JPH11507811A - Human cystatin E - Google Patents

Abstract

  (57) [Summary] Disclosed are human CysE polypeptides, and DNA (RNA) encoding such polypeptides. Procedures for producing such polypeptides by recombinant techniques are also disclosed. Also disclosed are methods for utilizing such polypeptides to treat osteoporosis, tumor metastasis, bacterial infection, viral infection, septic shock, inflammation, retinal hypersensitivity, caries, cachexia, and muscle wasting. I do. Also disclosed are diagnostic methods for detecting mutations in the coding sequence and changes in the concentration of the polypeptide in a sample derived from the host.

Description

DETAILED DESCRIPTION OF THE INVENTION                             Human cystatin E   The present invention relates to newly identified polynucleotides, such polynucleotides Polypeptides, such polynucleotides and polypeptides For the use of tides and the production of such polynucleotides and polypeptides Related. More specifically, the polypeptide of the present invention is putative as human cystatin E. And is sometimes referred to herein as "CysE". The present invention Also relates to inhibiting the action of such polypeptides.   The cystatin superfamily is a cysteine proteinase inhibitor Which are widely distributed in human tissues and fluids, and The rigid and reversible complex is converted to cysteines such as cathepsins B, H, L and S. Form with proteinase. Cystatin is involved in these proteinases. It is most likely involved in the regulation of normal or pathological processes. Obedience Therefore, cystatin affects the intracellular and extracellular catabolism of proteins and peptides. (Barret, A.J. and Kirchke, H.,Methods Enzymol., 80: 535-56 1 (1981)), prohormone (Orlowski, M.,Mol . Cell. Biochem., 52: 49-74 (198 3)) and proenzymes (Taugner, R. et al., Histochemistry, 83: 103-108 (1985)). It can regulate proteolytic processing and can be used in malignant cells (Sloane, BF,Semin . C ancer Biol. , 1: 137-152 (1990)) or microorganisms (Bjorck, L. et al.,Nature, 337: 38 5-386 (1989) and Bjorck, L. et al.J . Virol., 64: 941-943 (1990)) Can protect against vesicle invasion, and can be used to Seth (Mort, J.S. et al.Arthritis Rheum.27: 509-515 (1984)) and purulent qi. Bronchiectasis (Buttle, DJ, et al.,Scand . J. Clin. Lab. Invest., 50: 509-516 (1990 )) Can be adjusted.   The cystatin superfamily includes families I, II, and III (each And the Stefin family, the Cystatin family, and the Kininogen family (Also called Lee), each with members of the other family It has different members in its structural organization and biological distribution (Barret, A.J. Et al.,Biochem . J.236: 312 (1986)). Family I cystatins A and B are simply It consists of a polypeptide chain of about 100 amino acid residues and has no disulfide bridge. No. Family II cystatins consist of a polypeptide chain of about 120 amino acid residues. And has two intrachain disulfide bonds. Finally, Family III cystatins Kininogen is due to the presence of three family II cystatin-like domains. Exhibit a high degree of structural complexity, as characterized by Each domain is 2 With two disulfide bridges at positions homologous to Family II cystatins (Mull er-Esterl, W. et al.Transbiochem . Sci., 11: 336-339 (1986)). Family I And II cystatins are mainly present intracellularly and in secretions (Abrahamson, M .; J. et al. Biol. Chem., 261: 11282-11289 (1986)), whereas kininogen is Highly concentrated in blood plasma (Adam, A. et al.,Clin . Chem., 31: 423-426 ( 1985)).   At least one type II cystatin, designated cystatin C, It appears to be expressed in all tissues (Abrahamson, M. et al.Biochem . J., 2 68: 287-294 (1990)). In contrast, S-type cystatins dominantly appear in saliva. (Abrahamson, M. et al., J. Biol. Chem., 261: 11282-11289 (1986)). Shi Statins and derived peptides have antibacterial and antiviral activity (Bjor ck et al. (1989, 1990)), which wet the surface of epithelia where they were directly exposed to the environment. Is consistent with its presence in secretions. Cystatin also modulates the immune response. You can save. This inhibits the release of cystatin protease by macrophages By doing (Bieth, J.,Cysteine Proteinases and Their Inhibitors , V. Turk, ed. (Walter De Gruyter & Company, New York) 693-703 (1986)) Possible indirect or chemotactic response and phagocytosis of cells By inhibiting the respiratory burst of (Leung-Tack et al.,Biol . Chem . , 371: 255-258 (1990)), which can occur indirectly. This data is based on Type II system It suggests that tin may perform various protective functions on epithelial surfaces. Human type II The statin gene family consists of at least seven members.   Hereditary cystatin C amyloid vasculopathy (HCCAA) disease Related to the Glu → Leu mutation in the gene to be loaded. This is the cerebral artery It leads to the deposition of amyloid fibrils consisting of mutant cystatin C. This can cause fatal bleeding (Ghiso, J. et al.PNAS , USA,83: 2974-2978 (1986)).   The polypeptides of the present invention result from amino acid sequence homology with cystatin C. Presumably identified as CysE. This identification is a consequence of amino acid sequence homology. It was made as.   According to one aspect of the invention, novel mature polypeptides, as well as their production Fragments, analogs and derivatives that are physically active and useful for diagnosis or therapy A conductor is provided. The polypeptides of the present invention are of human origin.   According to another aspect of the present invention, an isolated nucleus encoding a polypeptide of the present invention. An acid molecule is provided, the nucleic acid molecule comprising mRNA, DNA, cDNA, genomic DNA, and DNA. Nalogs and their flags that are biologically active and useful for diagnosis or treatment Including statements.   According to yet a further aspect of the invention, a human encoding a polypeptide of the invention Recombinant prokaryotic and / or eukaryotic host cell containing the nucleic acid sequence Conditions that promote expression of the protein and subsequent recovery of the protein Below, such polypeptides are produced by recombinant techniques, including the step of culturing. A process is provided for producing.   According to a still further aspect of the invention, such a polypeptide, or such a polypeptide. Polynucleotides encoding such polypeptides may be used for therapeutic purposes, e. To inhibit psin, as well as osteoporosis, tumor metastasis, viral replication, inflammation To prevent bronchiectasis of suppuration, to protect the retina, to prevent leukoencephalopathy To reduce caries, treat allergic reactions, For treating wasting and for preventing amyloidosis, and for antimicrobial A process for utilizing as an agent is provided.   According to yet a further aspect of the invention, a nucleic acid encoding a polypeptide of the invention Nucleic acid probes containing nucleic acid molecules of sufficient length to specifically hybridize to a sequence Is also provided.   According to yet a further aspect of the invention, antibodies against such polypeptides are Provided.   According to yet another aspect of the invention, a nucleic acid sequence encoding a polypeptide of the invention For detecting diseases or susceptibility to diseases associated with mutations in An assay is provided.   According to a still further aspect of the invention, such a polypeptide, or such a polypeptide. Polynucleotides encoding such polypeptides can be used in scientific studies, such as DNA For in vitro purposes related to DNA synthesis and DNA vector production Process is provided.   These and other aspects of the invention will be apparent to those skilled in the art from the teachings herein. Should be.   The following drawings are illustrative of embodiments of the present invention and are encompassed by the claims. It is not meant to limit the scope of the invention.   FIG. 1 shows the cDNA sequence of the polypeptide of the invention and the corresponding deduced amino acid sequence Is shown. Use the standard one-letter abbreviations for amino acids. Sequencing, 373 automated DNA sequencing This was performed using a sensor (Applied Biosystems, Inc.).   FIG. 2 shows the relationship between the polypeptide of the invention (top row) and human cystatin C (bottom row). Shows amino acid sequence homology.   According to one aspect of the invention, it has the deduced amino acid sequence of FIG. 1 (SEQ ID NO: 2). Matured polypeptide, and was deposited on March 20, 1995 as ATCC Accession No. 97103. Isolation encoding the mature polypeptide encoded by the cDNA of the deposited clone Provided nucleic acid (polynucleotide).   