JPH1175841A - Detection, detecting apparatus and detecting reagent - Google Patents

Abstract

PROBLEM TO BE SOLVED: To detect a substance such as nucleic acid, protein, etc., in high sensitivity, by bonding a first label to a substance, bonding a second label for recognizing the first label to the first label and exhibiting a third label through the second label and obtaining information from the substance having the labels. SOLUTION: A probe 36 having a first label composed of nucleic acid, etc., is bonded to a substance such as a target gene [e.g. hepatitis B virus(HBV), etc.], etc., by hybridization. A branched probe 32 having a second probe composed of nucleic acid for recognizing the first label is bonded to the first label by hybridization. Nucleic acid 33 labeled with ferrocene 31 is bonded to between the branched probe 32, is brought into contact with a nitrocellulose filter 34 having immobilized a probe 35 to specifically bond a target gene to the HBV gene so as to catch the target gene. An electric voltage is impressed through the filter 34 to the substance and an electric current value produced by the ferrocene 31 is measured to detect the substance of the target gene such as HBV, etc., in high sensitivity.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting substances such as nucleic acids, proteins and organochlorine compounds,
The present invention relates to a detection device and a detection reagent.

[0002]

2. Description of the Related Art Generally, genetic information defined by genes is translated into proteins such as enzymes and hormones via messenger RNA, and the living body is maintained by the action of the proteins and enzymes. By the way, the total number of human genes is said to be 50,000 to 100,000. If any abnormality or change (for example, deletion, duplication, etc.) occurs in those genes,
Since the properties, types, amounts, and the like of the protein to be synthesized are changed, or the protein is not synthesized, homeostasis in a biological system cannot be maintained, thereby causing disorders such as various diseases in a living body. Therefore, disease detection and prevention can be performed by detecting a gene provided by a living body. In addition, by detecting genes such as viruses and bacteria present in the living body, the occurrence of diseases caused by the viruses and bacteria can be suppressed, or by quantifying the detected genes, the degree of progression of the diseases can be reduced. You can know.

In recent years, a method of diagnosing or identifying a disease based on a gene (diagnosis of a gene) has become possible with the progress of gene engineering. Also, various antigens, for example,
Detection of antigens such as AFP and CEA used as cancer markers and hormones is performed by using an immunological technique, which is useful for diagnosis of diseases such as cancer.

[0004] In the field of gene diagnosis, the detection sensitivity has been increasing. For example, in gene diagnosis of hepatitis C virus, from the viewpoint of using it as an indicator of the progress of treatment or disease, it is 10 ⁵ to 10. Sensitivity that can detect nucleic acids up to about ⁶ copy / mL is required. Similarly, HI
High detection sensitivity is also required in tests of viruses and bacteria such as V and HBV, detection of oncogenes, and the like, and further higher sensitivity is required. Further, in order to reduce the burden on the patient, the amount of the sample to be collected has been reduced, and in the measurement of blood electrolytes and the like, detection has already been performed from a sample of several microliters. In addition, since proteins such as cancer markers and hormones are present only in minute amounts in living organisms, higher sensitivity is inevitably required for their detection. Conventionally, the above-mentioned substances are labeled with, for example, a chemiluminescent substance, a radioisotope, a fluorescent substance, or the like to obtain a signal from the label, or the substance is amplified by an enzymatic reaction such as polymerase chain reaction (PCR method). Has been detected.

However, the method of obtaining a signal from a label by labeling it with a chemiluminescent substance, a radioisotope, a fluorescent substance or the like has insufficient sensitivity, and it is difficult to cope with the required high sensitivity. There was a problem that is. In addition, in a method of amplifying a substance by an enzymatic reaction such as a PCR method, an expensive enzyme such as Taq polymerase must be used, and there is a problem in that an economic burden required for detection is large.

[0006]

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned prior art, and provides a detection method, a detection apparatus and a detection reagent which are excellent in economical efficiency and operability while detecting a substance with high sensitivity. The purpose is to provide.

[0007]

The detection method according to the present invention comprises a step of binding a first label to a substance, and a step of recognizing the first label with respect to the bound first label.
And a step of presenting a third label via the second label, and a step of acquiring information from a substance provided with each of the labels.

According to the detection method of the present invention, a large amount of amplified information is obtained by binding each label to a substance so as to extend continuously and obtaining information from the substance having each label. Can be obtained, so that the substance can be detected with high sensitivity. Further, in obtaining information, it is only necessary to bond each label to the substance so as to extend continuously, so that it is possible to exhibit excellent economic efficiency and operability.

Further, the detection device according to the present invention comprises: means for binding a first label to a substance;
Means for binding a second label recognizing the first label to the label, and presenting a third label via the second label, and obtaining information from the substance provided with each of the labels And means for performing the following.

According to the detection apparatus of the present invention, there is provided means for linking each label to a substance so as to extend continuously, and means for acquiring information from the substance having each label linked by the means. Is provided, a large amount of amplified information can be obtained, so that a substance can be detected with high sensitivity. Also, in obtaining information,
Since each label is attached to the substance so as to extend continuously, it is possible to exhibit excellent economic efficiency and operability.

Further, the detection reagent according to the present invention is provided with a first label for labeling a substance, a second label for recognizing and binding to the first label, and a label via the second label. And a third marker to be provided.

According to the detection reagent of the present invention, a first label for labeling a substance, a second label that recognizes and binds to the first label, and is presented via the second label And the third label can be attached to the substance so as to extend the first, second, and third labels. It is possible to transmit information. In transmitting information, since each label is bonded to a substance so as to extend continuously, it is possible to exhibit excellent economic efficiency and operability.

In the present invention, substances include nucleic acids such as genes (specific sections having a certain length on the genome: structural genes), various proteins constituting the living body, various antigens and antibodies, lipids, sugars and the like. , Teratogenic substances such as dioxin and PCB, animal toxins such as verotoxin, bee venom and snake venom, LS
D, etc., various electrolytes and their complexes, and the like. Examples of the above substances include blood, leukocytes, serum,
Urine, feces, semen, saliva, cultured cells, tissue cells, microorganisms,
Bacteria, viruses, plants, animals, food, medicines, soil,
It may be derived from any of rivers and seawater. In detecting the above substances, blood, leukocytes, serum, urine, feces, semen, saliva, cultured cells, tissue cells, microorganisms, bacteria, viruses, plants, animals, foods, drugs, soil, rivers, seawater, etc. Can be used directly, but, for example, in genetic diagnosis, a nucleic acid is extracted from the sample using blood or amniotic fluid as a sample, and the nucleic acid is detected. The method of extracting a substance such as a nucleic acid from a sample is not particularly limited as long as an operation that causes a result that hinders detection of the substance is not performed.For example, in detecting a nucleic acid from a sample, a phenol-chloroform method or the like is used. Liquid
Liquid extraction method, solid-liquid extraction method using a carrier or QIAam
Commercially available kits such as p (manufactured by QIAGEN) and Smite Test (manufactured by Sumitomo Metal) can be used.

