JPH11248710A - Immunoreactive region of glycoprotein gpii of varicella herpes zoster virus (vzv) - Google Patents

Abstract

PROBLEM TO BE SOLVED: To establish a method for diagnosing infection with varicella herpes zoster viruses. SOLUTION: An immunoreactive peptide is homologous with a region of a glycoprotein including amino acid locations 450-655. The peptide preferably corresponds to amino acid locations 505-647, 517-597, 535-584, or 545-582. These immunoreactive peptides can be used for a method for diagnosing infection with varicella herpes zoster viruses.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to an immunoreactive peptide which is homologous to the region encompassing amino acid positions 450 to 655 of varicella-zoster virus glycoprotein II. In this context, preferred peptides are those wherein the region is amino acids 505-647, 517-597, 535-535.
These immunoreactive peptides, provided by peptides corresponding to 584 or 545 to 582, can be used in methods for the diagnosis of varicella-zoster infection.

[0002]

BACKGROUND OF THE INVENTION According to the International Commission on Virus Classification (ITCV), VZV belongs to the family Herpesviridae. In 75% of cases, primary infection occurs by age 15 years of life and usually follows a subclinical course. In contrast, infections in adults who have not previously been in contact with the virus, and in those who have been naturally or therapeutically immunosuppressed, can be severe. Fetal infection also results in severe symptoms, as the virus is capable of crossing the placenta and does not provide maternal antibody protection at this point. After primary infection, the virus is maintained in sensory ganglia throughout life. When reactivated, VZV spreads to peripheral nerves in sensory ganglia, causing shingles.

[0003] 70 open reading frames (O
RF) is a recently known glycoprotein gpI (ORF6
8), gpII (ORF31), gpIII (ORF37),
A fully determined VZ of 124,884 bp in length, including the open reading frames of gpIV (ORF67), gpV (ORF14), and gpVI (ORF60).
V genome nucleotide sequence (Dumas strain;
J. Davison & JE Scott, J. Gen. Virol. 67: 1759-18
16, 1986). In each case, the amino acid sequence deduced from the nucleotide sequence is the herpes simplex virus (HS)
V) shows more or less pronounced homology with the glycoproteins of gE, gB, gH, gI, gC and gL. However, there is no basis to support that functional homology can be derived from sequence homology.
Molecular biology techniques have been used to confirm the open reading frames of glycoproteins gpI, gpII, gpIII and gpV. Unlike the more fully studied HSV glycoprotein gB, VZV
Few data are available for a protein of homology to gpII. The corresponding study is gpII
Importance of gpII on the biosynthesis and virus neutralization processes of PM (PM Keller et al., Virologie 152: 181-191, 1986;
Masser et al., J. Gen. Virol. 74: 491-494, 1993).

[0004] Ellis et al. (EP0210931B1) have identified an ORF31 assigned to gpII. In addition, Ellis et al. Reported gp from VZV infected MRC5 cells (human fibroblasts).
The purification of II and its use for the preparation of virus neutralizing antibodies from guinea pigs is described. PM Keller
Virologie 152: 181-191, 1986 and M. Masser et al.
J. Gen. Virol. 74: 491-494, 1993 describes VZ of human serum.
To determine the titer of V-specific antibodies, gpII was used, especially purified by affinity chromatography from VZV infected cells. After deleting the carboxy terminal region, A. Bollen (EP0405867A1; US 371772)
For the purpose of preparing a V vaccine, gpII lacking its membrane anchor is expressed by constitutive expression in CHO cells using a baculovirus expression system in SF9 cells. Further, EH Wasmuth & WJ Miller (J. Med. Virol. 32:
189-193, 1990) use glycoproteins (including gpII) affinity purified from VZV-infected cells for glycoprotein or dot ELISA to determine the sensitivity of these test methods and the determined antibody titers against VZV infection. Demonstrated facts correlated with protection. However, none of the above reports provide any information on how to prepare an appropriate amount of glycoprotein gpII to set up a test on a diagnostically suitable scale. Furthermore, gp
No studies of the detailed structure of the immunoreactive epitope of II or especially of the gpII protein have been disclosed at all.

[0005] Methods for examining the status of immunity specific to VZV include radioimmunoassay (RI).
A), enzyme-linked immunosorbent assay (ELISA), fluorescent antibody membrane antigen assay (FAMA) and immunofluorescence test (IF
There is a very wide range of serological methods from T) to complement fixation (CF). These methods mainly detect VZV-specific antibodies. Viral material isolated after in-depth culture on cultured human fibroblasts and purified for diagnostic use by special methods is often used as the antigen.

However, VZ from infected fibroblasts
Isolation of the V antigen is associated with a risk of infection in persons engaged in this task. Furthermore, this preparation is very expensive and time-consuming, especially since the virus is not released from the infected cells and thus requires special purification methods. If the antigen is used for immunochemical testing without prior purification, the VZV-infected cells are disrupted by sonication, and the antigen is used directly after dilution, for example, for coating microtitration plates. In this method, in addition to virus-specific antigens, cell-specific antigens, which are associated with certain diseases, for example, autoimmune diseases, are present, mainly because cell-specific antigens bind to the wells of the microtitration plate. In these cases, these cell-specific antigens can produce false positive results, resulting in misdiagnosis. Other Test Methods Based on Purified Viral Glycoproteins, eg, Glycoprotein EL
ISAs require purifications that result in significantly more precise and costly losses, and it is therefore almost impossible to establish relatively large-scale immunochemical diagnostic tests. Glycoprotein ELISAs also often show cross-reactivity with HSV-specific antibodies and consequent false-positive results due to the significant homology that exists between the α-herpesvirus glycoproteins.

[0007]

One possible solution to the above-mentioned problems involves the use of recombinant proteins which can be prepared in large amounts in heterologous systems, for example in E. coli. With this system, there is no possibility that a person will be infected with VZV. In addition, this system offers the possibility of differential diagnostics directed to specific viral proteins. In particular, the reactive region of the VZV protein can be limited to such an extent that cross-reactivity with antibodies specific for other herpesviruses can be practically or completely eliminated. Proteins meeting these conditions may be host-specific proteins, such as E. coli maltose binding protein (MBP), or an N-terminal localization sequence composed of six histidine residues that contribute to the stability of the expressed product as a fusion partner ( His tag) can be expressed as a hybrid protein. These hybrid proteins can then be used in a single-step affinity purification process, in near pure and thus contaminant-free form, directly for coating diagnostically usable surfaces, for example ELISA microtitration plates. Can be. Proteins meeting the above criteria have not been described previously for the VZV system.

[0008]

SUMMARY OF THE INVENTION Surprisingly, VZV
Amino acid positions 450-65 on glycoprotein gpII
It was possible to determine the location of the diagnostically available epitope present in the region encompassing the 5's. Accordingly, the present invention relates to immunoreactive peptides that are homologous to the region encompassing AA 450-655 of gpII of VZV or that substantially comprise the region encompassing amino acids 450-655 of gpII. In this context, preferred peptides are given by peptides whose regions correspond to amino acids 505 to 647 or amino acids 517 to 597, particularly preferably those corresponding to amino acids 535 to 584, very preferably amino acids 545 to 582. Given. In this context, immunoreactive peptides exhibiting naturally varying amino acid sequences due to variations in the VZV strain are also explicitly included.

The present invention further relates to nucleic acids encoding the above-mentioned immunoreactive peptides according to the invention, ie DNA or RNA. That is, it is a nucleic acid having the sequence shown in Table 1. However, in addition to this, it is intended to include simultaneously nucleic acids encoding peptides that hybridize under stringent conditions to the nucleic acids described above and are recognized by antibodies to VZV but not to antibodies to other herpes viruses. Things.

The invention also relates to an immunoreactive peptide which can be prepared by the expression of one of the nucleic acids having the sequences shown in Table 1 or of the above-mentioned nucleic acids which hybridize under stringent conditions, all of which are recognized by antibodies against VZV. Immunoreactive peptides characterized by the fact that they are not recognized by antibodies to other herpesviruses.

[0011] The invention further relates to an immunochemical method which allows the detection of antibodies to VZV. In this method, one or more of the above immunoreactive peptides are contacted with a sample from a patient, eg, a blood, plasma or serum sample, for which the presence of VZV-specific antibodies is to be examined. Methods well known to those skilled in the art are then used to determine whether the antibodies from the sample bind to the used immunoreactive peptides or participate in other immunological relationships with these peptides, such as competition. You.

The present invention also relates to the use of the above-mentioned nucleic acid of the present invention for detecting VZV by nucleic acid hybridization. The present invention further relates to a test kit for detecting an antibody against VZV, comprising the immunoreactive peptide of the present invention, and a test kit for detecting VZV, comprising the nucleic acid of the present invention.

[0013]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Expression of glycoprotein II (gpII) in fragmented form in bacterial systems has been used to determine the location of diagnostically available immunoreactive regions. It is known that the gpII-specific immune response first appears after VZV infection. gpI and gpII
The appearance of an immune response to I is only seen thereafter. However, information on bacterial expression of gpII or its immune-related epitopes did not previously exist. As described in Ellis et al. (EP021093B1), the entire ORF31 of gpII was converted to genomic VZV DNA (Ell).
en strain) and the inserted DNA fragment
It was cloned into a prokaryotic expression vector pMAL-p2 (NEB) that could be expressed as a BP hybrid protein. However, it was found that the complete ORF31 was not suitable for bacterial expression. For this reason, the expression of ORF31 component regions was examined in the pMAL system. Corresponding expression products were detected for all fragments (fragment size 400 bp to 600 bp). A serum pool consisting of 25 VZV reactive human sera was used to test the reactivity of the expression product.
Only one fragment was found immunoreactive. This is 206 AA homologous to AA450-655 of gpII.
Fragment (sequence 1). To further define the immunoreactive epitope, expression of the components of this fragment in the pMAL system was performed. With the aid of immunoscreening, AA505-647 (pM
AL-427-gpII), AA517-597 (pMA
L-240-gpII) or AA 535-584 (pM
AL-149-gpII) was shown to be immunoreactive. It was possible to classify the region of AA535-584 as the major immunoreactive epitope of gpII.

Sequence 1: Amino acid residues 450 to 655 of gpII (Ellen strain). 206 AA in total; theoretical molecular weight 23.
5 kDa. The highlighted area corresponds to the immunoreactive domain. The underlined AA is the AA that has been substituted compared to the Dumas strain. The amino acid numbers are based on the published gpII sequence (A.
J. Davison & JE Scott, J. Gen. Virol. 67: 1759-18
16, 1986) at the start of the methionine (start codon). Glu Phe Ala Met Leu Gln Phe Thr Tyr Asp His Ile Gln Glu His Val Asn Glu Met Leu Ala Arg Ile Ser Ser Ser Trp Cys Gln Leu Gln Asn Arg Glu Arg Ala Leu Trp Ser Gly Leu Phe Pro Ile Asn Pro Ser Ala Leu Ala Ser Thr Ile Leu Asp Gln Arg Val Lys Ala Arg Ile Leu Gly Asp Val Ile Phe Val Ser Asn Cys Pro Glu Leu Gly Ser Asp Thr Arg Ile Ile Leu Gln Asn Ser Met Arg Val Ser Gly Ser Thr Thr Arg Cys Tyr Ser Arg Pro Leu Ile Ser Ile Val Ser Leu Asn Gly Ser Gly Thr Val Glu Gly Gln Leu Gly Thr Asp Asn Glu Leu Ile Met Ser Arg Asp Leu Leu Glu Pro Cys Val Ala Asn His Lys Arg Tyr Phe Leu Phe Gly His His Tyr Val Tyr Tyr Glu Asp Tyr Arg Tyr Val Arg Glu Ile Ala Val His Asp Val Gly Met Ile Ser Thr Tyr Val Asp Leu Asn Leu Thr Leu Leu Lys Asp Arg Glu Phe Met Pro Leu Gln Val Tyr Thr Arg Asp Glu Leu Arg Asp Thr Gly Leu Leu The nucleotide sequence corresponding to Asp Tyr Ser Glu Ile Gln is shown in Table 1.

[0015]

[Table 1]

[0016]

[Table 2]

To evaluate this domain in an immunoassay, the gpII sequence encoding a 206 AA long region was subcloned into the vector pQE (Qiagen). This vector construct was named pQE-gpII *. Since this vector has a histidine tag (6 × His) located at the C-terminus as a fusion moiety, the immunoreactivity of the human serum to be tested can be attributed exclusively to the gpII moiety and the immunoassay of VZV-reactive sera. False positive results can be excluded.

In the ELISA evaluation, plasmid p
The purified protein encoded by QE-gpII * has a sensitivity of 71% (n) for IgG diagnosis using a calculated cutoff 305 (mean of negative serum + 3 × standard deviation).
= 49), 100% specificity (n = 5), and 82% sensitivity when using a freely chosen cutoff 160.
A specificity of 80% was given.

In another ELISA evaluation, the sensitivity of the purified protein encoded by the plasmid pQE-gpII * was 23% when the calculated cutoff 102 (mean of negative serum + 3 × standard deviation) was used for IgM diagnosis.
(N = 13), 100% specificity (n = 41), and with a freely selected cutoff 70, the sensitivity was 61.
5% and a specificity of 80% were given. Sensitivity and specificity can always be optimized using methods well known to the skilled person. Hereinafter, the present invention will be exemplified by examples,
They should not be considered as limiting the invention in any way.

[0020]

EXAMPLES Example 1 Isolation of Virus VZV Particles and DNA Extraction Ultrasound was used to release virus particles from VZV-infected fibroblasts. The virus was run on a linear sucrose gradient (20
(-70% w / v) from cell components. DN
After incubation withase I, the viral DNA was converted to proteinase K and sodium dodecyl sulfate (SD
The virus particles were released by treating with S). After extraction with phenol / chloroform, the viral DNA was precipitated with ethanol.

Example 2 Cloning of ORF31 and Immunoreactive Fragments
Subcloning viral DNA (see Example 1) was used as a template for ORF31 amplification. It encodes gpII. The following primers were used as amplification oligonucleotides. gpIIH 5 ′ GGAATTCCTTCTATGTTTGTTACGGCGGTTG 3 ′ gpIIR 5 ′ GCTCTAGAGCATTTACACCCCCGTTACATTCTCG 3 ′ These oligonucleotides have the published sequence (AJ
Davison & JE Scott, J. Gen. Virol. 67: 1759-1816,
1986), but contains a restriction cleavage site sequence at their 5 'end that is complementary to the corresponding segment but does not hybridize to the template DNA. After amplification, size 2
The 630 bp amplicon was cleaved at the ends with restriction enzymes EcoRI and XbaI and ligated into the expression vector pMAL-p2 previously linearized with EcoRI and XbaI (pMA).
L-p2-ORF31). All ORF31s were sequenced in an overlapping, bi-directional fashion. It has a base substitution of cytosine by thymidine at nucleotide position 1550, which resulted in a substitution of serine by phenylalanine at the amino acid level.

For subcloning the immunoreactive region, the inserted region was excised from the vector pMAL-p2-ORF31 using the restriction enzymes described above, gel purified and then digested with ApoI. The resulting 610 bp ApoI
The fragment was similarly gel purified and the vector pMAL-
It was subcloned into the EcoRI cleavage site of c2. This vector was named pMAL-gpII *. After confirming immunoreactivity, the coding region was subcloned into the vector pQE. To this end, the 610 bp fragment was digested with the restriction enzymes SmaI and HindIII into the vector p.
Cleavage from MAL-gpII *, the vector pQE32 S
It was subcloned into the maI / HindIII restriction cleavage site.
This vector was named pQE-gpII *.

Example 3: Subcloning of immunoreactive epitopes Vector pMAL-gpII * and oligonucleotides as template DNA: 5 'CGGGATCCCGTGTTAAAGCTCGTATTCTCGGCGACG 3' and 5 'CCCAAGCTTTAATCCTGTATCCCGCAGCTCGTCTCT 3', 5 'CGGGATCCGTTTCTAATTGTCCAGAACTGGGATCAGGATCAGTCGATCAGTCAGTCAGTCAGTCGATCGATCGATCAGTCAGTCAGTCAGTCGATCGATCGATCAGTCAGTCAGTCGATCGATCGATCAGGATCACTA By performing amplification using 'CGGGATCCTCTATGAGGGTATCTGGTAGTACTACGCGTT 3' and 5 'CCCAAGCTTAGCCACGCATGGTTCTAACAGATC 3', a 427 bp fragment, a 240 bp fragment or a 149 bp fragment can be obtained, which are the enzymes BamHI and BamHI, respectively.
After restriction digestion with HindIII, the vector pMAL-c2 previously linearized with BamHI and HindIII
Was subcloned. Each of the resulting constructs
pMAL-427-gpII, pMAL-240-gpI
I and pMAL-149-gpII.

Example 4: a) Preparation of the recombinant protein pQE-gpII * The expression and purification of the recombinant protein pQE-gpII
The analysis was performed using metal affinity chromatography under denaturing conditions according to the manufacturer's instructions (from Clontech, Talon metal affinity resin, PT1320-1).

B) Preparation of solid phase I (system according to the invention)
The manufacturing B type microtitration plates (from Greiner), coated solution (50 mM of 110μl per each well
4 μg / ml recombinant p in sodium carbonate buffer, pH 9.5
QE-gpII) at 4 ° C. for 18 hours.
Then add the wells of the microtitration plate,
In each case 300 μl of washing solution (50 mM Tris / EDT)
A, pH 7.0-7.4 + 0.5% BSA).

C) for detecting VZV IgG antibodies
Enzyme immunoassay To detect anti-VZV IgG by enzyme immunoassay, a POD sample buffer (Behring Diagnostic
s GmbH, OWBE 945) 100 μl diluted 1: 100
Was pipetted in each case into microtitration plates prepared as described in Example 4b and the plates were incubated at 37 ° C. for 1 hour.

The plate was washed with a POD washing solution (Behring Diag).
nostics GmbH, OSEW 965) three times and then 1:50 in microbial conjugation buffer (Behring Diagnostics GmbH, OUWW 935).
Anti-human IgG / POD conjugate (Behring Dia
gnostics GmbH, Ch. 243713) was added by pipette. After one hour (37 ° C.) incubation, three more washing steps were performed. Bound peroxidase activity, which has a direct correlation to the number of bound VZV antibody molecules, was measured by H ₂ O ₂ / tetramethylbenzidine (Behring Diagnostic).
s GmbH, OUVG 945). 30 to room temperature
After standing for 0.5 min, the conversion of the substrate was
iagnostics GmbH, OSFA 965) and the absorbance was measured at 450 nm.

Anti-VZV antibody positive and anti-VZV antibody negative sera were tested in both the Enzygnost anti-VZV / IgG standard system (Behring Diagnostics GmbH, OWLT 155) and the enzyme immunoassay according to the invention. The results of the study (absorbance units) are shown in Table 2. When assessed by ELISA, purified pQE-gpII * protein was 69% sensitive (n = 5) using a calculated cut-off = 331 (mean of negative serum + 3 × standard deviation) for IgG diagnosis.
2), with a specificity of 94% (n = 16) and a freely chosen cut-off = 335, a sensitivity of 69% (n = 16)
52), giving a specificity of 100% (n = 16).

Example 5: Enzyme immunoassay for detecting VZV IgM antibody
Enzyme immunoassay for the detection of Lee anti -VZV IgM was performed as follows. That is, the serum is
D sample buffer (Behring Diagnostics GmbH, OWBE 9
45), diluted 1:50 in RF adsorbent (Behring
Diagnostics GmbH, OUCG 945) at a ratio of 1: 2 at room temperature for 15 minutes. 100 μl of the serum previously diluted as described above was incubated for 1 hour at 37 ° C. in the wells of a microtitration plate prepared as described in Example 4b.

The plate was washed with a POD washing solution (Behring Diag).
Nostics GmbH, OSEW 965)
Microbial conjugation buffer (Behring Diagnostics GmbH, OUWW 93
5) Anti-human IgM / POD conjugate diluted 1:25 in
100 μl (Behring Diagnostics GmbH Ch. 4241313) was added by pipette. After one hour of incubation (+ 37 ° C.), three additional washing steps were performed. Bound peroxidase activity, which directly correlates to the number of bound VZV antibody molecules, was measured by the addition of H ₂ O ₂ / tetramethylbenzidine (BehringDiagnostics GmbH, OUVG 945). After 30 minutes at room temperature, the conversion of the substrate was
The mixture was stopped by adding 5 M sulfuric acid (Behring Diagnostics GmbH, OSFA 965), and the absorbance was measured at 450 nm.

Anti-VZV-positive and anti-VZV-negative sera were obtained from the Enzygnost anti-VZV / IgM standard system (Beh
ring Diagnostics GmbH, OWLW 155) and the enzyme immunoassay of the present invention. The results of the study (absorbance units) are shown in Table 3. When assessed by ELISA, the purified pQE-gpII * protein was 38% sensitive (n = 13), specificity 100 using the calculated cutoff 102 (mean of negative serum + 3 x standard deviation) for IgM diagnosis.
% (N = 41) and a freely selected cut-off 96
Is used, sensitivity is 38% (n = 13), specificity is 100%
(N = 41).

[0032]

[Table 3]

[0033]

[Table 4]

[0034]

[Table 5]

[0035]

[Table 6]

[0036]

[Sequence List] SEQ ID NO: 1 Sequence length: 206 Sequence type: Amino acid Number of chains: Topology: Linear Sequence type: Protein Hypothetical: Yes Origin: Organism name: Varicella zoster virus Strain name: Location in the Ellen genome Location on the chromosome: ORF31 Sequence: Glu Phe Ala Met Leu Gln Phe Thr Tyr Asp His Ile Gln Glu His Val 1 5 10 15 Asn Glu Met Leu Ala Arg Ile Ser Ser Ser Trp Cys Gln Leu Gln Asn 20 25 30 Arg Glu Arg Ala Leu Trp Ser Gly Leu Phe Pro Ile Asn Pro Ser Ala 35 40 45 Leu Ala Ser Thr Ile Leu Asp Gln Arg Val Lys Ala Arg Ile Leu Gly 50 55 60 Asp Val Ile Ser Val Ser Asn Cys Pro Glu Leu Gly Ser Asp Thr Arg 65 70 75 80 Ile Ile Leu Gln Asn Ser Met Arg Val Ser Gly Ser Thr Thr Arg Cys 85 90 95 Tyr Ser Arg Pro Leu Ile Ser Ile Val Ser Leu Asn Gly Ser Gly Thr 100 105 110 Val Glu Gly Gln Leu Gly Thr Asp Asn Glu Leu Ile Met Ser Arg Asp 115 120 125 Leu Leu Glu Pro Cys Val Ala Asn His Lys Arg Tyr Ph e Leu Phe Gly 130 135 140 His His Tyr Val Tyr Tyr Glu Asp Tyr Arg Tyr Val Arg Glu Ile Ala 145 150 155 160 Val His Asp Val Gly Met Ile Ser Thr Tyr Val Asp Leu Asn Leu Thr 165 170 175 Leu Leu Lys Asp Arg Glu Phe Met Pro Leu Gln Val Tyr Thr Arg Asp 180 185 190 Glu Leu Arg Asp Thr Gly Leu Leu Asp Tyr Ser Glu Ile Gln 195 200 205 SEQ ID NO: 2 Sequence length: 618 Sequence type: Number of nucleic acid strands : Single strand Topology: Linear Sequence type: DNA (genome) Hypothetical: Yes Origin: Organism name: Varicella-zoster virus Strain name: Ellen Position in genome Chromosome position: ORF31 Sequence: GAATTTGCTA TGCTCCAGTT TACATATGAC CACATTCAAG AGCATGTTAA TGAAATGTTG 60 GCACGTATCT CCTCGTCGTG GTGCCAGCTA CAAAATCGCG AACGCGCCCT TTGGAGCGGA 120 CTATTTCCAA TTAACCCAAG TGCTTTAGCG AGCACCATTT TGGATCAACG TGTTAAAGCT 180 CGTATTCTTCGCGATCATGATGCTATCTCTGCTCGATCTGATCTCGTCGATCTGATCTCGTCGATCTGATCTCGTCGATCTGATTCTGGCGTACT A CGCGTTGTTA TAGCCGTCCT 300 TTAATTTCAA TAGTTAGTTT AAATGGGTCC GGGACGGTGG AGGGCCAGCT TGGAACAGAT 360 AACGAGTTAA TTATGTCCAG AGATCTGTTA GAACCATGCG TGGCTAATCA CAAGCGATAT 420 TTTCTATTTG GGCATCACTA CGTATATTAT GAGGATTATC GTTACGTCCG TGAAATCGCA 480 GTCCATGATG TGGGAATGAT TAGCACTTAC GTAGATTTAA ACTTAACACT TCTTAAAGAT 540 AGAGAGTTTA TGCCGCTGCA AGTATATACA AGAGACGAGC TGCGGGATAC AGGATTACTA 600 GACTACAGTG AAATTCAA 618 SEQ ID NO: 3 Length of sequence : 31 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Hypothetical: No Origin: Organism name: Varicella-zoster virus Strain name: Ellen Within genome Position on chromosome Position on chromosome: ORF31 Sequence: GGAATTCCTT CTATGTTTGT TACGGCGGTT G31 SEQ ID NO: 4 Sequence length: 34 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acids (Synthetic DNA) Hypothetical: No Source: Organism name: Varicella-zoster virus position in genome Position on chromosome: ORF31 Sequence: GCTCTAGAGC ATTTACACCC CCGTTACATT CTCG 34 SEQ ID NO: 5 Sequence length: 36 Sequence type: Nucleic acid Number of strands: Single strand Topology : Linear sequence type: Other nucleic acid (synthetic DNA) Hypothetical: No Origin: Organism name: Varicella-zoster virus Position in genome Chromosome position: ORF31 Sequence: CGGGATCCCG TGTTAAAGCT CGTATTCTCG GCGACG 36 SEQ ID NO: 6 Sequence length: 36 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Hypothetical: No Origin: Organism: Varicella-zoster virus strain Name: Ellen Location in genome Chromosome location: ORF31 Sequence: CCCAAGCTTT AATCCTGTAT CCCGCAGCTC GTCTCT 36 SEQ ID NO: 7 Sequence length: 36 Sequence type: Nuclear Number of chains: single-stranded Topology: linear Sequence type: other nucleic acids (synthetic DNA) Hypothetical: No Origin: Organism name: Varicella-zoster virus Strain name: Ellen Position in genome Position on chromosome : ORF31 Sequence: CGGGATCCGT TTCTAATTGT CCAGAACTGG GATCAG 36 SEQ ID NO: 8 Sequence length: 35 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acids (synthetic DNA) Hypothetical : No Origin: Organism name: Varicella-zoster virus Strain name: Position in Ellen genome Position on chromosome: ORF31 Sequence: CCCAAGCTTA TACGTAGTGA TGCCCAAATA GAAAA 35 SEQ ID NO: 9 Sequence length: 39 Sequence type: Nucleic acid Number: single-stranded Topology: linear Sequence type: other nucleic acids (synthetic DNA) Hypothetical: No Origin: Organism name: Varicella-zoster virus Strain name: E len Position in genome Chromosome position: ORF31 Sequence: CGGGATCCTC TATGAGGGTA TCTGGTAGTA CTACGCGTT 39 SEQ ID NO: 10 Sequence length: 33 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acids (synthetic DNA) Hypothetical: No Origin: Organism: Varicella-zoster virus Strain: Ellen Position in genome Chromosome position: ORF31 Sequence: CCCAAGCTTA GCCACGCATG GTTCTAACAG ATC 33

Continuation of the front page (51) Int.Cl. ⁶ identification code FI G01N 33/53 C12N 15/00 ZNAA // (C12N 15/09 ZNA C12R 1:92) (72) Inventor Klaus Ratsak 35037 Malburg, Germany . Woer Fischstraße 14 (72) Inventor Hans-Peter Hauser 35041 Ernhausen, Germany. Huoi Dornweg 6 (72) Inventor Bernhard Giesendorf, Germany 35041 Michelbach. Evgestar 24

Claims (14)

[Claims] 1. An immunoreactive peptide which is homologous to the region encompassing AA450-655 of gpII of VZV. 2. AA450 of gpII of substantially VZV.
An immunoreactive peptide consisting of a region encompassing 655. 3. The immunoreactive peptide according to claim 1, wherein the region corresponds to AA505 to 647. 4. The immunoreactive peptide according to claim 3, wherein the region corresponds to AA517-597. 5. The immunoreactive peptide according to claim 4, wherein the region corresponds to AA 535-584. 6. The immunoreactive peptide according to claim 5, wherein the region corresponds to AA 545 to 582. 7. An immunoreactive peptide which can be prepared by expressing the nucleic acid according to claim 9 or 10. 8. A nucleic acid encoding the amino acid sequence according to claim 1. 9. A nucleic acid corresponding to the nucleotide sequence shown in Table 1. 10. A nucleic acid encoding a peptide that hybridizes under stringent conditions with the nucleic acid according to claim 8 or 9 and is recognized by an antibody against VZV but not recognized by an antibody against another herpes virus. . 11. An immunochemical method using the immunoreactive peptide according to any one of claims 1 to 7 for detecting an antibody against VZV in a sample. 12. Use of the nucleic acid according to any one of claims 8 to 10 for detecting VZV by nucleic acid hybridization. A test kit for detecting an antibody against VZV, comprising the immunoreactive peptide according to any one of claims 1 to 7. A test kit for detecting VZV comprising the nucleic acid according to any one of claims 8 to 10.