JPH11290083A - New protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new protein comprising a protein Trad (salt) having a specific amino acid sequence, localized in skeleton skin and useful for prevention, treatment and diagnosis of diseases in skeletal muscle part such as muscular dystrophy and screening, etc., of the protein controller, etc. SOLUTION: This new protein comprises a new protein Trad (salt) containing substantially the same amino acid sequences as an amino acid sequence represented by the formula and has Db1 homologous (DH) region, a pleckstrin- like region and a phosphorylation enzyme region in single strand of polypeptide chain and is useful as a preventing agent and/or therapeutic agent for diseases in skeletal muscle part such as muscular dystrophy and/or useful for screening of the protein controller and diagnosis, etc., of diseases characteristics to skeletal muscle parts. The protein is obtained by searching EST database by using a base sequence of a human DAP kinase and carrying out PCR of human placenta cDNA library by using a synthetic oligonucleotide prepared from the resultant EST fragment as a primer, integrating the resultant Trad gene into a vector and expressing the gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel protein, Trad.
And its genes. The protein of the present invention
Trad has a Dbl homology (DH) region, a pleckstrin-like region, and a phosphorylase region in a single polypeptide chain, and has an agent for preventing a disease in a skeletal muscle site such as muscular dystrophy and / or It is used for a therapeutic agent, a method for screening for the protein regulatory substance, and a method for diagnosing a disease characteristic of a skeletal muscle site.

[0002]

2. Description of the Related Art Ras, Rab, Rho, Ran and the like are well known as a group of low molecular weight GTP-binding proteins (G proteins) (Barbaci
d, M., Annu. Rev. Biochem., 56: 779 (1987), Salminen, A.
Cell, 49: 527 (1987); Bischoff, FR et al., Nature, 354: 8.
0 (1991)). There are two types of G proteins: an activated form that binds GTP and an inactive form that binds to GDP.
ne nucleotide exchange factors (GEFs) are involved. Representatives of GEFs include Dbl (Hart, M. et al., Nature, 4: 311 (1
991)) and other, especially GE against the Rho subfamily
Many proteins showing Fs activity have a Dbl homology (DH) region (Quilliam, LA et al., BioEssays, 17: 395 (1995)). Rho
Subfamily functions at the cellular level include (1) cytoskeletal remodeling, (2) cell adhesion, (3) cell morphology, (4) cell motility, (5) cytokinesis, (6) smooth muscle contraction, (7) cell invasion, (8)
It is known that it is involved in gene expression etc.
(Fukada et al. Experimental Medicine, 15: 1152 (1997)).

[0003] Recently, as a molecule supposed to be involved in Rho signal transduction, Rho-associated kinase having Rho binding activity has been proposed.
se (Rho-kinase) (Matsui, T. et al., EMBO J. 15: 2208 (1996)), P
rotein kinase N (PKN) (Mukai, H. et al., Biochem. Biophys.
s.Commun. 199: 897 (1994)), C belonging to the Rho subfamily
Myotonic dystrophy kinase-related Cd that binds to dc42
c42-binding kinases (MACKs) (Leung, T. et al., Mol. Cell. Bio
l., 18: 130 (1998), and Trio with a DH region (Debant, A. et al., P.
Acad. Sci. USA, 93: 5466 (1996)) and molecules having a phosphorylase region involved in the activity of the Rho subfamily group have been elucidated. Rho-kinase, MACKs, et al. Characterize the phosphatase domain as the myotonic dystrophy kinase (DMK) (von der Ven, PF
Hum.ol.Genet. 2: 1889 (1993)).
The phosphatase region of rio is a DAP kinase having an activity for inducing apoptosis (Deiss, LP et al., Genes Dev., 9:15
(1995)) and Zip kinase (Kawai, T. et al., Mol. Cell. Biol., 18: 1).
642 (1998)).

[0004] In diseases related to skeletal muscle functions such as muscular dystrophy, knowledge related to the G protein signal transduction system and cell functions centering on DMK is increasing. However, it has not been clarified how enzymes that act as intracellular signal transduction systems activated in association with G proteins correspond to various diseases. Focusing on the tissue localization of each molecule, Rho-kinase is cerebral, cerebellar,
Localized in the lung, PKN, MACKs, and Trio are localized in large organs including skeletal muscle. Therefore, these molecules do not show selective localization in skeletal muscle. That is, it is selectively localized in skeletal muscle
If it becomes possible to provide genes related to the Rho subfamily, we will elucidate the pathology of diseases in the skeletal muscle region and establish diagnostic and therapeutic methods by analyzing the expression level, its structure and function, or analyzing its expression. Is thought to be possible.

[0005]

SUMMARY OF THE INVENTION The present inventors have proposed that Trio
It has a phosphorylase region with high homology to DAP kinase and focuses on having a DH region. We anticipated that a phosphatase having a DH domain and a high similarity to DAP kinase would be present in skeletal muscle, and we thought that this protein would be useful for screening drugs that control skeletal muscle function. That is, an object of the present invention is to find a new phosphatase that shows tissue localization in skeletal muscle, has a phosphatase structure similar to the DH region and DAP kinase, and uses this in the field of medicine and medical treatment. It is to provide a method.

[0006]

Means for Solving the Problems The present inventors have focused on DAP kinase for the purpose of solving the above problems. So DA
A database (GenBank Release, 100, April, 1997) to search for nucleotide sequences showing homology to the Pkinase nucleotide sequence
As a result, EST No.R19772 was extracted. R19772
Was a gene fragment showing homology between DAPkinase and 56.3% / 439base. Hyb shown in Example 1 based on the gene fragment information
cD of the entire coding region as a result of diligent effort using the ridization method
After obtaining NA, preparing an expression system, preparing a drug screening system, and preparing an antibody, the novel protein of the present invention is converted to Tr.
The present invention was completed under the name ad.

The amino acid sequence of the protein Trad of the present invention is shown in SEQ ID NO: 1 in the Sequence Listing, the DNA sequence encoding them is shown in SEQ ID NO: 2 in the Sequence Listing, and the cDNA complementary to the Trad is shown in SEQ ID NO: 3 in the Sequence Listing. Was. The above sequences are stored in the database (GenBan
k release, 100, April, 1997), these were new sequences. Patent sequence database
As a result of searching with DGENE (Derwent Information Ltd. 970921up, 1997), these were novel sequences.

That is, the present invention has the following constitution. (1) A protein Trad containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof. (2) A partial peptide of the protein Trad according to (1) or a salt thereof. (3) A nucleic acid containing a nucleic acid having a base sequence encoding the protein Trad described in SEQ ID NO: 2 in the sequence listing.

(4) A nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2 or a nucleic acid which hybridizes with the nucleic acid under stringent conditions and encodes a polypeptide having autophosphorylation activity. (5) A nucleic acid having at least a part of the base sequence represented by SEQ ID NO: 2 and having at least a part of the base sequence, particularly a 12-mer to 16-mer or more, more preferably an 18-mer or more, and a derivative thereof.

(6) A nucleic acid having at least a part of the nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2 is 3076.
The nucleic acid according to the above (5), which is the nucleic acid from the 3rd to the 3840th, and derivatives thereof. (7) The nucleic acid having at least a part of the nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2 is from position 823 to position 1335
The nucleic acid according to the above (5), which is the nucleic acid up to, and derivatives thereof.

(8) A nucleic acid having at least a part of the nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2
The nucleic acid according to (5), which is the nucleic acid from the 1st to the 1728th, and a derivative thereof. (9) A nucleic acid having at least a part of the base sequence represented by SEQ ID NO: 3 and having at least a part of the base sequence, particularly a 12-mer to 16-mer or more, more preferably an 18-mer or more, and a derivative thereof.

(10) A vector containing the nucleic acid according to (5). (11) An expression transformant carrying the vector of (10). (12) A method for screening a compound or a salt thereof using inhibition or activation as an index using the phosphorylation activity of the Trad protein for itself. (13) An antibody against the protein Trad or a salt thereof described in (1) or the partial peptide or a salt thereof described in (2).

The left and right ends of the amino acid sequence described in the sequence listing are the amino terminal (hereinafter referred to as N-terminal) and the carboxyl group terminal (hereinafter referred to as C-terminal), respectively. 5 'end and 3' end. In addition, preparation of cDNA necessary for the genetic manipulation described in the present invention, examination of expression by Northern blot,
A series of molecular biology experiments, such as screening by the n-method, preparation of recombinant DNA, determination of DNA base sequence, and preparation of cDNA library, can be performed by a method described in a usual experiment manual. Examples of the above-mentioned ordinary experiment book include, for example, Mo
lecular Cloning, Alabolatory manual, Cold Spring Har
ber Laboratory Press, Sambrook, J. et al. (1989).

The protein Trad of the present invention has a polypeptide consisting of at least the amino acid sequence of SEQ ID NO: 1 in the Sequence Listing, but it is known that it occurs in nature, such as intra-species mutation, allelic mutation, etc. A variant produced by a mutation due to a point mutation that can be prepared also contains an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1 as long as the properties of the polypeptide of SEQ ID NO: 1 are not lost. As such, they are included in the novel compounds of the present invention. Regarding the modification and substitution of the amino acid, for example, Benn
ett et al. are described in detail in patent applications (WO 96/2645) and the like, and can be prepared with reference thereto.Polypeptides modified and substituted by these methods are also included in the protein Trad of the present invention. .

For example, as shown in FIG. 3, the peptides represented by positions 987 to 1241 in SEQ ID NO: 1 are sequences unique to phosphorylase, and are useful for preparing a system for measuring enzyme activity. . Further, for example, 23 described in SEQ ID NO: 1 in the Sequence Listing
The peptides represented by positions 6 to 406 are sequences unique to Dbl-like proteins, and are useful for investigating the function of the Rho subfamily. In addition, for example, as described in SEQ ID NO: 1 in Sequence Listing
The peptide represented by positions 434 to 537 is a sequence specific to a pleckstrin-like protein, and this sequence is known to be involved in protein binding (Musacchio, A et al., T.
IBS, 18: 343 (1993)). Therefore, it is useful for searching for factors related to information transmission of the protein Trad and the like. Further, the peptides represented by the 1st to 21st, the 177th to 207th, and the 1260th to 1289th described in SEQ ID NO: 1 in the Sequence Listing are useful for producing antibodies as shown in Example 7.

The protein Trad containing the amino acid sequence represented by SEQ ID NO: 1 or a salt thereof, or a partial peptide of the protein or a salt thereof can be used for preparing an enzyme activity measurement system for diagnosis or treatment. It is useful for the production of a detection system for examining the function of the protein Trad and the production of antibodies.
The “stringent conditions” in the present invention refer to conditions that guarantee the specificity between hybridizing polynucleotides, such as 2 × SSC, 0.1% SDS, and 65 ° C. used in Example 2. By using conventional techniques, non-specific hybridization can be reduced and only highly complementary sequences can be identified by appropriately changing post-hybridization washing conditions such as temperature and salt concentration. It is.

Furthermore, 12 mer or more, especially 12 mer having at least a part of the base sequence of SEQ ID NO: 2 in the sequence listing
To 16mer or more, more preferably 18mer or more nucleic acid, and / or a derivative thereof, and / or 12mer or more having at least a part of the nucleotide sequence of SEQ ID NO: 3, particularly 12mer to 16mer or more, more preferably 18mer or more.
Using the above nucleic acids and derivatives thereof, the Tr of the present invention
The ad protein cDNA clone, cDNA, genomic DNA, genomic gene clone, etc. can be detected. The length of the required nucleic acid depends on the specificity of its sequence and the stability of its binding to the nucleic acid to be detected.
When detecting by erase chin reaction (PCR),
It is desirable that Tm (duplex dissociation temperature) be 45 ° C or higher. When DNAs bind like PCR, one GC
Tm can be estimated by combining the binding at 4 ° C and one AT binding at 2 ° C. Therefore, when the GC content is high, a 16-mer nucleic acid is required for a typical 12-mer GC content region of about 50%. When a nucleic acid derivative having more stable binding to DNA is used, it is possible to detect using a shorter nucleic acid. For example, as a method of examining these genes for the purpose of genetic diagnosis, 12mer or more, particularly 1
Hybridization, PCR using 2mer to 16mer or more, more preferably 18mer or more nucleic acid, that is, DNA, RNA, and derivatives thereof which are methylated, methylphosphated, deaminated, or thiophosphated.
And the like. In a similar manner, the homolog of the gene of the present invention in other organisms such as mice can be detected and the gene can be cloned. Furthermore, cloning of genes on the genome including humans is also possible.
Therefore, by using these cloned genes, the more detailed function of the protein Trad of the present invention can be revealed. For example, with the use of recent gene manipulation techniques, all methods can be used, including transgenic mice, gene targeting mice, and double knockout mice in which the gene related to the gene of the present invention is inactivated. The nucleic acid shown at positions 3076 to 3840 in SEQ ID NO: 2 is
The sequence is unique to a phosphorylase, and the nucleic acids shown at positions 823 to 1335 in SEQ ID NO: 2 are sequences unique to Dbl-like proteins. That is, by using such nucleic acid sequence information to enhance or delete the enzyme activity specific to the protein Trad in a mouse or the like, it can be used for more detailed analysis of the function of the protein Trad. In addition, a two-hybrid evaluation method applying protein binding ability in cells (Hsu, H. et al., Proc. Nat.
l. Acad. Sci. USA., 91: 3181 (1994)) enables analysis of a group of signaling molecules. The nucleic acids shown at positions 1417 to 1728 in the sequence listing SEQ ID NO: 2 are sequences unique to pleckstrin-like proteins. That is, this nucleic acid sequence information
It is useful for analyzing signaling molecules specific to ad. Also,
If there is an abnormality in the genome of the gene of the present invention, application to gene diagnosis and gene therapy is also possible.

At least 12 bases having at least a part of the base sequence of SEQ ID NO: 3 in the sequence listing, particularly from 12 mer to 16 me
The use of a DNA encoding a nucleic acid of r or more, more desirably 18 mer or more, and a derivative thereof enables detection of the Trad mRNA of the present invention. For example, as a method for examining the expression of these genes for the purpose of diagnosis, SEQ ID NO: 3
12mer or more having a partial base sequence of, in particular, 12mer to 16
mer or more preferably 18mer or more complementary nucleic acids, that is, antisense DNA, RNA, and their methylated, methylphosphated, deaminated, or thiophosphated derivatives or antisense nucleic acids, Hybridization, primer extension, nuclease protection assay, and other techniques can be used. Further, for the purpose of clarifying more detailed functions of the protein Trad of the present invention, administration of an antisense nucleic acid to a cell or a living body is also a possible use. For diseases in which an excessive reaction of the protein Trad of the present invention is in a pathological state, treatment can be performed by suppressing gene expression with these antisense nucleic acids. It is also possible to incorporate an antisense nucleic acid into an appropriate vector and use that vector. For examples of preparation and use of these antisense nucleic acids, see Murray, JAH. Hen, ANTISENSE RNA AND DNA, W
Detailed in iley-Liss, Inc., 1992.

As shown in Example 1, for example, the nucleotide sequence at positions 1799 to 2061 in SEQ ID NO: 3 in the sequence listing is effective for detecting Trad for diagnostic purposes, and is also useful for antisense for gene therapy. For the design of the sense nucleic acid, for example, 20 to 40 bases near the 5236th to 5238th positions in SEQ ID NO: 3 in the sequence listing
Is effective. As described above, 12m having at least a part of the base sequence of the base sequence of SEQ ID NO: 2
er or more, especially 12mer to 16mer or more, more preferably 18mer
Nucleic acids of mer or more, and derivatives thereof are useful for diagnosis and the like, 12 mer or more having at least a part of the base sequence of the base sequence of SEQ ID NO: 3, particularly 12 mer to 16 mer or more,
More desirably, a nucleic acid of 18mer or more and derivatives thereof are useful for diagnosis, treatment, and the like.

Examples of the vector containing the nucleic acid of the present invention include, for example, pBR322, pUC8, pUC19, pUC18 and pUC1 derived from Escherichia coli.
19 (both from TaKaRa) and the like, but any other one can be used as long as it can replicate and grow in the host. PE as a vector in Example 3.
FBOS (Mizushima, S. et al., Nucleic Acids Res., 18: 5322 (199
0)) was used as an example using Escherichia coli DH5α (TOYOBO) as a host. Examples of the phage vector containing the DNA of the present invention include λgt10 and λgt11 (manufactured by Stratagene). Other phage vectors can be used as long as they can be propagated in a host. The vector thus obtained is introduced into an appropriate host, for example, a bacterium belonging to the genus Escherichia or Bacillus using the calcium chloride method or the like.
A transformant carrying the vector containing the DNA of the present invention can be prepared. Examples of the genus Escherichia include Escherichia coli K12, HB101, MC1061, LE392, JM
109, INVαF ′, DH5α and the like. Examples of the bacterium of the genus Bacillus include Bacillus subtilis M1114. A phage vector can be prepared, for example, by using an in vitro packaging method (Proc. Natl. Acad. Sc.
i., 71: 2442 (1978)).

A transformed cell E. coli: DH5α-transfected by introducing a plasmid pEFBOS-FLAG-hTrad containing cDNA encoding the entire amino acid sequence of the protein Trad of the present invention into Escherichia coli DH5α.
pEFBOS-FLAG-hTrad was accepted by the Ministry of International Trade and Industry of Japan at the Institute of Biotechnology and Industrial Technology, on March 19, 1998, under the accession number: FE.
Deposited internationally as RM BP-6301. A vector containing a nucleic acid having a nucleotide sequence encoding Trad of the present invention is used for producing a nucleic acid having a nucleotide sequence encoding Trad of the present invention, and a transformant carrying the nucleic acid of Trad of the present invention. It is useful in producing The expression of Trad using the nucleic acid of the present invention prepared by the above method is known from Seika (Kriegler, Gene Transfer and Expression-A
Laboratory Manual, Stockton Press, 1990; and Yokota et al., Bio Manual Series 4, Gene Transfer and Expression / Analysis Methods, Yodosha, 1996), and many other methods are used.
That is, the cD encoding the isolated amino acid sequence of Trad
By connecting NA to an appropriate expression vector, eukaryotic cells such as animal cells and insect cells and prokaryotic cells such as bacteria can be produced as hosts.

When expressing the protein Trad of the present invention, the nucleic acid encoding the polypeptide of the present invention has a translation initiation codon at its 5 'end and a translation stop codon at its 3' end. You may. These translation initiation codon and translation termination codon can also be added using a suitable synthetic nucleic acid adapter. To express the DNA, a promoter is connected upstream. Examples of the vector include the aforementioned Escherichia coli-derived plasmid, Bacillus subtilis-derived plasmid, yeast-derived plasmid, and bacteriophage such as λ phage and animal viruses such as retrovirus and vaccinia virus.

The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. When the host to be transformed is Escherichia, a tac promoter, a trp promoter, a lac promoter and the like are preferable, and when the host is a Bacillus, SP01 promoter and SP02 promoter are preferable, and the host is yeast. In some cases, the PGK promoter, GAP promoter, ADH promoter and the like are preferred. When the host is a prokaryotic cell, it preferably has a ribosome binding site together with a promoter. If the host is an animal cell, SV40
Derived promoter, retroviral promoter,
Metal thionein promoter, heat shock promoter and the like can be used.

When expressing the polypeptide of the present invention, only a nucleic acid encoding a protein substantially equivalent to the amino acid sequence of SEQ ID NO: 1 in the Sequence Listing may be used. By adding a nucleic acid encoding a known antigen epitope, a protein with a special function can be produced. One example of such a technique is described in Choe, H .; Cell, 85, 1135-1148, 1996
The year can be raised.

The present inventors, as shown in Example 3,
As an expression vector for expressing the protein Trad, a DNA encoding the amino acid sequence shown in SEQ ID NO: 1 in the Sequence Listing was ligated to the expression vector pEFBOS-FLAG to prepare an expression vector containing the DNA of the present invention. Using the expression vector containing the DNA encoding Trad thus constructed, the DNA of the present invention
To produce a transformant carrying the vector containing Examples of the host include Escherichia, Bacillus, yeast, animal cells and the like. Examples of animal cells include monkey cells such as COS-7, Vero cells, Chinese hamster cells CHO, and silkworm cells SF9.

As shown in Example 4, the above-described expression vector is transfected, the protein Trad is expressed in COS-7 cells or the like, and transformants transformed with these expression plasmids are obtained. A transformant containing a vector containing a nucleic acid having a nucleotide sequence encoding a protein substantially equivalent to the protein Trad of the present invention was prepared, and each was prepared by a known method under appropriate culture conditions in a suitable medium. By culturing, the Trad protein of the present invention or a salt thereof can be produced. For example, as in Example 4, Wester
The production of Trad protein can be confirmed using n blotting or the like.

Trad is a phosphorylase obtained based on the genetic information of DAP kinase. As shown in FIG.
Trad's phosphatase domain is Trio, DAP kinase, Zip kinas
e, CaMkinase II, MLCK phosphorylase region and 58,4 respectively
Shows 1,41,30,37% homology. Therefore, as shown in Example 5, it was confirmed that the protein Trad has a phosphatase activity. An expression vector of wild-type Trad (pEFBOS-FLAG-hTrad), phosphatase-deficient TradK1016A (pEFBOS-FLAG-hTradK1016A), or a control (pEFBOSmock) was transiently introduced into COS7 cells according to the lipofection method. 36 hours after transfection, immunoprecipitates were prepared using FLAG tag, and their autophosphorylation activities were evaluated. As a result, as shown in Example 5, it was revealed that only wild-type Trad has autophosphorylation activity. Trad is also motivated to acquire genes from information that Trio has a DAP kinase-like region and a DH region. As shown in FIG. 4, the DH region of the protein Trad is composed of Trio, Kalirin (Rashidu
1, MA et al., J. Biol. Chem., 272: 12667 (1997)), showing 67, 38, and 42% homology with the DH region of Dbl, respectively. In particular, proteins showing GEFs activity against the Rho subfamily include Dbl homology (D
Since many of them have the H) region and regulate the cytoskeletal protein as a function of the Rho subfamily, the intracellular localization of the protein Trad and cytoskeletal protein was confirmed. As a result, as shown in Example 6, the protein Trad showed the same localization as the intracellular skeletal protein, suggesting that the protein Trad is involved in the signaling of the Rho subfamily. Further, as shown in Example 2, Trad showed selective tissue localization in skeletal muscle. As described above, the present invention is useful for screening a compound having an activity of regulating the function of skeletal muscle, as shown in Example 8, using the self-phosphorylation activity of Trad as an indicator.

An antibody that specifically recognizes the Trad protein can be prepared as described in Example 7. The length of the peptide for producing the antibody is not particularly limited,
It is sufficient if the length is such that the Trad protein can be characterized, and a peptide of preferably 6 amino acids or more, particularly preferably 8 amino acids or more, may be used. This peptide can be used as is or with KLH (keyhole-limpet hemocyanin) or BSA (bovine serum
After cross-linking with a carrier protein such as albumin), the animal is inoculated with an adjuvant, if necessary, and the serum thereof is recovered, whereby an antiserum containing an antibody (polyclonal antibody) recognizing the Trad protein can be obtained. It is also possible to purify the antibody from the antiserum before use. The animals to be inoculated include sheep, cows, goats, rabbits, mice, rats, and the like. Particularly, sheep and rabbits are preferable for preparing polyclonal antibodies. It is also possible to obtain a monoclonal antibody by a known method for producing a hybridoma cell. In this case, a mouse is preferable. In addition, the full length of the amino acid shown in SEQ ID NO: 1 or more than 6 residues, preferably the amino acid sequence of more than 8 residues GS
A product fused with T (glutathione S-transferase) or the like can be used as an antigen after being purified or unpurified. Book (Antibodies a laboratory ma
nual, E. Harlow et al., Cold Spring Harbor Laborato
Using the immunoglobulin gene isolated by the various methods described in ry), the gene cloning method, and the like, it can also be produced by a recombinant antibody expressed in cells. The antibody thus prepared can be used for purifying the protein Trad of the present invention.

[0029]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Next, embodiments of the present invention will be described in detail, but the present invention is not limited to only these embodiments.

[0030]

[Example 1] (Cloning of human Trad gene) Human DAP
Using the nucleotide sequence of kinase (Genes Dev. 9: 15-30 (1995)), the EST database (GenBank release) was added to `` DAP kinas
A keyword search for "e" revealed a human-derived clone with high homology to the human DAPkinase sequence. 56 EST fragment information, ZIP kinase (Kawai, T. et al., Mol.Cell.Biol., 1)
8: 1642 (1998)) except for EST sequences with high homology.
EST fragments were grouped. Several grouped EST fragments were amplified and used for the following cloning operations. As a result, the cloning of Trad was finally completed using R19772.

Based on the base sequence information of the R19772 sequence, a human placenta cDNA library (CLONTECH) was used as a material, using synthetic oligonucleotides described in SEQ ID NOs: 4 and 5 in the Sequence Listing.
PCR (Polymerase chain reaction) was performed to amplify the sequence of R19772 between 6 and 304 bases. PCR was performed using Taq polymerase (TaKaRa) at 94 ° C for 30 seconds, 56 ° C for 30 seconds, and 72 ° C for 1 minute.
One cycle was performed at 0 ° C. and 10 minutes at 72 ° C. A part of this PCR product was electrophoresed in 1.0% agarose gel, stained with ethidium bromide (Nippon Gene), and it was confirmed that about 300 bp cDNA was amplified under ultraviolet irradiation.
This band was excised from the gel, purified by Wizard (Promega), and cloned using a TA cloning kit (Novagen).

That is, pT7Blue (Novage
n companies, hereafter referred to as T-vector)
Are mixed so that the molar ratio is 1: 3, and Ligation is performed.
DNA was incorporated into the vector using kit (TaKaRa). Escherichia coli DH5α (TOYOBO
) And ampicillin (Sigma) at 50 μg / m
l-Broth (Takara Shuzo) containing 200 μg / ml of X-gal (Nacalai) on a plate of semi-solid medium, leave at 37 ° C for about 12 hours, and randomly select white colonies that have appeared. Planted in 2 ml of L-Broth liquid medium containing ampicillin at a concentration,
After culturing with shaking at 37 ° C. for about 8 hours, the cells were collected, and the plasmid was separated using Wizard Mini Prep (Promega) according to the attached instructions.
Digestion with EcoRI (TOYOBO) and restriction enzyme SalI (TOYOBO) confirmed that the PCR product was incorporated by cutting out about 300 bp of DNA, and confirmed the clones that had been incorporated. The nucleotide sequence of the cDNA was determined.

The nucleotide sequence of the inserted cDNA fragment was determined according to Applie
d Performed using a fluorescent sequencer manufactured by Biosystems. Preparation of sequence sample is PRISM, Ready React
ionDye Terminator Cycle Sequencing Kit (Applied Bio
systems). 10.0 μl of reaction stock solution in a 0.2 ml microtube, 1.6 μmol / μl of 2.0 μl
T7 promoter primer (GIBCO BRL) and 8.0μ
l of 0.10 μg / μl sequencing template DNA is added and mixed, and 25 cycles of PCR amplification reaction with 1 cycle of 96 ° C for 10 seconds, 50 ° C for 5 seconds and 60 ° C for 4 minutes are performed, and incubated at 4 ° C for 5 minutes. did. After the reaction, 2.0 μl of 3M sodium acetate (pH 5.2) and 50 μl of ethanol were added, and the mixture was stirred, left at room temperature for 15 minutes, and centrifuged at 14,000 rpm for 15 minutes to collect a precipitate. After the precipitate was washed with 70% ethanol, it was allowed to stand under vacuum for 2 minutes and dried to obtain a sample for sequencing. The sequence sample was dissolved in 6.0 μl of formamide containing 10 mM EDTA, denatured at 90 ° C. for 2 minutes, and cooled in ice to form a 2.0 μl sample.
μl was applied and subjected to sequencing.

When DNA sequencing was performed on six clones, all the clones resulted in SEQ ID NO:
It had a sequence corresponding to positions 3295 to 3557 of the DNA sequence 2 (not including the sequences of the primers at both ends). Next, using the above clone as a probe, a clone having a full-length cDNA was searched in a human placenta cDNA library (CLONTECH). 5 × 10 ⁵ plaques were removed using Molecular Clonin
g, A laboratory manual, 1989, Eds., Sambrook, J., etc.: Co
ld Spring Harbor Laboratory Press, Immobilization o
f bacteriophage λ plaques onnitrocellulose filter
The resulting plaque was transferred to a nylon filter (colony / plaque screen, NEN), and the transferred nylon filter was treated with alkali (1.5 M NaCl, 0.5 MN).
aOH-impregnated filter paper for 5 minutes), followed by neutralization treatment (1.5 minutes NaCl, 0.5M Tris-HCl (pH7.5) impregnated filter paper for 5 minutes) twice. 2 × SSC solution (1 × SSC
The solution was washed in 0.15 M NaCl, 15 mM citric acid (pH 7.0) for 5 minutes and air-dried. Radioisotope ³² using this filter
Hybridization was performed using the clone labeled with P as a probe.

The probe labeled with the radioactive isotope ³² P was prepared as follows. That is, 6base of R19772
The restriction enzyme EcoRI (TOYOBO) and restriction enzyme SalI (TOYOBO)
), Electrophoresed in a 1.0% agarose gel, stained with ethidium bromide (Nippon Gene Co., Ltd.), observed under ultraviolet light, and a band of about 300 bp was cut out from the gel, and Wizard (Promega Was used for purification. The obtained DNA fragment is labeled with a DNA labeling kit (Megapri
me DNA labeling system (Amersham). That is, 5 μl of primer solution from 10 to 50 ng / μl of DNA
Add deionized water to make a total volume of 33 μl, and add 5 boiling water baths.
For 5 minutes, then 10 μl of 5 × reaction solution, [α- ³² P] dCTP (Amer
sham) and 2 μl of Klenow enzyme solution (TOYOBO), and water-bathed at 37 ° C. for 10 minutes.
A 304 base fragment was synthesized from e. Further, after that, the product was purified by a Sephadex column (ProbeQuant G-50 Micro columns: Pharmacia), and after using a boiling water bath for 5 minutes, ice-cooling for 2 minutes before use.

The filters prepared by the above-described method were mixed with a SSC solution having a final concentration of 6 times, a Denhardt solution having a 5 times concentration (Wako Pure Chemical Industries), 1% SDS (sodium dodecyl sulfate, Wako Pure Chemical Industries, Ltd.). (Yakusha), and 100 μg / ml in a hybridization solution containing denatured salmon sperm DNA (Sigma) in a boiling water bath, and shaken at 65 ° C. for 0.5 to 1 hour.
The ³² P-labeled probe was added to the hybridization solution in the manner described above, and the mixture was shaken at 65 ° C. for 16 hours to perform hybridization.

Next, the filter was immersed in an SSC solution containing 0.1% SDS at a final concentration of 2 times each containing 0.1% SDS.
After washing twice, it was further washed twice at 65 ° C. for 30 minutes with a washing solution containing 0.2 times concentration of SSC and 0.1% SDS. After the washing, the filter was subjected to autoradiography at -85 ° C using an intensifying screen. As a result, a strongly exposed clone was picked up, plaque was replated again, screening was performed twice by the above-mentioned method, and a single clone was completely separated.

Molecular Cloning, A laboratory manua
1, 1989, Eds., Sambrook, J., Fritsch, EF, and Mania
tis, T., Cold Spring Harbor Laboratory Press 2.7
0, the according to the method, the phage of these clones about 10 ⁹
pfu (plaque forming unit) prepared, Wizard lambda prep
s (Promega) to purify the phage DNA,
digested with coRI (TOYOBO) and similarly restricted with EcoRI (TOYOBO)
BO) digested plasmid pBluescriptII KS (+) (Stra
tagene). The DNA sequence of these clones
The DNA sequencer was analyzed and the DNA sequence in SEQ ID NO: 2 in the Sequence Listing was determined.

The total length of Trad was determined as described above, and the sequence of Trad in SEQ ID NO: 1 in the sequence listing was determined.

[0040]

Example 2 (Northern Hybridization) In order to examine the mRNA expression of Trad of the present invention, Human Multiple Tis
Using sue Northern Blot (CLONTECH), Northern hybridization was performed using the translation region of human Trad as a probe. The radiolabel of the probe is Megaprime DNA la
beling system (Amersham) and [α- ³² P] dCTP (Amersham
Was carried out using The washing conditions for the filter are 2 × SSC,
0.1% SDS, wash once for 1 minute at room temperature, then 2x SSC, 0.1% SDS
Wash once at 65 ° C for 30 minutes, and further wash with 0.2 × SSC, 0.1% SDS.
Washing was performed at 30 ° C. for 30 minutes. After washing, the degree of blackening of the film was measured by autoradiography to determine the localization. The result is shown in FIG. As shown in FIG. 1, Trad was expressed only in skeletal muscle.

[0041]

Example 3 (Construction of Expression Vector and Preparation of Transformant) First, plasmid pBluescriptII KS (+) (Stratag
Using a Trad cDNA incorporated into the NotI site of ene Co., Ltd. as a template, Trad with a FLAG epitope added to the N-terminal was amplified by PCR. Amplification was performed using Amplitaq (Perkin Elmer), and a sense primer described in SEQ ID NO: 6 of the synthetic oligonucleotide and an antisense primer described in SEQ ID NO: 7 of the synthetic oligonucleotide were used. PCR was performed at 94 ° C for 1 minute, followed by 30 cycles of 94 ° C for 30 seconds, 60 ° C for 30 seconds, and 72 ° C for 1 minute.
C. for 10 minutes. The amplified PCR product was subcloned using a TA cloning kit (Novagen), and it was confirmed by sequencing that no mutation was contained. Next, the pBluescriptII KS (+)-hTrad prepared above and the PCR product were digested with the restriction enzyme XbaI (TaKaRa) and ligated.
escriptIIKS (+)-FLAG-hTrad was obtained. On the other hand, expression vector
(pEFBOS) (Mizushima, S. et al., Nucleic Acids Res., 18: 5322
(1990)) with restriction enzyme XbaI (TaKaRa), followed by Blunting
The end is blunted with kit (TaKaRa), and SalI linker is ligati
Connected with on kit (TaKaRa). The resulting plasmid was cut with the restriction enzyme SalI (TOYOBO), and the pBlu
escriptII KS (+)-FLAG-hTrad with restriction enzyme SalI (TOYOBO
PEFBOS-FLAG by connecting both vectors.
-I got hTrad. Next, a phosphatase-deficient mutant (TradK1016A) in which the lysine at position 1016 was substituted with alanine was used as a synthetic oligonucleotide described in SEQ ID NO: 8 in the Sequence Listing and Transformer Site-Directed Mutagenesis Kit manufactured by Clontech, and Prepared according to the protocol, pEFBOS-FLAG-
hTradK1016A was obtained.

Further, the prepared expression vector (pEFBOS-FL)
AG-hTrad, pEFBOS-FLAG-hTradK1016A) and E. coli DH5α (T
OYOBO). Plasmid pEFB containing cDNA encoding the entire amino acid sequence of Trad of the present invention
Transformed cells E. coli: DH5α-pEFBOS-FLAG-hTrad obtained by transfecting OS-FLAG-hTrad into Escherichia coli DH5α were sent to the Biotechnology Industrial Research Institute of the Ministry of International Trade and Industry of Japan, March 1, 1998.
Deposited internationally on September 9 as accession number: FERM BP-6301.

[0043]

Example 4 (Confirmation of Trad Expression) Wild-type Trad (pEFBOS-FL)
AG-hTrad) or Phosphorylase activity-deficient TradK1016A (pE
Each of FBOS-FLAG-hTradK1016A) or control (pEFBOSmock) was transiently introduced into COS-7 cells (ATCC No. CRL-1651) according to the lipofection method (Mirus). After 36 hours, 0.5%
500μ consisting of NP-40, 10mM Tris-HCl (pH7.5), 150mM NaCl
The cells were solubilized with 1 l of a cell extract preparation buffer to prepare a cell extract. Add 20 μl of this cell extract to Laemmli s
Add 20 μl of ample buffer (TEFCO), treat at 94 ° C for 5 minutes, and use 4-20% gradient polyacrylamide gel (TEFCO
After developing by SDS polyacrylamide gel electrophoresis using a nitrocellulose filter (Hybond ECL, Amersh
am). Filter with 5% skim milk (DIFCO
) / Tris base salin (TBS) -0.5% Tween20. Reaction of the filter with anti-FLAG antibody (Kodak)
Next, HRP-labeled sheep anti-mouse antibody (Amersh
am company) and washed with TBS-0.5% Tween20, then Renaiss
An X-ray film was exposed using ance (Dupont), and the molecular weight of the expressed protein was confirmed. The result is shown in FIG.
As shown in FIG. 2, wild-type Trad and phosphorylase activity-deficient type
TradK1016A showed a molecular weight of about 150 kDa.

[0044]

Example 5 Next, the activity of human Trad of the present invention will be specifically described. (Confirmation of the autophosphorylation activity of Trad) The phosphatase domain of Trad (positions 987 to 1241 in SEQ ID NO: 1) has high homology to the calmodulin-dependent kinase family (CaM kinase family). Comparison of the amino acid sequences of DAP kinase and Trad described in (1) shows that the phosphorylase domain is conserved (see FIG. 3). Therefore, it was directly confirmed that Trad has phosphorylase activity.

Wild-type FLAG-Trad (pEFBOS-FLAG-hTrad) or phosphatase-deficient FLAG-TradK1016A (pEFBOS-FLAG-hT
radK1016A) or control Vector (pEFBOSmock)
Lipofection method (Miru) on S-7 cells (ATCC number CRL-1651)
(s company). After 36 hours, 0.5% NP-40,1
The cells were solubilized with 500 μl of a cell extract preparation buffer consisting of 0 mM Tris-HCl (pH 7.5) and 150 mM NaCl to prepare a cell extract. Next, 100 μl of the cell extract was subjected to twice the non-specifically adsorbed protein removal treatment using 50 μl of protein agarose beads (Pharmacia) according to a standard method. In advance
1 μg of anti-FLAG antibody (Kodak) and 50 μl of Protein Gag
arose beads (Pharmacia) were bound, and 50 μl of the cell extract obtained by removing non-specifically adsorbed protein was reacted with beads (10 μl) at 4 ° C. overnight. After washing three times with 100 μl of a cell extract preparation buffer, an immunoprecipitate was prepared. 50 mM Tris-HCl (pH 7.0), 10 mM MgC in 20 μl of immunoprecipitate
20 μl of a phosphorylation buffer consisting of l ₂ and 3 mM MnCl ₂ and 10 μCi
[Γ- ³² P] ATP (Amersham) was added and incubated at 30 ° C. for 15 minutes to promote the phosphorylation reaction, and the Laemmli sample buffer (TEFCO
Was added and treated at 94 ° C. for 5 minutes to stop the phosphorylation reaction. 4-20% gradient polyacrylamide gel (TEFC
(Company O), developed by SDS polyacrylamide gel electrophoresis, dried the gel and analyzed by autoradiography.
The degree of autophosphorylation of about 150 kDa protein, which is the molecular weight of Trad, was determined by measuring the degree of blackening of the film. The result is shown in FIG.

[0046]

Example 6 (Confirmation of intracellular localization of human Trad protein)
1 × 10 ³ COs cultured in a LoveTech chamber (NUNC)
S-7 cells (ATCC No.CRL-1651), wild-type human Trad (pEFBOS
-FLAG-hTrad) was transiently introduced using the lipofection method (Mirus). 48 hours later, wash twice with PBS (-), 4
3% paraformaldehyde (Nakarai), 0.3% Tri
Cells were fixed for 5 minutes with a fixative solution consisting of ton-X 100 (Nakarai). Thereafter, the plate was washed three times with PBS (-) and blocked with PBS (-) containing 3% BSA (SIGMA) at room temperature for 60 minutes. Next, 10 μg / ml anti-FLAG antibody (Kodak) and 3% B
Primary staining was performed at room temperature for 60 minutes using PBS (-) containing SA.
After washing three times with BS (-), 10 μg / ml FITC-conjugated sheep anti-mouse antibody (TAGO) and 2 units / ml rhodamin phalloidin (Mol
30 minutes at room temperature using PBS (-) containing ecular Probes
Secondary staining was performed, followed by washing three times with PBS (-) to prepare a sample for microscopic observation.

AX80 (Olympus) was used for microscopic observation, and excitation wavelength of 470 to 4 for detecting FITC was used for detecting human Trad.
A filter having a wavelength of 90 nm and a detection wavelength of 515 to 550 nm was used. For detection of cytoplasmic proteins, filters having an excitation wavelength of 520 to 550 nm for detecting rhodamin and a detection wavelength of 580 nm or more were used. The results of the observation are shown in FIG. As shown in FIG. 5, it was confirmed that the intracellular distribution of human Trad protein and cytoplasmic protein were identical.

[0048]

Example 7 (Preparation of Antibody Recognizing Trad Protein) From the 1st Met to the 21st Cys, from the 177th Asp to the 207th Cys, and further from the 1260th Cys in SEQ ID NO: 1 in the Sequence Listing
Synthesize peptides up to Thr 1289 and use 3
After immunizing rabbits with the same amount of this peptide and measuring the antibody titer, whole blood was collected, serum was collected, and the attached instruction manual was used using the Econopack serum IgG purification kit manufactured by BioRad, USA. According to the protocol, an anti-human Trad protein rabbit polyclonal antibody was purified and prepared.

The peptide was synthesized by the Fmoc solid-phase synthesis method (Shinsei Kagaku Jikken Koza 1; Protein VI synthesis and expression, published by Tokyo Kagaku Dojin), and 2 mg of the synthetic peptide was used in an equivalent amount of the carrier protein KLH (keyhole-limpet). hemocyani) (PIERCE
And the maleimide method were used as antigens. One rabbit weighing about 2.5 kg (NZW, Japan SLE
And 0.5 mg of the antigen was subcutaneously administered to the back, and the same amount of the antigen was similarly administered at 21 days, 42 days and 63 days thereafter. On day 73 after the first administration, blood was collected from rabbits by carotid blood sampling under anesthesia, and the serum was separated and used as antiserum.

[0050]

Example 8 (Compound screening example) A compound having skeletal muscle function controlling activity was screened using the activity of Trad's autophosphorylase as an index. (1) Preparation of wild-type Trad Wild-type Trad (pEFBOS-FLAG-hTrad) was transferred to COS-7 cells (ATCC No.
RL-1651) was transiently introduced according to the lipofection method (Mirus). After 36 hours, 0.5% NP-40, 10 mM Tris-HCl (pH
7.5) The cells were solubilized with 500 μl of a cell extract preparation buffer consisting of 150 mM NaCl to prepare a cell extract. Next, an anti-FLAG antibody (Kodak) from the cell extract according to a standard method
And Protein G agarose beads (Pharmacia) to prepare an immunoprecipitate.

(2) Preparation of Inhibitor A compound commercially available as a phosphatase inhibitor was added to DMSO
(GIBO BRL) so as to be 10 mM. This was used as a stock solution and diluted with distilled water to prepare a 400 μM solution.
For comparison, DMSO was diluted with distilled water to the same concentration as the evaluation concentration. (3) Method for measuring inhibitory activity 20 μCi of [γ- ³² P] A was added to 20 μl of the immunoprecipitate containing wild-type Trad.
50 mM Tris-HCl (pH 7.0) containing TP (Amersham), 20 mM MgCl
_2, 6 mM MnCl kept warm promote phosphorylation reaction compound for evaluation of 400μM, prepared phosphorylation buffer 10 [mu] l and above consisting of ₂ solution was added 10 [mu] l 15 min at 30 ℃, Laemmli sample buffer
20 μl (TEFCO) is added and treated at 94 ° C. for 5 minutes to stop the phosphorylation reaction. Using SDS polyacrylamide gel electrophoresis using a 4-20% gradient polyacrylamide gel (TEFCO), evaporate the gel to dryness, and determine the degree of autophosphorylation of the protein of about 150 kDa, which is the molecular weight of Trad, by autoradiography. Was measured for radioactivity using a BAS-2000 bio-imaging analyzer (Fuji Photo Film Co., Ltd.). The inhibitory activity was determined by the rate of decrease in the amount of radioactivity due to the reaction of the DMSO solution containing no evaluation compound as a control.
Result, Cheryrythrine Chloride (CALBIOCHEM) 100 μM
(Final concentration) showed no inhibitory activity.

[0052]

EFFECT OF THE INVENTION The gene of the present invention can be used for the preparation of the protein Trad, and by using it, the analysis and detection of diseases in which the Rho subfamily is involved in the function of skeletal muscle and the detection of the Rho subfamily Genetically engineered production of proteins involved in activity
o Useful for diagnosis of diseases involving the subfamily and screening and evaluation of inducers or inhibitors of the activity of Trad phosphatase.