As the first, second and third labels, various substances such as nucleic acids, proteins, various antigens, antibodies, lipids and sugars can be used.
Must be a combination of substances that recognize and bind to each other. Combinations of labels that recognize and bind to each other include avidin and biotin, DN
Various antigens and antibodies such as P and anti-DNP antibodies, two nucleic acid molecules having complementary base sequences, organic compounds of appropriate size and host-guest molecules such as cyclodextrin, various receptors and antagonist molecules And sulfur-containing molecules such as gold and dithiothreitol, and thiolated nucleic acids. Here, the dissociation constant when the first and second labels bind is preferably 10 ⁻³ mol / L or less from the viewpoint of preventing a decrease in detection sensitivity.
Furthermore, in the present invention, the third label is presented via the second label, and the fourth label that recognizes the third label is bound to the third label, The extension reaction via the label can be performed almost infinitely by causing the fifth label to be presented via the. At this time, the number of labels to be bound to the substance may be appropriately set depending on the amount of the substance, the quality and amount of information obtained from the substance having each label, and the like. In addition, in each stage of the extension reaction after the third label, the combination of labels that recognize and bind to each other can apply the above-described combination, and the binding constant when each substance binds takes the above-described value. It is desirable. Further, each label may be configured such that the whole molecule functions as a label, or may be configured as a molecule having a label in a part of the molecule.

[0015] Here, how to combine the respective labels is as follows.
The first to third signs will be described in detail as examples. As described above, the first and second labels must be a combination that recognizes and binds to each other, and the following combinations can be given as combinations of the respective labels that satisfy this condition. That is, 1) first and third
2) a combination of the first and third labels of different types, 3)
There can be mentioned a combination method in which the second and third labels are the same type of label. Here, the case where each combination method is applied will be examined. First, when the combination method 1) is applied, since the second and third labels can recognize and bind to each other, for example, a molecule having the second and third labels in the same molecule is prepared. The substance can then be modified with multiple second and third labels by successively binding and extending the molecule. At this time, in a molecule having the second and third labels in the same molecule, the molecule must be configured so as to prevent intramolecular binding between the second and third labels. In this case, PBLG between the second and third labeling of the molecule
(Poly-γ-benzyl-L-glutamat
e) or the like, or if the structure of the entire molecule is designed so that intramolecular bonding between the second and third labels does not occur, the molecule between the second and third labels Inner coupling can be prevented. In addition, when the combination of 2) is applied, the third label does not recognize and bind to either of the first and second labels, and therefore the fourth label that recognizes and binds to the third label is used. The substance can be modified with various and many labels by repeating the step of binding the third label to the third label and presenting the fifth label via the fourth label. At this time, all of the labels can be different types of labels, and after the step of binding the fourth and fifth labels, molecules having labels that recognize and bind to each other may be used. Good. When all of the labels are different labels, since intramolecular bonding does not occur in the molecules having the respective labels due to the binding of the mutually recognizing labels, it is possible to design the molecules with a degree of freedom. it can. Further, when the combination of 3) is applied, the third label mutually recognizes and binds to the first label, but does not mutually recognize and binds to the second label. A fourth label (the first label) that mutually recognizes and binds to the label is bound to the third label, and the fifth label (the first label) is presented via the fourth label; A step of binding a sixth label (second label) mutually recognizing and binding to the fifth label to the fifth label and presenting the seventh label (second label) via the sixth label Can be used to modify the substance with multiple labels. At this time, all of the markers can be unified with the first and third (second) markers.
From the step of binding the fourth and fourth labels, a molecule having two labels that recognize and bind to each other may be used. It should be noted that the second and third markers are of the same type,
And the fifth label are the same species (the second and fourth labels are different)
In the case of the above, extension is performed to prevent intermolecular bonding between the molecule having the second and third labels in the molecule and the molecule having the fourth and fifth labels in the molecule. Must-have. Further, in the case where the label is bound to the substance so as to extend continuously, it is possible to appropriately select the combination of the above-described labels as necessary and combine them. Furthermore, by constructing a molecule in which the second label and the third label are provided on the first label that binds to the substance, the molecule can be continuously bound and extended only by using the molecular species. Further, if a plurality of third labels are presented via the second label and the operation is repeated continuously, the substance can be modified with a larger number of each label, and the detection sensitivity of the substance is further improved. be able to. When a plurality of third signs are presented via the second sign,
Since it may be difficult to continuously elongate the label due to steric hindrance based on the higher order structure of the molecule, based on the prediction of the tertiary structure that prevents steric hindrance, the third label via the second label may be used. It is necessary to design a molecule that presents a plurality of labels.

The means for binding the first label to the substance may be appropriately determined based on the type of the substance and the first label, as long as it can provide conditions for binding the substance and the first label. You can choose. For example, when the substance is a gene and the first label is a nucleic acid molecule having a specific base sequence, the first label is provided with a nucleic acid molecule having a base sequence that specifically binds to the substance. By performing hybridization between the substance and the nucleic acid molecule having the first label, the first label can be bound to the nucleic acid molecule. In this case, a means capable of performing hybridization is provided. Just choose. In the case where the first label is bound to the substance based on the antigen-antibody reaction, a means capable of performing the antigen-antibody reaction may be selected.
Means for binding a second label recognizing the first label to the first label and for presenting a third label via the second label include a first label and a second label. Any label can be appropriately selected based on the types of the first and second labels, as long as they can provide conditions for recognizing and binding with each other. For example, when the first label is a nucleic acid molecule having a specific base sequence, a second label having a base sequence that recognizes and specifically binds to the first label and a first label are used.
The second label can be bound to the first label by performing hybridization with the first label. In this case, for example, a means capable of realizing an environment in which hybridization can be performed is selected. do it. Also, when the second label is bound to the first label based on the antigen-antibody reaction, for example, a means capable of realizing an environment in which the antigen-antibody reaction can be performed may be selected. The third label may be present in the same molecule as the second label, or may be present separately from the second label. Must be presented through a second label upon binding.

The information obtained from a substance having a label includes a signal generated from the label, a signal generated from a labeling agent previously immobilized on the label or a molecule provided with the label, and the like. In obtaining such information, for example, a voltage is applied to a substance provided with each label, a method of measuring a signal generated by the applied voltage, or a substance provided with each label is irradiated with ultraviolet light or the like, A method of measuring an optical signal generated by the irradiation of the ultraviolet ray can be used. Means for measuring a signal generated by applying a voltage include, for example, a means for detecting an electric signal such as a current value, an electric conductivity, a potential, a resistance value, an electric capacity, an inductance and an impedance, a fluorescent light, a chemiluminescence, and the like. And means for detecting electrochemiluminescence. As a means for measuring a signal generated by the irradiation of ultraviolet rays, for example, a means for detecting fluorescence can be mentioned.

In order to continuously bind and extend each label to a substance, it is preferable to immobilize the substance on a carrier in advance. This is so that when a washing operation is required when elongating a substance by continuously binding each label, for example, when performing hybridization between nucleic acid molecules, the washing operation can be easily performed. In order to immobilize the substance on a simple substance, for example, electrodes such as gold, silver, copper, titanium, nickel, platinum, carbon, mercury, palladium, optical fiber, crystal oscillator,
If the ISFET and various semiconductor elements are used as a carrier and the substance is immobilized on the carrier, it is easy to detect the information when performing electrical measurement when acquiring information from the substance having each label. Becomes possible. In addition, a carrier generally used for genetic manipulation, such as a nitrocellulose membrane or a nylon membrane, may be used.A microtiter plate made of polypropylene or the like, beads such as polystyrene, latex, magnetic fine particles, gold colloid, or the like may be used as the carrier. Is also possible. Also, the method of immobilization is not particularly limited, and the immobilization can be performed by covalent bonding, physical adsorption, chemical adsorption, or the like. Further, upon immobilization, a substance that specifically binds to a substance, for example, a substance such as an antibody, an antigen or a nucleic acid may be previously bound to a carrier, and the substance may be bound to the carrier via the substance.

Furthermore, the detection reagent according to the present invention may be provided with the above-mentioned first, second and third labels. It is also possible to configure so as to be bound to a carrier and to be provided with the carrier together with the label. Furthermore, it is also possible to provide a buffer, an enzyme, and the like used when performing an extension reaction via a label. The detection reagent is constructed so that it can be sealed and stored so as not to be contaminated with DNase, RNase or various proteases.

[0020]

Embodiments of the present invention will be described below in detail with reference to the drawings.

First, a detection method in which avidin and biotin are applied as the second and third labels and a substance having avidin and biotin in one molecule will be described. In this case, a spacer is arranged between avidin and biotin in the molecule, a rigid molecular structure is formed, or a bond is formed between avidin and biotin so that intramolecular binding is not caused by avidin and biotin in the molecule. Since it is necessary to take a molecular structure that does not have
Avidin and biotin are respectively introduced into the terminal thereof through molecules such as polyamide, polyimide, aramid fiber, steroid, calixarene, and alkene having a helical structure. When introducing avidin and biotin, a plurality of avidin and biotin may be introduced, and it is not always necessary to use the same number. Further, as described above, it is also possible to configure so that avidin and biotin are provided only on different molecules, respectively. At this time, when each label is continuously bound to the substance and extended,
It is preferable that two or more avidins or biotins exist in the same molecule. If necessary, a molecule into which avidin and / or biotin is introduced may be used, for example, a luminescent substance such as luminol and an acridinium ester derivative, a fluorescent substance such as FITC and rhodamine, a ruthenium complex, lucigenin and europium and the like. Pre-labeled with a labeling agent such as an electrochemiluminescent substance, an enzyme such as alkaline phosphatase, peroxidase and glucose oxidase, a hapten such as trinitrobenzenesulfonic acid and dinitrobenzenesulfonic acid, biotin, avidin, a spin labeling agent and a radioisotope. It is also possible to put. Further, as a labeling agent, viologen, Hoechst 33258, Hoechst 33342, pisbenzimidazole, ethidium, ethidium bromide, acridine, aminoacridine, acridine orange, proflavine, erybutycin, actinomycin D, donomycin mitomycin, tris (phenanthroline) zinc complex , Tris (phenanthroline) ruthenium complex, tris (phenanthroline) cobalt complex, di (phenanthroline) zinc complex, di (phenanthroline) ruthenium complex, di (phenanthroline) cobalt complex, bipyridine platinum complex, terpyridine platinum complex, phenanthroline platinum complex, tris (Bipyridyl) zinc complex, tris (bipyridyl) ruthenium complex, tris (bipyridyl) cobalt complex, di (bipyridyl) cobalt Electrochemical such as quinone derivatives such as (zil) zinc complex, di (pipyridyl) ruthenium complex, di (bipyridyl) cobalt complex, ferrocenecarponic acid, ferrocene aldehyde, potassium ferri / ferrocyanide, hydroquinone and caffeic acid Active substances can also be applied. Thus, if information obtained from a large number of labeling agents provided in the substance is obtained, it is possible to detect the substance with high sensitivity. When an intercalating agent exhibiting electrochemically reversible oxidation-reduction is applied, the potential scan is repeated several to several hundred times, so that the oxidation-reduction current can be repeatedly measured, so that the detection signal is effectively amplified. This makes it possible to detect substances with higher sensitivity. For example, when hepatitis B virus (HBV) is detected using a substance having avidin and biotin in the same molecule, a probe A (5 ′) that specifically binds to the HBV gene on a nitrocellulose filter is used. -TCCCTTTCATCCT
GCTGCTATGCCTCATCT-3 ′) is immobilized. Here, a sample containing or suspected of containing HBV and a probe B specifically binding to HBV and having a base sequence different from that of probe A
(5'-GGACTTCTCTCAATTTTCTAG
GG-3 ′) is added for hybridization. The probe B has been labeled with avidin in advance. After the hybridization reaction, a molecule labeled with the fluorescent dye fluorescein and having avidin and biotin introduced via polyethylene having a molecular weight of 1,000 in the same molecule is added. Here, when the molecules are added simultaneously or alternately, the molecules are successively bound by the binding of avidin and biotin, so that a large amount of information (signal) by avidin and biotin can be obtained.
Finally, the HBV gene can be detected by washing the filter and measuring the fluorescence intensity generated from the filter.

When avidin and biotin are applied as the second and third labels, avidin and biotin may be present in different molecules, respectively.
In this case, at least one of avidin and biotin molecules needs to be present in each molecule.
This condition allows for the conversion of avidin and biotin to the second and third
The present invention is not limited to the case where it is used as a label, but is common to all labels that can recognize and bind to each other. For example, a molecule A having two avidins in the same molecule and a molecule B having two biotins in the same molecule are synthesized, and hepatitis B virus (HBV) is detected using the molecules A and B. in case of,
Probe A for HBV on nitrocellulose filter
Is immobilized. Here, a probe containing HBV and a sample containing or suspected of containing HBV are added to perform hybridization. The molecules A and B are labeled with a fluorescent dye (fluorescein) in advance, and the probe B is labeled with avidin in advance. After the hybridization reaction, molecules A and B labeled with a fluorescent dye are alternately or simultaneously added. Finally, the HBV gene can be detected by washing the filter and measuring the fluorescence intensity generated from the filter.

Further, when nucleic acid molecules are used as the second and third labels, for example, the branched probes shown in FIGS. 1 and 2 can be applied for the purpose of improving the detection sensitivity. At this time, 3'-GAGAGAGAGACCCC by the phosphoramidite method using a DNA synthesizer.
After synthesizing a nucleic acid having a base sequence consisting of CCCCCCCC-5 ', for example, a reagent represented by the following general formula is acted twice, and then 3'-CCCCCCCCCCCC
A nucleic acid having a base sequence of CCCAAGTAACC-5 'is synthesized. Then, five branched probes (FIG. 1) can be obtained. In addition, 3
And then 3'-CCCCCCCCCCCC
When a nucleic acid having a base sequence of CCAAGTAACC-5 'is synthesized, a nine-branched branched probe (FIG. 2) can be obtained. Note that the number of times the above-described reagent is allowed to act may be appropriately set according to the number of branches (the number of side chains) required for the branch probe.

[0024]

Embedded image On the other hand, a linear nucleic acid molecule 5'-GGTTCATTGGCTCTCTCTCTC-
3 'is similarly synthesized. If the branch probe and the nucleic acid molecule are alternately added to perform hybridization, the branch probe is extended so that the side chain is further expanded in accordance with the number of branches (side chains). Therefore, the branched probe and / or the linear nucleic acid binding between the branched probes may be labeled with a labeling agent, or the signal amplified by labeling the nucleic acid with the labeling agent at the stage of performing the last hybridization may be used. Once obtained, it is possible to easily detect highly sensitive substances. Of course, in the case of acquiring information (signal) based on a nucleic acid, a highly sensitive substance can be easily and simply detected. In addition, it is desirable to introduce a spacer consisting of 5 or more bases into the nucleic acid immediately after branching, since a linear nucleic acid binding between the branched probes tends to be difficult to bind due to steric hindrance caused by the side chain. . In preparing the branched probe, from the viewpoint of preventing the steric hindrance, it is preferable to prepare the branched probe so as to satisfy the following formula (1). That is, assuming that the number of branches (side chains) in the branched probe is L, the length of the nucleic acid (the number of bases) is n, and the number of reactions with the reagent is m, 10 ³ n (L + 1) (1-L ^m ) / (1
−L) n satisfying <1.3 × 10 ³ n ³ m ³ (1),
It is desirable to produce a branched probe by selecting from combinations of m and L. Furthermore, in this condition, it is desirable that L ^m to prepare a branched probes selected from a combination of maximum. By the above-mentioned branch probe and the nucleic acid binding between the branch probes, hepatitis B virus (HB
When V) is detected, a probe A that specifically binds to the HBV gene is immobilized on a nitrocellulose filter. Here, a sample containing HBV, or a sample containing HBV, a probe C which specifically binds to HBV and a branch probe and has a nucleotide sequence different from that of probe A, a branch probe, and a branch probe Hybridization is carried out by adding a nucleic acid that binds between them. After the hybridization reaction, as shown in FIG. 3, when the nucleic acid 33 that binds between the branch probes 32 is labeled with ferrocene 31, a large amount of information (signal) by the ferrocene 31 can be obtained. Finally, washing the nitrocellulose filter, applying a voltage through the filter and measuring the current value generated from ferrocene,
The HBV gene can be detected. Note that the above hybridization is usually performed at an ionic strength of 0.01 to 0.01.
5, pΗ5 to 10 in a buffer solution. It is possible to add dextran sulfate as a hybridization promoter, carrier nucleic acids such as salmon sperm DNA and bovine thymus DNA, EDII and a surfactant in order to prevent decomposition of the nucleic acids into the buffer. When carrying out the hybridization, if the carrier nucleic acid is mixed, the hybridization may be inhibited.Therefore, care should be taken in adding the carrier nucleic acid, and if necessary, a carrier nucleic acid having a known base sequence may be added. . On the other hand, when the nucleic acid extracted from the sample is DNA, it is heat denatured at 90 ° C. or higher and mixed in a buffer. In addition, after the nucleic acid extracted from the sample is heat-denatured at 90 ° C. or higher, it can be rapidly cooled at 0 ° C. and mixed with the buffer. When the nucleic acid extracted from the sample is RNA, it is not necessary to perform heat denaturation. During the hybridization, it is also possible to increase the reaction rate by performing operations such as stirring or shaking.
Then, hybridization may be performed at 10 to 90 ° C. for a reaction time of about 1 minute to about 1 night.

FIG. 4 is a diagram showing an embodiment of a detection device using electrodes. In FIG. 4, reference numeral 41 denotes an electrode on which a probe 42 that specifically binds to a substance is immobilized;
Reference numeral 3 denotes a reaction tank, and the power supply 44 is connected to the electrode 41 and the reaction tank 4.
3 are connected to form a circuit. Further, an ammeter 45, a voltmeter 46, and a variable resistor 47 are disposed inside the circuit, and after a reaction such as hybridization is performed in the reaction tank 43, a voltage or the like is applied to supply a current or the like flowing through the circuit. It is configured to measure. Note that the solution held in the reaction tank 43 can be easily replaced, and at the time of measurement, the inside of the reaction tank 43 can be replaced with a fresh hybridization solution or the like. According to the detection device shown in FIG. 4, a buffer (for example, a hybridization solution), a substance or a sample including the substance and the first to third labels are held inside the reaction tank 43, and a high A reaction such as hybridization is performed to bind the two. At this time,
When hybridization is performed, the temperature and time of the hybridization are desirably set as described above. In addition, antigen-antibody reactions and guest-
In the case of a reaction between a host and the like, reaction conditions may be appropriately set. Next, preferably, the reaction tank 43 and the electrode 41 are washed, the inside of the reaction tank 43 is filled with a fresh solution (for example, a hybridization solution), the power supply 44 is operated, and the current value or the voltage value is measured by the ammeter 45 or the like. It measures using the voltmeter 46. Then, from the measurement result, the presence and amount (concentration) of the substance contained in the sample are calculated. As described above, the detection sensitivity can be further improved by using various labeling agents. Here, the above-mentioned electrode can have the configuration shown in FIGS. 5 and 6, for example. FIGS. 5 and 6 are top views (FIGS. 5 (a) and 6 (a)) showing an example of the configuration of the electrode, and FIGS.
FIG. 6B and FIG.
(B)). In FIG. 5, a conductor 51 is formed on a substrate 52 which forms the basis of an electrode. Then, after an insulator 54 is formed on part of the conductor 51 and the substrate 52, an opening 53 made of a conductor that is opened and exposed by photolithography is formed. Also, in FIG. 6, an adhesive layer 5 is first placed on a substrate 52 which forms the basis of an electrode.
5 are formed. Then, the conductor 5 is formed on the adhesive layer 55.
After the formation of No. 1, an opening 53 made of a conductive material that is opened and exposed by photolithography is formed.

FIGS. 7 and 8 are views showing the configuration of an embodiment of a detection apparatus which is completely automated using the above-mentioned electrodes.

In FIG. 7 and FIG. 8, the detecting device comprises an electrode holder having the above-mentioned electrode, a reaction section having a variable temperature reaction vessel for reacting the above-mentioned electrode and a sample (substance), (A continuous elongation reaction of the label by hybridization, antigen-antibody reaction, etc.) A first washing unit equipped with a variable temperature washing tank for washing the electrode after washing, and the washed electrode after the reaction is inserted into an intercalating agent or the like. For reacting with a labeling agent, a labeling agent reaction unit having a temperature-variable labeling agent solution tank, and a second washing unit having a temperature-variable cleaning tank for washing the electrode after the reaction with the labeling agent, An electrochemical measurement unit for performing an electrochemical measurement of the cleaned electrode after the reaction with the agent, an analysis unit for analyzing data obtained by the electrochemical measurement, and a series of reactions (hybridization Continuous extension reaction labeling with internalization and antigen-antibody reaction and the like), washing, reaction with the labeling agent,
Cleaning, an operation unit for controlling the electrochemical measurement, and the above-described reaction unit, a first cleaning unit, a labeling agent reaction unit, a second cleaning unit, a moving device having an electrochemical measurement unit placed adjacent thereto. Have. Note that the detection device further includes a loading port for loading a detection sample (sample), a sample adjustment unit for extracting nucleic acids and the like from the sample, and a gap between the loading port and the sample preparation unit. A transport unit that moves the sample between the sample preparation unit and the reaction unit, and is generated at the time of the above-described reaction (continuous elongation reaction of the label by hybridization, antigen-antibody reaction, etc.), washing, and intercalating agent reaction. It is preferable that a waste storage unit for storing waste liquid is provided.

The detecting device 70 shown in FIG. 7 comprises an electrode fixing holder 71 for holding the above-mentioned electrodes, a reaction tank 72,
A washing tank 73, a labeling agent reaction tank 74, a second washing tank 75 and an electrochemical measurement tank 76, and a reaction tank 72, a washing tank 73,
Inserting agent reaction tank 74, washing tank 75, and electrochemical measurement tank 7
6 is provided with a moving device 77, and an analysis unit 78 and an operation unit 79. The movement of the electrode between these tanks is achieved by moving the reaction tank or the like using the moving device 77. A solution containing a sample or a substance such as a nucleic acid previously extracted from the sample is put in the reaction tank 72, and the electrode fixed to the electrode fixing holder 71 is immersed in the reaction tank 72. Next, in the reaction tank 72, the step of performing the extension reaction by binding the substance to the electrode having the probe immobilized thereon and continuously binding the label to the substance, a washing step, a labeling agent reaction step, and a washing step And an electrochemical process are sequentially performed. In the next first cleaning tank 73, the electrodes are usually
Washing is performed while controlling the temperature between 5 ° C and 80 ° C. By this step, nucleic acids, proteins, and the like that are nonspecifically bound to the electrodes can be removed. Next, in the labeling agent solution tank 74,
The washed electrode is controlled at a temperature between 25 ° C. and 80 ° C. to cause a reaction between the labeling agent and the substance-labeled complex formed on the electrode. In the next second cleaning tank 75, the electrodes are
The washing is performed while controlling the temperature between 80 ° C and 80 ° C. Furthermore,
Electrical measurement is performed in the electrochemical measurement tank 76. After the measurement, the substance to be detected (for example, a gene or the like) in the sample is referred to with reference to the calibration curve recorded in advance in the analysis unit 78.
Is output. The above operation is performed by the operation unit 7 electrically connected to each tank and unit.
9 through. The detection device 80 shown in FIG.
In addition to the detection device shown in FIG. 7, the sample loading port 81, the sample preparation unit 83, the space between the sample loading port 81 and the sample preparation unit 83, and the sample preparation unit 83 and the detection device 70 A sample transport unit 82 connecting
And a waste storage unit 87. In this embodiment, after the sample is put into the sample loading port 81, the sample is carried to the sample preparation unit 83 through the sample transport unit 82, and the sample preparation unit 83 extracts substances such as nucleic acids and removes cells. Is performed. The extracted substance is conveyed to the detection device 70 through the sample transport unit 82, and the above-described detection is performed. The waste storage unit 85 temporarily stores waste generated in the cleaning process and the like. In the above embodiment, the electrodes are held in the electrode fixing holder, and the electrical measurement is performed in the electrochemical measurement tank. However, a microtiter plate can be used instead of the electrodes, and the electrochemical measurement can be performed. It is also possible to mount an optical device for performing optical measurement instead of the measurement tank, and each configuration of the detection device may be appropriately set in consideration of the substance used for detection and the amount and quality of information to be detected. Good.

FIGS. 9, 10 and 11 are diagrams showing the configuration of an embodiment of the detection reagent. As shown in FIG. 9, the detection reagent 90 has an opening 53 having a diameter of 0.3 mm.
Are provided, and the gold electrodes 50 and the tubes 91 and 92 have, for example, the following configuration. That is, as an HBV gene detection reagent, a 20-mer probe A (5′-TCCCTTCCATCCTGGCTGCTA having a base sequence complementary to the base sequence of HBV in the opening 53
TGCCCTCATCT-3 ') was immobilized and the tube 9
Probe B (5′-GGACTT 1) has a base sequence complementary to the base sequence of HBV and is labeled with avidin.
CTCTCAATTTTCTAGGG-3 ′) is housed in the tube 92, and a PB having a molecular weight of 1000
Avidin and biotin are introduced into the terminal of the LG molecule, and the molecule C labeled with Hoechst 33258 is housed therein. Further, as another HBV gene detection reagent,
A 20-mer probe A having a base sequence complementary to the HBV base sequence was immobilized in the opening 53, and the tube 91 was provided with a base sequence complementary to the HBV base sequence and labeled with avidin. Probe B (5'-GGAC
TTCTCTCAATTTTCTAGGG-3 ′) is housed, and the tube 92 contains a plurality of molecules of biotin in the same molecule and a molecule D of ferrocene-labeled molecule D and a molecule E of ferrocene-labeled avidin. The molecule E is polyethyleneimine and N-su
It can be obtained by reacting ccinimidyl D-biotin with carboxyferrocene. Furthermore, as an HCV gene detection reagent, a 20-mer probe D (5′-C) having a nucleotide sequence complementary to the nucleotide sequence of HCV in the opening 53.
CTGTGAGGAACTACTGTC-3 ′) was immobilized, and a probe E (5′-TTCACGC) having a nucleotide sequence complementary to the HCV nucleotide sequence was immobilized on the tube 91.
AGAAAGCGCTCTAGCTCTCTCTCT-
3 ′) is housed therein, and the tube 92 has a branched probe that binds to the probe E and a probe F (5′-G) that is labeled with ferrocene and binds the branched probes.
GTTCATGGCTCTCTCTCT-3 ′).

Further, as shown in FIG.
Reference numeral 00 denotes a tube 101 containing latex beads on which an antiserum antibody is immobilized, a tube 102 containing an avidin-labeled anti-AFP antibody, and a PBL having a molecular weight of 10,000.
A tube 103 containing a substance F provided with avidin and biotin via G and labeled with HRP enzyme, and HR
Tube 104 containing ABTS as substrate for P enzyme
It is composed of Further, as shown in FIG. 11, the detection reagent 110 comprises a 20-mer probe G (5′-ATAATCCACCCTACCCCAG) having a base sequence complementary to the base sequence of HIV in each well 111.
TAGGAGAAAT-3 ′: SK38) immobilized on a microtiter plate 112, a probe H (5′-TTTGGTCCTCTGTC) having a nucleotide sequence complementary to the HIV nucleotide sequence by introducing a thiol group at the 5 ′ end.
TTATGTCCAGAATGC-3 ': SK39), a tube 114 containing gold colloid particles, and a tube 115 containing dithiothreitol. Note that the detection reagent according to the present invention is not limited to the above embodiment, and the type and storage form of the label may be appropriately set according to the substance to be detected or the characteristics of the label. Needless to say.

Example 1 HBV was detected from serum using the detection apparatus described in the embodiment. First, a serum component was separated from human peripheral venous blood to extract nucleic acids. On the other hand, a 20-mer probe A (5′-TC) having a base sequence complementary to the base sequence of HBV
CCTTTCATCCCTGCTGCTATGCCTCA
TCT-3 ′) has a thiol group introduced at the 5 ′ end,
It is fixed to the opening of the gold electrode shown in FIG. 5 by chemical adsorption. Next, a sample containing an HBV nucleic acid and a probe B having a base sequence complementary to the HBV base sequence
(5'-GGACTTCTCTCAATTTTCTAG
GG-3 ′) was added to perform hybridization. The probe B is labeled with avidin in advance. After the hybridization reaction, a molecular weight of 10
Avidin and biotin were introduced into the ends of the PBLG molecule of No. 00, and a molecule labeled with Hoechst 33258 was added. After washing, electrochemical measurement (cyclic voltammetry) was performed in a phosphate buffer to measure a current value. . Also,
HBV detection was evaluated from the obtained current values. Note that H
When a sample containing no BV was used, a current value of 50 nA was observed as a background current. In contrast, when a sample containing 1000 copies of HBV was used, a current value derived from Hoechst 33258 of 100 nA was obtained. Therefore, it was confirmed that nucleic acids derived from HBV of 1000 copies or more can be detected.

Example 2 Nucleic acids were extracted by separating serum components from human peripheral venous blood. On the other hand, a 20-mer probe A (5′-TCCCTTCCATCCTGCTG having a nucleotide sequence complementary to the nucleotide sequence of HBV
A thiol group was introduced at the 5 ′ end of CTATGCCTCATCT-3 ′) and immobilized by chemisorption at the opening of the gold electrode shown in FIG. Next, a sample containing an HBV nucleic acid and a probe B (5′-GGACTTCTCTCAATTT) having a base sequence complementary to the base sequence of HBV
The hybridization was carried out by adding TCTAGGG-3 ′). The probe B is labeled with avidin in advance. After the hybridization reaction,
Four molecules of avidin in the same molecule and a molecule F labeled with ferrocene, and four molecules of biotin in the same molecule and a molecule G labeled with ferrocene are added, and after washing, electrochemically in a phosphate buffer. Measurement (cyclic voltammetry)
And the current value was measured. The HBV detection was evaluated from the obtained current value. When a sample containing no HBV was used, a background current of 10 n
The current value of A was observed. On the other hand, HBV is 100
In the case of the sample containing 00 copies, a current value derived from 100 nA of ferrocene was obtained. Therefore, it was confirmed that nucleic acid derived from HBV of 10,000 copies or more can be detected.

Example 3 Nucleic acids were extracted by separating serum components from human peripheral venous blood. On the other hand, a 20-mer probe A (5′-TCCCTTCCATCCTGCTG having a nucleotide sequence complementary to the nucleotide sequence of HBV
A thiol group was introduced at the 5 ′ end of CTATGCCTCATCT-3 ′) and immobilized by chemisorption at the opening of the gold electrode shown in FIG. Next, a sample containing an HBV nucleic acid and a probe B (5′-GGACTTCTCTCAATTT) having a base sequence complementary to the base sequence of HBV
The hybridization was carried out by adding TCTAGGG-3 ′). The probe B is labeled with avidin in advance. After the hybridization reaction,
A molecule H containing two avidins in the same molecule and labeled with ferrocene is added and washed, and biotin is added in the same molecule.
In addition, molecule I labeled with ferrocene was added. The above elongation reaction by molecule H and molecule I is repeated 30 times,
After washing, an electrochemical measurement (cyclic voltammetry) was performed in a phosphate buffer to measure a current value. The HBV detection was evaluated from the obtained current value. When a sample containing no HBV was used, a current value of 10 nA was observed as a background current. In contrast, a sample containing 5000 copies of HBV
A current value derived from nA ferrocene was obtained. Therefore, it was confirmed that 5000 or more copies of HBV-derived nucleic acids could be detected.

Example 4 Serum components were separated from human peripheral venous blood and reacted with latex beads on which antiserum antibodies had been immobilized in advance. Next, the latex beads were reacted with an anti-AFP antibody labeled with avidin, and after washing, a molecule J comprising avidin and biotin was added via PBLG having a molecular weight of 10,000. Note that the molecule J
Is previously labeled with the HRP enzyme. After the above reaction, washing was performed, the substrate ABTS was added, and the absorbance was measured. The detection of HBV was evaluated from the obtained absorbance. As a result, in the case of a sample containing 0.1 pg of AFP, A
The change in absorbance was significantly observed as compared with the case where the sample containing no FP was used. Therefore, it was confirmed that AFP of 0.1 pg or more could be detected.

Example 5 Nucleic acids were extracted by separating serum components from human peripheral venous blood. On the other hand, a 20-mer probe D (5'-CCTGTGAGGAACTACTG) having a base sequence complementary to the base sequence of HCV
By introducing a thiol group at the 5 ′ end of TC-3 ′), FIG.
And immobilized on the opening of the gold electrode by chemical adsorption. next,
A sample containing an HCV nucleic acid and a probe E (5′-TT) having a base sequence complementary to the base sequence of HCV
CACGCAGAAAGCGTCTAGCTCTCTC
TCT-3 ′) was added to perform hybridization. Next, a branched probe having the structure shown in FIG. 1 and a probe F (5'-GGTTCATTGGCCTCT labeled with ferrocene for continuously extending the branched probe are used.
And CTCTCT-3 ′) were alternately added and hybridization was performed 10 times. After the hybridization reaction, washing was performed, and an electrochemical measurement (cyclic voltammetry) was performed in a phosphate buffer to measure a current value. The detection of HCV was evaluated from the obtained current value. When a sample containing no HCV was used, a current value of 50 nA was observed as a background current. In contrast, when a sample containing 1000 copies of HCV was used, a current value derived from 100 nA of ferrocene was obtained. Therefore, it was confirmed that a nucleic acid derived from HCV of 1000 copies or more can be detected.

Example 6 Nucleic acids were extracted by separating serum components from human peripheral venous blood. On the other hand, a 20-mer probe D (5'-CCTGTGAGGAACTACTG) having a base sequence complementary to the base sequence of HCV
By introducing a thiol group at the 5 ′ end of TC-3 ′), FIG.
And immobilized on the opening of the gold electrode by chemical adsorption. next,
A sample containing an HCV nucleic acid and a probe E (5′-TT) having a base sequence complementary to the base sequence of HCV
CACGCAGAAAGCGTCTAGCTCTCTC
TCT-3 ′) was added to perform hybridization. Next, a branched probe having the structure shown in FIG. 2 and a probe F (5′-GGTTCATTGGCCTCT) labeled with ferrocene to continuously extend the branched probe are used.
And CTCTCT-3 ′) were alternately added and hybridization was performed 10 times. Furthermore, the probe G labeled with ferrocene (5′-GGTTCATT
GG-3 ′) was added and hybridization was carried out.
After the hybridization reaction, washing was performed, and the current value was measured by electrochemical measurement (cyclic voltammetry) in a phosphate buffer. The detection of HCV was evaluated from the obtained current value. When a sample containing no HCV was used, the background current was 50%.
A current value of nA was observed. In contrast, HCV is 1000
When a sample containing a copy was used, a current value derived from 100 nA of ferrocene was obtained. Therefore, 10
It was confirmed that nucleic acids derived from HCV of 00 copies or more can be detected.

Example 7 Nucleic acids were extracted by separating serum components from human peripheral venous blood. On the other hand, a 20-mer probe H (5'-ATAATCCACCCTACCCCAG with a base sequence complementary to the HIV base sequence)
(TAGGAGAAAT-3 ': SK38) was immobilized on the bottom of a well of a microtiter plate by chemisorption. Next, a probe I (5′-TTTGGT) having a sample containing an HIV nucleic acid and a base sequence complementary to the base sequence of HIV and having a thiol group introduced at the 5 ′ end.
CCTTGTCTTATGTCCAGAATGC-
3 ′: SK39) was added to perform hybridization. Next, colloidal gold particles were added and washed to react dithiothreitol. After the addition of the colloidal gold particles and the reaction with dithiothreitol were repeated 10 times, the degree of aggregation of the colloidal gold was confirmed. When a sample containing no HIV was used, aggregates of colloidal gold were hardly observed. On the other hand, when a sample containing 1000 copies of HIV was used, aggregates of colloidal gold were largely grown. Therefore, it was confirmed that 1,000 or more copies of the nucleic acid derived from HIV can be detected.

Example 8 An anti-dioxin antibody was bound to the bottom of a well of a microtiter plate. Next, biotin-labeled dioxin and a sample presumed to contain dioxin were added to the wells of the microtiter plate and reacted at 37 ° C. for 1 hour.
After washing, avidin and substance K having a plurality of biotins in the same molecule were alternately added 10 times. The substance K is composed of polyethyleneimine and 5- (n-succinimidyloxy
It was obtained by reacting with carbonyl) pentyl D-biotinamide.
Finally, a biotin-labeled HRP enzyme is reacted, and HR
Color development based on the enzymatic reaction between the P enzyme and the substrate ABTS was detected. As a result of the detection, when the sample containing 0.1 pg of dioxin was used, a significant change in absorbance was confirmed as compared with the case where a sample containing no dioxin was used. Therefore, it was confirmed that dioxin of 0.1 pg or more can be detected.

Example 9 An anti-verotoxin antibody was bound to the bottom of a well of a microtiter plate. Next, a biotin-labeled verotoxin and a sample suspected of containing verotoxin were added to the wells of the microtiter plate and reacted at 37 ° C. for 1 hour. After washing, avidin and substance K having a plurality of biotins in the same molecule were alternately added 10 times. Finally, a biotin-labeled HRP enzyme was reacted, and color development based on the enzymatic reaction between the HRP enzyme and the substrate ABTS was detected. As a result of the detection, when the sample containing 0.1 pg of verotoxin was used, a significant change in absorbance was confirmed as compared with the case where a sample containing no verotoxin was used. Therefore, 0.1p
It was confirmed that g or more of verotoxin could be detected.

Example 10 An anti-Escherichia coli antibody was bound to the bottom of a well of a microtiter plate. Next, a biotin-labeled anti-O-157 antibody and a sample presumed to contain E. coli were added to the wells of the microtiter plate and reacted at 37 ° C. for 1 hour. After washing
Avidin and substance K having a plurality of biotins in the same molecule were alternately added 10 times. Finally, a biotin-labeled HRP enzyme is reacted, and the HRP enzyme and the substrate AB are reacted.
Color development based on the enzymatic reaction with TS was detected. As a result of the detection, when the sample containing 100 Escherichia coli O-157 was used, a significant change in absorbance was confirmed as compared with the case where a sample containing no Escherichia coli O-157 was used. Therefore, it was confirmed that 100 or more E. coli O-157 could be detected.

Example 11 An anti-Escherichia coli antibody was bound to the bottom of a well of a microtiter plate. Next, a biotin-labeled anti-O-157 antibody and a sample presumed to contain E. coli were added to the wells of the microtiter plate and reacted at 37 ° C. for 1 hour. After washing
O-157 serum and O-157 antibody were alternately added 10 times. Finally, the anti-O-
157 antibody was reacted, and color development based on the enzymatic reaction between the HRP enzyme and the substrate ABTS was detected. As a result of the detection, when the sample containing 100 Escherichia coli O-157 was used, a significant change in absorbance was confirmed as compared with the case where a sample containing no Escherichia coli O-157 was used. Therefore, it was confirmed that 100 or more E. coli O-157 could be detected.

[0042]

As described above in detail, according to the detection method of the present invention, each label is linked to the substance so as to extend continuously, and information is obtained from the substance having each label. By doing so, a large amount of amplified information can be obtained, so that a detection method capable of detecting a substance with high sensitivity can be provided. In addition, in order to obtain information, it is only necessary to bond each label to a substance so as to extend continuously, so that it is possible to provide a detection method capable of exhibiting excellent economic efficiency and operability. it can.

Further, according to the detection apparatus of the present invention, a means is provided for binding each label to the substance so as to extend continuously, and information is obtained from the substance provided with each label bound by the means. Since a large amount of amplified information can be obtained by providing such a means, a detection device capable of detecting a substance with high sensitivity can be provided. In addition, in obtaining information, a detection device capable of exhibiting excellent economic efficiency and operability can be provided because each label is bonded to a substance so as to extend continuously.

Further, according to the detection reagent of the present invention,
A first label for labeling the substance, and recognizing the first label;
And a second label to be bound and a third label presented via the second label, so that the first, second and third labels are bound to the substance so as to be extended. Therefore, it is possible to provide a detection reagent capable of transmitting a large amount of information amplified from a substance provided with each label. In transmitting information, since each label is bonded to a substance so as to extend continuously, it is possible to provide a detection reagent capable of exhibiting excellent economic efficiency and operability.

[Brief description of the drawings]

FIG. 1 is a diagram showing a configuration of a branch probe.

FIG. 2 is a diagram showing a configuration of a branch probe.

FIG. 3 is a schematic diagram when hybridization is performed using a branched probe.

FIG. 4 is a diagram showing an embodiment of a detection device.

FIG. 5 is a diagram showing a configuration example of an electrode.

FIG. 6 is a diagram showing a configuration example of an electrode.

FIG. 7 is a diagram showing one embodiment of a detection device provided with electrodes.

FIG. 8 is a diagram showing one embodiment of a detection device provided with electrodes.

FIG. 9 is a diagram showing one embodiment of a detection reagent.

FIG. 10 is a diagram showing one embodiment of a detection reagent.

FIG. 11 is a diagram showing one embodiment of a detection reagent.

[Explanation of symbols]

10, 20 ... branch probe 31 ... ferrocene 32 branch probe 33 ...
Nucleic acid 34 Nitrocellulose filter 35 Probe A 36 Probe C 41 Electrode 42 Probe 43 Reaction tank 44 Power supply 45 Ammeter 46 Voltmeter 51 Conductor 52 ... Substrate 53 ... Opening 54 ... Insulator 55 ... Adhesive layer 70,80 ... Detector 71 ... Electrode fixing holder 72 ... Reaction tank 73 ... First cleaning tank 74 ... Inserting agent solution tank 74: Labeling agent solution tank 75: Second washing tank 76
... Electrochemical measurement tank 77 ... Transfer device 78 ... Analysis unit 79 ...
... Operation unit 81 ... Sample loading port 82 ... Sample transport unit 83 ... Sample preparation unit 84 ... Control unit 85 ... Waste storage unit 86 ... Waste liquid storage unit 87 ... Reagent supply unit 88 ... Analysis unit 90, 100, 110 detection reagents 91, 92, 101 to 104, 113 to 115 tubes 111 wells 112 microtiter plate

Claims (3)

[Claims] 1. a step of binding a first label to a substance; binding a second label recognizing the first label to the bound first label; and the second label A step of presenting a third label via a computer, and a step of acquiring information from a substance provided with each of the labels. 2. A means for binding a first label to a substance, a second label recognizing the first label is bound to the bound first label, and the second label is bound to the first label. A detection device, comprising: means for presenting a third marker via a computer; and means for acquiring information from a substance provided with each of the markers. 3. a first label for labeling a substance; a second label that recognizes and binds to the first label; a third label presented via the second label; A detection reagent characterized by comprising: