JPH11221078A - Gene encoding l-glutamic acid/l-pyroglutamic acid mutually converting enzyme - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new gene encoding a polypeptide containing a specific (modified) amino acid sequence and exhibiting an L-glutamic acid/L- pyroglutamic acid mutually converting enzyme activity, and capable of producing the above enzyme by a gene engineering method. SOLUTION: This gene encoding L-glutamic acid/L-pyroglutamic acid mutually converting enzyme, is a new DNA encoding a polypeptide containing an amino acid sequence from 32th amino acid, Glu, to 433th amino acid, Pro, in an amino acid sequence expressed by the formula or an amino acid sequence modified by a loss, addition and/or a substitution of one or a plural number of amino acids in the above amino acid sequence, exhibiting an L-glutamic acid/L-pyroglutamic acid mutually converting enzyme activity, and capable of producing the above polypeptide having the above enzyme activity efficiently by a gene engineering method. The DNA is obtained by separating a chromosomal DNA of Alcaligenes faecalis, treating with a restricting enzyme, incorporating the obtained fragments into a vector, introducing the vector into E. coli, culturing, and selecting colonies capable of producing glutamic acid from pyroglutamic acid.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a gene system encoding a polypeptide having L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity and a method for producing the polypeptide using the same.

[0002]

2. Description of the Related Art L-glutamic acid / L-pyroglutamic acid interconverting enzyme is a reaction for producing L-glutamic acid from L-pyroglutamic acid and water newly discovered from a microorganism belonging to the genus Alcaligenes (in the present specification, L-pyroglutamic acid). It is an enzyme that catalyzes a ring-opening reaction) and its reverse reaction (herein referred to as an L-glutamic acid ring-closing reaction).

[0003] The present enzyme is used to convert L-pyroglutamic acid from L-pyroglutamic acid.
-Glutamic acid formation (for example, L-
Improvement of food taste by converting pyroglutamic acid to L-glutamic acid), L-glutamic acid from L-glutamic acid
Generation of pyroglutamic acid, D, utilizing these reactions
It is useful in the isolation of D- and L-glutamic acid from L-glutamic acid, the determination of pyroglutamic acid in a sample, and the like. However, the amount of polypeptide produced by this strain is very small, and a method for mass culture required for industrial production has not been established.

[0004]

SUMMARY OF THE INVENTION Accordingly, the present invention
It is intended to provide a method for efficiently producing a polypeptide having an activity of -glutamic acid / L-pyroglutamic acid interconverting enzyme by genetic engineering, and a gene encoding the full length of a desired polypeptide as a premise thereof. .

[0005]

In order to solve the above-mentioned problems, the present invention provides an amino acid sequence represented by SEQ ID NO: 1 from amino acid Glu at position 32 to amino acid P at position 433.
ro or an amino acid sequence modified by deletion, addition and / or substitution of one or more amino acids in said amino acid sequence,
Provided is a DNA encoding a polypeptide exhibiting L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity. As a specific embodiment, the present invention relates to an L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity having an amino acid sequence from amino acid Glu at position 32 to amino acid Pro at position 433 in the amino acid sequence shown in SEQ ID NO: 1. A DNA encoding the polypeptide.

[0006] The present invention further relates to an amino acid sequence represented by SEQ ID NO: 1, which has an amino acid sequence from amino acid Met at position 1 to amino acid Pro at position 433, or lacks one or more amino acids in the amino acid sequence. A DNA encoding a polypeptide having an amino acid sequence modified by loss, addition and / or substitution and exhibiting L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity or a precursor thereof is provided. As a specific embodiment described above, the present invention relates to an L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity having an amino acid sequence from Met at position 1 to Pro at position 433 in the amino acid sequence shown in SEQ ID NO: 1. A DNA encoding the polypeptide or a precursor thereof.

The present invention further relates to a DNA which hybridizes with a DNA having the nucleotide sequence of the region encoding the amino acid sequence shown in SEQ ID NO: 1 under stringent conditions, and
Provided is a naturally occurring DNA encoding a polypeptide having glutamic acid, L-pyroglutamic acid interconverting enzyme activity or a precursor thereof.

[0008] The present invention further relates to the amino acid sequence shown in SEQ ID NO: 1, from the first Met to the 31st Pr.
DNA encoding a signal sequence having an amino acid sequence up to o or having an amino acid sequence modified by deletion, addition and / or substitution of another amino acid in one or several amino acid sequences in said amino acid sequence. provide. As a specific embodiment described above, the present invention relates to the amino acid sequence represented by SEQ ID NO: 1, wherein Met at position 1 is
And a DNA encoding a signal sequence having an amino acid sequence from Pro to No. 31 to Pro.

The present invention also relates to a DNA having the nucleotide sequence shown in the region encoding the signal sequence having the amino acid sequence from Met at position 1 to Pro at position 31 in the amino acid sequence shown in SEQ ID NO: 1, and a stringent condition. D that hybridizes underneath and encodes a signal sequence
NA and a signal sequence encoded by the DNA are provided. The present invention also provides a vector encoding the above DNA, particularly an expression vector. The present invention further provides a host cell transformed with the above vector.

[0010] The present invention further provides a method for producing the enzyme-active polypeptide, which comprises culturing a host transformed with an expression vector comprising a DNA encoding the polypeptide. The invention further provides
In the amino acid sequence shown in SEQ ID NO: 1, M at the first position
a signal having an amino acid sequence from et to Pro at position 31 or having an amino acid sequence which is modified by deleting, adding and / or substituting one or several amino acid sequences in the amino acid sequence. Provide an array. As a specific embodiment described above, the present invention provides
In the amino acid sequence shown in SEQ ID NO: 1, M at the first position
and a signal sequence having an amino acid sequence up to Pro at position 31 et.

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION The L-encoding DNA of the present invention
A typical amino acid sequence of a polypeptide having glutamic acid / L-pyroglutamic acid interconverting enzyme activity is amino acid G at position 32 in the amino acid sequence shown in Sequence Listing 1.
It contains the amino acid sequence from lu to amino acid Pro at position 433. Alcalige faecalis containing a base sequence encoding a typical polypeptide of the present invention
nes faecalis) has the nucleotide sequence of SEQ ID NO: 1.
As shown in the figure, this includes the base number 364 position “A”
From the amino acid Met at position 1 to the amino acid Pr at position 433 from the amino acid Met at position 1
It encodes an amino acid sequence consisting of 433 amino acids up to o.

On the other hand, the N-terminal partial amino acid sequence of L-glutamic acid / L-pyroglutamic acid interconverting enzyme purified from the same Alcaligenes faecalis is SEQ ID NO:
It starts with Glu at position 32 in the amino acid sequence of 1.
Therefore, in the amino acid sequence shown in SEQ ID NO: 1, it is apparent that a polypeptide having at least the amino acid sequence from Glu at position 32 to Pro at position 433 has L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity. It is. Accordingly, the present invention, as a typical embodiment, includes the third amino acid sequence represented by SEQ ID NO: 1.
The present invention relates to a DNA comprising an amino acid sequence from Glu at position 2 to Pro at position 433, or containing the amino acid sequence and encoding a polypeptide having L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity.

However, it is well known that an enzyme protein contains a site essential for the enzyme activity and a site capable of maintaining the enzyme activity even after its structure is modified. It is generally known that the original enzymatic activity is maintained even when the amino acid sequence to be changed is partially, artificially or spontaneously changed. Accordingly, the present invention relates to the amino acid sequence shown in SEQ ID NO: 1, for example, in the amino acid sequence including the amino acid sequence from Glu at position 32 to Pro at position 433, deletion and addition of one or more amino acids. And / or having an amino acid sequence modified by substitution with another amino acid, and L-glutamic acid.
DNAs encoding polypeptides that maintain L-pyroglutamic acid interconverting enzyme activity are also included in the present invention.
The above-mentioned modification can be performed by a modification technique known before the present application, for example, site-directed mutagenesis, PCR, or the like, and is within a range that does not cause loss of L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity. .

Furthermore, once a DNA encoding a protein or polypeptide having a specific enzymatic activity is obtained, a DNA that can hybridize with the DNA under stringent conditions also has the same enzymatic activity. It is well known that they encode proteins or polypeptides that have Accordingly, the present invention relates to a polypeptide which can hybridize with a DNA having the nucleotide sequence shown in SEQ ID NO: 1 under stringent conditions and has L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity. Also encompasses the encoding DNA.

[0015] The DNA is preferably of natural origin,
For example, cDNA or genomic DNA. Examples of the origin of such DNA include various microorganisms belonging to prokaryotes or lower eukaryotes, for example, yeasts, fungi, bacteria, etc., and preferably bacteria, for example, cells belonging to the genus Alcaligenes, such as Alcaligenes. It is a bacterium of the species E. faecalis. Stringent conditions generally include hybridization of the target DNA with a probe.
Is a condition used when selecting the condition, for example, a temperature of 6
7 ° C., salt concentration 0.6-1.0 M NaCl, 20 hours.

The modified amino acid sequence or the amino acid sequence encoded by the hybridizing DNA is, for example, 70% or more, preferably 80% or more, and more Preferably, they have a homology of 90% or more.

As described above, in the amino acid sequence represented by SEQ ID NO: 1, the position of Met at position 1 to the position of Pro at position 31
This sequence is expected to be a signal sequence, since these sequences are not essential for the activity of L-glutamic acid / L-pyroglutamic acid interconverting enzyme. Therefore, the present invention relates to SEQ ID NO: 1 from Met at position 1 to position 31 at Met.
A signal sequence having an amino acid sequence up to the Pro position or an amino acid sequence modified by deletion, addition and / or substitution of another amino acid in one to several amino acid sequences in this amino acid sequence is provided. The above modification is
The range is a range that can be modified by a modification method known before the present application, for example, site-directed mutagenesis, a PCR method, and the like, and that does not lose the function as a signal sequence.

The present invention also relates to a DNA encoding the above signal sequence. The present invention can also hybridize with a DNA having a base sequence from the base “A” at position 304 to the base “G” at position 396 of SEQ ID NO: 1 under stringent conditions, and DN encoding a peptide having a function as a signal sequence
A and the signal sequence encoded by the DNA. In this case, the origin of the DNA and the stringent conditions are as described above for the L-glutamic acid / L-pyroglutamic acid converting enzyme.

The DNA of the present invention may be, for example, Alcaligenes faecalis N-38A.
(FERM P-14919).
The L-glutamic acid / L-pyroglutamic acid interconverting enzyme obtained from this microorganism strain has the following properties.

(1) Molecular weight 47,000 (by SDS-polyacrylamide gel electrophoresis) (2) Optimal reaction temperature: L-pyroglutamic acid ring-opening reaction: 45 to 50 ° C. L-glutamic acid ring-closing reaction: 45 ° C. (3) Reaction optimum pH: L-pyroglutamic acid ring-opening reaction: 7.2 to 7.4 L-glutamic acid ring-closing reaction: about 8.0 (4) Stable pH range: L-pyroglutamic acid ring-opening reaction: 6.5 to 10. 5 L-glutamic acid ring-closing reaction: 6.5 to 10.5 (5) Temperature stability: L-pyroglutamic acid ring-opening reaction: up to 55 ° C L-glutamic acid ring-closing reaction: up to 55 ° C.

The DNA derived from the donor microorganism is prepared, for example, by aeration and agitation culturing in liquid culture for about 1 to 3 days, centrifuging the resulting culture, collecting cells, and lysing the cells. Can be. As the lysis method, for example, treatment with a cell wall lysing enzyme such as lysozyme or β-glucanase, or ultrasonic treatment is used. Also,
If necessary, another enzyme agent such as a protease or a surfactant such as sodium lauryl sulfate may be used in combination, or a freeze-thawing treatment may be further performed. In order to separate and purify DNA from the lysate obtained in this manner, it is possible to appropriately purify the DNA according to a conventional method, for example, by appropriately combining methods such as phenol extraction, protein removal treatment, protease treatment, ribonuclease treatment, alcohol precipitation, and centrifugation. It can be carried out.

The DNA can be cleaved by, for example, sonication, restriction enzyme treatment, or the like. Restriction enzymes are appropriately used to facilitate the binding of the obtained DNA fragment to the vector fragment. You. Plasmids and phages are suitable as vectors. As the plasmid, for example, when Escherichia coli is used as a host cell, pUC18, pUC19, pKK223-
3 can be used. Such a vector is cut with a restriction enzyme or the like in the same manner as the DNA described above to obtain a vector fragment.

The method of linking the DNA fragment and the vector fragment may be any method using a known DNA ligase. For example, after annealing the DNA fragment and the vector fragment, the DNA fragment is ligated in vitro with a suitable DNA ligase. Make recombinant DNA. If necessary, after annealing, the DNA can be introduced into a host microorganism and converted into recombinant DNA using in vivo DNA ligase. Any host microorganism may be used as long as the recombinant DNA is stable and capable of expressing its characteristics.

The method for cloning the DNA of the present invention from Alcaligenes faecalis N-38A (FERM P-14919) is specifically described in Example 1. In summary, about 5 putative DNAs containing DNA encoding L-glutamic acid / L-pyroglutamic acid interconverting enzyme are considered.
A kbp DNA fragment B8 was obtained (FIG. 1). Next, this was cleaved with various restriction enzymes, and the fragment was inserted into an expression vector to examine the enzyme expression ability of each DNA fragment. The plasmid pB8-2k containing a DNA fragment of about 2 kbp (FIG. 2)
I got Next, the nucleotide sequence of the DNA insertion site in this plasmid was determined according to a conventional method, and FIGS. 3 to 5 (SEQ ID NO: 1)
Was obtained.

This DNA insertion site contains an open reading frame from base "A" at position 364 to base "T" at position 1602, and this open reading frame is the first of the amino acid sequence in SEQ ID NO: 1.
From the amino acid "Met" at position 433 to the amino acid "P
It encodes the amino acid sequence up to "ro". On the other hand, as shown in Example 2, an enzyme protein was purified from the microorganism strain Alcaligenes faecalis N-38A, and its N-
The terminal amino acid sequence is determined. That is, a microorganism of the genus Alcaligenes having a polypeptide-producing ability is cultured in a nutrient medium to produce a polypeptide. After completion of the culture, the cells are collected by centrifugation, the cells are disrupted by sonication or dynomill, and a cell-free extract is collected. This was purified by ammonium sulfate fractionation and various column chromatography,
High-purity polypeptide.

The sample is digested with a gas phase protein sequencer, identified by high performance liquid chromatography, and the partial amino acid sequence having the N-terminus of the polypeptide is determined. As a result, it was found that the N-terminal amino acid sequence is as shown in the amino acid sequence surrounded by the frame in FIG. 3 (in SEQ ID NO: 1, from amino acid “Glu” at position 32 to amino acid “Phe” at position 46). Therefore, the amino acid sequence at the N-terminal side of this amino acid sequence, that is, the amino acid sequence from the first “Met” to the 31st “P
Up to "ro" is not required for enzyme activity, and is presumed to be a signal peptide.

The DNA of the present invention not only encodes the amino acid sequence shown in SEQ ID NO: 1, but also can be obtained by deleting or adding one or more amino acids and / or substituting with another amino acid in the amino acid sequence. A DNA encoding a polypeptide having a modified amino acid sequence is also included in the present invention. Such a modified DNA can be obtained by a known DNA modification method. For example, site-specific mutagenesis, PCR, and the like can be used. Also,
DNA encoding a C-terminally truncated polypeptide
Can be obtained by introducing a translation stop codon at an appropriate position in the DNA.

The DNA of the present invention which hybridizes with the DNA having the nucleotide sequence shown in SEQ ID NO: 1 is obtained by extracting DNA from the above-mentioned DNA source by a well-known method, and extracting the DNA with an appropriate length by the above-mentioned method. After cutting into pieces,
For example, it can be selected by hybridizing with the inserted DNA in plasmid pB8-2k. The present invention also provides vectors, particularly expression vectors, comprising the various DNAs of the present invention, and host cells transformed with the vectors. The expression control region, for example, the promoter contained in the expression vector varies depending on the host.

The host cells used for producing the L-glutamic acid / L-pyroglutamic acid interconverting enzyme by expressing the DNA of the present invention include prokaryotes such as bacteria such as Escherichia coli and Bacillus bacteria such as Bacillus.
Subtilis and the like can be used. In addition, lower eukaryotes such as yeasts, filamentous fungi and the like can also be used. Examples of yeast include Saccharomyces (Saccharomy
ces) yeast such as Saccharomyces cerevisiae (Sa
ccharomyces cerevisiae), and the filamentous fungi include, for example, Aspergillus genus, for example, Aspergillus oryzae. Furthermore, higher eukaryotic cells include, for example, insect cells, such as silkworm cells, and mammalian cells, such as Chinese hamster ovary cells (CHO).

For bacterial hosts, for example, the LacZ promoter, Trp promoter, etc. are used; for yeast hosts, for example, promoters for glycolytic enzymes are used; for filamentous fungal hosts, for example, the AmyA promoter For animal cell hosts, for example, promoters for viral vectors are used. Once the DNA encoding a particular polypeptide has been cloned, expressing it in various hosts is a routine technique.

Transformation of a host with an expression vector is a common technique. It has been found that a large amount of polypeptide can be stably produced by culturing the obtained transformed microorganism in a nutrient medium. In nutrient media, for example,
It is preferable to contain a carbon source, a nitrogen source, minerals, and if necessary, organic trace nutrients such as amino acids and vitamins. At this time, as the carbon source, starch, soluble starch, glucose, fructose, sugars such as sucrose,
Organic acids such as acetic acid, citric acid and malic acid, and hydrocarbons are appropriately used. As the nitrogen source, organic and inorganic nitrogen sources such as meat extract, peptone, defatted soybean, corn steep liquor, pyroglutamic acid, glutamic acid and ammonium sulfate, and ammonia are used.

The culturing method is, for example, a method in which a liquid medium is pH 4-1.
0, while maintaining the temperature in the range of 25 to 65 ° C., culturing for about 1 to 4 days under aerobic conditions such as aeration and stirring to produce and accumulate the polypeptide. The polypeptide in the culture can be collected and used as it is, but is generally used after being separated into a polypeptide solution and microbial cells by filtration, centrifugation or the like according to a conventional method. When the polypeptide is present in the cells, the cells are sonicated,
The polypeptide solution is treated with a surfactant, a cell wall lysing enzyme and the like, and then filtered, centrifuged and the like to collect a polypeptide solution. In the case of a transformed microorganism, isopropyl-1
A promoter inducer such as -thio-β-D-galactoside (IPTG) is added to produce the polypeptide.

The polypeptide solution thus obtained is, for example, concentrated under reduced pressure, concentrated by membrane, and further purified by appropriately combining salting out with ammonium sulfate or the like, and fractional precipitation with methanol, ethanol, acetone or the like. Higher purity polypeptides can be collected and advantageously used as industrial polypeptide agents. In addition, the method for measuring pyroglutamic acid ring-opening enzyme activity and the description method described herein are as follows. On a titer plate, 0.1 M Tris-HCl buffer (pH 7.4) containing 0.5% pyroglutamic acid 9
Add 10 μl of the enzyme solution appropriately diluted to 0 μl, and add
After reaction for 30 minutes at 7.5 mM NAD,
1.2mM

INT, 1.5 U diaphorase, 1.
A 0.2 M triethanolamine buffer solution (pH 8.6) containing 0% Triton X-100 and 6 U glutamate dehydrogenase are added, and the mixture is left at room temperature for 15 minutes. After that, 492 nm
L-glutamic acid produced is determined by measuring the absorbance of the product. The unit of enzyme activity is expressed as one unit of the amount of enzyme required to produce 1 μmol of L-glutamic acid per minute under the conditions described above.

[0035]

Next, the present invention will be described more specifically with reference to examples. Embodiment 1 FIG . L-glutamic acid / L-pyroglutamic acid phase
Cloning of DNA encoding tautomeric enzyme 1-1 . Preparation of Chromosomal DNA Containing Alcaligenes faecalis Polypeptide Gene Chromosomal DNA containing the Alcaligenes faecalis polypeptide gene can be prepared by the method of H. Saito a.
nd K. Miura, Biochim. Biophys. Acta., 72 , 619-629.
(1963)).

That is, Alcaligenes faecalis N-38A (FERM P-14919) was prepared by adding 0.3% meat extract, 1.0% polypeptone, and 0.5% NaCl.
And cultured overnight at 30 ° C. in a medium containing The culture was centrifuged to collect the cells, and the obtained cells were suspended in 5 ml of Saline-EDTA solution (containing 0.5 M NaCl and 0.1 M EDTA · 2Na), and then lysozyme (manufactured by Wako Pure Chemical Industries, Ltd.) )
Was added at a rate of 1 mg / ml and kept at 37 ° C. for 30 minutes. This is kept at 60 ° C. for 20 minutes, then at −80 ° C.
After freezing for 20 minutes in Tris-SDS buffer (1.
13 ml containing 0% SDS and 0.1 M NaCl)
10 μl of E-RNase (10 mg / ml) (manufactured by Sigma) was added and reacted at 60 ° C. for 20 minutes.

After repeating this operation three times, the mixture was frozen at -80 ° C for 20 minutes. TE buffer (1.0 mM EDTA
Phenol saturated with 10 mM Tris-HCl buffer solution containing the same), and slowly stirred for 10 minutes.
The supernatant was obtained by centrifugation. After cooling with ice water, two times volume of cold ethanol was added to the supernatant to recover crude chromosomal DNA. 7
After washing twice with 0% ethanol, dissolving in TE buffer
Stored at ° C.

1-2 . Preparation of Recombinant DNA Containing Polypeptide Gene 1-1 . Restriction enzyme Sau3AI (NIPPON
GENE) to partially cut the chromosomal DNA so that the DNA fragment became about 2 to 4 kbp. Obtained DN
A fragment and pUC19 / BamHI / BAP (Fermentas M
BI) The vectors were mixed and heated at 65 ° C. for about 10 minutes.
After cooling on ice, Ligation high (DNA Ligation Ki
An equal amount of t) was added and reacted at 15 ° C. for 30 minutes to prepare a recombinant DNA.

1-3 . Escherichia recombinant DNA
Introduction into Escherichia coli Escherichia coli DH5α (manufactured by Toyobo) was used as a host cell. Competent cells were prepared by the RbCl preparation method (HL Birnboim and J. Doly, Nucleic Acid Reid).
s., 7 , 1513-1523 (1979)). The recombinant DNA obtained in Example 1-2 was added to the obtained competent cells, left on ice for 30 minutes, and heated at 42 ° C for 90 seconds.

Then, after being left for 2 minutes in ice, the medium (2)
% Bacto Tripton, 0.5% Bacto Yeast Extract,
Added including) a _{0.5% MgSO 4 · 7H 2 O} , 3
Incubate at 0 ° C for 30 minutes, and add ampicillin (5mg / 100m
l) and 5-bromo-4-chloro-3-indolyl-β-
Galactoside (5-bromo-4-chloro-3-indolyl
-Β-galactoside or X-Gal, 4mg / 100m
The mixture was spread on a plate agar medium containing l) and cultured at 30 ° C. for 24 hours, and a microorganism having formed a colorless plaque was selected as a transformant. Using the culture solution, a colony producing glutamic acid from pyroglutamic acid was selected, and a transformed microorganism into which a recombinant DNA containing a polypeptide gene had been introduced was selected.

The microorganism is grown and subjected to the rapid alkaline SDS method (M. Hattori and Y. Sakaki, Anal. Bioche
m., 152 , 232-238 (1986)). Various restriction enzymes were allowed to act on this, and the cleavage site was determined. FIG. 1 shows a restriction enzyme map of the DNA portion (B8) of the recombinant DNA derived from Alcaligenes faecalis N-38A strain. As is clear from the figure, the restriction enzyme Sal
I, HincII, SphI, HindIII and PstI
And NruI (manufactured by NIPPON GENE).

1-4 . Preparation of recombinant DNA containing polypeptide gene 1-3 . The plasmid DNA obtained by the above method was further digested with various restriction enzymes, fragments were separated by 0.7% agarose gel electrophoresis, and necessary fragments were extracted from the gel. The obtained DNA fragment is pU
It was ligated to C19 or pUC18 to prepare a recombinant DNA.

As a host microorganism, Escherichia coli DH5α was used. The recombinant DNA was transferred to this microorganism in accordance with the method of 1-3, a transformed microorganism was selected, and pB8 was transformed into HincII and HindIII (NIPPON GENE).
). A transformed microorganism (E. coli DH5α-pB8-2k) was obtained by transforming pB8-2k in which a DNA fragment of about 2 kbp cleaved with pUC18 was reversely ligated to pUC18. This transformed microorganism was DH5α-pB8 of 89.7.
The enzyme activity was doubled. The transformed microorganism was cultured in an L-medium containing 50 μg / ml of ampicillin, and a recombinant DNA (pB8-2k) was prepared from the obtained cells. In addition, various plasmids other than pB8-2k were obtained by the above method. The relative enzyme activities expressed by these plasmids are shown in FIG.

1-5 . Nucleotide sequence of recombinant DNA Dye terminator cycle sequencing (ABI PRISM
^TM Dye Terminator Cycle Sequencing Ready Reaction
Kit (Perkin Elmer) was used. )
According to 1-4 . (PB8-2)
The nucleotide sequence of k) was decoded. The results are shown in FIGS. In addition, the nucleotide sequence of the signal peptide gene upstream of the 5 'side thereof was examined in the same manner. The results are shown in FIG.

Embodiment 2 FIG. Alcaligenes faecalis
N-terminal partial amino acid of polypeptide derived from N-38A strain
Sequence 2-1 . Preparation of polypeptide Alcaligenes faecalis N-38A strain was prepared by adding meat extract 0.3%, polypeptone 1.0%, and NaCl 0.5%.
And a liquid medium containing 0.015% of adecanol and 30%
Culturing was performed with aeration and stirring at 16 ° C. for 16 hours to produce a polypeptide. The cells were collected by centrifugation, and the cells were disrupted with a Dynomill to obtain a cell-free extract. The polypeptide fraction was obtained from the obtained cell-free extract by salting out with ammonium sulfate, and then subjected to hydrophobic chromatography (phenyl toyopearl 6 manufactured by TOSOH).
50M), ion exchange chromatography (TOSOH
And purified by gel filtration (Sephadex G-100 manufactured by Pharmacia) to collect highly purified polypeptide.

2-2 . Partial amino acid sequence containing N-terminus 2-1 . The polypeptide prepared by the method described in the above was used as a gas phase protein sequencer (model PSQ- manufactured by Shimadzu Corporation).
1) and then analyzed by high performance liquid chromatography to determine the partial amino acid sequence containing the N-terminus. As a result, the sequence shown in the frame of FIG. 3 (SEQ ID NO:
2).

Embodiment 3 FIG. Polypep by transformed microorganism
Preparation of tide 3-1 . Transformed microorganism (E. coli DH5α-p
Preparation of polypeptide by B8) Escherichia coli DH5α-pB transformed microorganism into which a recombinant plasmid (pB8) containing a polypeptide gene (B8) derived from Alcaligenes faecalis has been introduced
8 was cultured in L medium at 25 ° C., and the obtained cells were washed with a 0.1 M Tris-HCl buffer, and the cells were sonicated. As a result of measuring the pyroglutamic acid ring-opening enzyme activity of the obtained cell-free extract, 1.53 U / 100 ml
Met.

3-2 . Transformed microorganism (E. coli)
Preparation of Polypeptide Using DH5α-pB8-2k) A plasmid pB8-2 in which a DNA fragment of about 2 kbp obtained by digesting pB8 with HindIII was ligated in the reverse direction to pUC18.
k was transformed into Escherichia coli DH5α (E. coli DH5α-pB8-2k) was cultured at 25 ° C. in an L medium, and the obtained cells were cultured in 0.1 M Tris-
After washing with an HCl buffer, the cells were sonicated. As a result of measuring the pyroglutamic acid ring-opening enzyme activity of the obtained cell-free extract, it was 137.7 U / 100 ml.

3-3 . Transformed microorganism (E. coli)
Preparation of Polypeptide by JM-109-pN38A) Alcaligenes faecalis N-3 shown in Sequence Table 1
The following primers were synthesized based on the initiation codon of the polypeptide gene sequence of strain 8A and the repetitive sequence at the 3 'end, and a restriction enzyme cleavage site was introduced by PCR. The amplified DNA fragment was reacted with EcoRI and HindIII, and ligated to the EcoRI and HindIII sites of pUC18 to prepare pN38A. The resulting plasmid was transformed into E. coli. coli JM-109 (manufactured by Toyobo). The resulting transformed microorganism (E. coli JM-
109-pN38A) at 25 ° C. using 10 ml of L medium.
And IPTG was added to a final concentration of 0.1 mM to induce polypeptide expression. As a result, I
After the addition of PTG, the production of polypeptide increased with time, and after 5 hours, an activity of 12.3 U / 100 ml was observed.

[0050]

Embedded image

3-4 . Transformed microorganism (E. coli)
Preparation of Polypeptide by JM-109-pN38A) pN38A obtained in 3-3 was used for EcoRI and HindII.
The DNA fragment obtained by digestion with I
223-3 was inserted into the EcoRI and HindIII sites. The obtained plasmid (pN38A) was used for E. coli. coli
It was transformed into JM-109. The obtained transformed microorganism is cultured at 25 ° C., and the concentration is adjusted to a final concentration of 0.1 mM.
PTG was added to express the polypeptide. IPTG
Five hours after the addition, the enzyme activity was measured to be 2062.4.
U / 100 ml.

3-5 . Transformed microorganism (E. coli)
Preparation of polypeptide by JM-105-pN38A) 3-4 . Plasmid (pN38A) obtained in coli JM-105 (Pharmacia). The resulting transformed microorganism was cultured at a culture temperature of 25 ° C., and IPTG was added to a final concentration of 0.1 mM to express the polypeptide. Five hours after the addition of IPTG, the enzyme activity was measured. As a result, 2062.4 U / 100
ml of activity was obtained.

3-6 . Transformed microorganism (E. coli)
Preparation of Polypeptide by TG-1-pN38A) The plasmid (pN38A) obtained in 3-4 was isolated from E. coli. co
li TG-1 (Funakoshi). The resulting transformed microorganism was cultured at a culture temperature of 25 ° C., and IPTG was added to a final concentration of 0.1 mM to express the polypeptide. Five hours after the addition of IPTG, the enzyme activity was measured. As a result, an activity of 362.7 U / 100 ml was obtained.

[0054]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1807 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear Sequence type: genomic DNA sequence TTAGGCGGTC ATGCGGGAGC AGGTGCTGTG CACAGGCGAT TTGTACTGCC TGATTATTGA 60 AGTGATTAAT AAATTGGTTT GAATTAAATT CAGAATTTATTTGAGTT TATGGCTATT AATAATAAGA ATATAAAAGT ATGGAAAAAA 180 ATATGAATTA AATTCTTTAA AAGAATATCT GTTATCTTCT GTCATTTATT GACGGCGCTC 240 TGGGTATGGT TGTTACGTTG CCGTTTCAGG TTTCGCACAC TACTTGTAGA GAGGGAla CT ATC AGC GTC AGC ATC GTC AGC AGC GTC AGC AGC GG Gly 5 10 15 CTG GCT TTA TTC GCA GCG GTT CAG AGC AGT GTT ATG GCT CAA AGC CCG 396 Leu Ala Leu Phe Ala Ala Val Gln Ser Ser Val Met Ala Gln Ser Pro 20 25 30 GAG CCC CGG CTG GAT ACC AGC CAG CTG TAT GCA GAC GTG CAT TTC CAC 444 Glu Pro Arg Leu Asp Thr Ser Gln Leu Tyr Ala Asp Val His Phe His 35 40 45 GCT TCC AAT TAC GCC ATG CAA GGT ATT TCT TTA AAG GAA TAT GCA GAG 492 Ala Ser Asn Tyr Ala Met Gln Gly Ile Ser Leu Lys Glu Tyr Ala Glu 50 55 60 CGC TAT ATG AGC GCC AAT CGC CAG CAA ATT GTG CGC TCC ACC ATC ATG 540 Arg Tyr Met Ser Ala Asn Arg Gln Gln Ile Val Arg Ser Thr Ile Met 65 70 75 CCG ATT CCT TTG CAG CAA CGC TGG GAC GGG TTT GAA CAG TAC CAG GCA 588 Pro Ile Pro Leu Gln Gln Arg Trp Asp Gly Phe Glu Gln Tyr Gln Ala 80 85 90 95 CAG TCT GGC GAT CAG ATG TAT GGC CCG AAC TAC TAC ATA GGC CCC AAA 636 Gln Ser Gly Asp Gln Met Tyr Gly Pro Asn Tyr Tyr Ile Gly Pro Lys 100 105 110 GCA GAC TTG TAT TAC TAC TCT TTT GTG GAT GCC ATG TTT GCA CGC GAG 684 Ala Asp Leu Tyr Tyr Tyr Ser Phe Val Asp Ala Met Phe Ala Arg Glu 115 120 125 TAC GAA CGC TTG CCG CCC CAG TAT CAG GAA AAG CTG GAT GTC ATG ATT 732 Tyr Glu Arg Leu Pro Pro Gln Tyr Gln Glu Lys Leu Asp Val Met Ile 130 135 140 ACG GCT TTC AAT CCC ATG GAC GTA TAT GCC TCG CAA CAT ATC AAG CGT 780 Thr Ala Phe Asn Pro Met Asp Val Tyr Ala Ser Gln His Ile Lys Arg 145 150 155 GCG GTG CTC AGT TTT CCA GGC GTG TTT GCC GGG GTG GGA GAG TTC ACC 82 8 Ala Val Leu Ser Phe Pro Gly Val Phe Ala Gly Val Gly Glu Phe Thr 160 165 170 175 ATT CAC AAG GAG CTG GTG TCC AGC AAG CTG GCT GGT GAA ACG GTA GAA 876 Ile His Lys Glu Leu Val Ser Ser Lys Leu Ala Gly Glu Thr Val Glu 180 185 190 CAA ACC AAG GCC CCC TCT GTG CCG CTA CCG CCT GAT GCG GGC GAT GGC 924 Gln Thr Lys Ala Pro Ser Val Pro Leu Pro Pro Asp Ala Gly Asp Gly 195 200 205 AGC AAG GTA TCG CTG TAT TCC GAG TCG CTG GAG TAT TTG TTC AAG ACC 972 Ser Lys Val Ser Leu Tyr Ser Glu Ser Leu Glu Tyr Leu Phe Lys Thr 210 215 220 ATT GAA GAG ATT GGT TTG GTC GCG ATC TTG CAC AAT GAT ATG TAC CGG 1020 Ile Glu Glu Ile Gly Leu Val Ala Ile Leu His Asn Asp Met Tyr Arg 225 230 235 GTA GAG GTC AAT TAC CAG GGT GAG CTG GAG CAT TCC TAT CCC GAT CAG 1068 Val Glu Val Asn Tyr Gln Gly Glu Leu Glu His Ser Tyr Pro Asp Gln 240 245 250 255 GAC TAT GTG GAC GGC TTG AAG CAC GTG TGC GGA CAT GCG CCC AAA GCC 1116 Asp Tyr Val Asp Gly Leu Lys His Val Cys Gly His Ala Pro Lys Ala 260 265 270 AAG GTG GTG TGG GCG CAT ACG GGC CTG GGG CGT TTT GTG AAA CCC ACC 1164 Lys Val Val Trp Ala His Thr Gly Leu Gly Arg Phe Val Lys Pro Thr 275 280 285 AGC GAC CAC ATT ACG CGC GTG AAA GAA GTG CTG GAT GCC TGC CCC AGC 1212 Ser Asp His Ile Thr Arg Val Lys Glu Val Leu Asp Ala Cys Pro Ser 290 295 300 TGG TCT ACC GAT ATT TCC TGG GAT CTG GTG CAG GAC TAT ATG TTG AAT 1260 Trp Ser Thr Asp Ile Ser Trp Asp Leu Val Gln Asp Tyr Met Leu Asn 305 310 315 CCC GAG CCG GGC ATG CCC AGT CGC CAG GAT TGG CTG AAT TTC TTC AAT 1308 Pro Glu Pro Gly Met Pro Ser Arg Gln Asp Trp Leu Asn Phe Phe Asn 320 325 330 335 GAA TAC CAG AAC CGG ATT CTG TGG GGT TCA GAT GTG GTG ATT TTT ACG 1356 Glu Tyr Gln Asn Arg Ile Leu Trp Gly Ser Asp Val Val Ile Phe Thr 340 345 350 CGT AAT CGC TTT GAG TCA GAC CCT CCC ACT TCA GTG ACA CCG GGC GGT 1404 Arg Asn Arg Phe Glu Ser Asp Pro Pro Thr Ser Val Thr Pro Gly Gly 355 360 365 TTG ATG GAA CCG GCT CAG TAC CAT GCG GAC TTG TCC AAG ATG AGG GAG 1452 Leu Met Glu Pro Ala Gln Tyr His Ala Asp Leu Ser Lys Met Arg Glu 370 375 380 380 TTT CTG GAC GAG TTG CCA GTG GCC ATA GGC AAC AAG ATT CGC TAT GAA 1500 Phe Leu Asp Glu Leu Pro Val Ala Ile Gly Asn Lys Ile Arg Tyr Glu 385 390 395 AAC TAT CTG GGT CTG TTC AAT CGT GCC AAG TTC TCT GTG CGG GCC TGG 1548 Asn Tyr Leu Gly Leu Phe Asn Arg Ala Lys Phe Ser Val Arg Ala Trp 400 405 410 415 GAG CGC GAG AAT GCG GAT CTC AAT ATC TGG GAT ATT CCT ACG CCC GTG 1596 Glu Arg Glu Asn Ala Asp Leu Asn Ile Trp Asp Ile Pro Thr Pro Val 420 425 430 CAT CCT TGAAGGAGGC ATGCTGTTGA TATGGGCGAT CAGCCATAGA TACTGGACTT 1652 His Pro 433 GATTCTGGCC CTTTCAAAGC CAATGGCAAA GGCAAAAAAC AGCCCCCCGA CAGTTGGATA 1712 ACTGTCGGGG GGCTGTGTGCTCATAGCTCTGCGTCTCTGCAGCTCTCTGCGGCTGGCT

SEQ ID NO: 2 Sequence length: 31 Sequence type: amino acid Topology: linear Sequence type: peptide sequence Met Thr Cys His Arg Ile Asn Ala Lys Ala Leu Ala Ala Ser Gly Leu 5 10 15 Ala Leu Phe Ala Ala Val Gln Ser Ser Val Met Ala Gln Ser Pro 20 25 30

SEQ ID NO: 3 Sequence length: 26 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: synthetic DNA sequence TTTGAATTCA TGACTTGCCA TCGTAT 26

SEQ ID NO: 4 Sequence length: 26 Sequence type: Number of nucleic acid chains: Single strand Topology: Linear Sequence type: Synthetic DNA sequence TTTAAGCTTG ACAGCAGAAT CAAGAA 26

[Brief description of the drawings]

FIG. 1 shows a DNA fragment p containing a region encoding L-glutamic acid / L-pyroglutamic acid interconverting enzyme.
It is a figure which shows the restriction enzyme map of B8.

FIG. 2 is a diagram showing the ability to express enzyme activity of various DNA fragments obtained by cleaving the DNA fragment shown in FIG. 1 with various restriction enzymes.

FIG. 3 is a diagram showing a base sequence of a DNA encoding L-glutamic acid / L-pyroglutamic acid interconverting enzyme and a corresponding amino acid sequence.

FIG. 4 is a diagram having the same meaning as in FIG. 3;

FIG. 5 is a diagram having the same meaning as in FIG. 3;

FIG. 6 is a diagram having the same meaning as in FIG. 3;

──────────────────────────────────────────────────続 き Continued on front page (51) Int.Cl. ⁶ Identification code FI (C12N 9/10 C12R 1:19)

Claims (16)

[Claims] In the amino acid sequence shown in SEQ ID NO: 1, amino acid Glu at position 32 to amino acid P at position 433
ro or an amino acid sequence modified by deletion, addition and / or substitution of one or more amino acids in said amino acid sequence,
DNA encoding a polypeptide exhibiting L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity. 2. In the amino acid sequence shown in SEQ ID NO: 1, from amino acid Glu at position 32 to amino acid P at position 433.
L-glutamic acid L having an amino acid sequence up to ro
-A DNA encoding a polypeptide having pyroglutamic acid interconverting enzyme activity. 3. The amino acid sequence shown in SEQ ID NO: 1, from amino acid Met at position 1 to amino acid Pr at position 433.
L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity having an amino acid sequence up to o or having an amino acid sequence modified by deletion, addition and / or substitution of one or more amino acids in said amino acid sequence Encoding a polypeptide or a precursor thereof
NA. 4. A polypeptide having an amino acid sequence from Met at position 1 to Pro at position 433 in the amino acid sequence shown in SEQ ID NO: 1 and showing L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity or a precursor thereof. DNA encoding 5. It hybridizes under stringent conditions with DNA having the nucleotide sequence of the region encoding the amino acid sequence shown in SEQ ID NO: 1, and comprises L-glutamic acid;
A naturally occurring DNA encoding a polypeptide having L-pyroglutamic acid interconverting enzyme activity or a precursor thereof. 6. The amino acid sequence shown in SEQ ID NO: 1, which has an amino acid sequence from Met at position 1 to Pro at position 31 or 1 in the amino acid sequence.
DNA encoding a signal sequence having an amino acid sequence modified by deletion, addition and / or substitution of another amino acid by several amino acids. 7. A DNA encoding a signal sequence having an amino acid sequence from Met at position 1 to Pro at position 31 in the amino acid sequence shown in SEQ ID NO: 1. 8. A DNA having the nucleotide sequence shown in the region encoding the signal sequence having the amino acid sequence from Met at position 1 to Pro at position 31 in the amino acid sequence shown in SEQ ID NO: 1, and hybridized under stringent conditions. DNA that soybeans and encodes a signal sequence. 9. D according to any one of claims 1 to 5,
A vector comprising NA. 10. A host cell transformed by the vector according to claim 9. A vector comprising the DNA according to any one of claims 6 to 8. A host cell transformed by the vector according to claim 11. 13. A method for producing a polypeptide exhibiting L-glutamic acid / L-pyroglutamic acid interconverting enzyme activity, comprising culturing the host cell according to claim 10. 14. An amino acid sequence represented by SEQ ID NO: 1 having an amino acid sequence from Met at position 1 to Pro at position 31 or deletion of one to several amino acid sequences in the amino acid sequence. A signal sequence having an amino acid sequence that has been modified by addition and / or substitution by another amino acid. 15. A signal sequence having an amino acid sequence from Met at position 1 to Pro at position 31 in the amino acid sequence shown in SEQ ID NO: 1. 16. A signal peptide encoded by the DNA according to claim 8.