The polynucleotide of the present invention can be used in a cDNA library derived from primary cultured amniotic cells. And was discovered. It is structurally related to the cystatin II superfamily. This is because 148 amino acid residues (of which approximately the first 28 amino acid residues Protein, so the mature protein contains 120 amino acids) Includes an open reading frame encoding This protein is It shows the highest degree of homology to statin C, spanning a stretch of 147 amino acids. 33.566% identity and 53.846% similarity.   The polynucleotide of the present invention may be in the form of RNA or DNA (this DNA is cDNA, DNA, and synthetic DNA). DNA is double-stranded or single-stranded Possible and, if single-stranded, the coding strand or the non-coding (antisense) strand Can be The coding sequence encoding the mature polypeptide is shown in FIG. 1 (SEQ ID NO: 1) May be identical to the coding sequence shown in Alternatively, as a result of the duplication or degeneracy of the genetic code, the coding sequence A different polypeptide encoding the same mature polypeptide as the DNA of SEQ ID NO: 1) or the deposited cDNA. Coding sequence.   Encoded by the mature polypeptide of FIG. 1 (SEQ ID NO: 2) or the deposited cDNA The polynucleotides encoding the mature polypeptides can include but are not limited to: Not limited to: coding sequence for mature polypeptide only; coding sequence for mature polypeptide Sequence and leader sequence or secretory sequence or proprotein sequence Additional coding sequence; coding sequence for mature polypeptide (and additional Coding sequence) as well as non-coding sequences (eg, introns or mature poly 5 'and / or 3' non-coding sequences of the peptide coding sequence).   Thus, the term "polynucleotide encoding a polypeptide" refers to a polypeptide. A polynucleotide containing only the coding sequence of the And / or polynucleotides containing non-coding sequences.   The present invention further relates to a polypeptide having the deduced amino acid sequence of FIG. 1 (SEQ ID NO: 2). Fragment of the polypeptide encoded by the cDNA of the clone or deposited clone Of the polynucleotides herein, which encode the analogs, analogs, and derivatives Related to variants. A variant of a polynucleotide is a naturally occurring version of the polynucleotide. Allelic variants or non-naturally occurring variants of the polynucleotide obtain.   Thus, the present invention provides the same mature polypeptide as shown in FIG. 1 (SEQ ID NO: 2), Or the same mature polypeptide encoded by the cDNA of the deposited clone , And variants of such polynucleotides including. This variant may be the polypeptide of FIG. 1 (SEQ ID NO: 2) or the deposited clone. Fragments, derivatives or analogs of the polypeptide encoded by the Code the log. Such nucleotide variants include deletion variants, substitution variants , And additional or insertion variants.   As shown herein above, the polynucleotide is shown in FIG. 1 (SEQ ID NO: 1). Naturally occurring alleles of the coding sequence shown or of the deposited clone It may have a coding sequence that is a child variant. As is known in the art, allelic modification A variant is a polynucleotide which may have one or more nucleotide substitutions, deletions or additions. Another form of the otide sequence, which substantially modifies the function of the encoded polypeptide. Do not change to   The invention also provides that the coding sequence for the mature polypeptide is a polypeptide from a host cell. Polynucleotide sequences that assist in the expression and secretion of the polynucleotide (eg, polynucleotides from cells). Leader sequence that functions as a secretory sequence to control peptide trafficking) Polynucleotides that can be fused to the reading frame of leader The polypeptide having the sequence is a proprotein and the polypeptide Has a leader sequence cleaved by the host cell to form the mature form of the I can do it. A polynucleotide may also encode a proprotein, which is a mature protein. It has an additional 5 'amino acid residue in the protein. Mature proteins with prosequences , Proproteins, and inactive forms of proteins. Once professional distribution When the row is cut, the active mature protein remains.   Thus, for example, a polynucleotide of the invention may comprise a mature protein, Of a protein having a sequence, or of a prosequence and a presequence (leader sequence) It may encode a protein that has both.   The polynucleotide of the present invention also allows for purification of the polypeptide of the present invention. It may have the coding sequence fused in frame to the marker sequence. Marker sequence Provides for purification of the mature polypeptide fused to a marker in the case of a bacterial host The hexahistidine tag supplied by the pQE-9 vector. is there Alternatively, for example, a marker sequence is used in a mammalian host (eg, COS-7 cells). If so, it may be a hemagglutinin (HA) tag. HA tag for influenza red blood Corresponding to an epitope derived from the hemagglutinin protein (Wilson, I. et al., Cell, 37 : 767 (1984)).   The term “gene” is a segment of DNA involved in producing a polypeptide chain. Means before and after the coding region (leader and trailer). iler)) as well as intervening sequences between individual coding segments (exons) ( Intron).   Fragments of the full-length CysE gene are used to isolate the full-length CysE gene and Other inheritances with high sequence similarity or similar biological activity to the sE gene For isolation of offspring, use as a hybridization probe in a cDNA library. Can be used. This type of probe preferably has at least 30 bases. And may have, for example, 50 bases or more. Probes also bind to full-length transcripts. Corresponding cDNA and genomic clones or regulatory regions and promoters A clone containing the complete CysE gene, including regions, exons, and introns Can be used to identify Screening example uses a known DNA sequence By synthesizing an oligonucleotide probe, the coding region of the CysE gene can be Isolating the region. Labeled DNA having a sequence complementary to the sequence of the gene of the present invention Oligonucleotides can be used as libraries of human cDNA, genomic DNA, or mRNA. Screen to determine which members of the library Used to determine whether   The invention further provides that at least 70%, preferably at least 90%, and If more than 95% identity is present, the sequence may be hybridized to a sequence as described herein. It relates to a polynucleotide to be rediscovered. The present invention particularly relates to Polynucleotides that hybridize to nucleotides under stringent conditions About As used herein, the term "stringent conditions" Hybridization is at least 95% between sequences, and preferably at least Meaning occurs only when 97% identity is present. In a preferred embodiment A polynucleotide that hybridizes to the polynucleotide described above in the present specification. The tide was determined by the cDNA of FIG. 1 (SEQ ID NO: 1) or the deposited cDNA (s). Has substantially the same biological function or activity as the encoded mature polypeptide. Encodes a polypeptide that retains the same.   Alternatively, the polynucleotide is hybridized to a polynucleotide of the invention. And has identity thereto, and has activity as described hereinabove. At least 20 bases, preferably 30 bases, which may or may not be retained, And more preferably it may have at least 50 bases. For example such polynuks Reotide is used as a probe for the polynucleotide of SEQ ID NO: 1 (eg, A probe for recovery of this polynucleotide, or a diagnostic probe) or Can be used as a PCR primer.   Accordingly, the present invention relates to a polynucleotide encoding the polypeptide of SEQ ID NO: 2. At least 70%, preferably at least 90%, and more preferably Or a polynucleotide having 95% identity and fragments thereof (this fragment). A fragment has at least 30 bases and preferably at least 50 bases) And polypeptides encoded by such polynucleotides .   Deposit (s) referred to herein are deposits of microorganisms for patent purposes Maintained under the Budapest Treaty on the International Recognition of These deposits are It is provided only as a convenience to the merchant, and under 35 U.S.C. 112 It does not acknowledge that a deposit is required. Polynucleotides in the deposit The sequence of the tide, as well as the amino acid sequence of the polypeptide encoded thereby, It is incorporated herein by reference, and includes any description of sequences herein. We manage in the event of such a conflict. Manufacture, use, or sell the deposit May require a license, and such a license is hereby granted. Is not given.   The present invention further has the deduced amino acid sequence of FIG. 1 (SEQ ID NO: 2), or A CysE polypeptide having an amino acid sequence encoded by the deposited cDNA, And fragments, analogs and derivatives of such polypeptides.   