal, and amplification was performed using the PCR DIG pobe synthesis kit. To prepare a new probe, and screening was performed using the BamHI library. Two colonies binding to the probe were obtained from about 1,500 clones, and the inserted fragment was analyzed. As a result, it was found that the entire region from the middle to the C-terminal of the β subunit was included. The clone selected at this time (clone FA
4-1) has accession number F to the Institute of Biotechnology and Industrial Technology, National Institute of Advanced Industrial Science and Technology
Deposited as ERM P-16334 (Deposit date: July 17, 1997). Then, the DNA sequence of the insert fragment of the positive clone obtained above was subjected to dye terminator cycle sequencing ki.
Determined using t (373A DNA sequencer). α,
SEQ ID NO: 4 shows the nucleotide sequence of the DNA containing the genes encoding the β and γ subunits.

[0026]

Industrial Applicability The present invention provides Thermotoga neapolitana-derived thermostable ATPase α, β, γ subunit genes. The protein produced from the gene of the present invention is extremely useful as a heat-resistant reagent and an ATP-supplying enzyme in a bioreactor.

[0027]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 503 Sequence type: Amino acid Topology: Unknown Sequence type: Protein Origin Organism name: Thermotoga neapolitana Strain name: DSM4359 strain Met Arg Ile Asn Pro Gly Glu Ile Thr Lys Val Leu Glu Glu Lys Ile 1 5 10 15 Lys Ser Phe Glu Glu Lys Ile Asp Leu Glu Asp Thr Gly Lys Val Ile 20 25 30 Gln Val Gly Asp Gly Ile Ala Arg Val Tyr Gly Leu Asn Lys Val Met 35 40 45 Val Ser Glu Leu Val Glu Phe Val Glu Thr Gly Val Lys Gly Val Ala 50 55 60 Phe Asn Leu Glu Glu Asp Asn Val Gly Ile Ile Val Leu Gly Glu Tyr 65 70 75 80 Lys Asp Ile Lys Glu Gly His Thr Val Arg Arg Leu Lys Arg Ile Ile 85 90 95 Glu Val Pro Val Gly Glu Glu Leu Leu Gly Arg Val Val Asn Pro Leu 100 105 110 Gly Glu Pro Leu Asp Gly Lys Gly Pro Ile Asn Ala Lys Asn Phe Arg 115 120 125 Pro Ile Glu Ile Lys Ala Pro Gly Val Ile Tyr Arg Lys Pro Val Asp 130 135 140 Thr Pro Leu Gln Thr Gly Ile Lys Ala Ile Asp Ser Met Ile Pro Ile 145 150 155 160 Gly Arg Gly Gln Arg Glu Leu Ile Ile Gly Asp Arg Gln Thr Gly Lys 165 170 175 Thr Ala Ile Ala Ile Asp Thr Ile Ile Asn Gln Lys Gly Gln Gly Val 180 185 190 Tyr Cys Ile Tyr Val Ala Ile Gly Gln Lys Lys Ser Ala Ile Ala Arg 195 200 205 Ile Ile Asp Lys Leu Arg Gln Tyr Gly Ala Leu Glu Tyr Thr Thr Val 210 215 220 Val Val Ala Ser Ala Ser Asp Pro Ala Thr Leu Gln Tyr Ile Ala Pro 225 230 235 240 Tyr Ala Gly Cys Ala Met Gly Glu Tyr Phe Ala Tyr Ser Gly Arg Asp 245 250 255 Ala Leu Val Val Tyr Asp Asp Leu Ser Lys His