JPH1132772A - Heat-stable ribonuclease h and dna coding for the enzyme - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide the subject new DNA composed of a DNA coding for a protein having a specific amino acid sequence and heat-stable ribonuclease activity and usable e.g. for the production of the above enzyme useful as a reagent for genetic engineering, diagnosis of abnormality of gene, etc. SOLUTION: This new DNA codes for a protein composed of an amino acid sequence expressed by the formula or a protein composed of an amino acid sequence of the formula wherein one or several amino acids are depleted, substituted or added and having a heat-stable ribonuclease activity comparable to that of the protein of the formula. The DNA is useful e.g. for the production of a heat-stable ribonuclease for genetic engineering reagents such as a cycling probe reagent or diagnostic agents for the abnormality of gene, etc. The new DNA can be produced from ultra-high thermophilic archaebacteria Pyrococcus sp.KOD1 strain by the cloning by shot gun cloning method using a ribonuclease- dependent temperature-sensitive E.coli mutant as a host.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a thermostable ribonuclease H and a DNA encoding the same.

[0002]

BACKGROUND OF THE INVENTION Ribonuclease H is a DNA / RNA
Since only the hybrid RNA strand is hydrolyzed, cD
It is used as a reagent for genetic engineering, for example, used for removing template RNA during NA synthesis. Ribonuclease H is also used in the cycling probe method, which has recently attracted attention as a diagnostic method for genetic abnormalities.

[0003] The cycling probe method uses DNA at both ends.
DNA-RNA-DNA in the center of which is made of RNA
In this method, a mutant DNA is detected using a strand as a probe. The RNA portion of the DNA-RNA-DNA strand is prepared so as to be complementary to the mutated portion of the target DNA, and this probe is paired with the DNA sample. When the probe and the mutant DNA form a double strand, ribonuclease H recognizes the DNA / RNA hybrid region as a substrate and cleaves the probe at the RNA portion. On the other hand, when this probe forms a double strand with wild-type DNA, a DNA / RNA hybrid is not completely formed, and therefore, this probe is not cleaved by ribonuclease H. Therefore, by detecting the fragment of the cleaved probe, the mutant DNA is contained in the DNA sample.
Can be checked to see if it exists. Mutant DN
Even if the amount of A is very small, if a series of reactions is repeated by a thermal cycler, the probe can be cut any number of times, so that probe fragments will accumulate,
As a result, its detection becomes possible. In this method, since a thermal cycler is used, it is extremely advantageous to use thermostable ribonuclease H.

[0004] As the thermostable ribonuclease H, those derived from the thermophilic bacterium Thermus thermophilus HB8 are known (Nucleic Acids Research, 19, 4443-4449 (199).
1)). However, if ribonuclease H having more excellent heat resistance can be obtained, it is more useful as a reagent for a cycling probe method and the like.

[0005]

An object of the present invention is to obtain ribonuclease H having excellent heat resistance and a DNA encoding the same.

[0006]

Means for Solving the Problems The inventors of the present invention prepared a ribonuclease H from the hyperthermophilic archaeon Pyrococcus sp. Strain KOD1.
The gene was successfully cloned, and the present invention was completed.

That is, the present invention provides a DNA encoding the following protein (a) or (b) (hereinafter, also referred to as the DNA of the present invention). (A) a protein consisting of the amino acid sequence of SEQ ID NO: 2 (b) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2, and equivalent to the protein of (a) With heat-resistant ribonuclease H activity

[0008] The DNA of the present invention preferably comprises SEQ ID NO: 2.
Encodes a protein consisting of the amino acid sequence of Specific examples of the DNA of the present invention include a DNA having the following base sequence (c) or (d), which encodes the protein (a) or (b). (C) base number 18 in the base sequence shown in SEQ ID NO: 1
DNA having a base sequence of 1 to 864 DNA that hybridizes under stringent conditions with DNA having a base sequence complementary to the base sequence of the DNA of (d) and (c)

Further, the present invention provides the following (a) or (b)
Heat-stable ribonuclease H (hereinafter, also referred to as the enzyme of the present invention) comprising the protein of the present invention. (A) a protein consisting of the amino acid sequence of SEQ ID NO: 2 (b) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2, and equivalent to the protein of (a) With heat-resistant ribonuclease H activity

The enzyme of the present invention preferably comprises a protein having the amino acid sequence of SEQ ID NO: 2. Thermus th
The optimum temperature for the growth of thermophiles (extreme thermophiles) such as ermophilus HB8 is around 80 ° C, while the optimum temperature for the growth of hyperthermophiles is around 90 ° C. The derived enzyme of the present invention is expected to have higher thermostability than ribonuclease H derived from thermophilic bacteria.

[0011]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below in detail.
The DNA of the present invention is a ribonuclease H having excellent heat resistance.
(Hereinafter, also referred to as RNaseH), that is, encodes the following protein (a) or (b): (A) a DNA encoding a protein having the amino acid sequence shown in SEQ ID NO: 2; (b) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 2, and ( A protein having RNaseH activity having the same thermostability as the protein of a)

Substitution, deletion or insertion of an amino acid residue can be caused by introducing a mutation such as nucleotide substitution, deletion or insertion into a nucleotide sequence by a known method such as site-directed mutation. . A method for measuring RNase H activity and a method for evaluating its heat resistance are known (for example, J. Biol. Chem. 266, 6038-6044 (1991) and
J. Biol. Chem. 267, 21535-21542 (1992)), one of ordinary skill in the art readily selects substitutions, deletions or insertions of one or more amino acid residues that do not substantially impair the thermostable RNaseH activity. be able to.

[0013] Preferably, the amino acid sequence of the protein of (b) is 80% different from the amino acid sequence of the protein of (a).
The homology is at least 90% or more.
In addition, a part of the structure of the protein can be changed by a natural or artificial mutation without substantially changing the thermostable RNaseH activity. The protein encoded by the DNA of the present invention also includes a protein having a structure corresponding to the homologous variant of the above-mentioned protein (a).

Specific examples of the DNA of the present invention include a DNA having the following base sequence (c) or (d), which encodes the protein (a) or (b). (C) base number 18 in the base sequence shown in SEQ ID NO: 1
DNA consisting of a base sequence of 1 to 864 (d) DNA which hybridizes with a DNA having a base sequence complementary to the base sequence of this DNA under stringent conditions

Here, the stringent conditions refer to conditions under which a so-called specific hybrid is formed and a non-specific hybrid is not formed. Although it is difficult to clearly quantify these conditions, as an example, nucleic acids having high homology, for example, a temperature ranging from Tm of a perfectly matched hybrid to a temperature 10 ° C. lower than the Tm, or A condition is such that DNAs having homology of 80% or more hybridize and nucleic acids having lower homology do not hybridize.

As described above, a method for measuring RNase H activity and a method for evaluating its heat resistance are known and are described in the above (c).
Having a nucleotide sequence complementary to the nucleotide sequence of the DNA
That hybridizes under stringent conditions with DNA
A to DNA encoding the heat-resistant protein having RNase H activity (ie, the DNA of (d) above)
Can be easily selected by those skilled in the art.

The DNA of the present invention preferably encodes the amino acid sequence shown in SEQ ID NO: 2, and is more preferably the DNA of the above (c). The DNA of the present invention is 2
It may be single-stranded or single-stranded, or may form double-stranded with RNA.

The DNA of the present invention can be synthesized based on one of its base sequences (SEQ ID NO: 1) determined by the present invention, as shown in the Examples below. The hyperthermophilic primordial chromosome D is obtained by PCR or hybridization using oligonucleotide primers or probes prepared based on this base sequence.
It can also be obtained from NA. Alternatively, the cDNA library of the hyperthermophilic archaeon can be obtained by screening using a polynucleotide having all or a part of the above nucleotide sequence as a probe.

The enzyme of the present invention is the following protein (a) or (b) encoded by the DNA of the present invention. (A) a protein consisting of the amino acid sequence of SEQ ID NO: 2 (b) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2, and equivalent to the protein of (a) Heat-resistant RNase H-active protein

As described above, this heat-resistant RNase H
Substitution of one or more amino acid residues that does not substantially impair activity;
Deletions or substitutions can be readily selected by those skilled in the art.

Preferably, the amino acid sequence of the protein (b) is 80% different from the amino acid sequence of the protein (a).
The homology is at least 90% or more.
Further, the enzyme of the present invention includes a polypeptide having the amino acid sequence shown in SEQ ID NO: 2 in which a part of the structure of the protein is changed by a natural or artificial mutation without substantially changing the thermostable RNaseH activity. A protein having a structure corresponding to the homologous variant is also included.

The amino acid sequence of SEQ ID NO: 2 has homology to the amino acid sequences of RNase HII derived from various organisms including Escherichia coli.
us jyannaschii) RNase HII amino acid sequence and 3
Since the enzyme of the present invention has 8% homology,
It is considered to be seHII.

The enzyme of the present invention is obtained by introducing the DNA of the present invention into a cell to obtain a transformed cell.
It can be produced by culturing in a suitable medium, producing and accumulating the enzyme of the present invention in the culture, and collecting the enzyme from the culture.

The DNA of the present invention can be introduced into cells by inserting the DNA of the present invention into a known expression vector, constructing a recombinant plasmid, and introducing the recombinant plasmid.

As the cell and the expression vector, a host-vector system usually used for the expression of a foreign protein can be used. For example, prokaryotic cells such as E. coli and an expression vector suitable therefor (for example, E. coli MIC3001 strain) And the vector pJLA503), eukaryotic cells such as mammalian cells, and suitable expression vectors. The medium and culture conditions are appropriately selected according to the cells used.

The enzyme of the present invention may be expressed alone, or may be expressed as a fusion protein with another protein. Further, the enzyme of the present invention may be expressed in its full length, or may be partially expressed as a partial peptide.

The culture is a medium and cells in the medium. The enzyme of the present invention can be collected from the culture by using the above-mentioned activity of the enzyme of the present invention as an index to disrupt cells, fractionate ammonium sulfate, It can be performed by known protein purification means such as anion exchange chromatography. In addition, since the enzyme of the present invention is heat-resistant, purification can be easily performed by denaturing a host-derived protein or the like by heat treatment. Therefore, heat treatment is preferably performed in the purification. As an example of a purification method, cells obtained by culturing are disrupted by sonication, and the obtained extract is heat-treated at 90 ° C. for 15 minutes, and then subjected to ammonium sulfate fractionation (precipitation with 70% saturated ammonium sulfate). Followed by anion exchange chromatography using a DE-52 column or the like.

[0028]

EXAMPLES Hereinafter, the present invention will be described more specifically with reference to examples.

[0029]

[Example 1] Cloning of DNA encoding thermostable RNase H (1) Shotgun cloning RNase derived from the hyperthermophilic archaeon Pyrococcus sp. KOD1 strain
Shotgun cloning was performed to obtain DNA encoding H. As a host for shotgun cloning, Escherichia coli MIC3001 strain, an RNaseH-dependent temperature-sensitive mutant, was used. In this strain, RN
Since the aseHI gene has been deleted and the RecB gene has been replaced by a temperature-sensitive gene, this strain grows at 30 ° C but cannot grow at 42 ° C. However, RNaseH or R
When transformed with a plasmid containing DNA encoding ecB protein, strain MIC3001 is no longer temperature sensitive and can grow at 42 ° C.

Pyrococcus sp. KOD1 strain (Gene 166, 139-1)
43 (1995), Associate Professor Masaaki Morikawa, Department of Materials and Biotechnology, Faculty of Engineering, Osaka University) After preparing chromosomal DNA, cutting the prepared chromosomal DNA with restriction enzymes BamHI or HindIII, and obtaining the resulting fragment with Thus, a mixture of plasmids having various insertion fragments was obtained by insertion into the restriction enzyme sites. Escherichia coli MIC3001 strain (Mr. Mitsutaya Itaya, Senior Researcher, Mitsubishi Chemical Life Science Research Institute) was transformed with these recombinant plasmids. Transformants were incubated at 42 ° C. and 30 ° C., respectively, and the number of colonies grown was determined. As a result, BamH
When I was used, 11 colonies grew on the plate at 42 ° C. Since about 5000 colonies grew at 30 ° C., the complementation rate of the temperature sensitivity was about 0.2%. After extracting plasmids from these 11 colonies, the cleavage patterns by various restriction enzymes were examined. As a result, the DNA fragments inserted into pBR322 derived from the obtained colonies were all the same and had a size of about 3 k.
bp (hereinafter, these plasmids are called pBR30
00).

(2) Determination of base sequence of DNA The base sequence of the DNA fragment inserted into pBR3000 was determined. The determined nucleotide sequence and the amino acid sequence predicted from the nucleotide sequence are shown in SEQ ID NO: 1, and only the amino acid sequence is shown in SEQ ID NO: 2. The number of amino acid residues of the protein predicted from this nucleotide sequence is 228, and the molecular weight is 257.
The isoelectric point is 5.4.

As a result of homology search for known amino acid sequences, various transport proteins and RNaseH
It was found that the homology with II was high. In particular, in the same archaeon, methane bacteria (Methanococcus jannaschii), R
It has 38% homology with the sequence of the open reading frame thought to be NaseHII.

[0033]

Example 2 Production of Thermostable Ribonuclease H (1) Construction of Mass Production System Using pBR3000 obtained in Example 1 as a template DNA, a 5′-primer containing a NdeI restriction enzyme site (TTAGGAGGTGAA CATAT)
G AAGATAGCGGGCATTGACGAGGC (SEQ ID NO: 3; underlined at NdeI site) and 3'- including SalI restriction enzyme site
A primer (GCGCG GTCGAC CCTCGCGGCTGCCAGTTTTGCAT (SEQ ID NO: 4), underlined at the SalI site) was used to amplify a DNA fragment of about 720 bp by PCR.
The PCR reaction was performed according to the instructions of a commercially available Gene Amp Kit (Takara). The obtained DNA fragment of about 720 bp was digested with restriction enzyme N.
After digestion with deI and SalI, the digest was subjected to 1.0% agarose gel electrophoresis, and a DNA fragment of about 720 bp was cut out and extracted for purification.

Next, the thus obtained DNA fragment was used to transform the expression vector pJLA503 in Escherichia coli (Medac, Germany).
Subclone) to construct an expression vector. In PJLA503, transcription from the bacteriophage lambda promoter P _R and P _L is, since under the control of the temperature-sensitive repressor cl ^Ts857, expression of the gene was inserted downstream of 30 to 32 ° C. At these promoters In contrast, at 40-42 ° C, gene expression is induced. Plasmid pJLA503 was digested with NdeI and SalI, and a DNA fragment of about 4.9 kb was purified by 0.7% agarose gel electrophoresis, and then ligated with the above DNA fragment of about 720 bp for cyclization. Ligation was performed using a commercially available ligation kit (Takara) according to the attached instructions. Escherichia coli MIC3001 was transformed with the thus obtained plasmid pJAL700K, and a transformant MIC3001 / pJ expressing a large amount of thermostable ribonuclease H was transformed.
I got AL700K.

(2) Purification The E. coli transformant MIC3001 / pJAL700K was shake-cultured at 30 ° C. in 400 ml of LB medium containing 100 μg / l ampicillin. When the absorbance of the culture at 600 nm reached 0.5, the culture temperature was raised to 42 ° C., and the culture was continued with shaking for 4 hours and then centrifuged to collect the cells. The obtained cells were added to 2 mM E
After suspending in 40 ml of 20 mM Tris-HCl buffer (pH 7.5) containing DTA, the cells were disrupted by sonication in ice. 30,0
Centrifuge the supernatant (crude extract) obtained by centrifugation at 00 rpm for 30 minutes for 90 minutes.
After heating at 15 ° C for 15 minutes, ammonium sulfate was added to a final concentration of 70% saturation, and the mixture was stirred in ice for 30 minutes, and then stirred at 30,000 rpm for 3 minutes.
The precipitate was collected by centrifugation for 0 minutes. The precipitate was dissolved in 10 ml of 5 mM Tris-HCl buffer (pH 8.0) and dialyzed against the same buffer at 4 ° C. overnight. Then, equilibrated with the same buffer
Loaded on DE-52 column. The enzyme passed through the DE-52 column under these conditions. The flow-through fraction was dialyzed overnight at 4 ° C. against 10 mM Tris-HCl buffer (pH 8.0) containing 1 mM EDTA. Then, the enzyme was adsorbed on the DE-52 column equilibrated with the same buffer, and the NaCl concentration was linearly increased to 0.5 M to elute the thermostable ribonuclease H from the DE-52 column. I let it. Collect the active fraction, 1
10 mM Tris-HCl buffer containing mM EDTA and 150 mM NaCl
(pH 8.0) to obtain a purified sample. The purified sample is
A single band was given on 15% SDS-PAGE. Purification yield is 20 ~
It was a 30 mg / l culture solution. The purified sample also gave a single peak by gel filtration, with an estimated molecular weight of 34,000. Since this value is close to the molecular weight of 27,000 estimated from SDS-PAGE,
This enzyme was suggested to function as a monomer. M13-DN with tritium-labeled activity of this enzyme
When measured at 37 ° C using A / RNA as a substrate, T
It showed about 50% specific activity as compared to RNase HI derived from hermus thermophilus HB8. Activity measurement is a known method
(J. Biol. Chem. 266, 6038-6044 (1991)).