The terms "fragment", "derivative", and "analog" are shown in FIG. When referring to the polypeptide of 2) or the polypeptide encoded by the deposited cDNA A polypeptide that retains substantially the same biological function or activity as such a polypeptide. Means a repeptide. Thus, the analog produces an active mature polypeptide. Proprotein that can be activated by cleavage of the proprotein portion to No.   The polypeptide of the present invention can be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. It can be a synthetic polypeptide, preferably a recombinant polypeptide.   The polypeptide encoded by the polypeptide of FIG. 1 (SEQ ID NO: 2) or the deposited cDNA A fragment, derivative, or analog of a polypeptide may comprise (i) one or more amino acids The acid residue is a conserved amino acid residue or a non-conserved amino acid residue (preferably a conserved amino acid residue). Residue), and such substituted amino acid residues are included in the genetic code. It may or may not be an amino acid residue that can be encoded more. Or (ii) one or more amino acid residues contain a substituent, or (i. ii) the mature polypeptide is a compound that increases the half-life of the polypeptide (eg, Fused with another compound such as polyethylene glycol), or (iv) the additional amino acid is a leader or secretory sequence, or a mature polypeptide; Mature proteins, such as those used for purification of peptide or proprotein sequences It may be fused to a polypeptide. Such fragments, derivatives And analogs are considered to be within the purview of those skilled in the art from the teachings herein. .   The polypeptides and polynucleotides of the present invention are preferably in isolated form And is preferably purified to homogeneity.   The term "isolated" refers to a substance that is in its natural environment (e.g., when it occurs in nature). Means taken out of the natural environment). For example, surviving animals The naturally occurring polynucleotide or polypeptide present in the But not separated from some or all of the coexisting materials in the natural system The same polynucleotide or polypeptide has been isolated. like this The polynucleotide may be part of a vector and / or such a polynucleotide Nucleotides or polypeptides can be part of the composition and such vectors State that the substance or composition is not part of its natural environment, State.   The polypeptide of the present invention is a polypeptide of SEQ ID NO: 2 (particularly a mature polypeptide). ) And at least 70% similarity (preferably at least 70% identity) Has to the polypeptide of SEQ ID NO: 2, and more preferably at least 90% Similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO: 2 And even more preferably at least 95% similarity (even more Preferably at least 95% identity) to the polypeptide of SEQ ID NO: 2. And also generally has at least 30% amino acids and More preferably, it has a portion of such a polypeptide comprising at least 50 amino acids. And a portion of such a polypeptide.   As is known to those skilled in the art, the "similarity" between two polypeptides is one polypeptide. Amino acid sequence of a peptide and its conserved amino acid substitutions in a second polypeptide Is determined by comparison with the sequence of   Fragments or portions of the polypeptides of the present invention can be accommodated by peptide synthesis Can be used to produce a full-length polypeptide. Therefore, this fragment Can be used as an intermediate to produce a full-length polypeptide. The present invention A fragment or portion of a polynucleotide may comprise a full-length polynucleotide of the invention. Can be used to synthesize.   The present invention also provides a vector comprising the polynucleotide of the present invention, a vector of the present invention. Cells genetically engineered with E. coli and polypep of the invention by recombinant technology It relates to the production of pide.   A host cell is a vector of the present invention (for example, a cloning vector or Can be genetically engineered (transduced or otherwise) using an expression vector. Or transformed or transfected). Vectors, for example , Plasmids, virus particles, phages and the like. Manipulated host Cells may activate the promoter, select for transformants, or It can be cultured in a conventional nutrient medium suitably modified to amplify the gene. Culture conditions (eg, temperature, pH, etc.) are dependent upon the host cell chosen for expression. Conditions used, and will be apparent to those skilled in the art.   The polynucleotide of the present invention is used for producing a polypeptide by recombinant technology. Can be used. Thus, for example, a polynucleotide expresses a polypeptide May be included in any one of a variety of expression vectors. Vector like this Encompasses chromosomal, non-chromosomal, and synthetic DNA sequences. This Such vectors include, for example, derivatives of SV40; bacterial plasmids; phage DNA; Culovirus; yeast plasmid; combination of plasmid and phage DNA And viral DNAs (eg, vaccinia, adenovirus, chicken) Pox virus, and pseudorabies). However, is it replicable in the host, Any other vector can be used as long as it is viable.   The appropriate DNA sequence can be inserted into the vector by various procedures. Generally, DNA distribution The row is inserted into the appropriate restriction endonuclease site by procedures known in the art. It is. Such and other procedures are deemed to be within the purview of those skilled in the art.   The DNA sequence in the expression vector may contain appropriate expression control sequences (protocol) that direct the synthesis of mRNA. Motor). Representative examples of such promoters May include: the LTR or SV40 promoter,E.coli lacOrt rp , Λ phage P_LPromoters and prokaryotic or eukaryotic cells or Are other promoters known to control gene expression in those viruses. Data. Expression vectors also provide a ribosome binding site for translation initiation and transcription. Contains a terminator. Vectors may also contain appropriate sequences for amplifying expression. May be contained.   Furthermore, the expression vector is preferably for selection of transformed host cells. Phenotypic characteristics (eg, for eukaryotic cell cultures, dihydrofolate reductase or Or neomycin resistance, or for exampleE.coliTetracycline resistance in Or one or more selectable marker genes that provide for ampicillin resistance.   A suitable DNA sequence as described herein above, as well as a suitable promoter sequence or The vector containing the control sequences is used to transform the Can be used to express   Representative examples of suitable hosts may include: bacterial cells (eg,E.coli ,Streptomyces,Salmonella typhimuriumA fungal cell (eg, yeast); Insect cells (eg,Drosophila S2andSpodoptera Sf9); Animal cells (eg, CHO, COS or Bowes melanoma); adenovirus; plant cells and the like. Suitable host The selection of is considered to be within the purview of those skilled in the art from the teachings herein.   More particularly, the present invention also includes one or more of the sequences broadly described above. Includes recombinant constructs. The construct may be a vector (eg, a plasmid vector or Or a viral vector), in which the sequence of the present invention is contained in the forward direction. Or they are inserted in the opposite direction. In a preferred aspect of this embodiment, the construct Further comprises a regulatory sequence operably linked to the sequence (eg, including a promoter). To). Numerous suitable vectors and promoters are available to those of skill in the art. Knowledgeable and commercially available. The following vectors are provided as examples. Bacteria Gender: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pblues cript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK 223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG4 4, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). But other Any plasmids or vectors that are capable of replicating in the host and exist It can be used as long as it can be continued.   The promoter region is CAT (chloramphenicol transferase) vector Using any vector that has a desired marker or other Can be selected from Two suitable vectors are PKK232-8 and pCM7. Especially Well known bacterial promoters include lacI, lacZ, T3, T7, gpt. λP_R, P_LAnd And trp. Eukaryotic promoters include CMV immediate, HSV thymidine kinase , Early and late SV40, LTR from retrovirus, and mouse metalloti Includes Onein I. Selection of appropriate vectors and promoters is Within the level of the trader.   In a further embodiment, the present invention relates to a host cell containing the above-described construct. Host cells can be higher eukaryotic cells (eg, mammalian cells) or lower eukaryotic cells. Or a host cell can be a prokaryotic cell (eg, a yeast cell). Bacterial cell). The introduction of the construct into the host Transfection, DEAE-dextran mediated transfection, or Can be achieved by Lectroporation (Davis, L., Dibner, M., Battey, I., B asic Methods in Molecular Biology, (1986)).   