[0053]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1289 Sequence type: Amino acid Topology: Linear Sequence type: Protein Origin Organism name: Human Tissue type: Skeletal muscle Sequence: Met Lys Gly Gly Asp Arg Ala Tyr Thr Arg Gly Pro Ser Leu Gly Trp 5 10 15 Leu Phe Ala Lys Cys Cys Cys Cys Phe Pro Cys Arg Asp Ala Tyr Ser 20 25 30 His Ser Ser Ser Glu Asn Gly Gly Lys Ser Glu Ser Val Ala Asn Leu 35 40 45 Gln Ala Gln Pro Ser Leu Asn Ser Ile His Ser Ser Pro Gly Pro Lys 50 55 60 Arg Ser Thr Asn Thr Leu Lys Lys Trp Leu Thr Ser Pro Val Arg Arg 65 70 75 80 Leu Asn Ser Gly Lys Ala Asp Gly Asn Ile Lys Lys Gln Lys Lys Val 85 90 95 Arg Asp Gly Arg Lys Ser Phe Asp Leu Gly Ser Pro Lys Pro Gly Asp 100 105 110 Glu Thr Thr Pro Gln Gly Asp Ser Ala Asp Glu Lys Ser Lys Lys Gly 115 120 125 Trp Gly Glu Asp Glu Pro Asp Glu Glu Ser His Thr Pro Leu Pro Pro 130 135 140 Pro Met Lys Ile Phe Asp Asn Asp Pro Thr Gln Asp Glu Met Ser Ser 145 150 155 160 Ser Leu Leu Ala Ala Arg Gln Ala Ser Thr Glu Val Pro Thr Ala Al a 165 170 175 Asp Leu Val Asn Ala Ile Glu Lys Leu Val Lys Asn Lys Leu Ser Leu 180 185 190 Glu Gly Ser Ser Tyr Arg Gly Ser Leu Lys Asp Pro Ala Gly Cys Leu 195 200 205 Asn Glu Gly Met Ala Pro Pro Thr Pro Pro Lys Asn Pro Glu Glu Glu 210 215 220 Gln Lys Ala Lys Ala Leu Arg Gly Arg Met Phe Val Leu Asn Glu Leu 225 230 235 240 Val Gln Thr Glu Lys Asp Tyr Val Lys Asp Leu Gly Ile Val Val Glu 245 250 255 Gly Phe Met Lys Arg Ile Glu Glu Lys Gly Val Pro Glu Asp Met Arg 260 265 270 270 Gly Lys Asp Lys Ile Val Phe Gly Asn Ile His Gln Ile Tyr Asp Trp 275 280 280 His Lys Asp Phe Phe Leu Ala Glu Leu Glu Lys Cys Ile Gln Glu Gln 290 295 300 Asp Arg Leu Ala Gln Leu Phe Ile Lys His Glu Arg Lys Leu His Ile 305 310 315 320 Tyr Val Trp Tyr Cys Gln Asn Lys Pro Arg Ser Glu Tyr Ile Val Ala 325 330 335 Glu Tyr Asp Ala Tyr Phe Glu Glu Val Lys Gln Glu Ile Asn Gln Arg 340 345 350 Leu Thr Leu Ser Asp Phe Leu Ile Lys Pro Ile Gln Arg Ile Thr Lys 355 360 365 Tyr Gln Leu Leu Leu Lys Asp Phe Leu Arg Tyr Ser Glu Lys Ala Gly 37 0 375 380 Leu Glu Cys Ser Asp Ile Glu Lys Ala Val Glu Leu Met Cys Leu Val 385 390 395 400 Pro Lys Arg Cys Asn Asp Met Met Asn Leu Gly Arg Leu Gln Gly Phe 405 410 415 Glu Gly Thr Leu Thr Ala Gln Gly Lys Leu Leu Gln Gln Asp Thr Phe 420 425 430 Tyr Val Ile Glu Leu Asp Ala Gly Met Gln Ser Arg Thr Lys Glu Arg 435 440 445 Arg Val Phe Leu Phe Glu Gln Ile Val Ile Phe Ser Glu Leu Leu Arg 450 455 460 Lys Gly Ser Leu Thr Pro Gly Tyr Met Phe Lys Arg Ser Ile Lys Met 465 470 475 480 Asn Tyr Leu Val Leu Glu Glu Asn Val Asp Asn Asp Pro Cys Lys Phe 485 490 495 Ala Leu Met Asn Arg Glu Thr Ser Glu Arg Val Val Leu Gln Ala Ala 500 505 510 Asn Ala Asp Ile Gln Gln Ala Trp Val Gln Asp Ile Asn Gln Val Leu 515 520 525 Glu Thr Gln Arg Asp Phe Leu Asn Ala Leu Gln Ser Pro Ile Glu Tyr 530 535 540 540 Gln Arg Lys Glu Arg Ser Thr Ala Val Met Arg Ser Gln Pro Ala Arg 545 550 555 560 Leu Pro Gln Ala Ser Pro Arg Pro Tyr Ser Ser Val Pro Ala Gly Ser 565 570 575 Glu Lys Pro Pro Lys Gly Ser Ser Tyr Asn Pro Pro Leu Pro Pro Leu 58 0 585 590 Lys Ile Ser Thr Ser Asn Gly Ser Pro Gly Phe Glu Tyr His Gln Pro 595 600 605 Gly Asp Lys Phe Glu Ala Ser Lys Gln Asn Asp Leu Gly Gly Cys Asn 610 615 620 620 Gly Thr Ser Ser Met Ala Val Ile Lys Asp Tyr Tyr Ala Leu Lys Glu 625 630 635 640 640 Asn Glu Ile Cys Val Ser Gln Gly Glu Val Val Gln Val Leu Ala Val 645 650 655 655 Asn Gln Gln Asn Met Cys Leu Val Tyr Gln Pro Ala Ser Asp His Ser 660 665 670 Pro Ala Ala Glu Gly Trp Val Pro Gly Ser Ile Leu Ala Pro Leu Thr 675 680 685 Lys Ala Thr Ala Ala Glu Ser Ser Asp Gly Ser Ile Lys Lys Ser Cys 690 695 700 Ser Trp His Thr Leu Arg Met Arg Lys Arg Ala Glu Val Glu Asn Thr 705 710 715 720 Gly Lys Asn Glu Ala Thr Gly Pro Arg Lys Pro Lys Asp Ile Leu Gly 725 730 735 Asn Lys Val Ser Val Lys Glu Thr Asn Ser Ser Glu Glu Ser Glu Cys 740 745 750 Asp Asp Leu Asp Pro Asn Thr Ser Met Gly Ile Leu Asn Pro Asn Phe 755 760 765 Ile Gln Glu Val Ala Pro Glu Phe Leu Val Pro Leu Val Asp Val Thr 770 775 780 Cys Leu Leu Gly Asp Thr Val Ile Leu Gln Cys Lys Val Cys Gly Arg 785 79 0 795 800 Pro Lys Pro Thr Ile Thr Trp Lys Gly Pro Asp Gln Asn Ile Leu Asp 805 810 815 Thr Asp Asn Ser Ser Ala Thr Tyr Thr Val Ser Ser Cys Asp Ser Gly 820 825 830 Glu Ile Thr Leu Lys Ile Cys Asn Leu Met Pro Gln Asp Ser Gly Ile 835 840 845 Tyr Thr Cys Ile Ala Thr Asn Asp His Gly Thr Thr Ser Thr Ser Ala 850 855 860 Thr Val Lys Val Gln Gly Val Pro Ala Ala Pro Asn Arg Pro Ile Ala 865 870 875 880 Gln Glu Arg Ser Cys Thr Ser Val Ile Leu Arg Trp Leu Pro Pro Ser 885 890 895 Ser Thr Gly Asn Cys Thr Ile Ser Gly Tyr Thr Val Glu Tyr Arg Glu 900 905 910 Glu Gly Ser Gln Ile Trp Gln Gln Ser Val Ala Ser Thr Leu Asp Thr 915 920 925 Tyr Leu Val Ile Glu Asp Leu Ser Pro Gly Cys Pro Tyr Gln Phe Arg 930 935 940 Val Ser Ala Ser Asn Pro Trp Gly Ile Ser Leu Pro Ser Glu Pro Ser 945 950 955 960 Glu Phe Val Arg Leu Pro Glu Tyr Asp Ala Ala Ala Asp Gly Ala Thr 965 970 975 Ile Ser Trp Lys Glu Asn Phe Asp Ser Ala Tyr Thr Glu Leu Asn Glu 980 985 990 Ile Gly Arg Gly Arg Phe Ser Ile Val Lys Lys Cys Ile His Lys Ala 995 Ten 00 1005 Thr Arg Lys Asp Val Ala Val Lys Phe Val Ser Lys Lys Met Lys Lys 1010 1015 1020 Lys Glu Gln Ala Ala His Glu Ala Ala Leu Leu Gln His Leu Gln His 1025 1030 1035 1040 Pro Gln Tyr Ile Thr Leu His Asp Thr Tyr Glu Ser Pro Thr Ser Tyr 1045 1050 1055 Ile Leu Ile Leu Glu Leu Met Asp Asp Gly Arg Leu Leu Asp Tyr Leu 1060 1065 1070 Met Asn His Asp Glu Leu Met Glu Glu Lys Val Ala Phe Tyr Ile Arg 1075 1080 1085 Asp Ile Met Glu Ala Leu Gln Tyr Leu His Asn Cys Arg Val Ala His 1090 1095 1100 Leu Asp Ile Lys Pro Glu Asn Leu Leu Ile Asp Leu Arg Ile Pro Val 1105 1110 1115 1120 Pro Arg Val Lys Leu Ile Asp Leu Glu Asp Ala Val Gln Ile Ser Gly 1125 1130 1135 His Phe His Ile His His Leu Leu Gly Asn Pro Glu Phe Ala Ala Pro 1140 1145 1150 Glu Val Ile Gln Gly Ile Pro Val Ser Leu Gly Thr Asp Ile Trp Ser 1155 1160 1165 Ile Gly Val Leu Thr Tyr Val Met Leu Ser Gly Val Ser Pro Phe Leu 1170 1175 1180 Asp Glu Ser Lys Glu Glu Thr Cys Ile Asn Val Cys Arg Val Asp Phe 1185 1190 1195 1200 Ser Phe Pro His Glu Tyr Phe C ys Gly Val Ser Asn Ala Ala Arg Asp 1205 1210 1215 Phe Ile Asn Val Ile Leu Gln Glu Asp Phe Arg Arg Arg Pro Thr Ala 1220 1225 1230 Ala Thr Cys Leu Gln His Pro Trp Leu Gln Pro His Asn Gly Ser Tyr 1235 1240 1245 Ser Lys Ile Pro Leu Asp Thr Ser Arg Leu Ala Cys Phe Ile Glu Arg 1250 1255 1260 Arg Lys His Gln Asn Asp Val Arg Pro Ile Pro Asn Val Lys Ser Tyr 1265 1270 1275 1280 Ile Val Asn Arg Val Asn Gln Gly Thr 1285 1289

SEQ ID NO: 2 Sequence length: 5355 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: cDNA to mRNA origin Organism name: human Tissue type: skeletal muscle Sequence: CAGCGGGGAG GGCGGGAGCC GGCTCTCGGG CGGCGGCGCT GAAGTTTCCT TCCCGCCGCG 60 CTCTCACCCC GGGCTGGCGC CCCGTGCCAT GCGGGAGCGC TGGGGCGGCG GGGCAAC 117 ATG AAG GGC GGC GAC AGG GCT TAC ACC CGA GGT CCC TCT GTG Gly TGG Gly TGG Gly TGG Gly CTC TTT GCT AAG TGC TGC TGT TGC TTC CCG TGT AGA GAT GCA TAC TCT 213 Leu Phe Ala Lys Cys Cys Cys Cys Phe Pro Cys Arg Asp Ala Tyr Ser 20 25 30 CAT TCC TCA AGC GAG AAT GGA GGC AAG TCC GAG TCC GTA GCC AAC CTG 261 His Ser Ser Ser Glu Asn Gly Gly Lys Ser Glu Ser Val Ala Asn Leu 35 40 45 CAG GCC CAG CCC TCC CTG AAC TCC ATC CAC AGT TCC CCG GGT CCC AAG 309 Gln Ala Gln Pro Ser Leu Asn Ser Ile His Ser Ser Pro Gly Pro Lys 50 55 60 CGC TCC ACC AAC ACT CTT AAG AAG TGG CTG ACG AGT CCT GTG CGT CGG 357 Arg Se r Thr Asn Thr Leu Lys Lys Trp Leu Thr Ser Pro Val Arg Arg 65 70 75 80 CTC AAC AGC GGG AAG GCA GAT GGA AAC ATC AAA AAG CAG AAG AAA GTT 405 Leu Asn Ser Gly Lys Ala Asp Gly Asn Ile Lys Lys Gln Lys Lys Val 85 90 95 CGC GAT GGT CGG AAG AGC TTT GAC CTG GGA TCT CCC AAG CCT GGG GAT 453 Arg Asp Gly Arg Lys Ser Phe Asp Leu Gly Ser Pro Lys Pro Gly Asp 100 105 110 GAA ACA ACC CCT CAG GGA GAC AGC GCT GAT GAG AAG AGC AAG AAA GGT 501 Glu Thr Thr Pro Gln Gly Asp Ser Ala Asp Glu Lys Ser Lys Lys Gly 115 120 125 TGG GGT GAA GAT GAG CCG GAT GAA GAG TCA CAC ACA CCC CTC CCA CCA 549 Trp Gly Glu Asp Glu Pro Asp Glu Glu Ser His Thr Pro Leu Pro Pro 130 135 140 CCT ATG AAG ATT TTT GAC AAC GAC CCT ACA CAG GAT GAA ATG TCC TCC 597 Pro Met Lys Ile Phe Asp Asn Asp Pro Thr Gln Asp Glu Met Ser Ser 145 150 155 160 TCT TTG CTA GCA GCC CGG CAG GCT TCC ACT GAA GTA CCT ACT GCT GCA 645 Ser Leu Leu Ala Ala Arg Gln Ala Ser Thr Glu Val Pro Thr Ala Ala 165 170 175 GAC CTT GTC AAT GCA ATA GAA AAG TTG GTC AAA AAC AAG CTG AGT CTA 6 93 Asp Leu Val Asn Ala Ile Glu Lys Leu Val Lys Asn Lys Leu Ser Leu 180 185 190 GAA GGA AGC TCA TAC CGG GGG AGC TTG AAA GAC CCT GCA GGC TGC CTG 741 Glu Gly Ser Ser Tyr Arg Gly Ser Leu Lys Asp Pro Ala Gly Cys Leu 195 200 205 AAT GAG GGG ATG GCC CCA CCC ACA CCT CCT AAA AAT CCA GAA GAA GAA 789 Asn Glu Gly Met Ala Pro Pro Thr Pro Pro Lys Asn Pro Glu Glu Glu 210 215 220 CAG AAA GCC AAG GCC CTG AGA GGC AGG ATG TTT GTC CTG AAT GAG CTG 837 Gln Lys Ala Lys Ala Leu Arg Gly Arg Met Phe Val Leu Asn Glu Leu 225 230 235 240 GTA CAG ACA GAG AAA GAC TAT GTC AAG GAT CTG GGC ATT GTG GTG GAG 885 Val Gln Thr Glu Lys Asp Tyr Val Lys Asp Leu Gly Ile Val Val Glu 245 250 255 GGC TTC ATG AAG AGA ATA GAA GAA AAG GGT GTC CCT GAG GAT ATG CGA 933 Gly Phe Met Lys Arg Ile Glu Glu Lys Gly Val Pro Glu Asp Met Arg 260 265 270 GGA AAG GAC AAA ATC GTG TTT GGA AAT ATT CAT CAG ATT TAT GAC TGG 981 Gly Lys Asp Lys Ile Val Phe Gly Asn Ile His Gln Ile Tyr Asp Trp 275 280 285 CAT AAG GAT TTT TTC CTG GCG GAA CTG GAA AAG TGT ATC C AG GAG CAA 1029 His Lys Asp Phe Phe Leu Ala Glu Leu Glu Lys Cys Ile Gln Glu Gln 290 295 300 GAC AGA TTG GCA CAG CTC TTT ATT AAG CAC GAG CGG AAG CTG CAC ATC 1077 Asp Arg Leu Ala Gln Leu Phe Ile Lys His Glu Arg Lys Leu His Ile 305 310 315 320 TAC GTG TGG TAT TGT CAG AAT AAG CCG CGC TCA GAG TAC ATC GTT GCT 1125 Tyr Val Trp Tyr Cys Gln Asn Lys Pro Arg Ser Glu Tyr Ile Val Ala 325 330 335 335 GAG TAT GAC GCC TAC TTT GAG GAG GTA AAA CAG GAG ATA AAT CAG AGG 1173 Glu Tyr Asp Ala Tyr Phe Glu Glu Val Lys Gln Glu Ile Asn Gln Arg 340 345 350 CTG ACA CTG AGT GAC TTC CTC ATC AAG CCC ATT CAG AGA ATA ACA AAA 1221 Leu Thr Leu Ser Asp Phe Leu Ile Lys Pro Ile Gln Arg Ile Thr Lys 355 360 365 TAC CAG TTG CTC CTC AAG GAC TTC CTG AGA TAC AGT GAG AAG GCT GGT 1269 Tyr Gln Leu Leu Leu Lys Asp Phe Leu Arg Tyr Ser Glu Lys Ala Gly 370 375 380 TTG GAG TGT TCA GAT ATC GAG AAA GCA GTG GAG TTA ATG TGC CTT GTT 1317 Leu Glu Cys Ser Asp Ile Glu Lys Ala Val Glu Leu Met Cys Leu Val 385 390 395 395 400 CCC AAA CGC TGC AAT GAC ATG AT G AAT CTA GGA CGT CTG CAG GGC TTT 1365 Pro Lys Arg Cys Asn Asp Met Met Asn Leu Gly Arg Leu Gln Gly Phe 405 410 415 GAG GGC ACT CTG ACT GCT CAG GGG AAG CTG CTG CAG CAG GAC ACA TTC 1413 Glu Gly Thr Leu Thr Ala Gln Gly Lys Leu Leu Gln Gln Asp Thr Phe 420 425 430 TAT GTG ATC GAG CTG GAT GCA GGC ATG CAG TCC CGG ACC AAA GAG AGG 1461 Tyr Val Ile Glu Leu Asp Ala Gly Met Gln Ser Arg Thr Lys Glu Arg 435 440 445 CGC GTG TTC CTC TTC GAG CAG ATT GTC ATC TTC AGT GAA CTG CTC AGG 1509 Arg Val Phe Leu Phe Glu Gln Ile Val Ile Phe Ser Glu Leu Leu Arg 450 455 460 AAG GGA TCC CTC ACC CCT GGC TAC ATG TTC AAA AGG AGC ATC AAG ATG 1557 Lys Gly Ser Leu Thr Pro Gly Tyr Met Phe Lys Arg Ser Ile Lys Met 465 470 475 480 AAT TAC TTG GTC CTG GAG GAG AAT GTG GAC AAT GAT CCC TGC AAG TTT 1605 Asn Tyr Leu Val Leu Glu Glu Asn Val Asp Asn Asp Pro Cys Lys Phe 485 490 495 GCA CTC ATG AAC AGA GAG ACT TCT GAG AGG GTT GTT CTG CAA GCC GCC 1653 Ala Leu Met Asn Arg Glu Thr Ser Glu Arg Val Val Leu Gln Ala Ala 500 505 510 AAC GCT GAC ATC CAG CAG GCC TGG GTG CAG GAC ATC AAT CAA GTC TTA 1701 Asn Ala Asp Ile Gln Gln Ala Trp Val Gln Asp Ile Asn Gln Val Leu 515 520 525 GAA ACA CAG CGA GAC TTT TTG AAT GCA CTG CAA TCG CCC ATT GAG TAT17 Glu Thr Gln Arg Asp Phe Leu Asn Ala Leu Gln Ser Pro Ile Glu Tyr 530 535 540 CAA CGG AAA GAA AGG AGC ACA GCT GTG ATG AGG TCT CAA CCT GCC AGG 1797 Gln Arg Lys Glu Arg Ser Thr Ala Val Met Arg Ser Gln Pro Ala Arg 545 550 555 560 CTT CCC CAA GCC AGC CCC AGG CCC TAC TCC TCT GTT CCT GCG GGC TCA 1845 Leu Pro Gln Ala Ser Pro Arg Pro Tyr Ser Ser Val Pro Ala Gly Ser 565 570 575 GAG AAG CCC CCA AAG GGC TCC AGC TAT AAC CCA CCT CTG CCT CCC CTG 1893 Glu Lys Pro Pro Lys Gly Ser Ser Tyr Asn Pro Pro Leu Pro Pro Leu 580 585 590 AAG ATA TCT ACC TCC AAT GGC AGT CCA GGG TTT GAA TAC CAC CAG CCT 1941 Lys Ile Ser Thr Ser Asn Gly Ser Pro Gly Phe Glu Tyr His Gln Pro 595 600 605 GGG GAC AAG TTC GAA GCC AGC AAG CAG AAC GAC CTG GGA GGC TGC AAT 1989 Gly Asp Lys Phe Glu Ala Ser Lys Gln Asn Asp Leu Gly Gly Cys Asn 610 615 620 GGG ACC TCG TCC ATG GCC GTG ATC AAA GAT TAC TAT GCA CTG AAG GAG 2037 Gly Thr Ser Ser Met Ala Val Ile Lys Asp Tyr Tyr Ala Leu Lys Glu 625 630 635 640 640 AAT GAA ATC TGT GTG AGC CAA GGT GAG GTG GTC CAG GTC CTC GCC GTC 2085 Asn Glu Ile Cys Val Ser Gln Gly Glu Val Val Gln Val Leu Ala Val 645 650 655 AAC CAG CAG AAC ATG TGT CTG GTG TAC CAG CCT GCC AGC GAC CAT TCC 2133 Asn Gln Gln Asn Met Cys Leu Val Tyr Gln Pro Ala Ser Asp His Ser 660 665 670 CCC GCC GCC GAG GGC TGG GTC CCA GGC AGC ATC CTG GCG CCC CTC ACC 2181 Pro Ala Ala Glu Gly Trp Val Pro Gly Ser Ile Leu Ala Pro Leu Thr 675 680 685 AAA GCC ACA GCA GCA GAA AGT AGT GAC GGG AGC ATC AAG AAG TCA TGT 2229 Lys Ala Thr Ala Ala Glu Ser Ser Asp Gly Ser Ile Lys Lys Ser Cys 690 695 700 TCA TGG CAT ACT CTA CGC ATG AGA AAG CGG GCG GAA GTG GAG AAC ACG 2277 Ser Trp His Thr Leu Arg Met Arg Lys Arg Ala Glu Val Glu Asn Thr 705 710 715 720 GGT AAA AAT GAA GCC ACA GGG CCT CGT AAA CCC AAG GAT ATT CTG GGC 2325 Gly Lys Asn Glu Ala Thr Gly Pro Arg Lys Pro L ys Asp Ile Leu Gly 725 730 735 AAC AAA GTC TCT GTT AAA GAG ACG AAC AGT TCC GAG GAA TCA GAG TGT 2373 Asn Lys Val Ser Val Lys Glu Thr Asn Ser Ser Glu Glu Ser Glu Cys 740 745 750 GAT GAT CTT GAC CCT AAT ACT AGC ATG GGG ATC TTA AAT CCA AAT TTC 2421 Asp Asp Leu Asp Pro Asn Thr Ser Met Gly Ile Leu Asn Pro Asn Phe 755 760 765 ATC CAA GAA GTG GCC CCA GAA TTC CTT GTG CCC TTG GTG GAT GTG ACC 2469 Ile Gln Glu Val Ala Pro Glu Phe Leu Val Pro Leu Val Asp Val Thr 770 775 780 TGC TTG CTT GGG GAC ACA GTG ATA CTG CAG TGC AAA GTC TGT GGG CGG 2517 Cys Leu Leu Gly Asp Thr Val Ile Leu Gln Cys Lys Val Cys Gly Arg 785 790 795 800 CCA AAG CCC ACC ATC ACT TGG AAG GGT CCA GAC CAG AAC ATC CTT GAC 2565 Pro Lys Pro Thr Ile Thr Trp Lys Gly Pro Asp Gln Asn Ile Leu Asp 805 810 815 ACT GAT AAC AGC TCA GCC ACA TAC ACG GTC TCC TCT TGT GAT TCT GGA 2613 Thr Asp Asn Ser Ser Ala Thr Tyr Thr Val Ser Ser Cys Asp Ser Gly 820 825 830 GAA ATC ACC CTG AAG ATC TGT AAT CTG ATG CCC CAA GAC AGT GGG ATT 2661 Glu Ile Thr Leu Lys Ile Cy s Asn Leu Met Pro Gln Asp Ser Gly Ile 835 840 845 TAT ACC TGC ATA GCA ACA AAT GAC CAC GGG ACC ACA TCA ACG TCT GCA 2709 Tyr Thr Cys Ile Ala Thr Asn Asp His Gly Thr Thr Ser Thr Ser Ala 850 855 860 ACA GTC AAA GTG CAA GGT GTT CCA GCA GCC CCT AAC CGC CCC ATT GCC 2757 Thr Val Lys Val Gln Gly Val Pro Ala Ala Pro Asn Arg Pro Ile Ala 865 870 875 875 880 CAG GAG AGA AGC TGC ACC TCC GTG ATT CTC CGC TGG CTG CCC CCC CCC TCC 2805 Gln Glu Arg Ser Cys Thr Ser Val Ile Leu Arg Trp Leu Pro Pro Ser 885 890 895 AGC ACA GGA AAC TGC ACT ATT TCT GGT TAC ACT GTG GAG TAC AGA GAG 2853 Ser Thr Gly Asn Cys Thr Ile Ser Gly Tyr Thr Val Glu Tyr Arg Glu 900 905 910 GAA GGT TCT CAG ATC TGG CAG CAG TCA GTG GCT TCG ACC TTG GAC ACT 2901 Glu Gly Ser Gln Ile Trp Gln Gln Ser Val Ala Ser Thr Leu Asp Thr 915 920 925 TAC TAC CTC GTC ATC GAA GAC CTT AGT CCC GGG TGT CCT TAT CAG TTC AGA 2949 Tyr Leu Val Ile Glu Asp Leu Ser Pro Gly Cys Pro Tyr Gln Phe Arg 930 935 940 940 GTC AGT GCC AGT AAC CCC TGG GGA ATC AGC CTT CCC AGT GAG CCC TCG 2997 Val Ser Ala Ser Asn Pro Trp Gly Ile Ser Leu Pro Ser Glu Pro Ser 945 950 955 960 GAG TTT GTG CGA CTT CCA GAA TAT GAT GCT GCT GCT GAT GGT GCC ACC 3045 Glu Phe Val Arg Leu Pro Glu Tyr Asp Ala Ala Ala Ala Asp Gly Ala Thr 965 970 975 ATT TCT TGG AAG GAA AAT TTT GAC TCA GCT TAC ACT GAG CTG AAT GAA 3093 Ile Ser Trp Lys Glu Asn Phe Asp Ser Ala Tyr Thr Glu Leu Asn Glu 980 985 990 ATT GGA AGA GGC CGT TTC TCT ATA GTA AAG AAA TGC ATT CAC AAA GCT 3141 Ile Gly Arg Gly Arg Phe Ser Ile Val Lys Lys Cys Ile His Lys Ala 995 1000 1005 ACC CGC AAA GAT GTG GCT GTG AAA TTT GTT AGC AAA AAA ATG AAG AAG 3189 Thr Arg Lys Asp Val Ala Val Lys Phe Val Ser Lys Lys Met Lys Lys 1010 1015 1020 AAA GAA CAG GCT GCC CAC GAG GCT GCC CTG CTT CAG CAC CTA CAG CAC 3237 Lys Glu Gln Ala Ala His Glu Ala Ala Leu Leu Gln His Leu Gln His 1025 1030 1035 1040 CCC CAG TAC ATC ACT CTC CAT GAC ACC TAT GAG TCC CCC ACA TCC TAC 3285 Pro Gln Tyr Ile Thr Leu His Asp Thr Tyr Glu Ser Pro Thr Ser Tyr 1045 1050 1055 ATC CTG ATC TTG GAA CTG ATG GAT GAT GGC C GG CTC TTA GAC TAC CTT 3333 Ile Leu Ile Leu Glu Leu Met Asp Asp Gly Arg Leu Leu Asp Tyr Leu 1060 1065 1070 ATG AAT CAT GAT GAA CTG ATG GAG GAA AAA GTA GCT TTC TAT ATC CGA 3381 Met Asn His Asp Glu Leu M Glu Glu Lys Val Ala Phe Tyr Ile Arg 1075 1080 1085 GAC ATC ATG GAG GCT CTG CAG TAC CTT CAC AAC TGC AGG GTT GCA CAT 3429 Asp Ile Met Glu Ala Leu Gln Tyr Leu His Asn Cys Arg Val Ala His 1090 1095 1100 TTG GAC ATA AAG CCT GAA AAC CTG CTC ATT GAC CTA CGG ATT CCA GTG 3477 Leu Asp Ile Lys Pro Glu Asn Leu Leu Ile Asp Leu Arg Ile Pro Val 1105 1110 1115 1120 CCT CGA GTG AAG CTC ATT GAC TTG GAG GAT GCT GTC CAG ATC TCG GGT 3525 Pro Arg Val Lys Leu Ile Asp Leu Glu Asp Ala Val Gln Ile Ser Gly 1125 1130 1135 CAC TTC CAC ATT CAC CAC CTG CTG GGG AAC CCT GAG TTT GCT GCC CCA 3573 His Phe His Ile His His Leu Leu Gly Asn Pro Glu Phe Ala Ala Pro 1140 1145 1150 GAA GTC ATT CAA GGC ATC CCC GTC TCC CTG GGG ACA GAC ATC TGG AGC 3621 Glu Val Ile Gln Gly Ile Pro Val Ser Leu Gly Thr Asp Ile Trp Ser 1155 1160 1165 ATC GGG GTT CTG ACA TAT GTC ATG CTG AGT GGG GTC TCC CCC TTC TTG 3669 Ile Gly Val Leu Thr Tyr Val Met Leu Ser Gly Val Ser Pro Phe Leu 1170 1175 1180 GAT GAG AGC AAA GAG GAG ACA TGT ATC AAC GTA TGC AGG GTG GAT TTC 3717 Asp Glu Ser Lys Glu Glu Thr Cys Ile Asn Val Cys Arg Val Asp Phe 1185 1190 1195 1200 AGC TTC CCC CAT GAA TAC TTC TGT GGT GTG AGC AAT GCT GCC AGA GAT 3765 Ser Phe Pro His Glu Tyr Phe Cys Gly Val Ser Asn Ala Ala Arg Asp 1205 1210 1215 TTC ATC AAT GTG ATC TTA CAG GAA GAT TTT CGG AGG CGG CCC ACA GCA 3813 Phe Ile Asn Val Ile Leu Gln Glu Asp Phe Arg Arg Arg Pro Thr Ala 1220 1225 1230 GCC ACA TGC TTG CAG CAT CCA TGG CTG CAG CCC CAT AAT GGC AGC TAC 3861 Ala Thr Cys Leu Gln His Pro Trp Leu Gln Pro His Asn Gly Ser Tyr 1235 1240 1245 TCT AAG ATC CCC CTG GAC ACC TCC CGC CTA GCA TGC TTC ATA GAA CGT 3909 Ser Lys Ile Pro Leu Asp Thr Ser Arg Leu Ala Cys Phe Ile Glu Arg 1250 1255 1260 CGC AAG CAC CAG AAT GAT GTG CGG CCT ATT CCC AAT GTC AAG AGC TAC 3957 Arg Lys His Gln Asn Asp Val Arg Pro Il e Pro Asn Val Lys Ser Tyr 1265 1270 1275 1280 ATT ATT GTC AAC CGG GTG AAC CAA GGG ACG TAGCCATCTC CCAGCCCCTA 4004 Ile Val Asn Arg Val Asn Gln Gly Thr 1285 1289 TGGTTTCATTCAGAGATGTGCA GTGTTCTCGATCA AAGCAAGTCTCGATCAGATGTGTCTGTCGATCAGATGTGTCTGTCATGAATTATC GAGCAGCAGT AAAAGTCACC CTAAATCAAG GGGCTTTTCA 4184 GAAGGTCATT CTGAAGAAAT AAAGAGGCAA AGGGTCACAG AAGTGTTCAG AAGAAGGGCA 4244 AAGATAAGAA CAATATTAGC TGTTACGAAA TTTTAACTGT ATCTTCCAAA ATGAGTGGTT 4304 AACTGGGCAA ACCTTAAGCT CACAAGAGTA TAAAAGATCT CTGGCTTTGC TGAAATTTTA 4364 AGCAAGAAGT TCTATTTAAT GGAGATGTCA TGTATATCAA CTATTCTGGT TTAGATAACT 4424 TAGATATAGT TTCTTGATAG GATAGATACC CACATACAGT ATAATATATC CCATTCAGGT 4484 TTCAGAGTTT TTCTAATATA GAGATATATA TATTAAATCA ATCACAAGTA ATTTTGAGTG 4544 CTCCAGTTAA GACAGTAATT TATTTACCGA ATCATTACAT TGTTTTGACT AAGCACAATT 4604 AGATGACAAG TTTTTTTAGA GCATTTTATA GATCTTGTAT AGAAATCTTT TACCAGAACC 4664 TGTGCATTAA GAGAAAGCAA TGTTGCCCTT TTGAATGAGA AAATTTTTTC TGTCAATCG C 4724 AGGTTATTTG ATTAAGATAG GTTCTTTCTG TATATGAAAC GCTCCCCGCA AATTCACTGG 4784 CAGCTCAGAA TTATTCTGGA AAGAAAGCCT GCCAGGAAAT AAATTCAAAT ACAGTATGAG 4844 CTGCGGGGAT ATTTTTGTGT CTACACCAGG TTTGAAATAA GTAAACAAAT ACAAGAGGTT 4904 CATATAAAAG GGCAAATGAA AACCTTTCCT ACAGTTCCTA TGAACAACGT ACCAACACTT 4964 TCTGATTTCT TCTACAGCTG TAGAATACCA TCTTTCAGAA AGTTGGCTGG CTTTATTTCT 5024 AACTCCTTAT TGAAGCTAAG GGGTGCTTAC TAAAAGGAGG CAGCCATATA GGCCTTTTAA 5084 AGGCCTGGTT CTAAGTCCTT TTTAAAGCCA TGGAACAAAA CCTGATACAT CACCCTAACA 5144 GAGCATTAAG TTGTAACTGA GATTGCAATA CCTGTCACCA TGCAGCCGCT GATAGTTCTC 5204 TGAACTAAAA GGACTAATTG TACTTTGAGG CCAATGCTGC TTTCTGGTGT ATATTCTCCA 5264 TACAAGATTA TTATTAACTG CTCTTTTTCC CTCTGGAAAATGAAAATGAATGAAAAAAGGAAAAAAGG

SEQ ID NO: 3 Sequence length: 5355 Sequence type: number of nucleic acid strands: single strand Topology: linear Sequence type: cDNA to mRNA antisense: YES Origin Organism name: human Tissue type: skeletal muscle sequence: TTTTTTTTTT TTTTTTTTTT TTCCCATGAA ATGCCCAGGT TTAATTTTTT TTCCACCAGA 60 GGGAAAAAGA GCAGTTAATA ATAATCTTGT ATGGAGAATA TACACCAGAA AGCAGCATTG 120 GCCTCAAAGT ACAATTAGTC CTTTTAGTTC AGAGAACTAT CAGCGGCTGC ATGGTGACAG 180 GTATTGCAAT CTCAGTTACA ACTTAATGCT CTGTTAGGGT GATGTATCAG GTTTTGTTCC 240 ATGGCTTTAA AAAGGACTTA GAACCAGGCC TTTAAAAGGC CTATATGGCT GCCTCCTTTT 300 AGTAAGCACC CCTTAGCTTC AATAAGGAGT TAGAAATAAA GCCAGCCAAC TTTCTGAAAG 360 ATGGTATTCT ACAGCTGTAG AAGAAATCAG AAAGTGTTGG TACGTTGTTC ATAGGAACTG 420 TAGGAAAGGT TTTCATTTGC CCTTTTATAT GAACCTCTTG TATTTGTTTA CTTATTTCAA 480 ACCTGGTGTA GACACAAAAA TATCCCCGCA GCTCATACTG TATTTGAATT TATTTCCTGG 540 CAGGCTTTCT TTCCAGAATA ATTCTGAGCT GCCAGTGAAT TTGCGGGGAG CGTTTCATAT 600 ACAGAAAGAA CCTATCTTAA TCAAATAACC TGCGATTGAC AGAAA AAATT TTCTCATTCA 660 AAAGGGCAAC ATTGCTTTCT CTTAATGCAC AGGTTCTGGT AAAAGATTTC TATACAAGAT 720 CTATAAAATG CTCTAAAAAA ACTTGTCATC TAATTGTGCT TAGTCAAAAC AATGTAATGA 780 TTCGGTAAAT AAATTACTGT CTTAACTGGA GCACTCAAAA TTACTTGTGA TTGATTTAAT 840 ATATATATCT CTATATTAGA AAAACTCTGA AACCTGAATG GGATATATTA TACTGTATGT 900 GGGTATCTAT CCTATCAAGA AACTATATCT AAGTTATCTA AACCAGAATA GTTGATATAC 960 ATGACATCTC CATTAAATAG AACTTCTTGC TTAAAATTTC AGCAAAGCCA GAGATCTTTT 1020 ATACTCTTGT GAGCTTAAGG TTTGCCCAGT TAACCACTCA TTTTGGAAGA TACAGTTAAA 1080 ATTTCGTAAC AGCTAATATT GTTCTTATCT TTGCCCTTCT TCTGAACACT TCTGTGACCC 1140 TTTGCCTCTT TATTTCTTCA GAATGACCTT CTGAAAAGCC CCTTGATTTA GGGTGACTTT 1200 TACTGCTGCT CAGACCCTGA ATAACCACTG ACGAGGTTTA AGAGGTACAT CTCTCAATTC 1260 AGAGAACTGC ACGGAGTGAA ATGATGAACA GAATTATTTA CAGTCACATT CAGTCTTGCT 1320 TTGGTTCACA CTGCACGTCT ATGTGAAACC ATAGGGGCTG GGAGATGGCT ACGTCCCTTG 1380 GTTCACCCGG TTGACAATGT AGCTCTTGAC ATTGGGAATA GGCCGCACAT CATTCTGGTG 1440 CTTGCGACGT TCTATGAAGC ATGCTAGGCG GGAGGTGTCC AGGGGGATCT TAGAGT AGCT 1500 GCCATTATGG GGCTGCAGCC ATGGATGCTG CAAGCATGTG GCTGCTGTGG GCCGCCTCCG 1560 AAAATCTTCC TGTAAGATCA CATTGATGAA ATCTCTGGCA GCATTGCTCA CACCACAGAA 1620 GTATTCATGG GGGAAGCTGA AATCCACCCT GCATACGTTG ATACATGTCT CCTCTTTGCT 1680 CTCATCCAAG AAGGGGGAGA CCCCACTCAG CATGACATAT GTCAGAACCC CGATGCTCCA 1740 GATGTCTGTC CCCAGGGAGA CGGGGATGCC TTGAATGACT TCTGGGGCAG CAAACTCAGG 1800 GTTCCCCAGC AGGTGGTGAA TGTGGAAGTG ACCCGAGATC TGGACAGCAT CCTCCAAGTC 1860 AATGAGCTTC ACTCGAGGCA CTGGAATCCG TAGGTCAATG AGCAGGTTTT CAGGCTTTAT 1920 GTCCAAATGT GCAACCCTGC AGTTGTGAAG GTACTGCAGA GCCTCCATGA TGTCTCGGAT 1980 ATAGAAAGCT ACTTTTTCCT CCATCAGTTC ATCATGATTC ATAAGGTAGT CTAAGAGCCG 2040 GCCATCATCC ATCAGTTCCA AGATCAGGAT GTAGGATGTG GGGGACTCAT AGGTGTCATG 2100 GAGAGTGATG TACTGGGGGT GCTGTAGGTG CTGAAGCAGG GCAGCCTCGT GGGCAGCCTG 2160 TTCTTTCTTC TTCATTTTTT TGCTAACAAA TTTCACAGCC ACATCTTTGC GGGTAGCTTT 2220 GTGAATGCAT TTCTTTACTA TAGAGAAACG GCCTCTTCCA ATTTCATTCA GCTCAGTGTA 2280 AGCTGAGTCA AAATTTTCCT TCCAAGAAAT GGTGGCACCA TCAGCAGCAG CATCATATTC 2 340 TGGAAGTCGC ACAAACTCCG AGGGCTCACT GGGAAGGCTG ATTCCCCAGG GGTTACTGGC 2400 ACTGACTCTG AACTGATAAG GACACCCGGG ACTAAGGTCT TCGATGACGA GGTAAGTGTC 2460 CAAGGTCGAA GCCACTGACT GCTGCCAGAT CTGAGAACCT TCCTCTCTGT ACTCCACAGT 2520 GTAACCAGAA ATAGTGCAGT TTCCTGTGCT GGAGGGGGGC AGCCAGCGGA GAATCACGGA 2580 GGTGCAGCTT CTCTCCTGGG CAATGGGGCG GTTAGGGGCT GCTGGAACAC CTTGCACTTT 2640 GACTGTTGCA GACGTTGATG TGGTCCCGTG GTCATTTGTT GCTATGCAGG TATAAATCCC 2700 ACTGTCTTGG GGCATCAGAT TACAGATCTT CAGGGTGATT TCTCCAGAAT CACAAGAGGA 2760 GACCGTGTAT GTGGCTGAGC TGTTATCAGT GTCAAGGATG TTCTGGTCTG GACCCTTCCA 2820 AGTGATGGTG GGCTTTGGCC GCCCACAGAC TTTGCACTGC AGTATCACTG TGTCCCCAAG 2880 CAAGCAGGTC ACATCCACCA AGGGCACAAG GAATTCTGGG GCCACTTCTT GGATGAAATT 2940 TGGATTTAAG ATCCCCATGC TAGTATTAGG GTCAAGATCA TCACACTCTG ATTCCTCGGA 3000 ACTGTTCGTC TCTTTAACAG AGACTTTGTT GCCCAGAATA TCCTTGGGTT TACGAGGCCC 3060 TGTGGCTTCA TTTTTACCCG TGTTCTCCAC TTCCGCCCGC TTTCTCATGC GTAGAGTATG 3120 CCATGAACAT GACTTCTTGA TGCTCCCGTC ACTACTTTCT GCTGCTGTGG CTTTGGTGAG 3180 GG GCGCCAGG ATGCTGCCTG GGACCCAGCC CTCGGCGGCG GGGGAATGGT CGCTGGCAGG 3240 CTGGTACACC AGACACATGT TCTGCTGGTT GACGGCGAGG ACCTGGACCA CCTCACCTTG 3300 GCTCACACAG ATTTCATTCT CCTTCAGTGC ATAGTAATCT TTGATCACGG CCATGGACGA 3360 GGTCCCATTG CAGCCTCCCA GGTCGTTCTG CTTGCTGGCT TCGAACTTGT CCCCAGGCTG 3420 GTGGTATTCA AACCCTGGAC TGCCATTGGA GGTAGATATC TTCAGGGGAG GCAGAGGTGG 3480 GTTATAGCTG GAGCCCTTTG GGGGCTTCTC TGAGCCCGCA GGAACAGAGG AGTAGGGCCT 3540 GGGGCTGGCT TGGGGAAGCC TGGCAGGTTG AGACCTCATC ACAGCTGTGC TCCTTTCTTT 3600 CCGTTGATAC TCAATGGGCG ATTGCAGTGC ATTCAAAAAG TCTCGCTGTG TTTCTAAGAC 3660 TTGATTGATG TCCTGCACCC AGGCCTGCTG GATGTCAGCG TTGGCGGCTT GCAGAACAAC 3720 CCTCTCAGAA GTCTCTCTGT TCATGAGTGC AAACTTGCAG GGATCATTGT CCACATTCTC 3780 CTCCAGGACC AAGTAATTCA TCTTGATGCT CCTTTTGAAC ATGTAGCCAG GGGTGAGGGA 3840 TCCCTTCCTG AGCAGTTCAC TGAAGATGAC AATCTGCTCG AAGAGGAACA CGCGCCTCTC 3900 TTTGGTCCGG GACTGCATGC CTGCATCCAG CTCGATCACA TAGAATGTGT CCTGCTGCAG 3960 CAGCTTCCCC TGAGCAGTCA GAGTGCCCTC AAAGCCCTGC AGACGTCCTA GATTCATCAT 4020 GTCATTGC AG CGTTTGGGAA CAAGGCACAT TAACTCCACT GCTTTCTCGA TATCTGAACA 4080 CTCCAAACCA GCCTTCTCAC TGTATCTCAG GAAGTCCTTG AGGAGCAACT GGTATTTTGT 4140 TATTCTCTGA ATGGGCTTGA TGAGGAAGTC ACTCAGTGTC AGCCTCTGAT TTATCTCCTG 4200 TTTTACCTCC TCAAAGTAGG CGTCATACTC AGCAACGATG TACTCTGAGC GCGGCTTATT 4260 CTGACAATAC CACACGTAGA TGTGCAGCTT CCGCTCGTGC TTAATAAAGA GCTGTGCCAA 4320 TCTGTCTTGC TCCTGGATAC ACTTTTCCAG TTCCGCCAGG AAAAAATCCT TATGCCAGTC 4380 ATAAATCTGA TGAATATTTC CAAACACGAT TTTGTCCTTT CCTCGCATAT CCTCAGGGAC 4440 ACCCTTTTCT TCTATTCTCT TCATGAAGCC CTCCACCACA ATGCCCAGAT CCTTGACATA 4500 GTCTTTCTCT GTCTGTACCA GCTCATTCAG GACAAACATC CTGCCTCTCA GGGCCTTGGC 4560 TTTCTGTTCT TCTTCTGGAT TTTTAGGAGG TGTGGGTGGG GCCATCCCCT CATTCAGGCA 4620 GCCTGCAGGG TCTTTCAAGC TCCCCCGGTA TGAGCTTCCT TCTAGACTCA GCTTGTTTTT 4680 GACCAACTTT TCTATTGCAT TGACAAGGTC TGCAGCAGTA GGTACTTCAG TGGAAGCCTG 4740 CCGGGCTGCT AGCAAAGAGG AGGACATTTC ATCCTGTGTA GGGTCGTTGT CAAAAATCTT 4800 CATAGGTGGT GGGAGGGGTG TGTGTGACTC TTCATCCGGC TCATCTTCAC CCCAACCTTT 4860 CTTGCTCTTC TCA TCAGCGC TGTCTCCCTG AGGGGTTGTT TCATCCCCAG GCTTGGGAGA 4920 TCCCAGGTCA AAGCTCTTCC GACCATCGCG AACTTTCTTC TGCTTTTTGA TGTTTCCATC 4980 TGCCTTCCCG CTGTTGAGCC GACGCACAGG ACTCGTCAGC CACTTCTTAA GAGTGTTGGT 5040 GGAGCGCTTG GGACCCGGGG AACTGTGGAT GGAGTTCAGG GAGGGCTGGG CCTGCAGGTT 5100 GGCTACGGAC TCGGACTTGC CTCCATTCTC GCTTGAGGAA TGAGAGTATG CATCTCTACA 5160 CGGGAAGCAA CAGCAGCACT TAGCAAAGAG CCACCCCAAA GAGGGACCTC GGGTGTAAGC 5220 CCTGTCGCCG CCCTTCATGT TGCCCCGCCG CCCCAGCGCT CCCGCATGGC ACGGGGCGCC 5280 AGCCCGGGGT GAGAGCGCGG CGGGAAGGAA ACTTCAGCGC CGCCGCCCGA GAGCCGGCTC 5340 CCGCCCTCC CCGCTG 5355

SEQ ID NO: 4 Sequence length: 18 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid, synthetic DNA Sequence: ACATCCTACA TCCTGATC 18 SEQ ID NO: 5 Sequence Length: 18 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid, synthetic DNA Sequence: TCTGGGGCAG CAAACTCA 18 SEQ ID NO: 6 Sequence length: 61 Sequence type : Number of nucleic acids: single strand Topology: linear Sequence type: other nucleic acids, synthetic DNA sequence: GGAGTCGACC ACCATGGACT ACAAGGACGA CGATGACAAG AAGGGCAACG ACAGGGCTT 60 A 61 SEQ ID NO: 7 Sequence length: 18 Sequence type: Nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acids, synthetic DNA Sequence: CCTCATTCAG GCAGCCTG 18 SEQ ID NO: 8 Sequence length: 59 Sequence type: nucleic acid Number of strands: single strand topology : Linear sequence type: Other nucleic acids, synthetic D (A) sequence: CCCGCAAAGA TGTGGCTGTG GCATTGTTAG CAAAAAAATG AAGAAGAAAG AACAGGCTG 59

[Brief description of the drawings]

FIG. 1 shows tissue distribution by Northern blotting of Trad.

FIG. 2 shows the results of measuring the autophosphorylation activity of Trad and the results of measuring the molecular weight of wild-type and activity-deficient Trad. The upper row shows wild-type Trad (FLAG-Trad) and activity-defective Trad (FLAG-Trad K101
6A) and the control (Vector) phosphorylating ability to self (150 kDa). The lower row shows the expressed wild-type Trad (FLAG-Trad) and activity-deficient Trad (FLAG-Trad K1016A) and control (Vector).
FLAG sequence of αFLAG Blot (western) to detect the protein,
The result of specifying the molecular weight is shown.

FIG. 3 shows a comparison table of amino acid sequences of the phosphorylase regions of Trad, Trio, DAPK, ZIPK, CaMKII, and MLCK. The black box (reverse)
The positions where amino acids match in at least three molecules are shown.

FIG. 4 shows an amino acid sequence comparison table of the Dbl homology (DH) region of Trad, Trio, kalirin, and Dbl. Black boxes (inverted) indicate locations where at least two molecules have identical amino acids.

FIG. 5 shows intracellular localization of Trad and intracellular skeletal protein using COS7 cells. The detection of Trad (FLAG-Trad) is performed by αFLAG staining of the FLAG sequence, and the detection of intracellular skeletal protein is performed by Rhod with Phalloidin, which has affinity for intracellular skeletal protein.
detected by amin, indicating that both subcellular localizations are equal.

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] April 20, 1998

[Procedure amendment 1]

[Document name to be amended] Drawing

[Correction target item name] Fig. 1

[Correction method] Change

[Correction contents]

FIG.

[Procedure amendment 2]

[Document name to be amended] Drawing

[Correction target item name] Figure 2

[Correction method] Change

[Correction contents]

FIG. 2

[Procedure amendment 3]

[Document name to be amended] Drawing

[Correction target item name] Figure 3

[Correction method] Change

[Correction contents]

FIG. 3

[Procedure amendment 4]

[Document name to be amended] Drawing

[Correction target item name] Fig. 4

[Correction method] Change

[Correction contents]

FIG. 4

[Procedure amendment 5]

[Document name to be amended] Drawing

[Correction target item name] Fig. 5

[Correction method] Change

[Correction contents]

FIG. 5

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI G01N 33/15 G01N 33/15 Z // A61K 38/00 AAR A61K 37/02 AAR (C12N 15/09 ZNA C12R 1:91) (C12N 1/21 C12R 1:19)

Claims (13)

[Claims] 1. A protein Trad containing an amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing.
Or its salt. 2. A partial peptide of the protein Trad according to claim 1, or a salt thereof. 3. A nucleic acid comprising a nucleic acid having a base sequence encoding the protein Trad described in SEQ ID NO: 2 in the sequence listing. 4. A nucleic acid comprising a nucleotide sequence represented by SEQ ID NO: 2 or a nucleic acid which hybridizes with the nucleic acid under stringent conditions and encodes a polypeptide having autophosphorylation activity. 5. A 12-mer or more nucleic acid having at least a part of the base sequence represented by SEQ ID NO: 2 in the sequence listing, and a derivative thereof. 6. The nucleic acid according to claim 5, wherein the nucleic acid having at least a part of the nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2 is a nucleic acid at positions 3076 to 3840, and derivatives thereof. 7. The nucleic acid according to claim 5, wherein the nucleic acid having at least a part of the nucleotide sequence in the nucleotide sequence represented by SEQ ID NO: 2 is a nucleic acid from the 823rd to the 1335th, and the derivative thereof. 8. The nucleic acid according to claim 5, wherein the nucleic acid having at least a part of the nucleotide sequence of the nucleotide sequence represented by SEQ ID NO: 2 is a nucleic acid at positions 1417 to 1728, and a derivative thereof. 9. A 12-mer or more nucleic acid having at least a part of the base sequence represented by SEQ ID NO: 3 in the sequence listing, and a derivative thereof. 10. A vector containing the nucleic acid according to claim 5. 11. The vector according to claim 10 is retained.
Trad expression transformant. 12. A method for screening a compound or a salt thereof using the phosphorylation activity of Trad protein for self as an indicator of inhibition or activation. 13. An antibody against the protein Trad according to claim 1 or a salt thereof or the partial peptide according to claim 2 or a salt thereof.