[0036]

According to the present invention, a novel thermostable ribonuclease H and a DNA encoding the same are provided.
Thermostable ribonuclease H is extremely useful as a reagent for genetic engineering such as a reagent for the cycling probe method and a diagnostic agent.

[0037]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 867 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism name: Pyrococcus sp. Strain name: KOD1 Sequence characteristics Symbol: CDS Location: 181.8.867 Sequence CGATAGCGCT GATGGTAAGT TCTGACTTCA GGAAGGTTCT CGGAATAAGT CTACTCCTAA 60 CTCTGACCGT CCAGCTTACC TCAGTGGTTC TTGCCTACTT CACCGCCATA CCCCCAAGTG 120 GTATAGCCAC GATAATGCTC AGGATGCTGAT GATT AGG Lys Ile Ala Gly Ile Asp Glu Ala Gly Arg Gly Pro Val Ile Gly 1 5 10 15 CCA ATG GTG ATA GCG GCG GTT GTG GTG GAT GAG AAT AGC CTC CCA AAG 276 Pro Met Val Ile Ala Ala Val Val Val Asp Glu Asn Ser Leu Pro Lys 20 25 30 CTC GAA GAA CTG AAG GTC AGG GAC TCT AAA AAA CTG ACA CCA AAG AGA 324 Leu Glu Glu Leu Lys Val Arg Asp Ser Lys Lys Leu Thr Pro Lys Arg 35 40 45 CGG GAG AAG CTT TTC AAT GAA ATA CTC GGA GTT TTA GAT GAT TAT GTA 372 Arg Glu Lys Leu Phe Asn Glu Ile L eu Gly Val Leu Asp Asp Tyr Val 50 55 60 ATT CTT GAA TTG CCT CCC GAT GTC ATT GGT TCC AGG GAG GGC ACG CTC 420 Ile Leu Glu Leu Pro Pro Asp Val Ile Gly Ser Arg Glu Gly Thr Leu 65 70 75 80 AAC GAG TTC GAG GTT GAG AAC TTC GCG AAG GCC CTG AAC TCG CTC AAG 468 Asn Glu Phe Glu Val Glu Asn Phe Ala Lys Ala Leu Asn Ser Leu Lys 85 90 95 GTA AAG CCC GAT GTA ATC TAC GCT GAC GCG GCT GAC GTT GAC GAG GAA 516 Val Lys Pro Asp Val Ile Tyr Ala Asp Ala Ala Asp Val Asp Glu Glu 100 105 110 CGC TTT GCG AGA GAG CTT GGG GAG AGG CTG AAC TTC GAG GCT GAA GTC 564 Arg Phe Ala Arg Glu Leu Gly Glu Arg Leu Asn Phe Glu Ala Glu Val 115 120 125 GTT GCG AAG CAC AAG GCC GAC GAC ATC TTT CCC GTC GTC TCA GCT GCT 612 Val Ala Lys His Lys Ala Asp Asp Ile Phe Pro Val Val Ser Ala Ala 130 135 140 TCA ATC CTC GCC AAG GTT ACA AGG GAC AGG GCG GTT GAA AAG CTC AAA 660 Ser Ile Leu Ala Lys Val Thr Arg Asp Arg Ala Val Glu Lys Leu Lys 145 150 155 160 GAA GAG TAC GGG GAG ATA GGC TCT GGC TAC CCA AGC GAC CCA AGA ACG 708 Glu Glu Tyr Gly Glu Ile Gly Ser Gly Tyr Pro Ser Asp Pro Arg Thr 165 170 175 AGG GCT TTT CTT GAG AAC TAT TAT CGG GAG CAC GGT GAG TTT CCG CCG 756 Arg Ala Phe Leu Glu Asn Tyr Tyr Arg Glu His Gly Glu Phe Pro Pro 180 185 190 ATA GTT AGG AAG GGC TGG AAG ACG CTG AAG AAG ATA GCA GAA AAA GTT 804 Ile Val Arg Lys Gly Trp Lys Thr Leu Lys Lys Ile Ala Glu Lys Val 195 200 205 GAG AGC GAG AAA AAG GCC GAA GAA AGG CAG GCT ACT CTT GAC CGC TAC 852 Glu Ser Glu Lys Lys Ala Glu Glu Arg Gln Ala Thr Leu Asp Arg Tyr 210 215 220 TTT CGG AAG GTC TGA 867 Phe Arg Lys Val 225

SEQ ID NO: 2 Sequence length: 228 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Met Lys Ile Ala Gly Ile Asp Glu Ala Gly Arg Gly Pro Val Ile Gly 1 5 10 15 Pro Met Val Ile Ala Ala Val Val Val Asp Glu Asn Ser Leu Pro Lys 20 25 30 Leu Glu Glu Leu Lys Val Arg Asp Ser Lys Lys Leu Thr Pro Lys Arg 35 40 45 Arg Glu Lys Leu Phe Asn Glu Ile Leu Gly Val Leu Asp Asp Tyr Val 50 55 60 Ile Leu Glu Leu Pro Pro Asp Val Ile Gly Ser Arg Glu Gly Thr Leu 65 70 75 80 Asn Glu Phe Glu Val Glu Asn Phe Ala Lys Ala Leu Asn Ser Leu Lys 85 90 95 Val Lys Pro Asp Val Ile Tyr Ala Asp Ala Ala Asp Val Asp Glu Glu 100 105 110 Arg Phe Ala Arg Glu Leu Gly Glu Arg Leu Asn Phe Glu Ala Glu Val 115 120 125 Val Ala Lys His Lys Ala Asp Asp Ile Phe Pro Val Val Ser Ala Ala 130 135 140 Ser Ile Leu Ala Lys Val Thr Arg Asp Arg Ala Val Glu Lys Leu Lys 145 150 155 160 Glu Glu Tyr Gly Glu Ile Gly Ser Gly Tyr Pro Ser Asp Pro Arg Thr 165 170 175 Arg Ala Phe Leu Glu Asn Tyr Tyr Arg Glu His Gly Glu Phe Pro Pro 180 185 190 Ile Val Arg Lys Gly Trp Lys Thr Leu Lys Lys Ile Ala Glu Lys Val 195 200 205 Glu Ser Glu Lys Lys Ala Glu Glu Arg Gln Ala Thr Leu Asp Arg Tyr 210 215 220 Phe Arg Lys Val 225

SEQ ID NO: 3 Sequence length: 41 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TTAGGAGGTG AACATATGAA GATAGCGGGC ATTGACGAGG C 41

SEQ ID NO: 4 Sequence length: 34 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence GCGCGGTCGA CCCTCGCGGC TGCCAGTTTT GCAT 34

──────────────────────────────────────────────────の Continued on front page (51) Int.Cl. ⁶ Identification code FI (C12N 9/22 C12R 1:19)

Claims (5)

[Claims] 1. A DNA encoding the following protein (a) or (b): (A) a protein consisting of the amino acid sequence of SEQ ID NO: 2 (b) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2, and equivalent to the protein of (a) With heat-resistant ribonuclease H activity 2. A DNA encoding a protein consisting of the amino acid sequence of SEQ ID NO: 2. 3. The DNA according to claim 1, which has the following nucleotide sequence (c) or (d). (C) base number 18 in the base sequence shown in SEQ ID NO: 1
DNA having a base sequence of 1 to 864 DNA that hybridizes under stringent conditions with DNA having a base sequence complementary to the base sequence of the DNA of (d) and (c) 4. A thermostable ribonuclease H comprising a protein of the following (a) or (b): (A) a protein consisting of the amino acid sequence of SEQ ID NO: 2 (b) consisting of an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of SEQ ID NO: 2, and equivalent to the protein of (a) With heat-resistant ribonuclease H activity 5. A thermostable ribonuclease H comprising a protein consisting of the amino acid sequence of SEQ ID NO: 2.