Encoded by a recombinant sequence in a conventional manner using the construct in a host cell Gene products can be produced. Alternatively, the polypeptide of the invention may be a conventional peptide It can be produced synthetically by a synthesizer.   Mature proteins are suitable for use in mammalian cells, yeast, bacteria, or other cells. And can be expressed under the control of a promoter. The cell-free translation system is also a DNA construct of the present invention. Can be used to produce such proteins using RNA from You. Suitable cloning vectors for use in prokaryotic and eukaryotic hosts And expression vectors are described in Sambrook et al., Molecular Cloning: A Laboratory Manual. , Second Edition, Cold Spring Harbor, N.Y., (1989) (the disclosure of which is incorporated herein by reference). Which is incorporated by reference).   Transcription of a DNA encoding a polypeptide of the present invention by higher eukaryotes may be a vector It is increased by inserting an enhancer sequence into the gene. Enhancers are DNA Cis-acting element, usually about 10 to about 300 bp, To increase its transcription. For example, on the late side of bp 100-270 of the replication origin SV40 enhancer, cytomegalovirus early promoter enhancer, Polyoma enhancer and adenovirus enhancer on the late stage of origin Is mentioned.   Generally, a recombinant expression vector contains an origin of replication and And a selectable marker (eg,E.coliAmpicillin resistance gene andS.cerevisi ae TRP1 gene) and highly expressed genes that direct transcription of downstream structural sequences Contains a promoter. Such promoters are, among others, glycolytic enzymes (eg, For example, 3-phosphoglycerate kinase (PGK)), α-factor, acid phosphatase, Or from an operon encoding a heat shock protein or the like. Heterogeneous structure The columns are the translation initiation and termination sequences and, preferably, the translated protein With a leader sequence capable of directing secretion into the periplasmic space or extracellular medium Assembled in phase. If desired, the heterologous sequence may have desired characteristics (eg, expressed N-terminal identification peptide that provides for the stabilization or simplified purification of a modified recombinant product) May be encoded.   Expression vectors useful for bacterial use include functional promoters and operable readouts. In the interrogation phase, the desired protein with the appropriate translation initiation and termination signals It is constructed by inserting a structural DNA sequence encoding a protein. The vector is Ensure the maintenance of one or more phenotypic selectable markers, and vectors, and Contain an origin of replication to provide for amplification in the host. Transformation Prokaryotic hosts suitable forE.coli,Bacillus subtilis,Salmonella typhimur ium And species within the genera Pseudomonas, Streptomyces, and Staphylococcus Although encompassing various species, other species can also be used as selections.   As a representative, but non-limiting example, an expression vector useful for bacterial use is Commercially available containing the genetic elements of the well-known cloning vector pBR322 (ATCC 37017) And a bacterial origin of replication. This Commercially available vectors such as, for example, pKK223-3 (Pharmacia Fine Chemicals, Upp. sala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). these The pBR322 "backbone" portion of the plasmid contains a suitable promoter and the structural sequence to be expressed. Be combined.   Following transformation of the appropriate host strain and propagation of the host strain to an appropriate cell density, The selected promoter is a suitable means (eg, temperature shift or chemical induction) And the cells are cultured for an additional period.   Cells are typically harvested by centrifugation and applied by physical or chemical means. More disrupted and the resulting crude extract is retained for further purification.   Microbial cells used in protein expression include freeze-thaw cycles, supersonic By any convenient method, including sonication, mechanical disruption, or use of cell lysing agents. Can be crushed. Such methods are well-known to those skilled in the art.   Various mammalian cell culture systems have also been used to express recombinant proteins. Can be Examples of mammalian expression systems are described in Gluzman, Cell, 23: 175 (1981). COS-7 strain of monkey kidney fibroblasts, and other capable of expressing compatible vectors Cell lines (eg, C127, 3T3, CHO, HeLa, and BHK cell lines) are included. Feeding Animal expression vectors contain an origin of replication, an appropriate promoter and enhancer, Ribosome binding site, polyadenylation site, splice donor Site and splice acceptor site, transcription termination sequence, and 5 'frankin It also contains non-transcribed sequences. A DNA sequence derived from the SV40 splice site, and Polyadenylation sites are used to provide the necessary non-transcribed genetic elements. Can be   The polypeptides of the present invention can be recovered from recombinant cell culture by a method comprising: And may be purified: ammonium sulfate or ethanol precipitation, acid extraction, anions and Or cation exchange chromatography, phosphocellulose chromatography, Hydrophobic interaction chromatography, affinity chromatography, hide Roxyl apatite chromatography and lectin chromatography. If necessary, the protein refolding step can Can be used to complete quality placement. Finally, high-performance liquid chromatography (HPLC) can be used for the final purification step.   The polypeptides of the present invention may be natural purified products or products of chemical synthetic procedures. Or a prokaryotic or eukaryotic host (eg, in culture) Bacterial, yeast, higher plants, insects, and mammalian cells) Can be done. Depending on the host used in the recombinant production procedure, the polypeptide of the invention May be glycosylated or may be non-glycosylated. Departure The light polypeptide may also include the first methionine amino acid residue.   The CysE polypeptides of the present invention comprise a human cathepsin enzyme, and consequently Can be used to inhibit pathologies associated with the action of cathepsins. For example, Cy sE includes osteoporosis, Behcet's disease, hypercalcemia, osteomalacia, -To treat allergic skin diseases, allergic rhinitis, and allergic purpura Can be used.   Cathepsins play an important role in tumor metastasis, and therefore, CysE It is also conceivable that it could be used to prevent metastasis.   CysE polypeptides stop the growth of certain bacterial agents (eg, streptococci). And reducing caries by reducing the production of caries-contributing acids. Can be used as an antimicrobial agent.   CysE polypeptides are also useful for treating infections caused by viruses. (For example, to prevent the replication of herpes simplex virus (HSV)) It can be used as a loose agent. CysE polypeptides also bind cysteine protein to the retina. It can be used to protect against attack by inase.   CysE polypeptides of the invention also interfere with the action of cysteine proteinases And can be used to treat cachexia and muscle wasting.   CysE polypeptides also modulate inflammation (eg, associated with rheumatoid arthritis). It can be used to transform and to treat septic shock. CysE poly Peptides can also be used to treat purulent bronchiectasis.   The polynucleotides and polypeptides of the present invention are useful for treating and treating human diseases. And can be used as test drugs and test substances for the discovery of diagnostics.   The present invention provides a method for identifying a receptor for a cystatin E polypeptide. I do. The gene encoding the receptor can be prepared by a number of methods known to those skilled in the art, for example, , Ligand panning and FACS sorting (Coligan et al., Current Protocols in  Immun., 1 (2), Chapter 5, (1991)). Preferably, expression Cloning is performed here by converting the polyadenylated RNA to a cystatin E polypeptide. CDNA library used when preparing from responding cells and made from this RNA. Libraries were split into pools and COS cells or cystatin E polypeptides. It is used to transfect other cells that do not respond to the cells. Slide gadget Transfected cells cultured on ras were labeled with cystatin E Exposure to the polypeptide. Cystatin E polypeptide can be iodinated or site-specific Can be labeled by a variety of means, including inclusion of a recognition site for the specific protein kinase. Solid After stabilization and incubation, slides are subjected to autoradiographic analysis You. Identify positive pools and prepare subpools and repeat subpools Re-transfected using a purification and rescreening process, A single clone is generated which encodes the putative receptor. For receptor identification Another approach is to use a labeled ligand, such as a cell membrane or receptor molecule. Can be bound photoaffinity with an extract preparation that expresses Crosslinked material by PAGE Decompose and expose to X-ray film. Disconnect the labeled complex containing the ligand receptor And digested into peptide fragments and submitted for protein microsequencing. obtain. Using amino acid sequences obtained from microsequencing, degenerate oligonucleotides can be used. Paired probe pairs are designed, cDNA libraries are screened and putative Identify the gene encoding the puter.   The present invention has identified compounds that bind to the cystatin E receptor, and Compounds to elicit a second messenger response Provide a way. As an example, mammalian cells expressing cystatin E receptor Alternatively, incubate the membrane preparation in the presence of the compound to be screened . Following the interaction of this compound with the receptor, a known second messenger system Response was measured and a second messenger induced by cystatin E Is compared to the response of the Such a second messenger system includes cAMP guanidine. Includes luate cyclase, ion channel, or phosphoinositide hydrolysis But not limited to these.   The polypeptide and the agonist compound of the present invention may be a cysteine proteinase. It can be assayed for its ability to inhibit activity. This assay is compatible with papain and Equilibrium constant (K) for dissociation of cystatin E complex with human and cathepsin B₁), 100M Continuous using 10 μM Z-Phe-Arg-NHMec as substrate in sodium phosphate buffer (Nicklin, M.J.H. and Barrett, A.J., Biochem. J., 223: 245-253 (1984)). This buffer is 1 mM dithiolate And 2 mM EDTA, and pH 6.5 for papain assay. PH is adjusted to 6.0 for cathepsin B assay. Cathepsin B before use For 20 minutes at room temperature in assay buffer. Assay The enzyme concentration is between 0.05 and 0.25 nM. Cystati tested in cathepsin B assay The highest concentration of protein E is 100 nM. Provide beneficial inhibition (ie, inhibitors A new steady state is obtained within one hour after the addition of). 20-50 nM in the assay. Substrate hydrolysis at 37 ° C is performed by Parkin-Elmer C In the etus LS50 fluorometer, the excitation and emission wavelengths were 360 and 46, respectively. Monitored at 0 nm. K of hydrolysis of Z-Phe-Arg-NHMec under assay_m The value is the apparent K obtained for the substrate-induced inhibitor dissociation._i The value is used to correct by the following relationship: Apparent K_i= K_i(1 + [S] / K_m).   The polypeptides and agonist compounds of the invention can be combined with a suitable pharmaceutical carrier. It can be used in combination. Such compositions comprise a therapeutically effective amount of the polypeptide or Or an agonist, and a pharmaceutically acceptable carrier or excipient. this Such carriers include saline, buffered saline, dextrose, water , Glycerol, ethanol, and combinations thereof. La It is not limited to. The formulation should suit the mode of administration.   The present invention also relates to a pharmaceutical composition of the invention filled with one or more components. Or a pharmaceutical pack or kit comprising one or more containers. Such a container Manufacture, use, or sale of a drug or biological product with respect to (one or more) Product labeling in the form prescribed by the governmental entity controlling the sale, Indicates an institutional approval for manufacture, use, or sale for human administration You. Further, the polypeptides or agonists of the present invention may be used in combination with other therapeutic compounds. Can be used.   Pharmaceutical compositions include, for example, oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, nasal It may be administered in a convenient manner by the intracavitary or intradermal route. Pharmaceutical compositions are identified Is administered in an amount effective to treat and / or prevent the symptoms of In general, they Doses of at least about 10 μg / kg body weight, and in many cases, It is administered in an amount not exceeding 8 mg / kg body weight. In most cases, the dosage is about 10 μg / day The dose ranges from about 1 mg / kg to about 1 mg / kg body weight, taking into account the administration route, symptoms and the like.   CysE polypeptides and agonist compounds that are polypeptides are described in accordance with the present invention. Thus, it can be used by expressing such polypeptides in vivo. this is Often referred to as "gene therapy".   Thus, for example, a cell from a patient can be a polynucleotide encoding a polypeptide. Can be engineered ex vivo with tide (DNA or RNA) and then engineered cells Is provided to the patient to be treated with this polypeptide. Such a method is It is well known in the art and is apparent from the teachings herein. For example, cells A retroviral plasmid containing an RNA encoding a polypeptide of the invention It can be manipulated by the use of vectors.   Similarly, cells can be used, for example, to express the polypeptide for in vivo expression of the polypeptide. It can be manipulated in vivo by known procedures in the field. For example, packaging cells A retroviral plasmid containing an RNA encoding a polypeptide of the invention Transfected with the vector, so that the packaging cells are the target here Produce infectious virus particles containing These producer cells To manipulate cells in vivo, and to express polypeptides in vivo. Me May be administered to the patient. The polypeptide of the present invention is administered by such a method. These and other methods for making clear from the teachings of the present invention will be apparent to those skilled in the art. It is.   The retrovirus from which the retroviral plasmid vector described above can be derived Lus includes Moloney mouse leukemia virus, spleen necrosis virus, Rous sarcoma Virus-like retrovirus, Harvey sarcoma virus, chicken leukemia Rus, gibbon leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative sarcoma virus, and mammalian tumor viruses, It is not limited to. In one embodiment, a retroviral plasmid vector Is derived from Moloney murine leukemia virus.   Vectors include one or more promoters. Suitable promoters that can be used -Miller et al.,Biotechniques, Vol. 7, No. 9, 980-990 (1989) Retroviral LTR; SV40 promoter; and human cytomegalovirus (CM V) promoter, or any other promoter (eg, a eukaryotic cell promoter) (Including the histone, pol III, and β-actin promoters, )), But is not limited thereto. Other that could be used Adenovirus promoter, thymidine kinase Zea (TK) promoter, and B19 parvovirus promoter, It is not limited to these. The selection of an appropriate promoter will depend on the teachings contained herein. It will be apparent to those skilled in the art from the illustration.   The nucleic acid sequence encoding the polypeptide of the present invention may be under the control of a suitable promoter. It is in. Suitable promoters that can be used include adenovirus promoters -(Eg, adenovirus major late promoter); or heterologous promoter (Eg, cytomegalovirus (CMV) promoter); RS virus (RSV) pro Motor; inducible promoters (eg, MMT promoter, metallothionein Promoter); heat shock promoter; albumin promoter; ApoA I promoter; human globin promoter; viral thymidine kinase promoter (Eg, herpes simplex thymidine kinase promoter); retrovirus LTR (including the modified retroviral LTR described herein above); β-actin pro Motor: and, but not limited to, the human growth hormone promoter Not done. A promoter also controls the gene encoding the polypeptide. It can be a natural promoter.   The retroviral plasmid vector transduces the packaging cell line, Used to form producer cell lines. Can be transfected Examples of packaging cells include Miller,Human Gene Therapy, Volume 1, 5-14 PE501, PA3 as described on page (1990), which is hereby incorporated by reference in its entirety. 17, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, GP + E-86, GP- envAm12, and DAN cell lines, but are not limited thereto. Vector The packaging cells can be transduced by any means known in the art. This Means such as electroporation, the use of liposomes, and Ca PO_FourBut not limited to precipitation. As an alternative, retro The ils plasmid vector can be encapsulated in liposomes or And can then be administered to a host.   Producer cell lines contain a nucleic acid sequence (single or multiple) that encodes the polypeptide. Infectious retroviral vector particles are produced. Then, like this Retroviral vector particles can be eukaryotic, either in vitro or in vivo. It can be used to transduce a biological cell. The transduced eukaryotic cells are Express the nucleic acid sequence (s) encoding the polypeptide. Transduced Possible eukaryotic cells include embryonic stem cells, embryonic sarcoma cells and hematopoietic stem cells, Hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelium Cells, including but not limited to cells.   