JPH11127872A - New intranuclear receptor protein, gene and its use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide the subject new intranuclear receptor protein having a specific amino acid sequence, capable of being bound to lipophilic hormone to express various physiological activities, and useful as a material leading to the development of medicines and the diagnoses and treatments of diseases, and the like. SOLUTION: This new intranuclear receptor protein contains an amino acid sequence of formula I, II or III or the substantially same amino acid sequence, can be bound to lipophilic hormones passing through cell membranes to express various physiological activities, and is useful as a material leading to the developments of medicines and the diagnoses and treatments of diseases. The intranuclear receptor protein is obtained by screening a human adult liver cDNA library with the zinc finger of a balloonfish intranuclear receptor cDNA as a probe, inserting a gene encoding a human intranuclear receptor obtained from a positive clone into a vector, transducing the obtained recombined vector into a host cell and subsequently culturing the transformant.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a human-derived nuclear receptor protein (hereinafter sometimes simply referred to as a nuclear receptor), a gene encoding the nuclear receptor protein,
Vectors and transformants containing the gene, methods for screening substances acting on the nuclear receptor protein {agonists and antagonists (antagonists)}, probes and primers derived from the gene encoding the nuclear receptor protein The present invention relates to an antisense gene for the nuclear receptor and an antibody against the nuclear receptor protein.

[0002]

2. Description of the Related Art In vivo, substances that express various physiological activities are produced, and one of these physiologically active substances is a hormone. Hormones can be classified into water-soluble hormones and steroid hormones represented by peptide hormones, thyroid hormones, and fat-soluble hormones represented by vitamin A and vitamin D. These hormones are produced in certain cells in the body, secreted into the blood and migrate to target cells. In the target cells, the hormones bind to specific receptors to exert physiological effects. The water-soluble hormone binds to a receptor (membrane receptor) present on the cell membrane surface, and the fat-soluble hormone passes through the cell membrane and binds to an intracellular receptor generally present in the nucleus.

[0003] Nuclear receptors are characterized by a DNA-binding domain composed of two zinc fingers and a binding domain (ligand-binding domain) at the C-terminus thereof with a lipid-soluble hormone rich in alpha helix. (Cell, Vol 83, 835-839 (1995)). In addition, a region located on the N-terminal side from the 5 ′ end of the DNA binding region is called a hypervariable region and is considered to have a ligand-independent transcription promoting function (Science,
vol. 240, 889-895 (1988); B
iol. Chem. , Vol 272, 539-550
(1997)). Many nuclear receptors are activated when a ligand such as a fat-soluble hormone binds to a ligand binding region. Nuclear receptors that are activated by the binding of a ligand include those whose DNA binding region binds to the target DNA and those that bind to the target DNA, regardless of the presence or absence of the ligand. Some bind to DNA. In each case, the binding of the ligand activates the nuclear receptor and controls the transcription of the target DNA. The form in which the nuclear receptor binds to the target gene varies depending on the type of the nuclear receptor, and may be a case where it binds by forming a homodimer, a case where it binds by forming a heterodimer, or a case where it binds with a monomer. So far, it has been revealed that nearly 50 types of nuclear receptors exist in vertebrates, but nuclear receptors using steroids as ligands are considered to form homodimers (Cell, vol. 83, 835-839,199
5). On the other hand, human vitamin D receptor and hMB67 form a heterodimer with the retinoid X receptor.
In many of these nuclear receptors, ligands and target genes have not yet been identified.
PS2 isolated from estrone-dependent breast cancer cells
Genes and the stremesin 3 gene are considered to be target genes for estrone.

[0004] In recent years, identification of other genes (proteins) whose expression is regulated by nuclear receptors not only elucidates the function of each cell or organ, but also causes disease at the level of gene transcription regulation. Therefore, research on the search for a novel nuclear receptor and its functional analysis has been spotlighted.

On the other hand, there is an increasing movement to develop therapeutic agents for various diseases by controlling the function of nuclear receptors by receptor antagonists or agonists. For example, attention has been focused on developing agonists or antagonists of nuclear receptors as new drugs by high-throughput screening using a reporter gene assay or the like.

[0006]

SUMMARY OF THE INVENTION An object of the present invention is to provide a novel human-derived nuclear receptor useful for the development of pharmaceuticals and a gene encoding the nuclear receptor protein. Another object of the present invention is to provide a method for screening a substance (agonist, antagonist) acting on a novel human-derived nuclear receptor, a vector containing the nuclear gene used for screening, and a transformant. It is another object of the present invention to provide a gene, an antisense gene, or an antibody useful for cloning, diagnosis, and treatment of a human nuclear receptor.

[0007]

In recent years, a method of cloning a novel receptor has been carried out by utilizing the fact that various nuclear receptors show similarity in amino acid sequence to a part of their structures. However, nuclear receptors often have very low expression, and it has generally been difficult to isolate DNA encoding a novel nuclear receptor from a human cDNA library.

The present inventors have conducted intensive studies to isolate a novel nuclear receptor gene. As a result, a novel nuclear receptor was first cloned from the puffer fish genome, and then DNE was constructed based on the base sequence constituting the zinc finger region, which is a characteristic structure of the pufferfish nuclear receptor.
A probe was synthesized, and using the probe, c
By screening a DNA library,
Multiple novel cDNAs encoding human nuclear receptors
(HAN023 and hAN016 (fetal type, adult type)) were successfully isolated.

From the analysis of the nucleotide sequence and the amino acid sequence, the isolated cDNA was found to have a zinc finger structure (Cell, Vol 83, 835-8) which is a structure characteristic of a known nuclear receptor.
39 (1995), Trends in Biochemical Sciences, Vol 16,
291-296 (1991)) and has homology with known nuclear receptors, and was therefore presumed to be a nuclear receptor.

[0010] For example, the isolated nuclear receptor designated as hAN023 has a zinc finger structure in the region from position 80 to position 146 of the amino acid sequence shown in SEQ ID NO: 3, so that this region is a DNA binding region. Estimated. This putative DNA binding region had 67.2% amino acid sequence homology with the DNA binding region of the human vitamin D receptor. In addition, hAN023 was strongly expressed in the liver and small intestine, and had steroid binding properties. From these, the nuclear receptor hAN
023 is a nuclear receptor that uses steroids as one of its ligands, and may be involved in the control of liver function;
Its expression in the liver and small intestine suggests that it may be involved in the control of lipid metabolism, mainly cholesterol metabolism. hAN016 (embryonic type) and hAN016
It was confirmed that both of the (adult type) DNA binding regions had 93.9% amino acid sequence homology with the DNA binding region of rat α-fetoprotein transcription factor. Rat α-
Fetoprotein has been implicated in liver development and canceration. Therefore, it is suggested that hAN016 may be involved in, for example, canceration of cells and / or control of liver function.

Therefore, the gene, protein or partial region thereof encoding the nuclear receptor of the present invention can be used for clarifying pathological symptoms or preventing and treating diseases in which the function of the nuclear receptor is directly or indirectly involved. It is extremely useful for drug development for

That is, the present invention provides, for the first time, the following nucleic acids, genes, proteins, recombinant vectors, transformants, antibodies, screening methods, probes, primers, antisense genes and the like. 1) to (27).

(1) A nuclear receptor protein comprising the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 5, or substantially the same amino acid sequence. (2) A nuclear receptor protein having the amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5, or having substantially the same amino acid sequence. (3) A nucleotide sequence encoding the nuclear receptor protein according to (1) or (2). (4) A nucleotide sequence wherein the nucleotide sequence of (3) is SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. (5) A nucleotide sequence in which the nucleotide sequence of (3) is represented by SEQ ID NO: 14 or SEQ ID NO: 15. (6) A polypeptide comprising a partial region of the nuclear receptor protein represented by the above (1) or (2). (7) The partial region of (6) is a ligand binding region,
A polypeptide which is a region selected from an NA binding region and a hypervariable region. (8) A nucleotide sequence encoding the polypeptide of (6). (9) The base sequence of (8) is a ligand binding region, D
A nucleotide sequence encoding a region selected from the NA binding region and the hypervariable region. (10) A partial sequence of the base sequence represented by SEQ ID NO: 14 or SEQ ID NO: 15. (11) A base sequence in which the partial base sequence of (10) is antisense. (12) A method for screening a substance that acts on a nuclear receptor protein, comprising contacting a test sample with the nuclear receptor protein according to (1) or (2) or the polypeptide according to (6), A method for screening a substance that acts on a nuclear receptor protein, comprising measuring a change in the nuclear receptor protein or the polypeptide. (13) A method for screening a substance that acts on a nuclear receptor protein, comprising contacting a test sample with cells expressing the nuclear receptor protein according to (1) or (2) or the polypeptide according to (6). Measuring the expression state of the nuclear receptor protein or another protein whose expression is regulated by the polypeptide, and determining the presence or absence of an action on the nuclear receptor of the test sample based on the level of expression. A screening method for a substance acting on a receptor protein. (14) A method for screening an antagonist to a substance (ligand) acting on a nuclear receptor protein, comprising: (a) the nuclear receptor protein according to (1) or (2) or the polypeptide according to (6) Contacting a ligand with a cell that expresses E. coli, and measuring the expression state of another protein whose expression is regulated by the nuclear receptor protein; and (b) the nuclear receptor protein or the nuclear receptor protein according to (1) or (2) above. Contacting a ligand and a test sample together with cells expressing the polypeptide according to (6), and measuring the expression state of another protein whose expression is regulated by said protein or polypeptide; Determining the antagonism of the test sample from the difference from the expression state of the other protein determined in step 2; Learning method. (15) An agent selected by the method according to (12) or (13). (16) An antagonist selected by the method according to (14). (17) An antibody or a part of an antibody reactive with the protein of (1) or (2). (18) A nucleotide sequence encoding the nuclear receptor protein according to (1) or (2), or a nucleotide sequence according to (5) or a nucleotide sequence complementary thereto, at least 15 contiguous nucleotide sequences Probe consisting of. (19) A gene encoding a nuclear receptor that hybridizes with the probe according to (18). (20) A nuclear receptor protein encoded by the gene according to (19). (21) A primer designed from the nucleotide sequence encoding the nuclear receptor protein according to (1) or (2) or the nucleotide sequence according to (5) or a nucleotide sequence complementary thereto. (22) PC using the primer according to (21) above
A gene encoding a nuclear receptor cloned by the R method. (23) A nuclear receptor protein encoded by the gene according to (22). (24) A recombinant vector containing the nucleic acid according to (3) or (5). (25) A transformant containing the nucleic acid according to (3) or (5). (26) A recombinant vector containing the nucleic acid according to (8) or (10). (27) A transformant containing the nucleic acid according to (8) or (10).

Definition of "substantially identical amino acid sequence" In general, when the amino acid sequence of a protein having a physiological activity is slightly changed, for example, one or more amino acids in the amino acid sequence may be deleted, substituted or added. It is a well-known fact that the physiological activity of the protein may be maintained in some cases. Therefore, the term “substantially the same amino acid sequence” as used herein means one or more amino acid sequences in the sequence as long as the biological activity is substantially equivalent to the amino acid sequence shown in SEQ ID NOS: 1 to 5. It is meant that a human nuclear receptor protein in which the amino acid is deleted, substituted or added is also included in the scope of the present invention. Preferably, 1 to 20 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids in the sequence represented by SEQ ID NOS: 1 to 5 are deleted, substituted or added. Human nuclear receptor protein. More preferably, 1 to 20 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids in the sequence represented by SEQ ID NOS: 1 to 5 are deleted, substituted or added. Human nuclear receptor protein that binds to a fat-soluble hormone, and still more preferably (1) one or more, preferably one or less, of the sequences represented by SEQ ID NOS: 1 to 3 A human nuclear receptor protein that binds to a steroid, wherein at least 10 or less, more preferably 1 to 5 amino acids are deleted, substituted or added, (2) represented by SEQ ID NO: 4 or SEQ ID NO: 5 Α-fetoprotein in which 1 to 20 amino acids in the sequence, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids have been deleted, substituted or added. One of the target gene to the human nuclear receptor protein is.

Mutants resulting from amino acid deletion, substitution or addition may include conservatively substituted sequences. This means that certain amino acid residues may be replaced by residues having similar physicochemical characteristics. Non-limiting examples of conservative substitutions include Il
Substitutions between aliphatic chain-containing amino acid residues, such as e, Val, Leu or Ala substitution, or substitution of polar groups such as Lys and Arg are included.

Mutants resulting from deletion, substitution or addition of amino acids can be produced, for example, by site-directed mutagenesis (for example, Nucl.
Research, vol. 10, No. 20, 64
87-6500, 1992). Site-directed mutagenesis can be performed, for example, using a synthetic oligonucleotide primer that contains a partial mutation that is complementary to the single-stranded phage DNA to be subjected to the specific mutation that is the desired mutation. That is, a strand complementary to a phage is synthesized using the synthetic oligonucleotide as a primer, and a host bacterium is transformed with the obtained double-stranded DNA. The transformed host is plated on agar and plaques are formed. Theoretically, 50% of the plaques have the mutation and the remaining 50% have the original sequence.
The resulting plaque is hybridized with the labeled synthetic probe under conditions that hybridize with the DNA having the mutation but do not hybridize with the original strand to obtain a mutant.

As a method for deleting, substituting or adding an amino acid sequence, in addition to the above-described site-directed mutagenesis, a method of treating a gene with a mutagen or a method of cleaving a gene with a restriction enzyme and selecting There is also a method of removing, adding or substituting the gene fragments thus obtained, and then linking them.

In the nucleic acid encoding the nuclear receptor of the present invention, since there are a plurality of codons encoding one amino acid, a gene having any nucleotide sequence can be used if the encoded amino acid sequence is the same. It is included in the scope of the present invention. Therefore, the present invention includes SEQ ID NOs: 1 to 5
Any gene encoding an amino acid sequence represented by
In addition, a nucleotide sequence encoding a human nuclear receptor protein in which one or more amino acids in the sequence are deleted, substituted or added is also included in the scope of the present invention.

Further, the nucleotide sequence falling within the scope of the present invention includes a gene which hybridizes to the human nuclear receptor nucleotide sequence of the present invention under stringent conditions and has a zinc finger structure in the nucleotide sequence. . Stringent conditions are described, for example, in Sambrook et al., Mo.
rectangularCloning: A Laborato
ry Manual, 2nd edition, Vo
l. 1, 101 to 104, (1986). More specifically, 1 × SSC, 0.5%
Cleaning conditions at SDS and a temperature of 65 degrees are included.

Definition of "substantially equivalent biological activity" As used herein, "substantially equivalent biological activity" refers to a biological activity having the function of binding to the same ligand or controlling the transcription activity of the same target gene. means.

Definition of "partial region" As used herein, the "partial region" is a part of the nuclear receptor protein of the present invention or a part of the nucleotide sequence of the nuclear receptor, preferably at least 6 parts. Means a polypeptide comprising two consecutive amino acid sequences or a nucleotide sequence comprising at least 18 consecutive nucleotide sequences. The base sequence may be, for example, an epitope (antigenic determinant) specific to the protein, or a region selected from a DNA binding region, a ligand binding region, a hypervariable region or a non-coding region. DNA
The binding region is a region composed of two zinc fingers, and includes, for example, (1) a region from about position 41 to about position 107 of the amino acid sequence shown in SEQ ID NO: 1; A region from about position 64 to about position 130 (3) a region from about position 80 to about 146 of the amino acid sequence shown in SEQ ID NO: 3 (4) a region from about position 24 to about position 89 in the amino acid sequence shown in SEQ ID NO: 4 ( 5) A region from about position 40 to about position 105 of the amino acid sequence shown in SEQ ID NO: 5, and the ligand binding region is a region rich in an alpha helix located at the C-terminus. For example, (1) SEQ ID NO: 1 (2) a region from about position 263 to about 457 of the amino acid sequence shown in SEQ ID NO: 2 (3) a region from about position 279 of the amino acid sequence shown in SEQ ID NO: 3 About 473 of the regions is a region from about position 106 to about position 495 of the amino acid sequence shown in (4) regions of about 90 of about 479 of the amino acid sequence shown in SEQ ID NO: 4 (5) SEQ ID NO: 5. The hypervariable region is sometimes referred to as an A / B region, and is a region from the 5 ′ side of the DNA binding region to the N-terminus (Science, vol. 2).
40, 889-895 (1988)). The "partial region" of the base sequence includes not only a sense sequence but also an antisense sequence.

As described above, the gene, protein or partial region thereof of the nuclear receptor of the present invention is used to elucidate the relationship with the pathological condition in which the function of the nuclear receptor is directly or indirectly involved, and It is extremely useful for developing pharmaceuticals for preventing and treating these diseases.

The association with the pathological condition directly or indirectly involving the nuclear receptor of the present invention is as follows. First, a ligand is specified, and then a group of genes that are transcriptionally regulated by the ligand and the nuclear receptor of the present invention are identified. It can be clarified by specifying. The ligand can be specified by bringing a test sample into contact with the nuclear receptor of the present invention or its partial domain polypeptide, and detecting a change in the nuclear receptor or its partial domain polypeptide. For example, it can be carried out by using the nuclear receptor protein of the present invention or a fragment thereof in a generally performed binding assay or the like. In addition, there is a method of constructing an expression system for the nuclear receptor protein of the present invention and a target gene to which the nuclear receptor binds, and detecting an increase in a protein which is a target gene product due to the addition of a ligand. For example, by using a reporter gene that expresses a reporter protein such as luciferase, aequorin, CAT, β-galactosidase under the control of the target gene promoter, the presence or absence of the target gene in host cells can be easily determined. Can be detected. Furthermore, instead of the full-length nuclear receptor of the present invention, a chimeric gene of the ligand-binding region of the receptor and the DNA-binding protein is expressed, and as a reporter gene, the minimal activity downstream of the nucleotide sequence to which the DNA-binding protein binds is defined. A plasmid linked with a promoter and a gene encoding the above-described reporter protein can be used. Examples of DNA binding proteins include, for example, GAL
4. Tetracycline repressor, LexA can be used. The expression system for the nuclear receptor protein of the present invention and the target gene to which the nuclear receptor binds, and the plasmid for expressing the chimeric gene between the ligand binding region of the receptor and the DNA-binding protein may be obtained by a conventional method of gene recombination. Can be.

The nuclear receptor protein or its peptide fragment of the present invention can be obtained by a conventional method of gene recombination. The host cell can be appropriately selected from prokaryotic cells, yeast or higher eukaryotic cells. Prokaryotes include gram negative or gram positive bacteria, for example, E. coli or Bacillus subtilis. Preferably, it is an animal cell, more preferably a mammalian cell. In addition, the expression system of the nuclear receptor protein of the present invention and the target gene to which the nuclear receptor binds can be obtained in the same manner.

Suitable cloning and expression vectors for use in bacterial, yeast, and higher eukaryotic hosts are, for example, PoPo
uwels et al., Cloning Vectors: A Laboratory Manual, El
sevier, New York, (1985). Expression vectors used in prokaryotic host cells generally include one or more phenotypic selectable marker genes. A phenotype selectable marker gene is, for example, a gene that confers antibiotic resistance or auxotrophy. Examples of expression vectors suitable for prokaryotic host cells include pBR322 (A
Commercially available plasmids such as TCC37017) or those derived therefrom. pBR322 is
Transformants are easily identified because they contain genes for ampicillin and tetracycline resistance.
An appropriate promoter is inserted into this pBR322 vector. Other commercially available vectors include, for example, pKK
223-3 (Pharmacia Fine in Uppsala, Sweden)
Chemicals) and pGEM1 (Promega Biotec, Madison, Wis., USA). Promoter sequences commonly used in expression vectors for prokaryotic host cells include tac promoter, β-lactamase (penicillinase), lactose promoter (Chang
Et al., Nature 275: 615, 1978; and Goeddel et al., Nature 28.
1: 544, 1979).

The nuclear receptor gene of the present invention may be expressed in yeast host cells. In this case, the genus Saccharomyces (for example, S. cerevisiae) is preferably used, but other yeast genus such as Pichia may be used. Yeast vectors often include sequences of origin of replication from 2μ yeast plasmids, autonomously replicating sequences (ARS), promoter regions, sequences for polyadenylation, sequences for transcription termination, and selectable marker genes.
A method for transforming yeast is described, for example, in the method of Hinnen et al. (Proc. Natl. Acad. Sci. USA 75: 1929, 1978).

[0027] Human nuclear receptor proteins can also be expressed using mammalian or insect host cell culture systems. Cells of mammalian origin include, for example, CV1 cells, NIH3T3
Cell lines, such as cells, HeLa cells, CHO cells, are preferred. Transcription and translation control sequences for mammalian host cell expression vectors can be obtained, for example, from the viral genome. Commonly used promoter and enhancer sequences are derived from CMV virus, polyoma virus, adenovirus 2 and the like. The SV40 viral genome, for example, DNA sequences derived from the SV40 origin, early and late promoters, enhancers, splice sites, and polyadenylation sites may be used. Other genetic elements may also be provided for nuclear gene expression in mammalian host cells. Expression vectors for use in mammalian host cells include, for example, pMAMneo (Clont
ech Laboratories) can be used.

The nuclear receptors of the present invention shown in SEQ ID NOs: 1 to 3 include various steroids (glucocorticoid,
Mineral corticoids, androgens, estrogens,
It is a nuclear receptor that uses progestin, or a synthetic intermediate or metabolite thereof, as one of its ligands.
Nuclear receptors with steroids as ligands are thought to form homodimers, whereas human vitamin D receptors and hMB67 are thought to form heterodimers with retinoid X receptors. However, the nuclear receptors shown in SEQ ID NOs: 1 to 3 have more homology to human vitamin D receptor and hMB67 than nuclear receptors using steroids as ligands.
Therefore, the nuclear receptors shown in SEQ ID NOs: 1 to 3 are considered to be a new type of nuclear receptor different from known steroid receptors forming homodimers, although steroids are used as one of the ligands. That is, the present invention provides a nuclear receptor having a steroid as a ligand, which is of a different type from known steroid receptors. The nuclear receptor of the present invention comprises a variety of known steroids. It may be involved in various actions.

The elucidation of the pathological condition involving the nuclear receptor of the present invention can be achieved by contacting the test sample with the expression level of the target gene when an antagonist or agonist is brought into contact with the cell expressing the nuclear receptor of the present invention. By comparing the expression level of the target gene in a nuclear receptor-expressing cell that has not been activated, the function to be clarified can be identified by specifying the gene to be activated. For example, a gene whose expression is controlled by the nuclear receptor of the present invention is identified by transcribing a labeled DNA from mRNA expressed in a cell and hybridizing the obtained labeled DNA to a DNA library chip. (Bioes
says, 18, 427-431 (1996)). Further, in an experimental animal, a model animal is prepared by disrupting (inactivating) an endogenous nuclear receptor gene derived from an experimental animal having the function of the nuclear receptor gene of the present invention, and the physical characteristics of this model animal are determined. By analyzing biological, pathological and genetic characteristics, it is possible to elucidate the relationship between the function of the nuclear receptor of the present invention and a disease.

Further, by introducing the human-derived gene of the present invention into the above-described model animal in which the endogenous gene has been disrupted, a model animal having only the human-derived gene of the present invention is prepared. By administering a drug (such as a compound) targeting a gene, it is possible to evaluate the therapeutic effect of the drug.

Furthermore, the nuclear receptor gene and its partial region of the present invention can be used as an antisense drug which controls the function of a nuclear receptor at the gene level.
It is also useful for use in gene therapy. Antisense genes can be designed by selecting not only amino acid coding regions but also amino acid non-coding regions. As the sequence of the non-coding region, for example, the sequences represented by SEQ ID NO: 14 and SEQ ID NO: 15 can be used.

The nucleotide sequence encoding the nuclear receptor of the present invention can be used as a probe or primer as a tool for searching for additional nuclear receptors. In order to use a fragment of the human nuclear receptor base sequence of the present invention as a probe, SEQ ID NOS: 6 to 10
The probe may be designed based on any one of the sequences 14 and 15. The length is desirably at least 15 consecutive base sequences. Probes can be labeled by conventional methods, for example, with a radioisotope, digoxigenin, a detectable enzyme, or the like. For example, when using radioactive P, when using a cDNA fragment, it is convenient to label with a random priming label, and when using a synthetic primer, it is convenient to label it at the 5 ′ end with a kinase. The probe thus labeled is hybridized with a cDNA library for cloning. Hybridization is performed by a commonly used method,
It can be performed depending on conditions. For example, 1XSSC,
0.5% SDS, washing at 65 ° C. The cDNA library may be derived from animals including mammals, but is preferably derived from human tissues and cells.

The partial nucleotide sequence of the human nuclear receptor of the present invention can be used as a primer. When designing primers, for example, SEQ ID NOs: 6 to 10,
For example, two of the arrays 14 and 15 may be selected so as to satisfy the following conditions. 1) The length of the primer is 15 to 40 bases, preferably 20 to 30 bases. 2) The ratio of guanine and cytosine in the primer is 4
0% to 60%, preferably 45% to 55%, more preferably 50% to 55%. 3) The distribution of adenine, thymine, guanine and cytosine in the primer sequence is not partially biased. For example, a region in which guanine and cytosine are repeatedly distributed is considered to have low specificity and is not suitable as a primer. 4) The distance on the base sequence of the human nuclear gene corresponding to the selected primer is preferably 100 to 3000 bases, more preferably 100 to 500 bases. 5) No complementary sequence exists between each primer or between the two primers. Once the sequence of the primer is selected, a commercially available DNA synthesizer, for example, Primer D
What is necessary is just to synthesize NA.

Hereinafter, the present invention will be described in detail. The present inventors screened a human liver cDNA library using probes (SEQ ID NO: 11 and SEQ ID NO: 13) designed based on the nucleotide sequence of the gene encoding the pufferfish nuclear receptor. Using SEQ ID NO: 11 as a probe,
A clone presumed to encode a nuclear receptor was obtained. However, since a clone encoding the full length was not obtained, the obtained gene fragment (SEQ ID NO: 12) was used as a probe to further screen a human liver cDNA library, which was presumed to encode the full length nuclear receptor. Two clones were obtained. Next, the obtained clones were subjected to sequence analysis.

SEQ ID NO: 14 shows the nucleotide sequence of one of the obtained clones presumed to encode the full length (designated as hAN023). The nucleotide sequence encoding the amino acid sequence is shown in SEQ ID NO: 8, and the deduced amino acid sequence is shown in SEQ ID NO: 3. As a result of sequence analysis of this gene, hAN023 was found to have a DNA binding region and a ligand binding region.

The nuclear receptor hAN023 has an amino acid sequence of 80 based on its homology to known nuclear receptor sequences.
The position from Cys to Met 146 is the DNA binding region, 2
It was presumed that the region from Leu 79 to Ser 473 was a ligand binding region. In addition, human vitamin D3 receptor (Proc. Natl. Acad. Sci. US
A. , Vol. 85, 3294-3298 (198
8)) had a homology of 67.2% with the amino acid sequence of the DNA binding region.

The nucleotide sequence of another putative full length clone is shown in SEQ ID NO: 15. This gene did not have a common translation initiation codon, ATG, in the region thought to encode the hypervariable region, but instead found a GTG or CTG codon. Several genes have been reported in which the initiation codon is not ATG but CTG or GTG is the translation initiation codon (Cell 52 (2), 185-195 (198)
8), EMBO 10 (3), 655-664 (199)
1). Virol, 66 (3) 1765-1768.
(1992)). Therefore, when the biosynthesis of the protein was examined in vitro, two types of proteins (about 48 kda and about 5 kda) were translated using CTG and GTG as translation initiation codons.
0 kda) was confirmed (the deduced amino acid sequence is shown in SEQ ID NO: 1 and SEQ ID NO: 2). Since these genes have the same DNA binding region and ligand binding region as the nuclear receptor hAN023, they were concluded to be splicing variants of the nuclear receptor hAN023.

When SEQ ID NO: 13 is used as a probe,
hAN016 (adult type, SEQ ID NO: 9), hAN016
Two clones (fetal type, SEQ ID NO: 10) were obtained. The deduced amino acid sequences of these clones are shown in SEQ ID NO: 4.
(HAN016 (adult type)), SEQ ID NO: 5 (hAN01
6 (embryotype)). Sequence analysis of these genes revealed that they had a DNA binding region and a ligand binding region. The nuclear receptor hAN016 (adult type; SEQ ID NO: 4) was estimated to have a DNA binding domain from Cys24 to Met89 and a ligand binding domain from Lys90 to Ala479. hAN016 (embryonic type; SEQ ID NO: 5)
Is the DNA binding domain from Cys40 to Met105, from Lys106
Ala495 was presumed to be the ligand binding domain. Further, hAN016 (adult type) (fetal type) is a known rat α-fetoprotein transcription factor (Molecular type).
and Cellular Biology, Vol16 No7, 3853-3865 (199
It had 93.9% homology with the DNA binding region of 6)) in amino acid sequence. The sequence at the C-terminal side of the DNA binding region of hAN016 (adult type, fetal type) is almost the same as previously reported, but the N-terminal side is different from the previously reported ones. Differences were identified.

The gene of the present invention can be obtained from a human liver-derived cDNA library by using a hybridization method as described in the following Examples. Based on the sequence, it can also be easily obtained by a PCR method using a cDNA library derived from human liver as a template. The nuclear receptor of the present invention has deletion, substitution, or addition of one or more amino acids in the sequence as long as the biological activity is substantially equivalent to that of the protein containing the amino acid sequence shown in SEQ ID NOS: 1 to 5. The isolated human nuclear receptor protein is also included in the scope of the present invention. Here, the biological activity means an activity of binding to the same ligand and controlling the transcription activity of a target gene. Preferably, one or more and 20 or less, preferably 1 or more in the sequence represented by SEQ ID NOS: 1 to 5
Or less, more preferably 1 to 5 amino acids are deleted, substituted or added. More preferably, 1 to 20 amino acids, preferably 1 to 10 amino acids, more preferably 1 to 5 amino acids in the sequence represented by SEQ ID NOS: 1 to 5 are deleted, substituted or added. A human nuclear receptor protein that binds to a fat-soluble hormone, and more preferably (1) one or more and 20 or less in the sequence represented by SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3, Preferably 1 to 10 or less, more preferably 1 to 5 amino acids have been deleted, substituted or added,
A human nuclear receptor protein that binds to steroids,
(2) 1 to 20 or less, preferably 1 to 10 or less in the sequence represented by SEQ ID NO: 4 or 5;
More preferably, 1 to 5 amino acids are deleted,
It is a human nuclear receptor protein having α-fetoprotein as one target gene, which is substituted or added.

Variants by amino acid deletion, substitution or addition may include conservatively substituted sequences. This means that certain amino acid residues may be replaced by residues having similar physicochemical characteristics. Non-limiting examples of conservative substitutions include Il
Substitutions between aliphatic chain-containing amino acid residues, such as e, Val, Leu or Ala substitution, or substitution of polar groups such as Lys and Arg are included.

Mutants obtained by deletion, substitution or addition of amino acids can be obtained by, for example, site-directed mutagenesis (for example, Nucl.
Research, vol. 10, No. 20, 64
87-6500, 1992).

Site-directed mutagenesis involves, for example, single-stranded phage DNA to be subjected to a particular mutation, which is the desired mutation.
Can be carried out using a synthetic oligonucleotide primer which is complementary to and partially contains a mutation. That is, a strand complementary to a phage is synthesized using the synthetic oligonucleotide as a primer, and a host bacterium is transformed with the obtained double-stranded DNA. The transformed host is plated on agar and plaques are formed. Theoretically, 50% of the plaques have the mutation and the remaining 50% have the original sequence. The resulting plaque is hybridized with the labeled synthetic probe under conditions that hybridize with the DNA having the mutation but do not hybridize with the original strand to obtain a mutant.

As a method of deleting, substituting or adding an amino acid sequence, in addition to the above-described site-directed mutagenesis, a method of treating a gene with a mutagen or a method of cleaving a gene with a restriction enzyme and selecting There is also a method of removing, adding or substituting the gene fragments thus obtained, and then linking them.

In the nucleic acid encoding the nuclear receptor of the present invention, since there are a plurality of codons encoding one amino acid, a gene having any nucleotide sequence can be used if the encoded amino acid sequence is the same. It is included in the scope of the present invention. Therefore, the present invention includes SEQ ID NOs: 1 to 5
Any gene encoding an amino acid sequence represented by
In addition, a nucleotide sequence encoding a human nuclear receptor protein in which one or more amino acids in the sequence are deleted, substituted or added is also included in the scope of the present invention. Here, “one or more amino acids are deleted, substituted or added” means the same as defined above.

Further, the nucleotide sequence falling within the scope of the present invention includes:
A gene that hybridizes to the human nuclear receptor nucleotide sequence of the present invention under stringent conditions and contains a zinc finger structure in the nucleotide sequence. Stringent conditions are described, for example, in Sambrook et al., Mole.
culturalCloning: A Laboratory
Manual, 2nd edition, Vol.
1, 101 to 104, (1986). More specifically, 1 × SSC, 0.5% SD
S, cleaning conditions at a temperature of 65 degrees are included.

The human nuclear receptor proteins shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively, have high homology to the known DNA binding region of rat α-fetoprotein transcription factor. Rat α-fetoprotein transcription factor is α
-Isolated as a transcription factor that binds to the control region of fetoprotein,
It is known to bind to AAGGTCA (Molecu
lar and Cellular Biology, Vol16, No7, 3853-3865 (1
996)). It is known that the α-fetoprotein gene is activated from the fetal period to the infant period, becomes inactive in an adult, and is reactivated in canceration (Molecular and Cellular Biology, VoI).
l.16 No7, 3853-3865 (1996), Molecular and Cellular
Biology, Vol.13 No3, 1619-1633 (1993)).

Therefore, the gene encoding the nuclear receptor protein shown in SEQ ID NOs: 9 and 10 can be used, for example, an agonist of hAN016 (adult type) or hAN016.
By screening for an antagonist of 016 (embryotype), it is possible to select a substance for controlling canceration of cells.

Since the nuclear receptor proteins represented by SEQ ID NOS: 1 to 3 are expressed in a small intestine / liver-specific manner, it is considered that the nuclear receptor contributes to the regulation of small intestine / liver function. Therefore, as described above, it is possible, for the first time, to use the nuclear receptor of the present invention to screen for agonists and antagonists contributing to the regulation of the expression of target genes specific to the small intestine and liver, and to improve small intestine and liver function. It is possible to contribute to the development of drugs to be regulated.

The nuclear receptors represented by SEQ ID NOS: 1 to 3 use a steroid compound as one of the ligands. Therefore, it is highly possible to use it for the development of a therapeutic drug for diseases caused by the action of steroids. For example, corticosterone is known to exhibit an action such as glycogen storage and cholesterol production in the liver, and an inhibitory action on Ca absorption in the intestinal tract. In addition, corticosterone is known to have an anti-inflammatory action, a carbohydrate metabolism action, a protein metabolism action, a lipid metabolism action, an electrolyte metabolism action, a urinary Ca excretion promoting action, and the like. Therefore,
By controlling the activity of nuclear receptors corticosterone ligand, diabetes, hyperlipidemia, hypertension,
Therapeutic agents for osteoporosis, muscular atrophy, edema, allergy, etc. can be developed. In addition, the nuclear receptors represented by SEQ ID NOs: 1 to 3 are 5β-androstane-3,17-dione, 5β which is a metabolite of androstenedione.
-Androstane-3α-ol-17-one, which is activated by 5β-androstane-3β-or-17-one, is considered to regulate androgen synthesis and metabolism. Similarly, progesterone analogs, progesterone analogs, 5β-pregnane-3,20-dione, 20α-dihydroxyprogesterone, 6,16α
-Being activated by dimethylpregnenolone and 11β-hydroxyesterone which is an estrone analog, it is considered that the hormone regulates the synthesis and metabolism of these hormones. Lutein hormone is known to have protein, sugar, lipid metabolism, elimination function in liver, immunosuppressive action, antidepressant action, etc. in addition to sex hormone action. For example, the physiological action of 5β-pregnane-3,20-dione is known. As one of them, an inhibitory effect on lymphocyte proliferation has been reported. It is known that estrogen regulates, in addition to the action of sex hormones, promotion of Ca deposition in bone, secretion of luteinizing hormone, production of adrenocortical hormone, and the like.

The nuclear receptors represented by SEQ ID NOS: 1 to 3 are nuclear receptors highly expressed in the liver and small intestine. Important functions in the living body characterized by involvement of both the liver and the small intestine include lipid metabolism centering on cholesterol and triglyceride, and the nuclear receptor is characterized by its expression distribution. Is thought to be involved in Proteins characterized by high expression in the liver and small intestine include apoA-I, apoA-II and various P450-based enzymes. Apo A-I, Apo A
-II is involved in lipid metabolism, mainly cholesterol and triglyceride metabolism, and it is widely known that P450-based enzymes regulate sterol synthesis / metabolism and drug metabolism. It is known that P450 enzymes are induced by steroids. In addition to these facts, as described above, the fact that the nuclear receptor ligands various steroids is related to the regulation of sterol metabolism, homeostasis, drug metabolism, and lipid metabolism centering on sterols. It is believed that this is supported. Therefore, it is thought that by controlling the function of the nuclear receptor, not only a drug for regulating various steroid actions but also a drug for hyperlipidemia and arteriosclerosis related to lipid metabolism can be developed.

In the examples of the present specification, it has been shown that steroids act as ligands for the nuclear receptor of the present invention, but it is possible to find compounds other than steroids by using the ligand screening system of the present invention. . In addition, since the nuclear receptors represented by SEQ ID NOs: 1 to 3 are highly expressed in the liver and small intestine, it is easily involved in physiological actions and diseases involving the liver and small intestine other than those described above. Imagine.

The antibody against the nuclear receptor of the present invention shown in SEQ ID NO: 1 to SEQ ID NO: 5 can be obtained, for example, by using the nuclear receptor protein of the present invention or a peptide fragment thereof obtained by a conventional method of gene recombination. And can be obtained by immunizing a mammal. Alternatively, a monoclonal antibody can be obtained by fusing spleen cells of an immunized mammal with myeloma cells.

[0053]

The present invention will be described below with reference to examples. (1) Screening of human adult liver cDNA library using Fugu AN023 as a probe Human adult liver cDNA library using λgt10 as a vector (Clontech Laboratories, Inc., Palo Alto, CA, US
A) was infected with E. coli C600Hfl strain and cultured at 37 ° C.
The formed plaques were treated with Hybond-N nylon membrane (Amersham Int.
(England plc, Little Chalfont, England), denatured with alkali, neutralized, and fixed by UV irradiation.
The probe used was [α- ³² P] d, a zinc finger 183 base pairs (SEQ ID NO: 11) of AN023 cDNA, one of the pufferfish nuclear receptors.
Randomly labeled with CTP was used. The sign is redip
rime DNA labelling system (Amersham International
plc, Little Chalfont, England). Hybridization was performed using 6x SSC (900mM NaCl, 90mM sodium citrate), 5x Denhardt solution (0.1% Ficoll
400, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.5% SDS, 100 μg / ml heat-denatured salmon sperm DNA at 55 ° C. overnight. Nylon membrane followed
2x SSC (300mM NaCl, 30mM sodium citrate), 0.1
After rinsing with a solution containing% SDS at room temperature, 1x SSC (150 mM N
aCl, 15mM sodium citrate), 55 ℃ with 0.1% SDS
Alternatively, it was washed with a solution at 60 ° C. The signal on the washed nylon membrane was analyzed using Bio-imaging Analysis System 2000 (Fu
ji Photo Film Co. Ltd., Tokyo, Japan). Positive signals obtained in the primary screening were purified to a single clone by performing secondary and tertiary screening.

(2) Screening of Human New Nuclear Receptor cDNA Among clones isolated using the zinc finger of the pufferfish nuclear receptor AN023 cDNA as a probe, clone 2a245
(SEQ ID NO: 12) was found to be a cDNA fragment consisting of 644 bases having complete zinc fingers. Therefore, to obtain a full-length cDNA, 2a
The entire 245 inserts were replaced with [α- ³² P] dCTP and rediprime DNA lab.
The cells were randomly labeled with the elling system and used as a probe to screen for a human adult liver cDNA library. Hybridization is performed with 6x SSC
(900mM NaCl, 90mM sodium citrate), 5x Denhar
dt solution (0.1% Ficoll 400, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.5% SDS, 100μg / m
l Performed overnight in a solution containing heat-denatured salmon sperm DNA at 65 ° C. Wash the nylon membrane with 1x SSC (150mM NaCl, 15mM
(Sodium citrate) and 0.1% SDS at 65 ° C. The signal on the washed nylon membrane is Bio-
imaging Analysis System 2000 (Fuji Photo Film Co.
Ltd., Tokyo, Japan). Positive signals obtained in the primary screening were purified to a single clone by performing secondary and tertiary screening. As a result, two clones, JTY100 (SEQ ID NO: 14) and JTY105, thought to encode the full length
(SEQ ID NO: 15) was obtained.

(3) Sequencing of Phage Clones and Sequence Analysis The inserted sequence of the phage was amplified by PCR. That is, a single plaque of phage was diffused by leaving it in sterile water for 30 minutes, and a part of the plaque was partially dispersed in 20 μl of a PCR reaction solution (10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2,
0.25mM dATP, 0.25mM dCTP, 0.25mM dGTP, 0.25mM dTTP,
0.1μM λgt10 forward primer, 0.1μM λgt10 rever
se primer, 0.025U / μl recombinant TaKaRa Taq (Taka
ra Shuzo, Tokyo, Japan)). PCR conditions were 95 ° C for 2 minutes-> (95 ° C for 30 seconds-> 55 ° C for 30 seconds-> 72 ° C 2
Min) x 35 cycles-> 72 ° C Set to 10 minutes, PCR equipment is Gen
eAmp PCR System 9600 was used. The sequence of the amplified DNA was determined by the primer walking method.
The sequencing reaction was performed as follows. Amplified DNA
Was desalted with Sephadex G-50 (Pharmacia, Uppsala, Sweden), reacted with Dye Terminator Cycle Sequencing Kit FS, and electrophoresed with DNA Sequencer Model 373A. The obtained sequence was stored in a DDBJ database (National Institute of Genetics, Mishim) using the BLAST method.
a, Japan). Gene
Amp PCR System 9600, Dye Terminator Cycle Sequenci
ng Kit FS and DNA Sequencer Model 373A
n Elmer Applied Biosystems Division (Foster City,
CA, USA). Sequence analysis revealed that clone JTY100 was a full-length CD of human novel nuclear receptor hAN023.
The clone was found to encode S (SEQ ID NO: 8, and the corresponding amino acid sequence is shown in SEQ ID NO: 3). As a result of the homology search, it was estimated that Cys80 to Met146 was a DNA binding region, and Leu279 to Ser473 was a ligand binding region. The homology of the amino acid and nucleotide sequences of these two regions was determined by using the human vitamin D3 receptor (hVDR) and Xenopus orphan receptor ONR1 (xONR
Table 1 shows the results of 1) analysis of the human orphan receptor MB67 (hMB67).

[0056]

[Table 1]

(4) Expression of JTY105 As a result of the sequence analysis, JTY105 (SEQ ID NO: 15)
Is a part of JTY100 (base sequence 311 of SEQ ID NO: 14)
To 438) was found to be a clone missing by splicing. In JTY105, there was no ATG sequence serving as a general translation initiation in a region considered to encode a hypervariable region. However, since a gene using CTG or GTG as a translation initiation codon has been reported, the gene is also CTG. And GTG may function as an initiation codon. Therefore, using the cDNA represented by SEQ ID NO: 15 as a template, an in vitro transcription & tranlation kit (Promega
The biosynthesis of protein was examined in a test tube using the system of the company. As a result, two types of proteins (about 48 kda and about 50 kd) translated using CTG and GTG as translation initiation codons.
The presence of a) was confirmed. The sequence of the gene having CTG as the start codon is shown in SEQ ID NO: 6 (the deduced amino acid sequence is shown in SEQ ID NO: 1). The sequence of a gene having GTG as a start codon is shown in SEQ ID NO: 7 (the deduced amino acid sequence is shown in SEQ ID NO: 2). From the above results, JTY105 is JTY105
It was concluded that the hypervariable region had the same DNA binding region and ligand binding region as 100, and a part of the hypervariable region was different from JTY100. That is, hAN023 has two types of cDNAs (mRNAs) considered to be splicing variants, one of which encodes a protein (SEQ ID NO: 3) having a normal ATG translation initiation site, and the other one has a CTG Alternatively, two types of proteins having GTG as a translation initiation site (SEQ ID NO: 1 and SEQ ID NO:
2), and it was confirmed that hAN023 contained a total of three types of proteins.

(5) Identification of Expression Site by Northern Blotting To analyze the expression level of hAN023 in each organ,
Northern blotting was performed using a sequence containing the ligand binding region of No. 023 (base sequence 797 to 1765 of SEQ ID NO: 14) as a probe. Human poly (A) + RNA
Source is Human Multiple Tissue Northern Blot (Clo
ntech Laboratories, Inc., Palo Alto, CA, USA). This blot shows the heart, brain, placenta, lung, liver,
2 μg each of skeletal muscle, kidney, pancreas, adrenal medulla, thyroid, adrenal cortex, testis, thymus, small intestine, stomach poly (A) + RNA,
After size fractionation, it was transferred and immobilized on a nylon membrane. The probe has a sequence containing the ligand binding region of hAN023 (base sequence 797 to 1765 of SEQ ID NO: 14).
Was prepared by random labeling with [α- ³² P] dCTP and rediprime DNA labeling system. Hybridization conditions were determined using ExpressHyb Hybridization Solution (C
lontech Laboratories, Inc., Palo Alto, CA, USA). 0.1x S for washing nylon membrane
SC (15mM NaCl, 1.5mM sodium citrate), 0.1% SD
The test was performed using a 50 ° C. solution containing S. Signals on the washed nylon membrane were visualized using Bio-imaging Analysis System 2000. As a result, it was confirmed that hAN023 was specifically expressed in the small intestine and liver. And
The size of the mRNA was about 3.5 kilobases (FIG. 1). Weak bands of 4.5 and 6.5 kilobases were also detected in the small intestine and liver. (6) Activation of hAN023 by steroid The region containing the ligand binding region of hAN023 (base sequence 797 to 1765 in SEQ ID NO: 14) was converted to pM DNA-BD vector (CLONETECH
Mammalian MATCHMAKER Two-Hybrid Assay Kit, # K16
The hAN023 expression plasmid (pM-hAN023) was constructed by inserting the DNA immediately downstream of the DNA binding region of GAL4 in 02-1). The reporter plasmid (pG5tkLuc3) is a GAL4-responsive element (UAS
x5) and minimal promot of HSV thymidine kinase (TK)
It was constructed to express firefly luciferase under the control of er. That is, pG5CAT vector (CLONETECH, Mammalia
n MATCHMAKER Two-Hybrid Assay Kit, # K1602-1)
HSVtk derived from pTKβ (CLONETECH, # 6179-1) downstream of UASx5
Connect the minimal promoter and insert it into pGL3-Basicvector
(Promega, # E1751). Purification of plasmids from Escherichia coli JM109 transformed with each plasmid was performed using an endotoxin-free plasmid purification kit (QUIAGEN, EndoFree Plasmid Maxi Kit # 123).
63). CV1 cells in 24-well plate (FALCON
# 3047), seed 0.4x10 ^{5 /} 0.4ml per well, 37
The cells were cultured at 5 ° C. under 5% CO ₂ . Cultures included 10% fetal calf serum treated with activated carbon, 50 units / ml penicillin (GIBCO BRL) and 50 units / ml.
D-MEM (L) containing μg / ml streptomycin (GIBCO BRL)
ow Glucose (Niken Institute of Biomedical Research) (hereinafter abbreviated as DCC medium) was used. After culturing for 20 hours, Lipofectamine reagent
(1.6μl / well) (GIBCO BRL, # 18324-012)
Cells were transfected with a receptor plasmid (pM-hAN023; 360 ng / well) and a reporter plasmid (pG5tkLuc3; 40 ng / well). Transfection
Five hours later, the medium used for transfection was replaced with a DCC medium. The next day, add the test compound, 37 ° C, 5% C
Incubated under O ₂ for another 20 hours. After washing the cells twice with PBS (-), a cell lysing agent (Promega, Luciferase Cell Culture Ly
sis Reagent, # E1531) (100 μl / well) was added to lyse the cells. Transfer a portion (10 μl / well) of the cell lysate to a luciferase assay plate (Coaster 3916 OPAQUEPLATE).
And added a luciferase substrate (50 μl / well) (Diatron, Lumikit Dialluciferase) to measure luciferase activity. The measurement of luciferase activity was performed by using a Diamondtron CT-9000D for each sample for 15 seconds. As a result, as shown in Table 2, it was revealed that various natural and synthetic steroids enhance the transcriptional activity of hAN023.

[0059]

[Table 2]

(7) Isolation of hAN016 (fetal type) gene Human fetal liver cDNA library using λgt10 as a vector (Clontech Laboratories, Inc., Palo Alto, CA, US
A) was infected with E. coli C600Hfl strain and cultured at 37 ° C, and the formed plaque was treated with Hybond-N nylon membrane (Amersham Inter
national plc, Little Chalfont, England)
After alkali denaturation and neutralization, they were fixed by UV irradiation. The probe was 183 base pairs (SEQ ID NO: 13) of zinc finger of AN016 cDNA, one of puffer nuclear receptors, [α- ³² P] dCTP
Used at random. Rediprim on the sign
e DNA labelling system (Amersham International pl
c, Little Chalfont, England). Hybridization was performed using 6x SSC (900mM NaCl, 90mM sodium citrate), 5x Denhardt solution (0.1% Ficoll 40
0, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 0.5% SDS, 100 μg / ml heat-denatured salmon sperm DNA
Performed overnight in a solution at 5 ° C. Nylon membrane followed by 2xS
SC (300 mM NaCl, 30 mM sodium citrate), 0.1% SD
After rinsing with a solution containing S at room temperature, 1x SSC (150 mM NaCl,
Washed with a solution containing 55 mM sodium citrate) and 0.1% SDS at 55 ° C. The signal on the washed nylon membrane is Bi
o-imaging Analysis System 2000 (Fuji Photo Film C
o. Ltd., Tokyo, Japan). Positive signals obtained in the primary screening were purified to a single clone by performing secondary and tertiary screening.

(8) Sequence analysis of hAN016 (fetal type) gene Phage DN was obtained from a phage clone isolated using the zinc finger of the pufferfish nuclear receptor AN016 cDNA as a probe.
A was prepared, digested with the restriction enzyme EcoRI, and the inserted sequence was separated and purified by a conventional method. The purified insert sequence was fragmented by sonication, the ends were blunted, and the plasmid vector pGEM 5Zf (+) (Promega Cor
poration, Madison, WI, USA) and transformed Escherichia coli JM109 into a shotgun library with an insert sequence of 500 bp on average. The inserted sequence of each clone of this shotgun library was amplified by PCR. That is, each clone of the shotgun library was
l PCR reaction solution (10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5
mM MgCl2, 0.25 mM dATP, 0.25 mM dCTP, 0.25 mM dGTP,
0.25mM dTTP, 0.1μM M13 forward primer, 0.1μM M13
reverse primer, 0.025U / μl recombinant TaKaRa Taq
(Takara Shuzo, Tokyo, Japan)) at 95 ℃ 2
PCR was performed under the following conditions: min-> (95 ° C 30 seconds-> 55 ° C 30 seconds-> 72 ° C 2 minutes) x 35 cycles-> 72 ° C 10 minutes. Gen PCR
eAmp PCR System 9600 was used. The amplified DNA is available on Sep.
After desalting with hadex G-50 (Pharmacia, Uppsala, Sweden)
The reaction was performed with Dye Terminator Cycle Sequencing Kit FS, and electrophoresed on DNA Sequencer Model 373A. A contic was prepared from the obtained sequence, and the entire base sequence of the inserted sequence was determined for each phage clone. The obtained nucleotide sequence was obtained using the DDBJ database (N
ational Institute of Genetics, Mishima, Japan). GeneAmp PCR System
9600, Dye Terminator Cycle Sequencing Kit FS, and DNA Sequencer Model 373A were purchased from Perkin Elmer Appli.
It was purchased from ed Biosystems Division (Foster City, CA, USA). As a result of the sequence analysis, among the clones obtained, clone ab410 was a human novel nuclear receptor hAN01
The clone was found to encode 6 (embryotype) full-length CDS. (SEQ ID NO: 10; the corresponding amino acid sequence is shown in SEQ ID NO: 5). Homology search result, Cy
DNA binding domain from s40 to Met105, Lys106 to Ala4
Up to 95 were estimated to be ligand binding domains. Table 3 shows the results of analyzing the homology of the amino acid and nucleotide sequences of these two domains to mouse orphan receptor LRH (mLRH) and rat orphan receptor FTF (rFTF).
Shown in

[0062]

[Table 3]

(9) Isolation of hAN016 (adult type) gene Human adult liver cDNA library using λgt10 as a vector (Clontech Laboratories, Inc., Palo Alto, CA, US
A) was infected with E. coli C600Hfl strain and cultured at 37 ° C, and the formed plaque was treated with Hybond-N nylon membrane (Amersham Inter
national plc, Little Chalfont, England)
After alkali denaturation and neutralization, they were fixed by UV irradiation. The probe was 183 base pairs (SEQ ID NO: 13) of zinc finger of AN016 cDNA, one of puffer nuclear receptors, [α- ³² P] dCTP
Used at random. Rediprim on the sign
e DNA labelling system (Amersham International pl
c, Little Chalfont, England). The screening was carried out by the same method and under the same conditions as for the isolation of the hAN016 (fetal type) gene. Positive signals obtained in the primary screening were purified to a single clone by performing secondary and tertiary screening.

(10) Sequence analysis of hAN016 (adult type) A shotgun library was prepared from the phage clone isolated using the zinc finger of the pufferfish nuclear receptor AN016 cDNA as a probe in the same manner as in the sequence analysis of fetal hAN016. Then, the entire nucleotide sequence of the inserted sequence was determined. Among the clones obtained as a result of the sequence analysis, clone aa814 is a human novel nuclear receptor hAN.
The clone was found to encode a full-length CDS of 016 (adult type). (SEQ ID NO: 9; the corresponding amino acid sequence is shown in SEQ ID NO: 4). In addition, Va of hAN016 (adult type)
The amino acid sequence after l6 was identical to the amino acid sequence after Val22 of hAN016 (fetal type). As a result of homology search, Cys24 to Met89 were found to be in the DNA binding domain, Lys90.
Up to Ala479 was presumed to be the ligand binding domain. The amino acid and base sequence of these two domains are hAN016
(Fetal type).

[0065]

As described above, according to the present invention, a human nuclear receptor protein, a gene encoding the protein, a vector and a transformant containing the gene, a method for screening for agonists and antagonists of the protein are provided. , Probes and primers designed from the gene, and antibodies to the human nuclear receptor protein. That is, the present invention provided useful materials and methods that lead to the development of pharmaceuticals and the diagnosis and treatment of diseases.

[0066]

[Sequence List] SEQUENCE LISTING <110> JAPAN TOBACCO Inc <120> New nuclear receptors, genes encoding said nuclear receptors and the use thereof. <130> J98-0151 <140> <141> <150> JP 9-230335 <151 > 1997-08-11 <160> 15 <170> PatentIn Ver. 2.0

<210> 1 <211> 434 <212> PRT <213> Homo sapiens <400> 1 Leu Glu Val Arg Pro Lys Glu Ser Trp Asn His Ala Asp Phe Val His 1 5 10 15 Cys Glu Asp Thr Glu Ser Val Pro Gly Lys Pro Ser Val Asn Ala Asp 20 25 30 Glu Glu Val Gly Gly Pro Gln Ile Cys Arg Val Cys Gly Asp Lys Ala 35 40 45 Thr Gly Tyr His Phe Asn Val Met Thr Cys Glu Gly Cys Lys Gly Phe 50 55 60 Phe Arg Arg Ala Met Lys Arg Asn Ala Arg Leu Arg Cys Pro Phe Arg 65 70 75 80 Lys Gly Ala Cys Glu Ile Thr Arg Lys Thr Arg Arg Gln Cys Gln Ala 85 90 95 Cys Arg Leu Arg Lys Cys Leu Glu Ser Gly Met Lys Lys Glu Met Ile 100 105 110 Met Ser Asp Glu Ala Val Glu Glu Arg Arg Ala Leu Ile Lys Arg Lys 115 120 125 Lys Ser Glu Arg Thr Gly Thr Gln Pro Leu Gly Val Gln Gly Leu Thr 130 135 140 Glu Glu Gln Arg Met Met Ile Arg Glu Leu Met Asp Ala Gln Met Lys 145 150 155 160 Thr Phe Asp Thr Thr Phe Ser His Phe Lys Asn Phe Arg Leu Pro Gly 165 170 175 Val Leu Ser Ser Gly Cys Glu Leu Pro Glu Ser Leu Gln Ala Pro Ser 180 185 190 Arg Glu Glu Ala Ala Lys Trp Ser Gln Val Arg Lys Asp Leu Cys Ser 195 200 205 Leu Lys Val Ser Leu Gln Leu Arg Gly Glu Asp Gly Ser Val Trp Asn 210 215 220 Tyr Lys Pro Pro Ala Asp Ser Gly Gly Lys Glu Ile Phe Ser Leu Leu 225 230 235 240 Pro His Met Ala Asp Met Ser Thr Tyr Met Phe Lys Gly Ile Ile Ser 245 250 255 Phe Ala Lys Val Ile Ser Tyr Phe Arg Asp Leu Pro Ile Glu Asp Gln 260 265 270 Ile Ser Leu Leu Lys Gly Ala Ala Phe Glu Leu Cys Gln Leu Arg Phe 275 280 285 Asn Thr Val Phe Asn Ala Glu Thr Gly Thr Trp Glu Cys Gly Arg Leu 290 295 300 Ser Tyr Cys Leu Glu Asp Thr Ala Gly Gly Phe Gln Gln Leu Leu Leu 305 310 315 320 Glu Pro Met Leu Lys Phe His Tyr Met Leu Lys Lys Leu Gln Leu His 325 330 335 Glu Glu Glu Tyr Val Leu Met Gln Ala Ile Ser Leu Phe Ser Pro Asp 340 345 350 350 Arg Pro Gly Val Leu Gln His Arg Val Val Asp Gln Leu Gln Glu Gln 355 360 365 Phe Ala Ile Thr Leu Lys Ser Tyr Ile Glu Cys Asn Arg Pro Gln Pro 370 375 380 Ala His Arg Phe Leu Phe Leu Lys Ile Met Ala Met Leu Thr Glu Leu 385 390 395 400 Arg Ser Ile Asn Ala GlnHis Thr Gln Arg Leu Leu Arg Ile Gln Asp 405 410 415 Ile His Pro Phe Ala Thr Pro Leu Met Gln Glu Leu Phe Gly Ile Thr 420 425 430 Gly Ser

<210> 2 <211> 457 <212> PRT <213> Homo sapiens <400> 2 Val Asp Pro Arg Gly Glu Val Gly Ala Lys Asn Leu Pro Pro Ser Ser 1 5 10 15 Pro Arg Gly Pro Glu Ala Asn Leu Glu Val Arg Pro Lys Glu Ser Trp 20 25 30 Asn His Ala Asp Phe Val His Cys Glu Asp Thr Glu Ser Val Pro Gly 35 40 45 Lys Pro Ser Val Asn Ala Asp Glu Glu Val Gly Gly Pro Gln Ile Cys 50 55 60 Arg Val Cys Gly Asp Lys Ala Thr Gly Tyr His Phe Asn Val Met Thr 65 70 75 80 Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Ala Met Lys Arg Asn Ala 85 90 95 Arg Leu Arg Cys Pro Phe Arg Lys Gly Ala Cys Glu Ile Thr Arg Lys 100 105 110 Thr Arg Arg Gln Cys Gln Ala Cys Arg Leu Arg Lys Cys Leu Glu Ser 115 120 125 Gly Met Lys Lys Glu Met Ile Met Ser Asp Glu Ala Val Glu Glu Arg 130 135 140 Arg Ala Leu Ile Lys Arg Lys Lys Ser Glu Arg Thr Gly Thr Gln Pro 145 150 155 160 Leu Gly Val Gln Gly Leu Thr Glu Glu Gln Arg Met Met Ile Arg Glu 165 170 175 Leu Met Asp Ala Gln Met Lys Thr Phe Asp Thr Thr Phe Ser His Phe 180 185 190 Lys Asn Phe Arg Leu Pro Gly Val Leu Ser Ser Gly Cys Glu Leu Pro 195 200 205 Glu Ser Leu Gln Ala Pro Ser Arg Glu Glu Ala Ala Lys Trp Ser Gln 210 215 220 Val Arg Lys Asp Leu Cys Ser Leu Lys Val Ser Leu Gln Leu Arg Gly 225 230 235 240 Glu Asp Gly Ser Val Trp Asn Tyr Lys Pro Pro Ala Asp Ser Gly Gly 245 250 255 Lys Glu Ile Phe Ser Leu Leu Pro His Met Ala Asp Met Ser Thr Tyr 260 265 270 Met Phe Lys Gly Ile Ile Ser Phe Ala Lys Val Ile Ser Tyr Phe Arg 275 280 285 Asp Leu Pro Ile Glu Asp Gln Ile Ser Leu Leu Lys Gly Ala Ala Phe 290 295 300 Glu Leu Cys Gln Leu Arg Phe Asn Thr Val Phe Asn Ala Glu Thr Gly 305 310 315 320 Thr Trp Glu Cys Gly Arg Leu Ser Tyr Cys Leu Glu Asp Thr Ala Gly 325 330 335 Gly Phe Gln Gln Leu Leu Leu Glu Pro Met Leu Lys Phe His Tyr Met 340 345 350 Leu Lys Lys Leu Gln Leu His Glu Glu Glu Tlu Val Leu Met Gln Ala 355 360 365 Ile Ser Leu Phe Ser Pro Asp Arg Pro Gly Val Leu Gln His Arg Val 370 375 380 Val Asp Gln Leu Gln Glu Gln Phe Ala Ile Thr Leu Lys Ser Tyr Ile 385 390 395 400 400 Glu Cys Asn Arg Pro GlnPro Ala His Arg Phe Leu Phe Leu Lys Ile 405 410 415 Met Ala Met Leu Thr Glu Leu Arg Ser Ile Asn Ala Gln His Thr Gln 420 425 430 Arg Leu Leu Arg Ile Gln Asp Ile His Pro Phe Ala Thr Pro Leu Met 435 440 445 Gln Glu Leu Phe Gly Ile Thr Gly Ser 450 455

<210> 3 <211> 473 <212> PRT <213> Homo sapiens <400> 3 Met Thr Val Thr Arg Thr His His Phe Lys Glu Gly Ser Leu Arg Ala 1 5 10 15 Pro Ala Ile Pro Leu His Ser Ala Ala Ala Glu Leu Ala Ser Asn His 20 25 30 Pro Arg Gly Pro Glu Ala Asn Leu Glu Val Arg Pro Lys Glu Ser Trp 35 40 45 Asn His Ala Asp Phe Val His Cys Glu Asp Thr Glu Ser Val Pro Gly 50 55 60 Lys Pro Ser Val Asn Ala Asp Glu Glu Val Gly Gly Pro Gln Ile Cys 65 70 75 80 Arg Val Cys Gly Asp Lys Ala Thr Gly Tyr His Phe Asn Val Met Thr 85 90 95 Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Ala Met Lys Arg Asn Ala 100 105 110 Arg Leu Arg Cys Pro Phe Arg Lys Gly Ala Cys Glu Ile Thr Arg Lys 115 120 125 Thr Arg Arg Gln Cys Gln Ala Cys Arg Leu Arg Lys Cys Leu Glu Ser 130 135 140 Gly Met Lys Lys Glu Met Ile Met Ser Asp Glu Ala Val Glu Glu Arg 145 150 155 160 Arg Ala Leu Ile Lys Arg Lys Lys Ser Glu Arg Thr Gly Thr Gln Pro 165 170 175 Leu Gly Val Gln Gly Leu Thr Glu Glu Gln Arg Met Met Ile Arg Glu 180 185 190 Leu Met Asp Ala Gln Met Lys Thr Phe Asp Thr Thr Phe Ser His Phe 195 200 205 Lys Asn Phe Arg Leu Pro Gly Val Leu Ser Ser Gly Cys Glu Leu Pro 210 215 220 Glu Ser Leu Gln Ala Pro Ser Arg Glu Glu Ala Ala Lys Trp Ser Gln 225 230 235 240 Val Arg Lys Asp Leu Cys Ser Leu Lys Val Ser Leu Gln Leu Arg Gly 245 250 255 Glu Asp Gly Ser Val Trp Asn Tyr Lys Pro Pro Ala Asp Ser Gly Gly 260 265 270 Lys Glu Ile Phe Ser Leu Leu Pro His Met Ala Asp Met Ser Thr Tyr 275 280 285 Met Phe Lys Gly Ile Ile Ser Phe Ala Lys Val Ile Ser Tyr Phe Arg 290 295 300 Asp Leu Pro Ile Glu Asp Gln Ile Ser Leu Leu Lys Gly Ala Ala Phe 305 310 315 320 Glu Leu Cys Gln Leu Arg Phe Asn Thr Val Phe Asn Ala Glu Thr Gly 325 330 335 Thr Trp Glu Cys Gly Arg Leu Ser Tyr Cys Leu Glu Asp Thr Ala Gly 340 345 345 350 Gly Phe Gln Gln Leu Leu Leu Glu Pro Met Leu Lys Phe His Tyr Met 355 360 365 Leu Lys Lys Leu Gln Leu His Glu Glu Glu Tyr Val Leu Met Gln Ala 370 375 380 Ile Ser Leu Phe Ser Pro Asp Arg Pro Gly Val Leu Gln His Arg Val 385 390 395 400 400 Val Asp Gln Leu Gln GluGln Phe Ala Ile Thr Leu Lys Ser Tyr Ile 405 410 415 Glu Cys Asn Arg Pro Gln Pro Ala His Arg Phe Leu Phe Leu Lys Ile 420 425 430 Met Ala Met Leu Thr Glu Leu Arg Ser Ile Asn Ala Gln His Thr Gln 435 440 445 Arg Leu Leu Arg Ile Gln Asp Ile His Pro Phe Ala Thr Pro Leu Met 450 455 460 Gln Glu Leu Phe Gly Ile Thr Gly Ser 465 470

<210> 4 <211> 479 <212> PRT <213> Homo sapiens <400> 4 Met Ser Gly Pro Arg Val Ser Gln Phe Lys Met Val Asn Tyr Ser Tyr 1 5 10 15 Asp Glu Asp Leu Glu Glu Leu Cys Pro Val Cys Gly Asp Lys Val Ser 20 25 30 Gly Tyr His Tyr Gly Leu Leu Thr Cys Glu Ser Cys Lys Gly Phe Phe 35 40 45 Lys Arg Thr Val Gln Asn Asn Lys Arg Tyr Thr Cys Ile Glu Asn Gln 50 55 60 Asn Cys Gln Ile Asp Lys Thr Gln Arg Lys Arg Cys Pro Tyr Cys Arg 65 70 75 80 Phe Gln Lys Cys Leu Ser Val Gly Met Lys Leu Glu Ala Val Arg Ala 85 90 95 Asp Arg Met Arg Gly Gly Arg Asn Lys Phe Gly Pro Met Tyr Lys Arg 100 105 110 Asp Arg Ala Leu Lys Gln Gln Lys Lys Ala Leu Ile Arg Ala Asn Gly 115 120 125 Leu Lys Leu Glu Ala Met Ser Gln Val Ile Gln Ala Met Pro Ser Asp 130 135 140 Leu Thr Ile Ser Ser Ala Ile Gln Asn Ile His Ser Ala Ser Lys Gly 145 150 155 160 Leu Pro Leu Asn His Ala Ala Leu Pro Pro Thr Asp Tyr Asp Arg Ser 165 170 175 Pro Phe Val Thr Ser Pro Ile Ser Met Thr Met Pro Pro His Gly Ser 180 185 190 Leu Gln Gly Tyr Gln Thr Tyr Gly His Phe Pro Ser Arg Ala Ile Lys 195 200 205 Ser Glu Tyr Pro Asp Pro Tyr Thr Ser Ser Pro Glu Ser Ile Met Gly 210 215 220 Tyr Ser Tyr Met Asp Ser Tyr Gln Thr Ser Ser Pro Ala Ser Ile Pro 225 230 235 240 His Leu Ile Leu Glu Leu Leu Lys Cys Glu Pro Asp Glu Pro Gln Val 245 250 255 Gln Ala Lys Ile Met Ala Tyr Leu Gln Gln Glu Gln Ala Asn Arg Ser 260 265 270 Lys His Glu Lys Leu Ser Thr Phe Gly Leu Met Cys Lys Met Ala Asp 275 280 285 Gln Thr Leu Phe Ser Ile Val Glu Trp Ala Arg Ser Ser Ile Phe Phe 290 295 300 Arg Glu Leu Lys Val Asp Asp Gln Met Lys Leu Leu Gln Asn Cys Trp 305 310 315 320 Ser Glu Leu Leu Ile Leu Asp His Ile Tyr Arg Gln Val Val His Gly 325 330 335 Lys Glu Gly Ser Ile Phe Leu Val Thr Gly Gln Gln Val Asp Tyr Ser 340 345 350 Ile Ile Ala Ser Gln Ala Gly Ala Thr Leu Asn Asn Leu Met Ser His 355 360 365 Ala Gln Glu Leu Val Ala Lys Leu Arg Ser Leu Gln Phe Asp Gln Arg 370 375 380 Glu Phe Val Cys Leu Lys Phe Leu Val Leu Phe Ser Leu Asp Val Lys 385 390 395 400 Asn Leu Glu Asn Phe GlnLeu Val Glu Gly Val Gln Glu Gln Val Asn 405 410 415 Ala Ala Leu Leu Asp Tyr Thr Met Cys Asn Tyr Pro Gln Gln Thr Glu 420 425 430 Lys Phe Gly Gly Gln Leu Leu Leu Arg Leu Pro Glu Ile Arg Ala Ile Ser 435 440 445 Met Gln Ala Glu Glu Tyr Leu Tyr Tyr Lys His Leu Asn Gly Asp Val 450 455 460 Pro Tyr Asn Asn Leu Leu Ile Glu Met Leu His Ala Lys Arg Ala 465 470 475

<210> 5 <211> 495 <212> PRT <213> Homo sapiens <400> 5 Met Ser Ser Asn Ser Asp Thr Gly Asp Leu Gln Glu Ser Leu Lys His 1 5 10 15 Gly Leu Thr Pro Ile Val Ser Gln Phe Lys Met Val Asn Tyr Ser Tyr 20 25 30 Asp Glu Asp Leu Glu Glu Leu Cys Pro Val Cys Gly Asp Lys Val Ser 35 40 45 Gly Tyr His Tyr Gly Leu Leu Thr Cys Glu Ser Cys Lys Gly Phe Phe 50 55 60 Lys Arg Thr Val Gln Asn Asn Lys Arg Tyr Thr Cys Ile Glu Asn Gln 65 70 75 80 Asn Cys Gln Ile Asp Lys Thr Gln Arg Lys Arg Cys Pro Tyr Cys Arg 85 90 95 Phe Gln Lys Cys Leu Ser Val Gly Met Lys Leu Glu Ala Val Arg Ala 100 105 110 Asp Arg Met Arg Gly Gly Arg Asn Lys Phe Gly Pro Met Tyr Lys Arg 115 120 125 Asp Arg Ala Leu Lys Gln Gln Lys Lys Ala Leu Ile Arg Ala Asn Gly 130 135 140 Leu Lys Leu Glu Ala Met Ser Gln Val Ile Gln Ala Met Pro Ser Asp 145 150 155 160 Leu Thr Ile Ser Ser Ala Ile Gln Asn Ile His Ser Ala Ser Lys Gly 165 170 175 Leu Pro Leu Asn His Ala Ala Leu Pro Pro Thr Asp Tyr Asp Arg Ser 180 185 190 Pro Phe Val Thr Ser Pro Ile Ser Met Thr Met Pro Pro His Gly Ser 195 200 205 Leu Gln Gly Tyr Gln Thr Tyr Gly His Phe Pro Ser Arg Ala Ile Lys 210 215 220 Ser Glu Tyr Pro Asp Pro Tyr Thr Ser Ser Pro Glu Ser Ile Met Gly 225 230 235 240 Tyr Ser Tyr Met Asp Ser Tyr Gln Thr Ser Ser Pro Ala Ser Ile Pro 245 250 255 His Leu Ile Leu Glu Leu Leu Lys Cys Glu Pro Asp Glu Pro Gln Val 260 265 270 Gln Ala Lys Ile Met Ala Tyr Leu Gln Gln Glu Gln Ala Asn Arg Ser 275 280 285 Lys His Glu Lys Leu Ser Thr Phe Gly Leu Met Cys Lys Met Ala Asp 290 295 300 Gln Thr Leu Phe Ser Ile Val Glu Trp Ala Arg Ser Ser Ile Phe Phe 305 310 315 320 Arg Glu Leu Lys Val Asp Asp Gln Met Lys Leu Leu Gln Asn Cys Trp 325 330 335 Ser Glu Leu Leu Ile Leu Asp His Ile Tyr Arg Gln Val Val His Gly 340 345 350 Lys Glu Gly Ser Ile Phe Leu Val Thr Gly Gln Gln Val Asp Tyr Ser 355 360 365 Ile Ile Ala Ser Gln Ala Gly Ala Thr Leu Asn Asn Leu Met Ser His 370 375 380 Ala Gln Glu Leu Val Ala Lys Leu Arg Ser Leu Gln Phe Asp Gln Arg 385 390 395 395 400 Glu Phe Val Cys Leu LysPhe Leu Val Leu Phe Ser Leu Asp Val Lys 405 410 415 Asn Leu Glu Asn Phe Gln Leu Val Glu Gly Val Gln Glu Gln Val Asn 420 425 430 Ala Ala Leu Leu Asp Tyr Thr Met Cys Asn Tyr Pro Gln Gln Thr Glu 435 440 445 Lys Phe Gly Gln Leu Leu Leu Arg Leu Pro Glu Ile Arg Ala Ile Ser 450 455 460 Met Gln Ala Glu Glu Tyr Leu Tyr Tyr Lys His Leu Asn Gly Asp Val 465 470 475 480 Pro Tyr Asn Asn Leu Leu Ile Glu Met Leu His Ala Lys Arg Ala 485 490 495

<210> 6 <211> 1305 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (1305) <400> 6 ctg gag gtg aga ccc aaa gaa agc tgg aac cat gct gac ttt gta cac 48 Leu Glu Val Arg Pro Lys Glu Ser Trp Asn His Ala Asp Phe Val His 1 5 10 15 tgt gag gac aca gag tct gtt cct gga aag ccc agt gtc aac gca gat 96 Cys Glu Asp Thr Glu Ser Val Pro Gly Lys Pro Ser Val Asn Ala Asp 20 25 30 gag gaa gtc gga ggt ccc caa atc tgc cgt gta tgt ggg gac aag gcc 144 Glu Glu Val Gly Gly Pro Gln Ile Cys Arg Val Cys Gly Asp Lys Ala 35 40 45 act ggc tat cac ttc aat gtc atg aca tgt gaa gga tgc aag ggc ttt 192 Thr Gly Tyr His Phe Asn Val Met Thr Cys Glu Gly Cys Lys Gly Phe 50 55 60 ttc agg agg gcc atg aaa cgc aac gcc cgg ctg agg ccc ttc cgg 240 Phe Arg Arg Ala Met Lys Arg Asn Ala Arg Leu Arg Cys Pro Phe Arg 65 70 75 80 aag ggc gcc tgc gag atc acc cgg aag acc cgg cga cag tgc cag gcc 288 Lys Gly Ala Cys Glu Ile Thr Arg Lys Thr Arg Arg Gln Cys Gln Ala 85 90 95 tgc cgc ctg cgc aag tgc ctg gag agc ggc atg aag aag gag atg atc 336 Cys Arg Leu Arg Lys Cys Leu Glu Ser Gly Met Lys Lys Glu Met Ile 100 105 110 atg tcc gac gag gcc gtg gag gag agg cgg gcc ttg atc aag cgg aag 384 Met Ser Asp Glu Ala Val Glu Glu Arg Arg Ala Leu Ile Lys Arg Lys 115 120 125 aaa agt gaa cgg aca ggg act cag cca ctg gga gtg cag ggg ctg aca 432 Lys Ser Glu Arg Thr Gly Thr Gln Pro Leu Gly Val Gln Gly Leu Thr 130 135 140 gag gag cag cgg atg atg atc agg gag ctg atg gac gct cag atg aaa 480 Glu Glu Gln Arg Met Met Ile Arg Glu Leu Met Asp Ala Gln Met Lys 145 150 155 160 acc ttt gac act acc ttc tcc cat ttc aag aat ttc cgg ctg cg 528 Thr Phe Asp Thr Thr Phe Ser His Phe Lys Asn Phe Arg Leu Pro Gly 165 170 175 gtg ctt agc agt ggc tgc gag ttg cca gag tct ctg cag gcc cca tcg 576 Val Leu Ser Ser Gly Cys Glu Leu Pro Glu Ser Leu Gln Ala Pro Ser 180 185 190 agg gaa gaa gct gcc aag tgg agc cag gtc cgg aaa gat ctg tgc tct 624 Arg Glu Glu Ala Ala Lys Trp Ser Gln Val Arg Lys Asp Leu Cys Ser 195 200 205 ttg aag gtc tct cgg cag ggg gag gat ggc agt gtc tgg aac 672 Leu Lys Val Ser Leu Gln Leu Arg Gly Glu Asp Gly Ser Val Trp Asn 210 215 220 tac aaa ccc cca gcc gac agt ggc ggg aaa gag atc ttc tcc ctg ctg 720 Tyr Lys Pro Ala Asp Ser Gly Gly Lys Glu Ile Phe Ser Leu Leu 225 230 235 240 ccc cac atg gct gac atg tca acc tac atg ttc aaa ggc atc atc agc 768 Pro His Met Ala Asp Met Ser Thr Tyr Met Phe Lys Gly Ile Ile Ser 245 250 255 ttt gcc aaa gtc atc tcc tac ttc agg gac ttg ccc atc gag gac cag 816 Phe Ala Lys Val Ile Ser Tyr Phe Arg Asp Leu Pro Ile Glu Asp Gln 260 265 270 atc tcc ctg ctg aag ggg gcc gct ttc gag gct ctg aga ttc 864 Ile Ser Leu Leu Lys Gly Ala Ala Phe Glu Leu Cys Gln Leu Arg Phe 275 280 285 aac aca gtg ttc aac gcg gag act gga acc tgg gag tgt ggc cgg ctg 912 Asn Thr Val Phe Asn Ala Glu Thr Trp Glu Cys Gly Arg Leu 290 295 300 tcc tac tgc ttg gaa gac act gca ggt ggc ttc cag caa ctt cta ctg 960 Ser Tyr Cys Leu Glu Asp Thr Ala Gly Gly Phe Gln Gln Leu Leu Leu 305 310 315 320 gag ccc at aaa ttc cac tac atg ctg aag aag ctg cag ctg cat 1008 Glu Pro Met Leu Lys Phe His Tyr Met Leu Lys Lys Leu Gln Leu His 325 330 335 gag gag gag tat gtg ctg atg cag gcc atc tcc ctc ttc gccca Glu Glu Tyr Val Leu Met Gln Ala Ile Ser Leu Phe Ser Pro Asp 340 345 350 cgc cca ggt gtg ctg cag cac cgc gtg gtg gac cag ctg cag gag caa 1104 Arg Pro Gly Val Leu Gln His Arg Val Val Asp Gln Leu Gln Glu Gln 355 360 365 ttc gcc att act ctg aag tcc tac att gaa tgc aat cgg ccc cag cct 1152 Phe Ala Ile Thr Leu Lys Ser Tyr Ile Glu Cys Asn Arg Pro Gln Pro 370 375 380 gct cat agg ttc ttg ttc atg ag atg gct atg ctc acc gag ctc 1200 Ala His Arg Phe Leu Phe Leu Lys Ile Met Ala Met Leu Thr Glu Leu 385 390 395 400 cgc agc atc aat gct cag cac acc cag cgg ctg ctg cgc atc cag gac 1248 Arg Ser Iln Asla His Thr Gln Arg Leu Leu Arg Ile Gln Asp 405 410 415 ata cac ccc ttt gct acg ccc ctc atg cag gag ttg ttc ggc atc aca 1296 Ile His Pro Phe Ala Thr Pro Leu Met Gln Glu Leu Phe Gly Ile Thr 420 425 430 ggt agc tga 1305 Gly Ser 435

<210> 7 <211> 1374 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (1374) <400> 7 gtg gac ccc agg gga gaa gtc gga gca aag aac tta cca cca agc agt 48 Val Asp Pro Arg Gly Glu Val Gly Ala Lys Asn Leu Pro Pro Ser Ser 1 5 10 15 cca aga ggc cca gaa gca aac ctg gag gtg aga ccc aaa gaa agc tgg 96 Pro Arg Gly Pro Glu Ala Asn Leu Glu Val Arg Pro Lys Glu Ser Trp 20 25 30 aac cat gct gac ttt gta cac tgt gag gac aca gag tct gtt cct gga 144 Asn His Ala Asp Phe Val His Cys Glu Asp Thr Glu Ser Val Pro Gly 35 40 45 aag ccc agt gtc aac gca gat gag gaa gtc gga ggt ccc caa atc tgc 192 Lys Pro Ser Val Asn Ala Asp Glu Glu Val Gly Gly Pro Gln Ile Cys 50 55 60 cgt gta tgt ggg gac aag gcc act ggc tat cac ttc aat gtc atg aca 240 Arg Val Cys Gly Asp Lys Ala Thr Gly Tyr His Phe Asn Val Met Thr 65 70 75 80 tgt gaa gga tgc aag ggc ttt ttc agg agg agg gcc atg aaa cgc aac gcc 288 Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Ala Met Lys Arg Asn Ala 85 90 95 cgg ctg agg tgc ccc ttc cgg aag ggc gcc tgc gag atc acc cgg aag 336 Arg Leu Arg Cys Pro Phe Arg Lys Gly Ala Cys Glu Ile Thr Arg Lys 100 105 110 acc cgg cga cag tgc cag gcc tgc cgc ctg cgc aag tgc ctg gag agc 384 Thr Arg Arg Gln Cys Gln Ala Arg Leu Arg Lys Cys Leu Glu Ser 115 120 125 ggc atg aag aag gag atg atc atg tcc gac gag gcc gtg gag gag agg 432 Gly Met Lys Lys Glu Met Ile Met Ser Asp Glu Ala Val Glu Glu Arg 130 135 140 cgg gcc ttg atc aag cgg aag aaa agt gaa cgg aca ggg act cag cca 480 Arg Ala Leu Ile Lys Arg Lys Lys Ser Glu Arg Thr Gly Thr Gln Pro 145 150 155 160 ctg gga gtg cag ggg ctg aca gag gag cag cgg atg atg atc agg gag 528 Leu Gly Val Gln Gly Leu Thr Glu Glu Gln Arg Met Met Ile Arg Glu 165 170 175 ctg atg gac gct cag atg aaa acc ttt gac act acc ttc tcc cat ttc 576 Leu Met Asp Ala Gln Met Lys Thr Phe Asp Thr Thr Phe Ser His Phe 180 185 190 aag aat ttc cgg ctg cca ggg gtg ctt agc agt ggc tgc gag ttg cca 624 Lys Asn Phe Arg Leu Pro Gly Val Leu Ser Ser Gly Cys Glu Leu Pro 195 200 205 gag tct ctg cag gcc cca tc agg gaa gaa gct gcc aag tgg agc cag 672 Glu Ser Leu Gln Ala Pro Ser Arg Glu Glu Ala Ala Lys Trp Ser Gln 210 215 220 gtc cgg aaa gat ctg tgc tct ttg aag gtc tct ctg cag ctg cgg ggg Asp Leu Lys Cys Ser Leu Lys Val Ser Leu Gln Leu Arg Gly 225 230 235 240 gag gat ggc agt gtc tgg aac tac aaa ccc cca gcc gac agt ggc ggg 768 Glu Asp Gly Ser Val Trp Asn Tyr Lys Pro Pro Ala Asp Ser Gly Gly 245 250 255 aaa gag atc ttc tcc ctg ctg ccc cac atg gct gac atg tca acc tac 816 Lys Glu Ile Phe Ser Leu Leu Pro His Met Ala Asp Met Ser Thr Tyr 260 265 270 atg ttc aaa ggc atc atc agc ttt gcc aaa gtc atc tac ttc agg 864 Met Phe Lys Gly Ile Ile Ser Phe Ala Lys Val Ile Ser Tyr Phe Arg 275 280 285 gac ttg ccc atc gag gac cag atc tcc ctg ctg aag ggg gcc gct ttc 912 Asp Leu Pro Ile Glu Lep Gln Ser Leu Lys Gly Ala Ala Phe 290 295 300 gag ctg tgt caa ctg aga ttc aac aca gtg ttc aac gcg gag act gga 960 Glu Leu Cys Gln Leu Arg Phe Asn Thr Val Phe Asn Ala Glu Thr Gly 305 310 315 320 acc tgg gag t ggc cgg ctg tcc tac tgc ttg gaa gac act gca ggt 1008 Thr Trp Glu Cys Gly Arg Leu Ser Tyr Cys Leu Glu Asp Thr Ala Gly 325 330 335 ggc ttc cag caa ctt cta ctg gag ccc atg ctg Gac attc cac aaa ttc cac Phe Gln Gln Leu Leu Leu Glu Pro Met Leu Lys Phe His Tyr Met 340 345 350 ctg aag aag ctg cag ctg cat gag gag gag tat gtg ctg atg cag gcc 1104 Leu Lys Lys Leu Gln Leu His Glu Glu Glu Tyr Val Leu Met Ala 355 360 365 atc tcc ctc ttc tcc cca gac cgc cca ggt gtg ctg cag cac cgc gtg 1152 Ile Ser Leu Phe Ser Pro Asp Arg Pro Gly Val Leu Gln His Arg Val 370 375 380 gtg gac cag ctg cag gat catttc act ctg aag tcc tac att 1200 Val Asp Gln Leu Gln Glu Gln Phe Ala Ile Thr Leu Lys Ser Tyr Ile 385 390 395 400 gaa tgc aat cgg ccc cag cct gct cat agg ttc ttg ttc ctg aag atc 1248 Glu Cys Asn Arg Pro Pro Ala His Arg Phe Leu Phe Leu Lys Ile 405 410 415 atg gct atg ctc acc gag ctc cgc agc atc aat gct cag cac acc cag 1296 Met Ala Met Leu Thr Glu Leu Arg Ser Ile Asn Ala Gln His Thr Gln 420 425 430 cgg ctg ctg cgc atc cag gac ata cac ccc ttt gct acg ccc ctc atg 1344 Arg Leu Leu Arg Ile Gln Asp Ile His Pro Phe Ala Thr Pro Leu Met 435 440 445 cag gag ttg ttc ggc atc aca ggt agga tg Leu Phe Gly Ile Thr Gly Ser 450 455

<210> 8 <211> 1422 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (1422) <400> 8 atg aca gtc acc agg act cac cac ttc aag gag ggg tcc ctc aga gca 48 Met Thr Val Thr Arg Thr His His Phe Lys Glu Gly Ser Leu Arg Ala 1 5 10 15 cct gcc ata ccc ctg cac agt gct gcg gct gag ttg gct tca aac cat 96 Pro Ala Ile Pro Leu His Ser Ala Ala Ala Glu Leu Ala Ser Asn His 20 25 30 cca aga ggc cca gaa gca aac ctg gag gtg aga ccc aaa gaa agc tgg 144 Pro Arg Gly Pro Glu Ala Asn Leu Glu Val Arg Pro Lys Glu Ser Trp 35 40 45 aac cat gct gac ttt gta cac tgt gag gac aca gag tct gtt cct gga 192 Asn His Ala Asp Phe Val His Cys Glu Asp Thr Glu Ser Val Pro Gly 50 55 60 aag ccc agt gtc aac gca gat gag gaa gtc gga ggt ccc caa atc tgc 240 Lys Pro Ser Val Asn Ala Asp Glu Glu Val Gly Gly Pro Gln Ile Cys 65 70 75 80 cgt gta tgt ggg gac aag gcc act ggc tat cac ttc aat gtc atg aca 288 Arg Val Cys Gly Asp Lys Ala Thr Gly Tyr His Phe Asn Val Met Thr 85 90 95 tgt gaa gga tgc aag ggc ttt ttc agg agg gcc atg aaa cgc aac gcc 336 Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Ala Met Lys Arg Asn Ala 100 105 110 cgg ctg agg tgc ccc ttc cgg aag ggc gcc tgc gag atc acc cgg aag 384 Arg Leu Arg Cys Pro Phe Gly Ala Cys Glu Ile Thr Arg Lys 115 120 125 acc cgg cga cag tgc cag gcc tgc cgc ctg cgc aag tgc ctg gag agc 432 Thr Arg Arg Gln Cys Gln Ala Cys Arg Leu Arg Lys Cys Leu Glu Ser 130 135 140 ggc at a aag gag atg atc atg tcc gac gag gcc gtg gag gag agg 480 Gly Met Lys Lys Glu Met Ile Met Ser Asp Glu Ala Val Glu Glu Arg 145 150 155 160 cgg gcc ttg atc aag cgg aag aaa agt gaa cgg aca ggg act cacca 528 Arg Ala Leu Ile Lys Arg Lys Lys Ser Glu Arg Thr Gly Thr Gln Pro 165 170 175 ctg gga gtg cag ggg ctg aca gag gag cag cgg atg atg atc agg gag 576 Leu Gly Val Gln Gly Leu Thr Glu Glu Gln Arg Met Ile Arg Glu 180 185 190 ctg atg gac gct cag atg aaa acc ttt gac act acc ttc tcc cat ttc 624 Leu Met Asp Ala Gln Met Lys Thr Phe Asp Thr Thr Phe Ser His Phe 195 200 205 aag aat ttc cgg ctg cca ggg gtg ctt agc agt ggc tgc gag ttg cca 672 Lys Asn Phe Arg Leu Pro Gly Val Leu Ser Ser Gly Cys Glu Leu Pro 210 215 220 gag tct ctg cag gcc cca tcg agg gaa gaa gct gcc aag tgg agc cag 720 Glu Ser Leu Gln Pro Ser Arg Glu Glu Ala Ala Lys Trp Ser Gln 225 230 235 240 gtc cgg aaa gat ctg tgc tct ttg aag gtc tct ctg cag ctg cgg ggg 768 Val Arg Lys Asp Leu Cys Ser Leu Lys Val Ser Leu Gln Leu Arg Gly 245 250 255 gag gat ggc agt gtc tgg aac tac aaa ccc cca gcc gac agt ggc ggg 816 Glu Asp Gly Ser Val Trp Asn Tyr Lys Pro Pro Ala Asp Ser Gly Gly 260 265 270 270 aaa gag atc ttc tcc ctg ctg ccc cac atg gct gac tca acc tac 864 Lys Glu Ile Phe Ser Leu Leu Pro His Met Ala Asp Met Ser Thr Tyr 275 280 285 atg ttc aaa ggc atc atc agc ttt gcc aaa gtc atc tcc tac ttc agg 912 Met Phe Lys Gly Ile Ile Ser Phe Ala Ly Val Ile Ser Tyr Phe Arg 290 295 300 gac ttg ccc atc gag gac cag atc tcc ctg ctg aag ggg gcc gct ttc 960 Asp Leu Pro Ile Glu Asp Gln Ile Ser Leu Leu Lys Gly Ala Ala Phe 305 310 315 320 gag ctg tgt ca ctg aga ttc aac aca gtg ttc aac gcg gag act gga 1008 Glu Leu Cys Gln Leu Arg Phe Asn Thr Val Phe Asn Ala Glu Thr Gly 325 330 335 acc tgg gag tgt ggc cgg ctg tcc tac tgc ttg gaa gac act gca Trp Glu Cys Gly Arg Leu Ser Tyr Cys Leu Glu Asp Thr Ala Gly 340 345 350 ggc ttc cag caa ctt cta ctg gag ccc atg ctg aaa ttc cac tac atg 1104 Gly Phe Gln Gln Leu Leu Leu Glu Pro Met Tle Lys Phe Met 355 360 365 ctg aag aag ctg cag ctg cat gag gag gag tat gtg ctg atg cag gcc 1152 Leu Lys Lys Leu Gln Leu His Glu Glu Glu Tyr Val Leu Met Gln Ala 370 375 380 atc tcc ctc ttc tcc cca gacg gtg ctg cag cac cgc gtg 1200 Ile Ser Leu Phe Ser Pro Asp Arg Pro Gly Val Leu Gln His Arg Val 385 390 395 400 gtg gac cag ctg cag gag caa ttc gcc att act ctg aag tcc tac att 1248 Val Asp Gln Leu Gln Glu Gln Phe Ala Ile Thr Leu Lys Ser Tyr Ile 405 410 415 gaa tgc aat cgg ccc cag cct gct cat agg ttc ttg ttc ctg aag atc 1296 Glu Cys Asn Arg Pro Gln Pro Ala His Arg Phe Leu Phe Leu Lys Ile 420 425 430 atg gct atg ctc acc gag ctc cgc agc atc aat gct cag cac acc cag 1344 Met Ala Met Leu Thr Glu Leu Arg Ser Ile Asn Ala Gln His Thr Gln 435 440 445 cgg ctg ctg cgc atc cag gac ata cac ccc ttt ccc ctc atg 1392 Arg Leu Leu Arg Ile Gln Asp Ile His Pro Phe Ala Thr Pro Leu Met 450 455 460 cag gag ttg ttc ggc atc aca ggt agc tga 1422 Gln Glu Leu Phe Gly Ile Thr Gly Ser 465 470

<210> 9 <211> 1440 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (1440) <400> 9 atg tcg ggt ccc cga gtg tct caa ttt aaa atg gtg aat tac tcc tat 48 Met Ser Gly Pro Arg Val Ser Gln Phe Lys Met Val Asn Tyr Ser Tyr 1 5 10 15 gat gaa gat ctg gaa gag ctt tgt ccc gtg tgt gga gat aaa gtg tct 96 Asp Glu Asp Leu Glu Glu Leu Cys Pro Val Cys Gly Asp Lys Val Ser 20 25 30 ggg tac cat tat ggg ctc ctc acc tgt gaa agc tgc aag gga ttt ttt 144 Gly Tyr His Tyr Gly Leu Leu Thr Cys Glu Ser Cys Lys Gly Phe Phe 35 40 45 aag cga aca gtc caa aat aat aaa agg tac aca tgt ata gaa aac cag 192 Lys Arg Thr Val Gln Asn Asn Lys Arg Tyr Thr Cys Ile Glu Asn Gln 50 55 60 aac tgc caa att gac aaa aca cag aga aag cgt tgt cct tac tgt cgt 240 Asn Cys Gln Ile Asp Lys Thr Gln Arg Lys Arg Cys Pro Tyr Cys Arg 65 70 75 80 ttt caa aaa tgt cta agt gtt gga atg aag cta gaa gct gta agg gcc 288 Phe Gln Lys Cys Leu Ser Val Gly Met Lys Leu Glu Ala Val Arg Ala 85 90 95 gac cga atg cgt gga gga agg aat aag ttt ggg cca atg tac aag aga 336 Asp Arg Met Arg Gly Gly Arg Asn Lys Phe Gly Pro Met Tyr Lys Arg 100 105 110 gac agg gcc ctg aag caa cag aaa aaa gcc ctc atc cga gcc aat gga 384 Asp Arg Ala Leu Lys Gln Lys Lys Ala Leu Ile Arg Ala Asn Gly 115 120 125 ctt aag cta gaa gcc atg tct cag gtg atc caa gct atg ccc tct gac 432 Leu Lys Leu Glu Ala Met Ser Gln Val Ile Gln Ala Met Pro Ser Asp 130 135 140 ctg acc att tcc tct gca att caa aac atc cac tct gcc tcc aaa ggc 480 Leu Thr Ile Ser Ser Ala Ile Gln Asn Ile His Ser Ala Ser Lys Gly 145 150 155 160 cta cct ctg aac cat gct gcc ttg cct cct aca gac tat gac aga agt 528 Leu Pro Leu Asn His Ala Ala Leu Pro Pro Thr Asp Tyr Asp Arg Ser 165 170 175 ccc ttt gta aca tcc ccc att agc atg aca atg ccc cct cac ggc agc 576 Pro Phe Val Thrl Ser Pro Ile Ser Met Thr Met Pro Pro His Gly Ser 180 185 190 ctg caa ggt tac caa aca tat ggc cac ttt cct agc cgg gcc atc aag 624 Leu Gln Gly Tyr Gln Thr Tyr Gly His Phe Pro Ser Arg Ala Ile Lys 195 200 205 tct gag tac cca gac ccc tat acc agc tca ccc gag tcc ata atg ggc 672 Ser Glu Tyr Pro Asp Pro Tyr Thr Ser Ser Pro Glu Ser Ile Met Gly 210 215 220 tat tca tat atg gat agt tac cag acg agc tct cca gca agc atc cca 720 Tyr Ser Tyr Met Asp Ser Tyr Gln Thr Ser Ser Pro Ala Ser Ile Pro 225 230 235 240 cat ctg ata ctg gaa ctt ttg aag tgt gag cca gat gag cct caa gtc 768 His Leu Ile Leu Glu Leu Leu Lys Cys Glu Pro Asp Glu Pro Gln Val 245 250 255 cag gct aaa atc atg gcc tat ttg cag caa gag cag gct aac cga agc 816 Gln Ala Lys Ile Met Ala Tyr Leu Gln Gln Glu Gln Ala Asn Arg Ser 260 265 270 aag cac gaa aag ctg agc acc ttt ggg ctt atg atg gca gat 864 Lys His Glu Lys Leu Ser Thr Phe Gly Leu Met Cys Lys Met Ala Asp 275 280 285 caa act ctc ttc tcc att gtc gag tgg gcc agg agt agt atc ttc ttc 912 Gln Thr Leu Phe Ser Ile Val Glu Tla Arg Ser Ser Ile Phe Phe 290 295 300 aga gaa ctt aag gtt gat gac caa atg aag ctg ctt cag aac tgc tgg 960 Arg Glu Leu Lys Val Asp Asp Gln Met Lys Leu Leu Gln Asn Cys Trp 305 310 315 320 agt gag ctc a atc ctc gac cac att tac cga caa gtg gta cat gga 1008 Ser Glu Leu Leu Ile Leu Asp His Ile Tyr Arg Gln Val Val His Gly 325 330 335 aag gaa gga tcc atc ttc ctg gtt act ggg caa caa gtg gac tat tcc10 Lys Glu Gly Ser Ile Phe Leu Val Thr Gly Gln Gln Val Asp Tyr Ser 340 345 350 ata ata gca tca caa gcc gga gcc acc ctc aac aac ctc atg agt cat 1104 Ile Ile Ala Ser Gln Ala Gly Ala Thr Leu Asn Asn Leu Met Ser His 355 360 365 gca cag gag tta gtg gca aaa ctt cgt tct ctc cag ttt gat caa cga 1152 Ala Gln Glu Leu Val Ala Lys Leu Arg Ser Leu Gln Phe Asp Gln Arg 370 375 380 gag ttc gta tgt ctg aaa ttc ttg ctc ttt agt tta gat gtc aaa 1200 Glu Phe Val Cys Leu Lys Phe Leu Val Leu Phe Ser Leu Asp Val Lys 385 390 395 400 aac ctt gaa aac ttc cag ctg gta gaa ggt gtc cag gaa caa gtc aat 1248 Asn Leu Gln Leu Val Glu Gly Val Gln Glu Gln Val Asn 405 410 415 gcc gcc ctg ctg gac tac aca atg tgt aac tac ccg cag cag aca gag 1296 Ala Ala Leu Leu Asp Tyr Thr Met Cys Asn Tyr Pro Gln Gln Thr Glu 420 425 430 aaa ttt gga cag cta ctt ctt cga cta ccc gaa atc cgg gcc atc agt 1344 Lys Phe Gly Gln Leu Leu Leu Arg Leu Pro Glu Ile Arg Ala Ile Ser 435 440 445 atg cag gct gaa gaa tac ctc tac tac aag cac ggg gat gtg 1392 Met Gln Ala Glu Glu Tyr Leu Tyr Tyr Lys His Leu Asn Gly Asp Val 450 455 460 ccc tat aat aac ctt ctc att gaa atg ttg cat gcc aaa aga gca taa 1440 Pro Tyr Asn Asn Leu Leu Ile Glu Met His Ala Lys Arg Ala 465 470 475 480

<210> 10 <211> 1488 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (1488) <400> 10 atg tct tct aat tca gat act ggg gat tta caa gag tct tta aag cac 48 Met Ser Ser Asn Ser Asp Thr Gly Asp Leu Gln Glu Ser Leu Lys His 1 5 10 15 gga ctt aca cct att gtg tct caa ttt aaa atg gtg aat tac tcc tat 96 Gly Leu Thr Pro Ile Val Ser Gln Phe Lys Met Val Asn Tyr Ser Tyr 20 25 30 gat gaa gat ctg gaa gag ctt tgt ccc gtg tgt gga gat aaa gtg tct 144 Asp Glu Asp Leu Glu Glu Leu Cys Pro Val Cys Gly Asp Lys Val Ser 35 40 45 ggg tac cat tat ggg ctc ctc acc tgt gaa agc tgc aag gga ttt ttt 192 Gly Tyr His Tyr Gly Leu Leu Thr Cys Glu Ser Cys Lys Gly Phe Phe 50 55 60 aag cga aca gtc caa aat aat aaa agg tac aca tgt ata gaa aac cag 240 Lys Arg Thr Val Gln Asn Asn Lys Arg Tyr Thr Cys Ile Glu Asn Gln 65 70 75 80 aac tgc caa att gac aaa aca cag aga aag cgt tgt cct tac tgt cgt 288 Asn Cys Gln Ile Asp Lys Thr Gln Arg Lys Arg Cys Pro Tyr Cys Arg 85 90 95 ttt caa aaa tgt cta agt gtt gga atg aag c ta gaa gct gta agg gcc 336 Phe Gln Lys Cys Leu Ser Val Gly Met Lys Leu Glu Ala Val Arg Ala 100 105 110 gac cga atg cgt gga gga agg aat aag ttt ggg cca atg tac aag aga 384 Asp Arg Met Arg Gly Gly Arg Asn Lys Phe Gly Pro Met Tyr Lys Arg 115 120 125 gac agg gcc ctg aag caa cag aaa aaa gcc ctc atc cga gcc aat gga 432 Asp Arg Ala Leu Lys Gln Gln Lys Lys Ala Leu Ile Arg Ala Asn Gly 130 135 140 ctt aag cta gaa gcc atg tct cag gtg atc caa gct atg ccc tct gac 480 Leu Lys Leu Glu Ala Met Ser Gln Val Ile Gln Ala Met Pro Ser Asp 145 150 155 160 ctg acc att tcc tct gca att caa aac atc cac tct gcc tcc aaa ggc 528 Leu Thr Ile Ser Ser Ala Ile Gln Asn Ile His Ser Ala Ser Lys Gly 165 170 175 cta cct ctg aac cat gct gcc ttg cct cct aca gac tat gac aga agt 576 Leu Pro Leu Asn His Ala Ala Leu Pro Pro Thr Asp Tyr Asp Arg Ser 180 185 190 ccc ttt gta aca tcc ccc att agc atg aca atg ccc cct cac ggc agc 624 Pro Phe Val Thr Ser Pro Ile Ser Met Thr Met Pro Pro His Gly Ser 195 200 205 ctg caa ggt tac caa aca tat g gc cac ttt cct agc cgg gcc atc aag 672 Leu Gln Gly Tyr Gln Thr Tyr Gly His Phe Pro Ser Arg Ala Ile Lys tct gag tac cca gac ccc tat acc agc tca ccc gag tcc ata atg ggc 720 Ser Glu Tyr Pro Asp Pro Tyr Thr Ser Ser Pro Glu Ser Ile Met Gly 225 230 235 240 tat tca tat atg gat agt tac cag acg agc tct cca gca agc atc cca 768 Tyr Ser Tyr Met Asp Ser Tyr Gln Thr Ser Ser Pro Ala Ser Ile Pro 245 250 255 cat ctg ata ctg gaa ctt ttg aag tgt gag cca gat gag cct caa gtc 816 His Leu Ile Leu Glu Leu Leu Lys Cys Glu Pro Asp Glu Pro Gln Val 260 265 270 270 cag gct aaa atc atg gcc tat ttg cag caa gag cag gct agc 864 Gln Ala Lys Ile Met Ala Tyr Leu Gln Gln Glu Gln Ala Asn Arg Ser 275 280 285 aag cac gaa aag ctg agc acc ttt ggg ctt atg tgc aaa atg gca gat 912 Lys His Glu Lys Leu Ser Thr Phe Gly Leu Lys Met Ala Asp 290 295 300 caa act ctc ttc tcc att gtc gag tgg gcc agg agt agt atc ttc ttc 960 Gln Thr Leu Phe Ser Ile Val Glu Trp Ala Arg Ser Ser Ile Phe Phe 305 310 315 320 aga gaa ctt aag gtt gat g ac caa atg aag ctg ctt cag aac tgc tgg 1008 Arg Glu Leu Lys Val Asp Asp Gln Met Lys Leu Leu Gln Asn Cys Trp 325 330 335 agt gag ctc tta atc ctc gac cac att tac cga caa gtg gta cat Gga 1056 Ser Glu Leu Ile Leu Asp His Ile Tyr Arg Gln Val Val His Gly 340 345 350 aag gaa gga tcc atc ttc ctg gtt act ggg caa caa gtg gac tat tcc 1104 Lys Glu Gly Ser Ile Phe Leu Val Thr Gly Gln Gln Val Asp Tyr Ser 355 360 365 ata ata gca tca caa gcc gga gcc acc ctc aac aac ctc atg agt cat 1152 Ile Ile Ala Ser Gln Ala Gly Ala Thr Leu Asn Asn Leu Met Ser His 370 375 380 gca cag gag tta gtg gca aaa ctt cgt tct ctc cag ttt gat caa cga 1200 Ala Gln Glu Leu Val Ala Lys Leu Arg Ser Leu Gln Phe Asp Gln Arg 385 390 395 400 gag ttc gta tgt ctg aaa ttc ttg gtg ctc ttt agt tta gat gtc aaa 1248 Glu Phe Val Hes Leu Lys Val Leu Phe Ser Leu Asp Val Lys 405 410 415 aac ctt gaa aac ttc cag ctg gta gaa ggt gtc cag gaa caa gtc aat 1296 Asn Leu Glu Asn Phe Gln Leu Val Glu Gly Val Gln Glu Gln Val Asn 420 425 430 gcc gc c ctg ctg gac tac aca atg tgt aac tac ccg cag cag aca gag 1344 Ala Ala Leu Leu Asp Tyr Thr Met Cys Asn Tyr Pro Gln Gln Thr Glu 435 440 445 aaa ttt gga cag cta ctt ctt cga cta ccc gaa atc cgg agt 1392 Lys Phe Gly Gln Leu Leu Leu Arg Leu Pro Glu Ile Arg Ala Ile Ser 450 455 460 atg cag gct gaa gaa tac ctc tac tac aag cac ctg aat ggg gat gtg 1440 Met Gln Ala Glu Glu Tyr Leu Tyr Tyr Lys Asn Gly Asp Val 465 470 475 480 ccc tat aat aac ctt ctc att gaa atg ttg cat gcc aaa aga gca taa 1488 Pro Tyr Asn Asn Leu Leu Ile Glu Met Leu His Ala Lys Arg Ala 485 490 495

[0077] <210> 11 <211> 183 <212> DNA <213> Fugu rubripes <400> 11 tgtgtggtgt gtggtgacaa agcatcgggg tatcactaca acgctctcac ctgcgaggga 60 tgcaaaggtt tcttccggcg cagcgtgact aaaaaagccg tataccactg caagagcggc 120 ggcagctgcg agatggacat gtacatgagg aggaagtgcc aagactgccg gctgaggaag 180 tgc 183

[0078] <210> 12 <211> 644 <212> DNA <213> Homo sapiens <400> 12 gaattccggc atgcctttac ttcagtggat tttcggcctc agcctgcaag ccaagtgttc 60 acagtgagaa aagcaagaga ataagctaat actcctgtcc tgaaaaaggc agcggctcct 120 tggtaaagct actccttgat cgatcctttg caccggattg ttcaaagtgg accccagggg 180 agaagtcgga gcaaagaact taccaccaag cagtccaaga ggcccagaag caaacctgga 240 ggtgagaccc aaagaaagct ggaaccatgc tgactttgta cactgtgagg acacagagtc 300 tgttcctgga aagcccagtg tcaacgcaga tgaggaagtc ggaggtcccc aaatctgccg 360 tgtatgtggg gacaaggcca ctggctatca cttcaatgtc atgacatgtg aaggatgcaa 420 gggctttttc aggagggcca tgaaacgcaa cgcccggctg aggtgcccct tccggaaggg 480 cgcctgcgag atcacccgga agacccggcg acagtgccag gcctgccgcc tgcgcaagtg 540 cctggagagc ggcatgaaga aggagatgat catgtccgac gaggccgtgg aggagaggcg 600 ggccttgatc aagcggaaga aaagtgaacg gacagccgga attc 644

[0079] <210> 13 <211> 183 <212> DNA <213> Fugu rubripes <400> 13 tgtcctgtct gtggggacag ggtgtcaggg tatcactacg ggctgctcac ctgtgaaagc 60 tgcaagggct tcttcaagcg ttcagtgcag aataacaagg attacacctg tgcagaacaa 120 cagagctgcc ccatgaacct ttcacagagg aaacgttgcc ctttctgccg cttccaaaag 180 tgc 183

<210> 14 <211> 3243 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (344) .. (1765) <400> 14 gccgcttagt gcctacatct gacttggact gaaatatagg tgagagacaa gattgtctca 60 tatccgggga aatcataacc tatgactagg acgggaagag gaagcactgc ctttacttca 120 gtgggaatct cggcctcagc ctgcaagcca agtgttcaca gtgagaaaag caagagaata 180 agctaatact cctgtcctga aaaaggcagc ggctccttgg taaagctact ccttgatcga 240 tcctttgcac cggattgttc aaagtggacc ccaggggaga agtcggagca aagaacttac 300 caccaagcag tgctggcagc cccctgaggc caaggacagc agc atg aca gtc acc 355 Met Thr Val Thr 1 agg act cac cac ttc aag gag ggg tcc ctc aga gca cct gcc ata ccc 403 Arg Thr His His Phe Lys Glu Gly Ser Leu Arg Ala Pro Ala Ile Pro 5 10 15 20 ctg cac agt gct gcg gct gag ttg gct tca aac cat cca aga ggc cca 451 Leu His Ser Ala Ala Ala Glu Leu Ala Ser Asn His Pro Arg Gly Pro 25 30 35 gaa gca aac ctg gag gtg aga ccc aaa gaa agc tgg aac cat gct gac 499 Glu Ala Asn Leu Glu Val Arg Pro Lys Glu Ser Trp Asn His Ala Asp 40 45 50 ttt gta cac tgt gag gac aca gag tct gtt cct gga aag ccc agt gtc 547 Phe Val His Cys Glu Asp Thr Glu Ser Val Pro Gly Lys Pro Ser Val 55 60 65 aac gca gat gag gaa gtc gga ggt ccc caa atc tgc cgt gta tgt ggg 595 Asn Ala Asp Glu Glu Val Gly Gly Pro Gln Ile Cys Arg Val Cys Gly 70 75 80 gac aag gcc act ggc tat cac ttc aat gtc atg aca tgt gaa gga tgc 643 Asp Lys Ala Thr Gly Tyr His Phe Asn Val Met Thr Cys Glu Gly Cys 85 90 95 100 aag ggc ttt ttc agg agg gcc atg aaa cgc aac gcc cgg ctg agg tgc 691 Lys Gly Phe Phe Arg Arg Ala Met Lys Arg Asn Ala Arg Leu Arg Cys 105 110 115 ccc ttc cgg aag ggc gcc tgc gag atc acc acc cgg cga cag 739 Pro Phe Arg Lys Gly Ala Cys Glu Ile Thr Arg Lys Thr Arg Arg Gln 120 125 130 tgc cag gcc tgc cgc ctg cgc aag tgc ctg gag agc ggc atg aag aag 787 Cys Gln Ala Cys Arg Leg Arg Leu Glu Ser Gly Met Lys Lys 135 140 145 gag atg atc atg tcc gac gag gcc gtg gag gag agg cgg gcc ttg atc 835 Glu Met Ile Met Ser Asp Glu Ala Val Glu Glu Arg Arg Ala Leu Ile 150 155 160 aag cgg aag aaa agt gaa cgg aca ggg act cag cca ctg gga gtg cag 883 Lys Arg Lys Lys Ser Glu Arg Thr Gly Thr Gln Pro Leu Gly Val Gln 165 170 175 180 ggg ctg aca gag gag cag cgg atg atg atc agg gag ctg atg gac gct 931 Gly Leu Thr Glu Glu Gln Arg Met Met Ile Arg Glu Leu Met Asp Ala 185 190 195 cag atg aaa acc ttt gac act acc ttc tcc cat ttc aag aat ttc cgg 979 Gln Met Lys Thr Phe Asp Thr Thr Phe Ser His Phe Lys Asn Phe Arg 200 205 210 ctg cca ggg gtg ctt agc agt ggc tgc gag ttg cca gag tct ctg cag 1027 Leu Pro Gly Val Leu Ser Ser Gly Cys Glu Leu Pro Glu Ser Leu Gln 215 220 225 gcc cca tcg agg gaa gaa gct gcc ag tag cag gtc cgg aaa gat 1075 Ala Pro Ser Arg Glu Glu Ala Ala Lys Trp Ser Gln Val Arg Lys Asp 230 235 240 ctg tgc tct ttg aag gtc tct ctg cag ctg cgg ggg gag gat ggc agt 1123 Leu Cys Ser Leu Lys Val Gln Leu Arg Gly Glu Asp Gly Ser 245 250 255 260 gtc tgg aac tac aaa ccc cca gcc gac agt ggc ggg aaa gag atc ttc 1171 Val Trp Asn Tyr Lys Pro Pro Ala Asp Ser Gly Gly Lys Glu Ile Phe 265 270 270 tcc ctg ctg ccc cac atg gct gac atg tca acc tac atg ttc aaa ggc 1219 Ser Leu Leu Pro His Met Ala Asp Met Ser Thr Tyr Met Phe Lys Gly 280 285 290 atc atc agc ttt gcc aaa gtc atc tcc tac ttc agg gac atc 1267 Ile Ile Ser Phe Ala Lys Val Ile Ser Tyr Phe Arg Asp Leu Pro Ile 295 300 305 gag gac cag atc tcc ctg ctg aag ggg gcc gct ttc gag ctg tgt caa 1315 Glu Asp Gln Ile Ser Leu Leu Lys Gly Ala Ala Pla Glu Leu Cys Gln 310 315 320 ctg aga ttc aac aca gtg ttc aac gcg gag act gga acc tgg gag tgt 1363 Leu Arg Phe Asn Thr Val Phe Asn Ala Glu Thr Gly Thr Trp Glu Cys 325 330 335 340 ggc cgg ctg tcc tac ttg gaa gac act gca ggt ggc ttc cag caa 1411 Gly Arg Leu Ser Tyr Cys Leu Glu Asp Thr Ala Gly Gly Phe Gln Gln 345 350 355 ctt cta ctg gag ccc atg ctg aaa ttc cac tac atg ctg Leag Leag ug Glu Pro Met Leu Lys Phe His Tyr Met Leu Lys Lys Leu 360 365 370 cag ctg cat gag gag gag tat gtg ctg atg cag gcc atc tcc ctc ttc 1507 Gln Leu His Glu Glu Glu Tyr Val Leu Met Gln Ala Ile Ser Leu Phe 375 380 385 tcc cca gac cgc cca ggt gtg ctg cag cac cgc gtg gtg gac cag ctg 1555 Ser Pro Asp Arg Pro Gly Val Leu Gln His Arg Val Val Asp Gln Leu 390 395 400 cag gag caa ttc gag att act ctg ag tac att gaa tgc aat cgg 1603 Gln Glu Gln Phe Ala Ile Thr Leu Lys Ser Tyr Ile Glu Cys Asn Arg 405 410 415 420 ccc cag cct gct cat agg ttc ttg ttc ctg aag atc atg gct atg ctc 1651 Pro Gln Pro Ala His Phe Leu Phe Leu Lys Ile Met Ala Met Leu 425 430 435 acc gag ctc cgc agc atc aat gct cag cac acc cag cgg ctg ctg cgc 1699 Thr Glu Leu Arg Ser Ile Asn Ala Gln His Thr Gln Arg Leu Leu Arg 440 445 450 cag gac ata cac ccc ttt gct acg ccc ctc atg cag gag ttg ttc 1747 Ile Gln Asp Ile His Pro Phe Ala Thr Pro Leu Met Gln Glu Leu Phe 455 460 465 ggc atc aca ggt agc tga gcggctgccc ttgggtgag cct ttgggtgacc 470 gcagccagac ccagagccct ctgagccgcc actcccgggc caagacagat ggacactgcc 1855 aagagccgac aatgccctgc tggcctgtct ccctagggaa ttcctgctat gacagctggc 1915 tagcattcct caggaaggac atggg tgccc cccaccccca gttcagtctg tagggagtga 1975 agccacagac tcttacgtgg agagtgcact gacctgtagg tcaggaccat cagagaggca 2035 aggttgccct ttccttttaa aaggccctgt ggtctgggga gaaatccctc agatcccact 2095 aaagtgtcaa ggtgtggaag ggaccaagcg accaaggata ggccatctgg ggtctatgcc 2155 cacataccca cgtttgttcg cttcctgagt cttttcattg ctacctctaa tagtcctgtc 2215 tcccacttcc cactcgttcc cctcctcttc cgagctgctt tgtgggctcc aggcctgtac 2275 tcatcggcag gtgcatgagt atctgtggga gtcctctaga gagatgagaa gccaggaggc 2335 ctgcaccaaa tgtcagaagc ttggcatgac ctcattccgg ccacatcatt ctgtgtctct 2395 gcatccattt gaacacatta ttaagcaccg ataataggta gcctgctgtg gggtatacag 2455 cattgactca gatatagatc ctgagctcac agagtttata gttaaaaaaa caaacagaaa 2515 cacaaacaat ttggatcaaa aggagaaatg ataagtgaca aaagcagcac aaggaatttc 2575 cctgtgtgga tgctgagctg tgatggcggg cactgggtac ccaagtgaag gttcccgagg 2635 acatgagtct gtaggagcaa gggcacaaac tgcagctgtg agtgcgtgtg tgtgatttgg 2695 tgtaggtagg tctgtttgcc acttgatggg gcctgggttt gttcctgggg ctggaatgct 2755 gggtatgctt tgtgacaagg ctacgctgac aatcagttaa acacaccgga gaagaaccat 2815 ttacatgcac cttatatttc tgtgtacaca tctattctca aagctaaagg gtatgaaagt 2875 gcctgccttg tttatagcca cttgtgagta aaaatttttt tgcattttca caaattatac 2935 tttatataag gcattccaca cctaagaact agttttggga aatgtagccc tgggtttaat 2995 gtcaaatcaa ggcaaaagga attaaataat gtacttttgg ctagaggggt aaactttttt 3055 ggcctttttc tggggaaaat aatgtggggg tgtggaaata gaaacatacg caagcataca 3115 tatttttact acttatttta ttattatcct gtataaatct gaagactccg gcgtaagaac 3175 ataaaaatga attatttaac ttggcttact tataaaatga ttgttctgta taaaagttaa 3235 aaaaaaaa 3243

<210> 15 <211> 3057 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (206) .. (1579) <400> 15 catatccggg gaaatcataa cctatgacta ggacgggaag aggaagcact gcctttactt 60 cagtgggaat ctcggcctca gcctgcaagc caagtgttca cagtgagaaa agcaagagaa 120 taagctaata ctcctgtcct gaaaaaggca gcggctcctt ggtaaagcta ctccttgatc 180 gatcctttgc accggattgt tcaaa gtg gac ccc agg gga gaa gtc gga gca 232 Val Asp Pro Arg Gly Glu Val Gly Ala 1 5 aag aac tta cca cca agc agt cca aga ggc cca gaa gca aac ctg gag 280 Lys Asn Leu Pro Pro Ser Ser Pro Arg Gly Pro Glu Ala Asn Leu Glu 10 15 20 25 gtg aga ccc aaa gaa agc tgg aac cat gct gac ttt gta cac tgt gag 328 Val Arg Pro Lys Glu Ser Trp Asn His Ala Asp Phe Val His Cys Glu 30 35 40 gac aca gag tct gtt cct gga aag ccc agt gtc aac gca gat gag gaa 376 Asp Thr Glu Ser Val Pro Gly Lys Pro Ser Val Asn Ala Asp Glu Glu 45 50 55 gtc gga ggt ccc caa atc tgc cgt gta tgt ggg gac aag gcc act ggc 424 Val Gly Gly Pro Gln Ile Cys Arg Val Cys Gly Asp Lys Ala Thr Gly 60 65 70 tat cac ttc aat gtc atg aca tgt gaa gga tgc aag ggc ttt ttc agg 472 Tyr His Phe Asn Val Met Thr Cys Glu Gly Cys Lys Gly Phe Phe Arg 75 80 85 agg gcc atg aaa cgc aac gcc cgg ctg agg tgc cag ggc 520 Arg Ala Met Lys Arg Asn Ala Arg Leu Arg Cys Pro Phe Arg Lys Gly 90 95 100 105 gcc tgc gag atc acc cgg aag acc cgg cga cag tgc cag gcc tgc cgc 568 Ala Cys Glu Ile Thr Arg Lys Thr Arg Arg Gln Cys Gln Ala Cys Arg 110 115 120 ctg cgc aag tgc ctg gag agc ggc atg aag aag gag atg atc atg atg tcc 616 Leu Arg Lys Cys Leu Glu Ser Gly Met Lys Lys Glu Met Ile Met Ser 125 130 135 gac gag gcc ggg gag agg cgg gcc ttg atc aag cgg aag aaa agt 664 Asp Glu Ala Val Glu Glu Arg Arg Ala Leu Ile Lys Arg Lys Lys Ser 140 145 150 gaa cgg aca ggg act cag cca ctg gga gtg cag ggg ctg aca gag gag 712 Glu Arg Gly Thr Gln Pro Leu Gly Val Gln Gly Leu Thr Glu Glu 155 160 165 cag cgg atg atg atc agg gag ctg atg gac gct cag atg aaa acc ttt 760 Gln Arg Met Met Ile Arg Glu Leu Met Asp Ala Gln Met Lys Thr Phe 170 175 180 185 gac act acc ttc tcc cat ttc aag aat ttc cgg ctg cca ggg gtg ctt 808 Asp Thr Thr Phe Ser His Phe Lys Asn Phe Arg Leu Pro Gly Val Leu 190 195 200 agc agt ggc tgc gag ttg cca gag tct ctg cag gcc cca tcg agg gaa 856 Ser Ser Gly Cys Glu Leu Pro Glu Ser Leu Gln Ala Pro Ser Arg Glu 205 210 215 gaa gct gcc aag tgg agc cag gtc cgg aaa gat ctg tgc tct ttg aag 904 Glu Ala Ala Lys Trp Ser Gln Val Lys Asp Leu Cys Ser Leu Lys 220 225 230 gtc tct ctg cag ctg cgg ggg gag gat ggc agt gtc tgg aac tac aaa 952 Val Ser Leu Gln Leu Arg Gly Glu Asp Gly Ser Val Trp Asn Tyr Lys 235 240 245 ccc cca gcc gac agt ggc ggg aaa gag atc ttc tcc ctg ctg ccc cac 1000 Pro Pro Ala Asp Ser Gly Gly Lys Glu Ile Phe Ser Leu Leu Pro His 250 255 260 265 atg gct gac atg tca acc tac atg ttc aaa ggc atc atc agc ttt gcc 1048 Met Ala Asp Met Ser Thr Tyr Met Phe Lys Gly Ile Ile Ser Phe Ala 270 275 280 aaa gtc atc tcc tac ttc agg gac ttg ccc atc gag gac cag atc tcc 1096 Lys Val Ile Ser Tyr Phe Arg Asp Leu Pro Ile Glu Asp G ln Ile Ser 285 290 295 ctg ctg aag ggg gcc gct ttc gag ctg tgt caa ctg aga ttc aac aca 1144 Leu Leu Lys Gly Ala Ala Pla Ghe Le Gy Leu Cys Gln Leu Arg Phe Asn Thr 300 305 310 gtg ttc ag gg g tgg gag tgt ggc cgg ctg tcc tac 1192 Val Phe Asn Ala Glu Thr Gly Thr Trp Glu Cys Gly Arg Leu Ser Tyr 315 320 325 tgc ttg gaa gac act gca ggt ggc ttc cag caa ctt cta ctg gag ccc 1240 Cys Leu Glu Ala Gly Gly Phe Gln Gln Leu Leu Leu Glu Pro 330 335 340 345 atg ctg aaa ttc cac tac atg ctg aag aag ctg cag ctg cat gag gag 1288 Met Leu Lys Phe His Tyr Met Leu Lys Lys Leu Gln Leu His Glu Glu 350 360 gag tat gtg ctg atg cag gcc atc tcc ctc ttc tcc cca gac cgc cca 1336 Glu Tyr Val Leu Met Gln Ala Ile Ser Leu Phe Ser Pro Asp Arg Pro 365 370 375 ggt gtg ctg cag cac cgc gtg gtg gac gag caa ttc gcc 1384 Gly Val Leu Gln His Arg Val Val Asp Gln Leu Gln Glu Gln Phe Ala 380 385 390 att act ctg aag tcc tac att gaa tgc aat cgg ccc cag cct gct cat 1432 Ile Thr Leu Lys Ser Tyr Ile Glu Cy s Asn Arg Pro Gln Pro Ala His 395 400 405 agg ttc ttg ttc ctg aag atc atg gct atg ctc acc gag ctc cgc agc 1480 Arg Phe Leu Phe Leu Lys Ile Met Ala Met Leu Thr Glu Leu Arg Ser 410 415 at 425 atc gct cag cac acc cag cgg ctg ctg cgc atc cag gac ata cac 1528 Ile Asn Ala Gln His Thr Gln Arg Leu Leu Arg Ile Gln Asp Ile His 430 435 440 ccc ttt gct acg ccc ctc atg cag gag ttg ttc gc atc agc atc 1576 Pro Phe Ala Thr Pro Leu Met Gln Glu Leu Phe Gly Ile Thr Gly Ser 445 450 455 tgagcggctg cccttgggtg acacctccga gaggcagcca gacccagagc cctctgagcc 1636 gccactcccg ggccaagaca gatggacact gccaagagcc gacaatgccc tgctggcctg 1696 tctccctagg gaattcctgc tatgacagct ggctagcatt cctcaggaag gacatgggtg 1756 ccccccaccc ccagttcagt ctgtagggag tgaagccaca gactcttacg tggagagtgc 1816 actgacctgt aggtcaggac catcagagag gcaaggttgc cctttccttt taaaaggccct 1876 tgtggtctgg ggagaaatcc ctcagatccc actaaagtgt caaggtgtgg aagggaccaa 1936 gcgaccaagg ataggccatc tggggtctat gcccacatac ccacgtttgttc cctgttcctc tcttcctc tctgcttcctg 1996 taatagtcct gtctcccact tcccactcgt tcccctcctc 2056 ttccgagctg ctttgtgggc tccaggcctg tactcatcgg caggtgcatg agtatctgtg 2116 ggagtcctct agagagatga gaagccagga ggcctgcacc aaatgtcaga agcttggcat 2176 gacctcattc cggccacatc attctgtgtc tctgcatcca tttgaacaca ttattaagca 2236 ccgataatag gtagcctgct gtggggtata cagcattgac tcagatatag atcctgagct 2296 cacagagttt atagttaaaa aaacaaacag aaacacaaac aatttggatc aaaaggagaa 2356 atgataagtg acaaaagcag cacaaggaat ttccctgtgt ggatgctgag ctgtgatggc 2416 gggcactggg tacccaagtg aaggttcccg aggacatgag tctgtaggag caagggcaca 2476 aactgcagct gtgagtgcgt gtgtgtgatt tggtgtaggt aggtctgttt gccacttgat 2536 ggggcctggg tttgttcctg gggctggaat gctgggtatg ctttgtgaca aggctacgct 2596 gacaatcagt taaacacacc ggagaagaac catttacatg caccttatat ttctgtgtac 2656 acatctattc tcaaagctaa agggtatgaa agtgcctgcc ttgtttatag ccacttgtga 2716 gtaaaaattt ttttgcattt tcacaaatta tactttatat aaggcattcc acacctaaga 2776 actagttttg ggaaatgtag ccctgggttt aatgtcaaat caaggcaaaa ggaattaaat 2836 aatgtacttt tggctagagg ggtaaa cttt tttggccttt ttctggggaa aataatgtgg 2896 gggtgtggaa atagaaacat acgcaagcat acatattttt actacttatt ttattattat 2956 cctgtataaa tctgaagact ccggcgtaag aacataaaaa tgaattattt aacttggctt 3016 acttataaaatgtattgttgttgt

[0082]

[Brief description of the drawings]

BRIEF DESCRIPTION OF DRAWINGS FIG. 1 is a view showing the mRNA expression status of nuclear receptor of SEQ ID NO: 3 in various tissues analyzed by Northern blotting.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12Q 1/68 C12Q 1/68 A G01N 33/53 G01N 33/53 D 33/566 33/566 // (C12N 15/09 ZNA (C12R 1:91) (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19)

Claims (27)

[Claims] 1. A nuclear receptor protein comprising an amino acid sequence represented by SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 5, or a substantially identical amino acid sequence. 2. SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3,
An amino acid sequence represented by SEQ ID NO: 4 or SEQ ID NO: 5,
Or a nuclear receptor protein having substantially the same amino acid sequence. 3. A nucleotide sequence encoding the nuclear receptor protein according to claim 1 or 2. 4. The nucleotide sequence according to claim 3, wherein the nucleotide sequence is SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. 5. The nucleotide sequence according to claim 3, wherein the nucleotide sequence is represented by SEQ ID NO: 14 or SEQ ID NO: 15. 6. A polypeptide comprising a partial region of the nuclear receptor protein represented by claim 1 or 2. 7. The polypeptide according to claim 6, wherein the partial region is a region selected from a ligand binding region, a DNA binding region, and a hypervariable region. 8. A base sequence encoding the polypeptide according to claim 6. 9. A base sequence wherein the base sequence of claim 8 encodes a region selected from a ligand binding region, a DNA binding region, and a hypervariable region. 10. A partial sequence of the nucleotide sequence represented by SEQ ID NO: 14 or SEQ ID NO: 15. 11. A base sequence wherein the partial base sequence of claim 10 is antisense. 12. A method for screening a substance that acts on a nuclear receptor protein, wherein the method comprises the steps of:
A test sample is brought into contact with the nuclear receptor protein or the polypeptide according to claim 6, and a change in the nuclear receptor protein or the polypeptide is measured, thereby screening for a substance acting on the nuclear receptor protein. Law. 13. A method for screening a substance that acts on a nuclear receptor protein, wherein the method comprises the steps of:
A test sample is brought into contact with cells expressing the nuclear receptor protein or the polypeptide according to claim 6, and the expression state of the nuclear receptor protein or another protein whose expression is regulated by the polypeptide is measured. A method for screening for a substance that acts on a nuclear receptor protein, comprising determining whether or not the test sample has an effect on a nuclear receptor from the strength of the test sample. 14. A method for screening an antagonist to a substance acting on a nuclear receptor protein,
(1) The expression state of another protein whose expression is regulated by the nuclear receptor protein when a ligand is brought into contact with cells expressing the nuclear receptor protein according to claim 1 or 2 or the polypeptide according to claim 6. And (2) bringing a ligand and a test sample into contact with cells expressing the nuclear receptor protein according to claim 1 or claim 2 or the polypeptide according to claim 6; Measuring the expression state of another protein that is subject to expression regulation;
And a method for screening for an antagonist to a substance acting on a nuclear receptor protein, wherein the antagonistic action of a test sample is determined from the difference from the expression state of the other protein determined in step 2. 15. A substance acting on a nuclear receptor protein selected by the method according to claim 12 or 13. 16. An antagonist to a substance acting on a nuclear receptor protein selected by the method according to claim 14. 17. An antibody or a part of an antibody reactive with the protein according to claim 1 or 2. 18. A nucleotide sequence encoding the nuclear receptor protein according to claim 1 or claim 2, or a nucleotide sequence according to claim 5 or a nucleotide sequence complementary thereto, which is at least 15 consecutive nucleotide sequences. Become a probe. (19) A gene encoding a nuclear receptor which hybridizes with the probe according to (18). 20. A nuclear receptor protein encoded by the gene according to claim 19. 21. A primer designed from the nucleotide sequence encoding the nuclear receptor protein according to claim 1 or 2, or the nucleotide sequence according to claim 5, or a nucleotide sequence complementary thereto. 22. A gene encoding a nuclear receptor cloned by PCR using the primer according to claim 21. 23. A nuclear receptor protein encoded by the gene according to claim 22. 24. A recombinant vector containing the nucleic acid according to claim 3 or 5. 25. A transformant containing the nucleic acid according to claim 3 or 5. 26. A recombinant vector containing the nucleic acid according to claim 8 or 10. 27. A transformant containing the nucleic acid according to claim 8 or 10.