Ala Val Ala Tyr Arg 260 265 270 Gln Leu Ser Leu Leu Met Arg Arg Pro Pro Gly Arg Glu Ala Tyr Pro 275 280 285 Gly Asp Ile Phe Tyr Leu His Ser Arg Leu Leu Glu Arg Ala Val Arg 290 295 300 Leu Asn Asp Lys Leu Gly Gly Gly Ser Leu Thr Ala Leu Pro Ile Val 305 310 315 320 Gly Thr Gln Ala Asn Asp Ile Ser Ala Tyr Ile Pro Thr Asn Val Ile 325 330 335 Ser Ile Thr Asp Gly Gln Ile Tyr Leu Glu Pro Gly Leu Phe Tyr Ala 340 345 350 Gly Gln Arg Pro Ala Ile Asn Val Gly Leu Ser Val Ser Arg Val Gly 355 360 365 Gly Ala Ala Gln Ile Lys Ala Met Lys Gln Val Ala Gly Met Leu Arg 370 375 380 Ile Glu Leu Ala Gln Tyr Arg Glu Leu Glu Thr Phe Ala Gln Phe Ala 385 390 395 400 Thr Glu Leu Asp Pro Ala Thr Arg Ala Gln Ile Val Arg Gly Gln Arg 405 410 415 Leu Met Glu Leu Leu Lys Gln Glu Gln Tyr Ser Pro Met Pro Val Glu 420 425 430 Glu Gln Val Val Val Ile Phe Ala Gly Val Arg Gly Tyr Leu Asp Asp 435 440 445 Leu Pro Val Glu Ala Val Arg Arg Phe Glu Lys Glu Phe Leu Arg Phe 450 455 460 Met His Glu Lys His Gln Asp Ile Leu Asp Asp Ile Arg Glu Lys Lys 465 470 475 480 Glu Leu Thr Pro Glu Thr Glu Glu Lys Leu Lys Lys Ala Ile Glu Glu 485 490 495 Phe Lys Ala Val Phe Arg Val 500

SEQ ID NO: 2 Sequence length: 468 Sequence type: amino acid Topology: unknown Sequence type: protein Origin Organism name: Thermotoga neapolitana Strain name: DSM4359 strain Met Ala Lys Gly Ser Lys Gly Tyr Ile Val Gly Val Met Gly Pro Val 1 5 10 15 Val Asp Val Lys Phe Pro Glu Glu Glu Leu Pro Asp Ile Phe Asn Ala 20 25 30 Leu Glu Val Val Asn Pro Gln Thr Gly Gln Lys Ile Val Leu Glu Val 35 40 45 Glu Gln Leu Ile Gly Asp Gly Val Val Arg Thr Val Ala Met Asp Ser 50 55 60 Thr Asp Gly Leu Met Lys Gly Leu Glu Val Val Asp Thr Gly Glu Pro 65 70 75 80 Ile Thr Ala Pro Val Gly Lys Glu Val Leu Gly Arg Ile Leu Asn Val 85 90 95 Ile Gly Glu Pro Val Asp Glu Ala Gly Glu Ile Lys Ser Lys Glu Arg 100 105 110 Trp Pro Ile His Arg Pro Ala Pro Glu Leu Ile Glu Gln Ser Thr Glu 115 120 125 Ile Glu Ile Leu Glu Thr Gly Ile Lys Val Ile Asp Leu Leu Ala Pro 130 135 140 Phe Pro Lys Gly Gly Lys Ile Gly Phe Phe Gly Gly Ala Gly Val Gly 145 150 155 160 Lys Thr Val Leu Val Met Glu Leu I le Arg Asn Ile Ala Ile Glu His 165 170 175 Lys Gly Phe Ser Val Phe Ala Gly Val Gly Glu Arg Thr Arg Glu Gly 180 185 190 Asn Glu Leu Trp Leu Glu Met Gln Glu Ser Gly Val Leu Gly Asn Thr 195 200 205 Ile Leu Val Phe Gly Gln Met Asn Glu Pro Pro Gly Ala Arg Phe Arg 210 215 220 Val Ala Leu Thr Ala Leu Thr Ile Ala Glu Tyr Phe Arg Asp Val Glu 225 230 235 240 Gly Arg Asp Val Leu Leu Phe Ile Asp Asn Ile Phe Arg Phe Val Gln 245 250 255 Ala Gly Ser Glu Val Ser Ala Leu Leu Gly Arg Met Pro Ser Ala Val 260 265 270 Gly Tyr Gln Pro Thr Leu Ala Thr Asp Met Gly Glu Leu Gln Glu Arg 275 280 285 285 Ile Thr Ser Thr Arg Arg Gly Ser Ile Thr Ser Val Gln Ala Ile Tyr 290 295 300 Val Pro Ala Asp Asp Ile Thr Asp Pro Ala Pro Ala Thr Thr Phe Ala 305 310 315 320 His Leu Asp Ala Thr Val Val Leu Ser Arg Arg Ile Ala Glu Leu Gly 325 330 335 Leu Tyr Pro Ala Val Asp Pro Leu Asp Ser Ser Ser Lys Ile Leu Asp 340 345 350 Pro Ala Val Val Gly Arg Glu His Tyr Glu Val Ala Arg Gly Val Gln 355 360 365 Glu Val Leu Gln Arg Tyr Lys Asp Leu G ln Asp Ile Ile Ala Ile Leu 370 375 380 Gly Val Lys Glu Leu Ser Pro Glu Asp Lys Leu Val Val His Arg Ala 385 390 395 400 400 Arg Arg Ile Gln Arg Phe Leu Ser Gln Pro Phe His Val Ala Glu Arg 405 410 415 Phe Thr Gly Arg Pro Gly Lys Tyr Val Pro Leu Glu Glu Thr Ile Arg 420 425 430 Gly Phe Lys Glu Ile Leu Asp Gly Lys Leu Asp Asp Val Pro Glu Gln 435 440 445 Ala Phe Leu Met Ala Gly Thr Ile Asp Glu Val Lys Glu Arg Ala Lys 450 455 460 Glu Met Arg Ser 465

SEQ ID NO: 3 Sequence length: 278 Sequence type: amino acid Topology: unknown Sequence type: protein Origin Organism name: Thermotoga neapolitana Strain name: DSM4359 strain Met Ser Arg Gly Arg Met Leu Gln Ile Lys Arg Lys Ile Asn Ala Thr 1 5 10 15 Gln Ser Leu Met Lys Ile Thr Arg Ala Met Glu Met Val Ala Arg Ala 20 25 30 Lys Ser Arg Lys Met Glu Ala Glu Tyr Gln Lys Phe Lys Pro Phe Tyr 35 40 45 Glu Glu Val Lys Arg Leu Trp Ser Leu Ile Pro Asp Glu Ser Leu Asp 50 55 60 Pro Val Phe Phe Glu Glu Gly Asp Arg Asp Leu Ile Val Val Ile Thr 65 70 75 80 Ser Asp Met Gly Leu Cys Gly Ser Phe Asn Ser Glu Ile Ile Arg Glu 85 90 95 Ala Glu Lys Val Ile Ser Glu Ser Lys Asn Pro His Leu Ile Leu Ile 100 105 110 Gly Leu Lys Ala Ile Asn His Phe Arg Thr Gly Asn Ile Leu Lys Met 115 120 125 Tyr Asp Arg Phe Tyr Glu Ile Pro Asp Phe Arg Asn Gly Ser Thr Ile 130 135 140 Val Glu Asp Ile Tyr Glu Phe Met Asp Gly Arg Pro Val Asn Val Lys 145 150 155 160 Val Val Phe Ser Arg Phe Lys Asn Il e Leu Ile Gln Arg Pro Glu Val 165 170 175 Tyr Asp Leu Ile Pro Leu Lys Arg Lys Glu Lys Lys Arg Glu Asp Phe 180 185 190 Glu Phe Glu Pro Leu Pro Glu Gln Leu Val Pro Val Val Leu His Tyr 195 200 205 Tyr Leu Ser Thr Thr Leu Met Glu Leu Met Phe Gln Thr Lys Ile Gly 210 215 220 Glu Phe Tyr Ala Arg Gln Asn Ala Met Lys Asn Ala Thr Asp Asn Ala 225 230 235 240 Gln Glu Val Ile Arg Glu Leu Thr Leu Ala Tyr Asn Lys Ala Arg Gln 245 250 255 Ala Ser Ile Thr Gln Glu Leu Ile Glu Ile Val Thr Gly Ala Glu Ala 260 265 270 Leu Lys Glu Ile Glu Lys 275

SEQ ID NO: 4 Sequence length: 4097 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: genomic DNA Origin Organism name: Thermotoga neapolitana Strain name: DSM4359 strain CAAAACGACC GTAGACGAAT CCTTGATAGC GGGAGCCGTT GTGGAATTCG AAGGATTCAG 60 ACTGGATACG ACCGTTCAGG GCAGACTGAA AAGGCTCTCC CAGGAAACCC TCAAAAGGGG 120 TGAGATGAG TTG AGG ATA AAT CCC GGT GAA ATC ACC AAA GTA CTG GAA 168 Met Arg Ile Asn Pro Gly Glu GAG AAG ThrAGluAAG AAG ATA GAC CTT GAG GAC ACC GGA 216 Glu Lys Ile Lys Ser Phe Glu Glu Lys Ile Asp Leu Glu Asp Thr Gly 15 20 25 AAG GTC ATC CAG GTG GGA GAC GGT ATA GCC CGT GTG TAT GGT TTG AAC 264 Lys Val Ile Gln Val Gly Asp Gly Ile Ala Arg Val Tyr Gly Leu Asn 30 35 40 45 AAG GTG ATG GTG AGT GAA CTT GTG GAG TTT GTG GAG ACA GGC GTC AAG 312 Lys Val Met Val Ser Glu Leu Val Glu Phe Val Glu Thr Gly Val Lys 50 55 60 GGT GTG GCC TTC AAC CTG GAA GAA GAC AAC GTT GGT ATC ATC GTG CTC 360 Gly Val Ala Phe Asn Leu Glu Glu Asp Asn Val Gly Ile Ile Val Leu 65 70 75 GGC GAA TAC AAG GAC ATA AAA GAA GGA CAC ACC GTC AGA AGG CTC AAA 408 Gly Glu Tyr Lys Asp Ile Lys Glu Gly His Thr Val Arg Arg Leu Lys 80 85 90 AGG ATC ATA GAA GTG CCT GTT GGA GAA GAA CTC CTT GGA AGA GTG GTG 456 Arg Ile Ile Glu Val Pro Val Gly Glu Glu Leu Leu Gly Arg Val Val 95 100 105 AAT CCT CTC GGT GAA CCC CTC GAC GGT AAA GGA CCT ATA AAT GCA AAA 504 Asn Pro Leu Gly Glu Pro Leu Asp Gly Lys Gly Pro Ile Asn Ala Lys 110 115 120 125 AAT TTC AGA CCG ATA GAG ATA AAA GCT CCT GGT GTC ATC TAC AGA AAA 552 Asn Phe Arg Pro Ile Glu Ile Lys Ala Pro Gly Val Ile Tyr Arg Lys 130 135 140 CCC GTT GAC ACA CCC CTC CAG ACG GGT ATA AAG GCC ATA GAC TCC ATG 600 Pro Val Asp Thr Pro Leu Gln Thr Gly Ile Lys Ala Ile Asp Ser Met 145 150 155 ATT CCT ATT GGT AGA GGC CAG AGA GAG CTG ATC ATA GGC GAC AGA CAG 648 Ile Pro Ile Gly Arg Gly Gln Arg Glu Leu Ile Ile Gly Asp Arg Gln 160 165 170 ACC GGA AAG ACC GCC ATA GCC ATC GAC ACG ATC ATC AAC CAG AAG GGA 696 Thr Gly Lys Thr Ala Ile Ala Ile Asp Thr Ile Ile Asn Gln Lys Gly 175 180 185 CAG GGT GTT TAC TGT ATA TAC GTG GCA ATC GGT CAG AAA AAA TCT GCA 744 Gln Gly Val Tyr Cys Ile Tyr Val Ala Ile Gly Gln Lys Lys Ser Ala 190 195 200 205 ATA GCA AGG ATT ATA GAC AAA CTC AGG CAG TAC GGA GCC TTG GTAC 792 Ile Ala Arg Ile Ile Asp Lys Leu Arg Gln Tyr Gly Ala Leu Glu Tyr 210 215 220 ACC ACG GTG GTG GTG GCT TCC GCA TCC GAT CCC GCC ACA CTC CAG TAC 840 Thr Thr Val Val Val Ala Ser Ala Ser Asp Pro Ala Thr Leu Gln Tyr 225 230 235 ATA GCG CCC TAC GCG GGA TGT GCC ATG GGA GAG TAC TTT GCT TAC TCT 888 Ile Ala Pro Tyr Ala Gly Cys Ala Met Gly Glu Tyr Phe Ala Tyr Ser 240 245 250 GGA AGA GAT GCA CTC GTG GTG TAC GAT GAT CTC TCG AAA CAC GCC GTT 936 Gly Arg Asp Ala Leu Val Val Tyr Asp Asp Leu Ser Lys His Ala Val 255 260 265 GCC TAC AGG CAA CTC TCA CTT CTC ATG AGG AGG CCT CCT GGA AGA GAG 984 Ala Tyr Arg Gln Leu Ser Leu Leu Met Arg Arg Pro Pro Gly Arg Glu 270 275 280 280 285 GCA TAC CCC GGT GAT ATA TTC TAC CTG CAC TCC AGG CTC CTT GAA AGA 1032 Ala Tyr Pro Gly Asp Ile Phe Tyr Leu His Ser Arg Leu Leu Glu Arg 290 295 300 GCG GTT CGA CTG AAC GAC AAA CTC GGT GGT GGT TCT CTG ACG GCA CTC 1080 Ala Val Arg Leu Asn Asp Lys Leu Gly Gly Gly Ser Leu Thr Ala Leu 305 310 315 CCA ATC GTT GGG ACC CAG GCA AAC GAC ATA TCC GCT TAC ATA CCA ACG 1128 Pro Ile Val Gly Thr Gln Ala Asn Asp Ile Ser Ala Tyr Ile Pro Thr 320 325 330 AAC GTG ATA TCC ATC ACA GAT GGA CAG ATC TAC CTC GAA CCC GGC CTG 1176 Asn Val Ile Ser Ile Thr Asp Gly Gln Ile Tyr Leu Glu Pro Gly Leu 335 340 345 TTC TAC GCA GGA CAG AGG CCT GCT ATA AAC GTC GGT CTG TCC GTG TCC 1224 Phe Tyr Ala Gly Gln Arg Pro Ala Ile Asn Val Gly Leu Ser Val Ser 350 355 360 365 AGG GTG GGA GGA GCC GCA CAG ATA AAG GCC ATG AAG CAG GTG GCT GGA 1272 Arg Val Gly Gly Ala Ala Gln Ile Lys Ala Met Lys Gln Val Ala Gly 370 375 380 ATG TTG AGA ATA GAA CTT GCC CAG TAC AGA GAA CTA GAA ACC TTC GCC 1320 Met Leu Arg Ile Glu Leu Ala Gln Tyr Arg Glu Leu Glu Thr Phe Ala 385 390 395 395 CAG TTT GCA ACG GAG CTG GAT CCG GCC ACA AGG GCT CAG ATC GTA AGG 1368 Gln Phe Ala Thr Glu Leu Asp Pro Ala Thr Arg Ala Gln Ile Val Arg 400 405 410 GGT CAA AGA CTC ATG GAA CTT CTG AAA CAG GAA CAA TAC AGT CCA ATG 1416 Gly Gln Arg Leu Met Glu Leu Leu Lys Gln Glu Gln Tyr Ser Pro Met 415 420 425 CCC GTT GAA GAA CAG GTT GTT GTT ATA TTT GCG GGA GTC AGG GGC TAT 1464 Pro Val Glu Glu Glu Gln Val Val Val Ile Phe Ala Gly Val Arg Gly Tyr 430 435 440 445 CTG GAC GAT CTG CCT GTG GAG GCA GTC AGA AGG TTC GAA AAA GAG TTC 1512 Leu Asp Asp Leu Pro Val Glu Ala Val Arg Arg Phe Glu Lys Glu Phe 450 455 460 CTC AGG TTC ATG CAT GAG AAG CAC CAG GAT ATA CTG GAC GAT ATC AGA 1560 Leu Arg Phe Met His Glu Lys His Gln Asp Ile Leu Asp Asp Ile Arg 465 470 475 GAG AAG AAA GAA CTT ACC CCC GAG ACA GAA GAA AAA CTC AAG AAG GCT 1608 Glu Lys Lys Glu Leu Thr Pro Glu Thr Glu Glu Lys Leu Lys Lys Ala 480 485 490 490 ATC GAA GAG TTC AAA GCT GTG TTC AGG GTG TGATGGGAC ATG AGC AGA 1656 Ile Glu Glu Phe Lys Ala Val Phe Arg Val Met Ser Arg 495 500 1 GGT CGA ATG TTA CAG ATA AAA CGG A AA ATA AAC GCC ACA CAA TCT CTC 1704 Gly Arg Met Leu Gln Ile Lys Arg Lys Ile Asn Ala Thr Gln Ser Leu 5 10 15 ATG AAG ATC ACA CGT GCC ATG GAA ATG GTG GCA CGT GCG AAA TCG AGA 1752 Met Lys Ile Thr Arg Ala Met Glu Met Val Ala Arg Ala Lys Ser Arg 20 25 30 35 AAG ATG GAG GCA GAG TAT CAG AAA TTC AAA CCC TTC TAC GAA GAG GTA 1800 Lys Met Glu Ala Glu Tyr Gln Lys Phe Lys Pro Phe Tyr Glu Glu Val 40 45 50 AAA CGT CTT TGG TCA CTG ATA CCG GAT GAG AGT CTC GAT CCA GTC TTC 1848 Lys Arg Leu Trp Ser Leu Ile Pro Asp Glu Ser Leu Asp Pro Val Phe 55 60 65 TTC GAA GAA GGA GAC AGA GAT CTG ATC GTG GTG ATA ACG AGT GAT ATG 1896 Phe Glu Glu Gly Asp Arg Asp Leu Ile Val Val Ile Thr Ser Asp Met 70 75 80 GGA CTC TGT GGT TCT TTC AAC AGC GAA ATC ATA AGA GAA GCA GAG AAG 1944 Gly Leu Cys Gly Ser Phe Asn Ser Glu Ile Ile Arg Glu Ala Glu Lys 85 90 95 GTG ATC TCC GAG TCG AAA AAT CCC CAT CTT ATA CTC ATA GGT CTC AAG 1992 Val Ile Ser Glu Ser Lys Asn Pro His Leu Ile Leu Ile Gly Leu Lys 100 105 110 115 GCA ATA AAC CAT TTC AGA ACG GG G AAC ATT TTG AAG ATG TAC GAT AGA 2040 Ala Ile Asn His Phe Arg Thr Gly Asn Ile Leu Lys Met Tyr Asp Arg 120 125 130 Phe Tyr Glu Ile Pro Asp Phe Arg Asn
Gly Ser Thr Ile Val Glu Asp 135 140 145 ATC TAC GAA TTC ATG GAC GGC AGA CCT GTG AAC GTC AAA GTG GTG TTC 2136 Ile Tyr Glu Phe Met Asp Gly Arg Pro Val Asn Val Lys Val Val Phe 150 155 160 AGT CGA AAC ATA CTC ATT CAA AGA CCA GAG GTG TAC GAT CTC 2184 Ser Arg Phe Lys Asn Ile Leu Ile Gln Arg Pro Glu Val Tyr Asp Leu 165 170 175 ATT CCT CTC AAA AGA AAA GAG AAG AAG AGA GAA GAT TTC GAA TTC GAA 2232 Ile Pro Leu Lys Arg Lys Glu Lys Lys Arg Glu Asp Phe Glu Phe Glu 180 185 190 195 CCT CTT CCT GAG CAA CTC GTT CCC GTC GTA CTC CAT TAC TAC TAT CTG TCT 2280 Pro Leu Pro Glu Gln Leu Val Pro Val Val Leu His Tyr Tyr Leu Ser 200 205 210 ACC ACT TTG ATG GAA CTC ATG TTC CAG ACG AAG ATA GGG GAG TTC TAT 2328 Thr Thr Leu Met Glu Leu Met Phe Gln Thr Lys Ile Gly Glu Phe Tyr 215 220 225 GCC AGA CAG AAC GCC ATG AAG AAC GCA ACC GAC AAC GCC CAG GAA GTG 2376 Ala Arg Gln Asn Ala Met Lys Asn Ala Thr Asp Asn Ala Gln Glu Val 230 235 240 ATC AGA GAG CTG ACA CTG GCT TAC AAC AAA GCA CGT CAG GCT TCG ATC 2424 Ile Arg Glu Leu Thr Leu Ala Tyr Asn Lys Ala Arg Gln Ala Ser Ile 245 250 255 ACC CAG GAA CTC ATA GAG ATA GTG ACG GGT GCT GAA GCA CTG AAG GAA 2472 Thr Gln Glu Leu Ile Glu Ile Val Thr Gly Ala Glu Ala Leu Lys Glu 260 265 270 275 275 ATC GAA AAA TGAGGTGATA CGGT ATG GCA AAG GGT TCA AAA GGA TAC ATA 2522 Ile Glu Lys Met Ala Lys Gly Ser Lys Gly Tyr Ile 1 5 GTG GGA GTG ATG GGG CCC GTC GTGAT GTG AAG TTC CCC GAA GAA GAA 2570 Val Gly Val Met Gly Pro Val Val Asp Val Lys Phe Pro Glu Glu Glu 10 15 20 25 CTT CCA GAC ATA TTC AAC GCC CTT GAG GTC GTG AAT CCT CAA ACG GGG 2618 Leu Pro Asp Ile Phe Asn Ala Leu Glu Val Val Asn Pro Gln Thr Gly 30 35 40 CAG AAG ATT GTT CTT GAA GTA GAA CAA CTC ATA GGA GAC GGT GTC GTG 2666 Gln Lys Ile Val Leu Glu Val Glu Gln Leu Ile Gly Asp Gly Val Val 45 50 55 AGA ACG GTG GCG ATG GAC TCC ACC GAT GGG CTC ATG AAG GGT CTG GAA 2714 Arg Thr Val Ala Met Asp Ser Thr Asp Gly Leu Met Lys Gly Leu Glu 60 65 70 GTG GTT GAT ACG GGT GAA CCA ATT ACC GCT CCC GTG GGA AAA GA A GTA 2762 Val Val Asp Thr Gly Glu Glu Pro Ile Thr Ala Pro Val Gly Lys Glu Val 75 80 85 CTC GGA AGA ATA CTG AAC GTT ATA GGA GAG CCC GTG GAC GAA GCC GGC 2810 Leu Gly Arg Ile Leu Asn Val Ile Gly Glu Pro Val Asp Glu Ala Gly 90 95 100 105 GAG ATA AAG TCG AAG GAA AGG TGG CCG ATC CAC AGG CCT GCT CCT GAA 2858 Glu Ile Lys Ser Lys Glu Arg Trp Pro Ile His Arg Pro Ala Pro Glu 110 115 120 CTT ATA GAA CAG TCC ACC GAG ATC GAA ATC CTC GAG ACG GGG ATA AAA 2906 Leu Ile Glu Gln Ser Thr Glu Ile Glu Ile Leu Glu Thr Gly Ile Lys 125 130 135 GTT ATC GAT CTG CTT GCA CCG TTT CCA AAG GGT GGA AAA ATA GGT TTC 2954 Val Ile Asp Leu Leu Ala Pro Phe Pro Lys Gly Gly Lys Ile Gly Phe 140 145 150 TTC GGT GGT GCA GGT GTT GGT AAA ACC GTG CTC GTT ATG GAA TTG ATC 3002 Phe Gly Gly Ala Gly Val Gly Lys Thr Val Leu Val Met Glu Leu Ile 155 160 165 AGA AAC ATC GCT ATA GAG CAT AAG GGA TTT TCC GTG TTC GCG GGT GTT 3050 Arg Asn Ile Ala Ile Glu His Lys Gly Phe Ser Val Phe Ala Gly Val 170 175 180 185 GGT GAG AGG ACA AGA GAG GGA AAC GAA CTC TGG CTT GAA ATG CAG GAA 3098 Gly Glu Arg Thr Arg Glu Gly Asn Glu Leu Trp Leu Glu Met Gln Glu 190 195 200 AGC GGC GTT CTT GGT AAC ACT ATC CTC GTC TTC GGA CAG ATG AAC GAA 3146 Ser Gly Val Leu Gly Asn Thr Ile Leu Val Phe Gly Gln Met Asn Glu 205 210 215 CCA CCG GGG GCA AGG TTC AGG GTT GCC TTG ACC GCG CTC ACA ATA GCC 3194 Pro Pro Gly Ala Arg Phe Arg Val Ala Leu Thr Ala Leu Thr Ile Ala 220 225 230 GAA TAC TTC AGG GAC GTT GAA GGA AGA GAC GTT CTT CTC TTC ATA GAC 3242 Glu Tyr Phe Arg Asp Val Glu Gly Arg Asp Val Leu Leu Phe Ile Asp 235 240 245 AAC ATA TTC AGG TTC GTT CAG GCG GGA AGT GAG GTT TCT GCT TTT CTT 3290 Asn Ile Phe Arg Phe Val Gln Ala Gly Ser Glu Val Ser Ala Leu Leu 250 255 260 265 GGA AGA ATG CCG TCC GCA GTT GGT TAT CAG CCC ACC CTT GCA ACC GAC 3338 Gly Arg Met Pro Ser Ala Val Gly Tyr Gln Pro Thr Leu Ala Thr Asp 270 275 280 ATG GGA GAG CTC CAG GAG AGA ATC ACC TCG ACC AGG AGA GGA TCC ATC 3386 Met Gly Glu Leu Gln Glu Arg Ile Thr Ser Thr Arg Arg Gly Ser Ile 285 290 295 ACT TCC GTT CAG GCC A TT TAC GTA CCC GCA GAC GAC ATA ACT GAT CCT 3434 Thr Ser Val Gln Ala Ile Tyr Val Pro Ala Asp Asp Ile Thr Asp Pro 300 305 310 Ala Pro Ala Thr Thr Phe Ala His Leu
Asp Ala Thr Val Val Leu Ser 315 320 325 AGA AGA ATA GCA GAG CTC GGG CTT TAC CCT GCT GTT GAC CCG CTC GAT 3530 Arg Arg Ile Ala Glu Leu Gly Leu Tyr Pro Ala Val Asp Pro Leu Asp 330 335 CT 340 CT AAG ATA CTC GAT CCC GCT GTC GTT GGA AGA GAA CAC TAC 3578 Ser Ser Ser Lys Ile Leu Asp Pro Ala Val Val Gly Arg Glu His Tyr 350 355 360 GAA GTG GCA AGA GGT GTT CAG GAA GTA CTC CAG AGG TAC AAG GAC CTG 3626 Glu Val Ala Arg Gly Val Gln Glu Val Leu Gln Arg Tyr Lys Asp Leu 365 370 375 CAG GAT ATC ATA GCC ATC CTC GGT GTA AAG GAG TTG TCT CCG GAG GAC 3674 Gln Asp Ile Ile Ala Ile Leu Gly Val Lys Glu Leu Ser Pro Glu Asp 380 385 390 AAA CTC GTT GTT CAC CGC GCA AGG AGA ATT CAG AGG TTC TTG AGT CAG 3722 Lys Leu Val Val His Arg Ala Arg Arg Ile Gln Arg Phe Leu Ser Gln 395 400 405 CCT TTC CAC GTT GCT GAA AGG TTC ACA GGA AGA CCC GGT AAA TAC GTT 3770 Pro Phe His Val Ala Glu Arg Phe Thr Gly Arg Pro Gly Lys Tyr Val 410 415 420 425 CCT CTT GAG GAG ACG ATC AGA GGT TTC AAA GAG ATC CTC GAT GGA AAG 3818 Pro Leu Glu Glu Thr Ile Arg Gly Phe Lys Glu Ile Leu Asp Gly Lys 430 435 440 CTT GAC GAT GTC CCT GAA CAG GCG TTT CTC ATG GCC GGA ACC ATC GAC 3866 Leu Asp Asp Val Pro Glu Gln Ala Phe Leu Met Ala Gly Thr Ile Asp 445 450 455 GAA GTC AAA GAG CGC GCT AAA GAG ATG AGG AGT TGAAAGCGTG AAGGTGAAGA 3919 Glu Val Lys Glu Arg Ala Lys Glu Met Arg Ser 460 465 TCGTATCACC CTATGGAACG GTTTTCGATCGAGA TGATCGATCGATGGATTGATCGATGGATTGATCGATCGAGATGGTTCGATCGAGATG CATCACACAG CTTTCCGTGT 4039 GTGATGTAAA AATCAAATCT GGTGAAGAGG AGTTTCGTCT CAAAGTTGCA GGTGGTTT 4097

[Brief description of the drawings]

FIG. 1 is a diagram showing the relationship between the enzyme activity of ATPase of the present invention and temperature.

──────────────────────────────────────────────────の Continuing on the front page (51) Int.Cl. ⁶ Identification code FI (C12N 9/14 C12R 1:01) (72) Inventor Tadashi Maruyama 75-1 Hirata, 75-3, Hirata, Kamaishi-shi, Iwate Pref. Marine Biotechnology Research Institute, Kamaishi Laboratory

Claims (4)

[Claims] 1. A thermostable F-type ATPase comprising the following proteins (A), (B) and (C) as subunits: (A) a protein consisting of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 1, and which functions as a subunit of ATPase (B) a protein comprising the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2; A protein having a function as a unit (C) a protein having the amino acid sequence of SEQ ID NO: 3, or an amino acid sequence having one or several amino acids deleted, substituted or added in the amino acid sequence of SEQ ID NO: 3, And a protein that functions as a subunit of ATPase 2. A gene encoding the following protein (a) or (b): (a) a protein comprising the amino acid sequence of SEQ ID NO: 1 (b) an amino acid sequence of SEQ ID NO: 1 in which one or several amino acids have been deleted, substituted or added, and as a subunit of ATPase Protein with the function of 3. A gene encoding the following protein (a) or (b): (a) a protein comprising the amino acid sequence of SEQ ID NO: 2 (b) an amino acid sequence of SEQ ID NO: 2 wherein one or several amino acids are deleted, substituted or added, and as a subunit of ATPase Protein with the function of 4. A gene encoding the following protein (a) or (b): (a) a protein comprising the amino acid sequence of SEQ ID NO: 3 (b) an amino acid sequence of SEQ ID NO: 3 in which one or several amino acids have been deleted, substituted or added, and as a subunit of ATPase Protein with the function of