Hereditary Cystatin C Amyloid Angiopathy Disease Causes Fatal Bleeding And Alzheimer's disease, Down's syndrome, Parkinson's disease, dimentia tia) and can lead to death before the age of 40.   Accordingly, the present invention relates to the use of the CysE gene as a diagnostic. CysE mutant Detection allows diagnosis of HCCAA-like diseases arising from mutations in the CysE gene .   Individuals with mutations in the human CysE gene can be Can be detected. Nucleic acids for diagnosis are derived from patient cells (blood, urine, saliva, tissue bio Psy, and autopsy material, including, but not limited to). Get Nom DNA can be used directly for detection or use PCR before analysis (Saiki et al., Nature, 324: 163-166 (1986)). RNA Alternatively, cDNA can also be used for the same purpose. As an example, code CysE PCR primers complementary to the nucleic acid used to identify and analyze CysE mutations Can be done. For example, deletions and insertions are amplified in comparison to the normal genotype. Can be detected by a change in the size of the resulting product. Point mutations are radiolabeled CysE  RNA or, alternatively, a radiolabeled CysE antisense DNA sequence Can be identified by hybridizing the isolated DNA. Perfectly matched array Can be distinguished from mismatched duplexes by differences in RNase A digestion or melting temperature .   Sequence differences between the control gene and the mutated gene can be determined by direct DNA sequencing. Can be revealed by In addition, cloned DNA segments are identified Can be used as a probe to detect a DNA segment. Sensitivity of the method Is greatly enhanced when combined with PCR. For example, sequencing primers Indicates the double-stranded PCR product or the single-stranded template produced by the modified PCR. Used with a salt molecule. Sequencing is performed using radiolabeled nucleotides. Performed by conventional procedures or automated sequencing procedures using fluorescent tags.   Genetic testing based on DNA sequence differences can be performed on gels with or without denaturing agents. Achieved by detecting changes in the electrophoretic mobility of DNA fragments in obtain. Small sequence deletions and insertions are visualized by high-resolution gel electrophoresis. obtain. DNA fragments of different sequences are separated on denaturing formamide gradient gels. Can be separated. Here the mobility of different DNA fragments in the gel depends on their specificity Is delayed in the gel at different positions according to the local or partial melting temperature (eg See, for example, Myers et al., Science, 230: 1242 (1985)).   Sequence changes at specific positions may also be attributed to nuclease protection assays (eg, RNas e-protection and S1 protection or chemical cleavage methods (eg, Cotton et al., PNAS, USA, 85: 439) 7-4401 (1985))).   Therefore, detection of a specific DNA sequence can be detected by hybridization, RNase protection, Cleavage, direct DNA sequencing, or the use of restriction enzymes (e.g., (RFLP) and achieved by methods such as Southern blotting of genomic DNA Can be done.   In addition to more conventional gel electrophoresis and DNA sequencing, mutations are also It can be detected by Chu analysis.   The sequences of the present invention are also valuable for chromosome identification. This sequence is Specifically target a specific location on a chromosome and hybridize to that location You. In addition, there is now a need to identify specific sites on the chromosome. Currently dyed Chromosome markers based on actual sequence data (repetitive polymorphisms) that can be used to label body positions There are few intellectualizing reagents. Mapping of the DNA of the present invention to the chromosome This is an important first step in correlating sequences with disease-related genes.   Briefly, the sequence consists of the PCR primers (preferably 15-25 bp) from the cDNA. It can be mapped to a chromosome by preparation. Computation of the 3 'untranslated region of the gene Data analysis does not span more than one exon in genomic DNA, and therefore amplification Used to quickly select primers that complicate the process. Then These primers are used for PCR screening of somatic cell hybrids containing individual human chromosomes. Used for leaning. Hybrid containing human gene corresponding to primer Only yield amplified fragments.   PCR mapping of somatic cell hybrids assigns specific DNA to specific chromosomes A quick procedure for Use the same oligonucleotide primer with the present invention Use a panel of fragments from a particular chromosome or similar format in a large A pool of genomic clones is used to achieve sublocalization. Can be achieved. Other mapping lists that can also be used to map to chromosomes The strategy was in situ hybridization, labeled flow sorting (float w-sorted) Prescreening using chromosomes and live chromosome-specific cDNA Includes preselection by hybridization to build a rally.   Fluorescence in situ hybridization of cDNA clones to metaphase chromosome spreads (FISH) can be used to provide a precise chromosomal location in one step. This Can be used with cDNAs having at least 50 or 60 bases. this For a review of technologies, see Verma et al., Human Chromosomes: a Manual of Basic Tech See niques, Pergamon Press, New York (1988).   Once a sequence has been mapped to a precise chromosomal location, the physical The location can be correlated with the genetic map data. Such data is described, for example, in M cKusick, Mendelian Inheritance in Man (Johns Hopkins University Welch Med (available online from the ical Library). Then The relationship between a disease and a gene that maps to the same chromosomal region is described by linkage analysis (physical analysis). (Simultaneous inheritance of genes adjacent to the gene).   Next, differences in the cDNA or genomic sequence between affected and unaffected individuals Need to decide. The mutation is observed in some or all affected individuals, If not observed in any normal individual, this mutation is a causative agent of the disease. It is.   At the current resolution of physical and genetic mapping techniques, disease A cDNA correctly located in a chromosomal region associated with a potential of between 50 and 500 It may be one of the causative genes. (This is a 1 megabase mapping resolution, And one gene per 20 kb).   The polypeptide, a fragment or other derivative thereof, or an analog thereof. Logs, or cells that express them, produce antibodies against them Can be used as an immunogen. These antibodies are, for example, polyclonal antibodies, Or it may be a monoclonal antibody. The present invention also provides chimeric antibodies, single chain antibodies, And production of humanized antibodies and Fab fragments or Fab expression libraries Things. Various procedures known in the art can be used to construct such antibodies and fragments. Can be used for the production of   Antibodies raised against polypeptides corresponding to the sequences of the present invention may be used to Obtained by direct injection of the polypeptide or by administration of the polypeptide to the animal. Can be The animal is preferably non-human. Then, like this The resulting antibody binds to the polypeptide itself. In this way, polypepti Even a sequence that encodes only the fragment of the peptide binds to the entire native polypeptide. Can be used to generate matching antibodies. Such antibodies are then It can be used to isolate a polypeptide from a tissue that expresses the polypeptide.   Antibodies produced by continuous culture of cell lines for preparation of monoclonal antibodies Any technique that provides a can be used. Examples include hybridoma technology (Kohle r and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B cells Hybridoma technology (Kozbor et al., 1983, Immunology Today 4:72), and human EBV hybridoma technology for producing noclonal antibodies (Cole et al., 1985, Mono clonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). It is.   The technology described for producing single-chain antibodies (U.S. Pat. Can be adapted to generate single-chain antibodies to light immunogenic polypeptide products . In addition, the transgenic mouse is used as the immunogenic polypeptide product of the present invention. It can be used to express humanized antibodies to it.   The invention will be further described with reference to the following examples; It should be understood that the present invention is not limited to such an embodiment. All parts or quantity Are by weight unless otherwise specified.   To facilitate understanding of the following examples, certain frequently occurring methods and / or Or terms are described.   "Plasmids" are capitalized with a lower case p followed by and / or followed by a capital letter and / or Or it is specified by showing a number. The starting plasmids herein are commercially available And are publicly available without restriction or in accordance with published procedures It can be constructed from available plasmids. In addition, equivalent to the described plasmid Are known in the art and will be apparent to those skilled in the art.   `` Digestion '' of DNA involves touching it with a restriction enzyme that acts only at certain sequences in the DNA. It means to cut by a medium reaction. The various restriction enzymes used herein are commercially available. Are sold and their reaction conditions, cofactors, and other requirements are The known ones were used. For analytical purposes, typically 1 μg of plasmid Or DNA fragment is used in about 20 μl of buffer solution with about 2 units of enzyme Is done. For the purpose of isolating DNA fragments for plasmid construction, Typically, 5-50 μg of DNA is used in larger volumes with 20-250 units of enzyme. Digested. Appropriate buffers and substrate amounts for particular restriction enzymes can be determined by the manufacturer. Specified. An incubation time of about 1 hour at 37 ° C is usually used, This can vary according to the supplier's instructions. After digestion, the reaction is The desired fragment is isolated by direct electrophoresis on a gel.   Size separation of truncated fragments is described by Goeddel, D. et al., Nucleic Acids Res., 8: 4. This is done using an 8% polyacrylamide gel as described by O57 (1980).   "Oligonucleotide" refers to a single-stranded polydeoxynucleotide or two phases. Refers to any of the complementary polydeoxynucleotide chains, which are chemically synthesized Can be Such synthetic oligonucleotides have no 5 'phosphate and therefore If you do not add phosphate with ATP in the presence of the enzyme, another oligonucleotide Do not connect with Synthetic oligonucleotides are non-dephosphorylated fragment Connect to   "Ligation" forms a phosphodiester bond between two double-stranded nucleic acid fragments. (Maniatis, T et al., Supra, p. 146). If not provided otherwise, Ligation is performed using known buffers and conditions, using approximately equimolar amounts of the DNA to be ligated. Achieved using 10 units of T4 DNA ligase (“ligase”) per 0.5 μg of fragment Can be done.   Unless otherwise stated, Graham, F. and Van der Eb, A., Virology, 52: 456-45. 7 (1973). Transformation was performed as described in Method 7 (1973).                                 Example 1 Bacterial expression and purification of soluble CysE   The DNA sequence encoding CysE (ATCC accession number 97103) was replaced with the processed CysE 5 ′ sequence of protein (excluding signal peptide sequence) and CysE gene First, use a PCR oligonucleotide primer corresponding to the 3 'vector sequence. To amplify. Additional nucleotides corresponding to CysE were added to the 5 'and 3' Added to row. The 5 'oligonucleotide primer has the sequence 5' CGCCCATGGCGGCCG CAGGAG 3 '(SEQ ID NO: 3), which is an NcoI restriction enzyme site followed by a process Contains the CysE coding sequence starting from the putative terminal amino acids of the shingled protein. 3 ′ sequence, 5 ′ CGCAAGCTTTCACATCTGCAAAAAGTTGGC 3 ′ (SEQ ID NO: 4) is HindII It contains the sequence complementary to the I site, followed by the CysE coding sequence. Restriction enzyme section The position is on the bacterial expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA, 91111). Corresponds to a restriction enzyme site. pQE-9 is resistant to antibiotics (Amp^r), Bacterial origin of replication (o ri), IPTG regulatable promoter operator (P / O), ribosome binding site (R BS), a 6-His tag, and a restriction enzyme site. Then, pQE-9 was transferred to NcoI and And HindIII. The amplified sequence is ligated into pQE-9 and a histidine tag And the sequence encoding RBS were inserted in frame. Then, Using the compound,E . coliThe M15 / rep 4 strain (Qiagen, Inc.) was isolated from Sambrook, J. et al., Molecu. lar Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989) Transformation was performed according to the procedure described. M15 / rep4 provides multiple copies of plasmid pREP4 contains. It expresses the lacI repressor and also has kanamycin resistance ( Kan^r). Transformants are identical due to their ability to grow on LB plates. Set. Then, ampicillin / kanamycin resistant colonies were selected. Plasmi DNA was isolated and confirmed by restriction enzyme analysis. Black containing the desired construct Solution in LB medium supplemented with both Amp (100 μg / ml) and Kan (25 μg / ml). Grow overnight (O / N) in body culture. Large scale with 1: 100 to 1: 250 ratio using O / N culture Inoculate the culture. Cells are grown at an optical density of 600 (O.D.⁶⁰⁰) Is between 0.4 and 0.6 Grown up to Then, IPTG ("Isopropyl-B-D-thiogalactopyranoside" ") To a final concentration of 1 mM. IPTG inactivates the lacI repressor This induces clearing of P / O, leading to increased gene expression. The cells Were grown for 3-4 hours. The cells were then collected by centrifugation. Cell pellet The soot was solubilized in the chaotropic drug 6M guanidine HCl. Soluble after clarification CysE under conditions that allow it to be more tightly bound by a protein containing a 6-His tag This solution was purified by chromatography on a nickel-chelate column. (Hochuli, E. et al., J. Chromatography 411: 177-184 (1984)). 6M CysE The column was eluted in guanidine HCl (pH 5.0) and, for regeneration purposes, 3M guanidine was used. Gin HCl, 100 mM sodium phosphate, 10 mM glutathione (reduced), and 2 mM Adjusted to rutathione (oxidized form). 12 hours incubation in this solution After that, the protein was dialyzed against 10 mM sodium phosphate.                                 Example 2 Cloning and expression of CysE using the baculovirus expression system   The DNA sequence encoding the full-length CysE protein (ATCC Accession No. 97103) was PCR oligonucleotide primers corresponding to the 5 ′ and 3 ′ sequences of the gene Amplified using: No. 5) and a BamHI restriction enzyme site (bold) followed by a eukaryotic cell. Signal efficient for initiation of translation in cells (Kozak, M., J. Mol. Biol., 196: 94). 7-950 (1987)) and the 18 nucleotides of this CysE gene (the translation start codon "A TG "is underlined). No. 6) and the cleavage site of the restriction endonuclease BamHI and this CysE Contains nucleotides complementary to the 3 'untranslated sequence of the gene. Commercialize amplified sequences 1% agar using a kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.) Isolated from loin gel. This fragment was then used for the endonuclease BamH Digested with I and then purified again on a 1% agarose gel. This fragment is Call it 2.   The vector pA2 (a modified version of the pVL941 vector, described below) was transformed into a baculovirus expression system. (For a review, see Summers, M.D.). And Smith, G.E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector was obtained from Autographa californ Strong polyhedrin promoter of ica nuclear polyhedrosis virus (AcMNPV), and Includes a recognition site for the subsequent restriction endonuclease BamHI. Simian virus (SV) 4 A polyadenylation site of 0 is used for efficient polyadenylation. Recombinant c For easy selection of ills, coli β-galactosidase gene Lihedrin promoter followed by polyadenylation of the polyhedrin gene Insert in the same direction as the signal. Polyhedrin sequence cotransfected in the wild Flanking the viral sequence for cell-mediated homologous recombination of type 2 viral DNA You. Many other baculovirus vectors can be used in place of pA2. An example Examples are pRG1 pAc373, pVL941, and pAcIM1 (Luckow, V.A. and Summers , M.D., Virology, 170: 31-39).   The plasmid is digested with the restriction enzyme BamHI and the pups are then digested by procedures known in the art. Dephosphorylated using bovine intestinal phosphatase. Then, the DNA was purchased from a commercially available kit ( 1% agarose gel using "Geneclean" BIO 101 Inc., La Jolla, Ca. Isolated. This vector DNA is called V2.   Fragment F2 and dephosphorylated plasmid V2 were converted using T4 DNA ligase. Connected. Then, E. Transform E. coli HB101 cells and use the enzyme BamHI Thus, bacteria containing a plasmid having the CysE gene (pBacCysE) were identified. Claw The sequence of the activated fragment was confirmed by DNA sequencing.   5 μg of the plasmid pBacCysE was ligated with the lipofection method (Felgner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987)). Culovirus ("BaculoGold^TMbaculovirus DNA ", Pharmingen, San Diego, C A.) and co-transfected.   1 μg BaculoGold^TM50 μl of viral DNA and 5 μg of plasmid pBacCysE Containing serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD) Mixing in sterile wells of a crotiter plate. Then 10 μl of Lipofect Tin and 90 μl of Grace medium, mix and incubate for 15 minutes at room temperature. I was vate. The transfection mixture was then added to serum-free Grac Sf9 insect cells (ATCC C) seeded in 35 mm tissue culture plates containing 1 ml of e-medium RL 1711). Mix the plate with the newly added solution. For this purpose, it was vibrated back and forth. The plate was then incubated at 27 ° C. for 5 hours . After 5 hours, the transfection solution was removed from the plate and 10% bovine 1 ml of Grace insect medium supplemented with fetal serum was added. Incubate plate And the culture was continued at 27 ° C. for 4 days.   After 4 days, the supernatant was collected and as described by Summers and Smith (supra). A plaque assay was performed. As an alternative, the blue stained plaque "Blue Gal" (Life Technologies Inc., Gaithersburg) Agarose gel was used. (A detailed description of the "plaque assay" Insect cell culture and baculo distributed by Life Technologies Inc., Gaithersburg (It can also be found in the Virology User Guide (pages 9-10)).   Four days after serial dilution, the virus is added to the cells and blue stained plaques are I picked it up with the tip of a Ndolph pipette. The agar containing the recombinant virus was then Resuspended in Eppendorf tubes containing 0 μl Grace medium. Agar, short The supernatant containing the recombinant baculovirus was removed by centrifugation. It was used to infect Sf9 cells seeded on the tissue. Four days later, these cultures The culture dish supernatant was collected and then stored at 4 ° C.   Sf9 cells were grown in Grace medium supplemented with 10% heat inactivated FBS. Cells At a multiplicity of infection (MOI) of 2, the cells were infected with the recombinant baculovirus V-CysE. 6 hours Afterwards, the medium was removed and SF900 II medium without methionine and cysteine ( Life Technologies Inc., Gaithersburg). 42 hours later, 5 μCi³⁵ S-methionine and 5 μCi³⁵S-cysteine (Amersham) was added. Cells Incubate for an additional 16 hours, after which cells are collected by centrifugation and Identified proteins were visualized by SDS-PAGE and autoradiography .                                 Example 3 COS Expression of recombinant CysE in cells   Induction of expression of plasmid CysE HA from vector pcDNAI / Amp (Invitrogen) I do. The vector pcDNAI / Amp contains the following: 1) SV40 origin of replication, 2) Ampici Phosphorus resistance gene, 3) E. coli origin of replication, 4) polylinker region, SV40 intro And a CMV promoter followed by a polyadenylation site. The entire CysE precursor and A DNA fragment encoding the HA tag fused in-frame to its 3 'end Was cloned into the polylinker region of the vector. Therefore, the recombinant protein Expression is controlled under the CMV promoter. The HA tag was previously described (I. Wilson , H. Niman, R .; Heighten, A Cherenson, M.S. Connolly, and R. Lerner, 1984 Epitome from influenza hemagglutinin protein such as Step Corresponding to The fusion of the HA tag to our target protein allows the This allows easy detection of recombinant proteins using antibodies that recognize the protein.   The plasmid construction strategy is described below:     The DNA sequence encoding CysE (ATCC Accession No. 97103) was Constructed by PCR in the first EST cloned using the imer: The primer 5 'GCGCGGATCCACCATGGCGCGTTCG 3' (SEQ ID NO: 7) has a BamHI site It contains the 12 nucleotides of the CysE coding sequence beginning with the start codon following it; Row, 5'GCGCTCTAGATCAAGCGTAGTCTGGGACGTCGTATGGGTACATCTGCACAAA 3 '(sequence number No. 8) contains the XbaI site, the translation stop codon, the HA tag, and the nucleotide sequence of the CysE coding sequence. Contains sequences complementary to otide (not including stop codon). Therefore, the PCR product , BamHI site, CysE coding sequence followed by HA tag fused in frame, HA tag Includes an adjacent translation termination stop codon, and an XbaI site. PCR amplified DNA fragment And the vector (pcDNAI / Amp) are digested with BamHI and XbaI restriction enzymes, And connected. The ligation mixture is coli SURE strain (Stratagene Cloning Systems , 11099 North Torrey Plnes Road, available from La Jolla, CA 92037) Transform, inoculate the transformed culture into ampicillin medium plates, and Knee selected. Isolate plasmid DNA from transformants and correct The presence of the ment was determined by restriction enzyme analysis. For expression of recombinant CysE, COS cells were EAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)) Transfected. Expression of CysE HA protein is determined by radiolabeling. And immunoprecipitation (E. Harlow, D. Lane, Antibodies: A Laboratory  Manual, Cold Spring Harbor Laboratory Press, (1988)). Transform cells Two days after fiction,³⁵Labeled with S-cysteine for 8 hours. The culture medium is then And harvest the cells with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SD S, 1% NP-40, 0.5% DOC, 50 mM Tris (pH 7.5)) (Wilson, I. et al., Supra). 37: 767 (1984)). Both cell lysate and culture medium are Sedimentation with the antibody. Precipitated protein on 15% SDS-PAGE gel analyzed.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI A61K 45/00 ADS A61K 45/00 ADY ADY 48/00 ADU 48/00 ADU C12N 1/21 C12N 1/21 C12Q 1/68 ZNAA C12Q 1/68 ZNA G01N 33/566 G01N 33/566 33/573 33/573 A61K 37/02 ABJ // (C12N 1/21 C12R 1:19) (81) Designated country EP (AT, BE, CH, DE) , DK, ES, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, ML, MR, NE) , SN, TD, TG), AP (KE, MW, SD, SZ, UG), AM, AT, AU, BB, BG, BR, BY, CA, CH, CN, CZ DE, DK, ES, FI, GB, GE, HU, JP, KE, KG, KP, KR, KZ, LK, LT, LU, LV, MD, MG, MN, MW, MX, NO, NZ, PL , PT, RO, RU, SD, SE, SI, SK, TJ, TT, UA, US, UZ, VN (72) Inventor Yu, Guorian United States of America Maryland 20878, Darnesstown, Strawvale Lane 13524 (72 Inventor Gents, Reiner United States of America Maryland 20904, Silver Spring, Fairland Park Drive 13404 (72) Inventor Rosen, Craig A. United States of America Maryland 20882, Laytonsville, Rolling Hill Road 22400

Claims (1)

[Claims] 6. 2. The method according to claim 1, comprising nucleotides 1 to 576 of the sequence shown in FIG. 3. The polynucleotide according to item 1. 7. 2. The method according to claim 1, comprising nucleotides 14 to 459 of the sequence shown in FIG. 3. The polynucleotide according to item 1. 8. A vector comprising the DNA according to claim 2. 9. A host cell genetically engineered with the vector of claim 10. 10. A process for producing a polypeptide, comprising: the inn of claim 11. Expressing a polypeptide encoded by the DNA from the main cell ,process. 11. A method comprising genetically engineering a cell with the vector of claim 10. A process for producing cells capable of expressing a repeptide. 12. A polypeptide comprising a member selected from the group consisting of:   (i) a polypeptide having the deduced amino acid sequence shown in FIG. 1 and a fragment thereof Analogs and derivatives; and   (ii) a polypeptide encoded by the cDNA of ATCC Accession No. 97103; Fragments, analogs, and derivatives of polypeptides. 13. A compound that activates the receptor of the polypeptide of claim 12. 14． A compound that inhibits the receptor of the polypeptide according to claim 12. 15. Administering a therapeutically effective amount of the polypeptide of claim 12 to a patient. A method for the treatment of a patient having a need for CysE, including. 16. Encodes said polypeptide and expresses said polypeptide in vivo By providing the patient with DNA, the therapeutically effective amount of the polypeptide is administered. The method of claim 15, wherein 17． A method of treating a patient having a need to inhibit a CysE polypeptide, comprising: 15. A method comprising administering to a patient a therapeutically effective amount of the compound of claim 14. 18. A disease or disorder associated with underexpression of the polypeptide of claim 12. A process for diagnosing susceptibility to:   Determining a mutation in the nucleic acid sequence encoding the polypeptide. Roses. 19. The diagnostic process:   Analyzing the presence of the polypeptide of claim 12 in a sample derived from the host. Process comprising the steps of: 20. Binding to and against the polypeptide of claim 12; A method for identifying a compound that activates a receptor comprising:   A cell that expresses a receptor for the polypeptide on the cell surface; Contact with the compound to be treated under conditions that permit binding to the receptor. Wherein the receptor responds to the binding of a compound to the receptor. Associated with a second component that can provide a detectable signal; and   Detecting the presence of a signal generated from the interaction of the compound with the receptor The compound binds to the receptor and activates the receptor Determining whether to do, A method comprising: