JPH11125634A - Solid phase for immunoassay - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a solid phase for immunological measurement which is highly reactive and invulnerable to the effect of a coexistence substance in a sample. SOLUTION: In this solid phase for immunoassay, a substance (active component) that immunologically reacts specifically with a substance to be measured is bonded indirectly to a solid carrier through two types or more or two molecules or more of interstitial substances (high polymer such as protein). Such an immunoassay is performed using a prepared solid phase. As compared with the conventional method using a solid phase having an active component (antigen, antibody or the like) bonded thereto directly or through one molecule of interstitial substance, a signal value based on a specific immunoreaction is increased to lower interference by cerum components.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a solid phase used for immunoassay (immunoassay).

[0002]

2. Description of the Related Art As a method for measuring and analyzing an antigenic substance or an antibody substance, an immunoassay method has an advantage that it is simple and has high specificity. Above all, immunoassay has long been the mainstream of the technique of detecting a substance by immunoreacting a carrier (hereinafter referred to as a solid phase) having a surface to which an antigen or an antibody is previously bound and a substance to be measured in a specimen. For example, after capturing the amount of the label associated with the amount of the substance to be measured on the solid phase, separating the solid phase from the unreacted components, and measuring the amount of the label on the solid phase, the amount of the substance to be measured (Heterogeneous method) and a method of measuring the extent to which the solid phase is cross-linked and aggregated by the substance to be measured to determine the amount of the substance to be measured (homogeneous method) are well known. In any case, in the measurement method using these solid phases, it is assumed that the substance bound to the solid phase has the same immunoreactivity as that in the solution even in the bound state.

[0003]

However, the binding between these active ingredients and the solid phase is not usually carried out in a very controlled manner, and is often left to spontaneous physical adsorption. In this case, depending on the active component to be immobilized, denaturation due to adsorption occurs to decrease immunological activity, the active site is hidden on the adsorption surface side and cannot react, or the active site is near the adsorption surface Steric hindrance causes a decrease in reactivity. In fact, it is an empirically known fact that when low-molecular substances such as haptens and peptide hormones are directly insolubilized as an antigen substance in a solid phase, it is empirically known that the antigenicity tends to decrease. Some have been reviewed and reported. For example, Ishikawa et al. [Journal of Biochemistry, J. Biochem, Vol.
P.3 (1978)] states that in the measurement of anti-insulin antibody in a sample, bovine serum albumin was first bound and then insulin was bound and insolubilized, rather than using a solid phase to which insulin was directly bound. We reported that the specific signal value was several times higher when using the phase. On the other hand, in the case of high molecular weight antigens and antibodies, there is little discussion about the reactivity of the active ingredient bound to the solid phase. In addition, it is expected that the decrease in reactivity as described above is likely to occur when the sample comes into contact with a sample containing a large amount of contaminants, such as serum. Did not. In such a measurement method using a solid phase,
Depending on the active ingredient, the reactivity may decrease due to solid-phase immobilization, and the value of the substance to be measured may be reduced because the measurer is not conscious of the fact that the detection sensitivity of the measurement system is degraded. There is no denying that they may not be evaluated correctly.

[0004] An object of the present invention is to bind an active ingredient to a solid phase under such circumstances without causing degradation by direct adsorption or reduction in reactivity due to steric hindrance. An object of the present invention is to provide a solid phase capable of increasing mobility and reacting in a state close to a solution.

[0005]

Means for Solving the Problems In the preparation of a solid phase for immunoassay, the present inventor has proposed that (1) binding of an active ingredient to a solid phase indirectly via two or more intervening molecules. The present inventors have found that the mobility of the active ingredient is high, the reaction is hardly affected by steric hindrance, (2) a solid phase can be prepared with little decrease in activity due to serum components and the like, and the present invention has been accomplished.

[0006] The present invention has the following features. (1) that a substance (active ingredient) capable of specifically forming an immune complex with the substance to be measured is indirectly bound to the solid phase carrier via two or more intervening substances; Characterized solid phase for immunoassay. (2) The solid phase for immunoassay according to (1), wherein the intervening substance is a protein. (3) The mediator is a protein having a molecular weight of 10,000 or more (2)
The solid phase for immunoassay described. (4) The immunoassay solid phase according to (3), wherein the active ingredient is a specific antigen. (5) The solid phase for immunoassay according to (3), wherein the active ingredient is a specific antibody. (6) The immunoassay solid phase according to (4), wherein the active ingredient is a human immunodeficiency virus type I p17 antigen, p24 antigen or reverse transcriptase antigen. (7) The solid phase for immunoassay according to (5), wherein the active ingredient is an antibody against p24 antigen of human immunodeficiency virus type I or an antibody against human growth hormone. (8) An immunoassay, wherein the solid phase for immunoassay according to (1) is used as a first solid phase in an immunocomplex transfer method. (9) An immunoassay kit comprising the solid phase according to (1).

Hereinafter, the present invention will be described. In the present specification, “a substance (active ingredient) capable of specifically forming an immune complex with a substance to be measured” mainly means an antibody in the case of measuring an antigen and an antigen in the case of measuring an antibody. That is,
When the substance to be measured is an antibody, it means a specific antigen. For example, when measuring an anti-virus antibody such as an anti-HIV antibody or an anti-HBV antibody,
When measuring an autoantibody such as an antinuclear antibody or an antithyroglobulin antibody, the corresponding autoantigen is replaced with an allergic Ig.
When measuring E, it refers to the corresponding allergen, and when measuring an anti-protein antibody such as an anti-interferon antibody or an anti-growth hormone antibody, it refers to the corresponding protein. these,
The antigenic substance as an active substance may be the whole or a part of the molecule, and may be a natural product or a synthetic product. Especially,
P in Anti-HIV (Human Immunodeficiency Virus) Antibody Measurement
The 17 antigen, p24 antigen or reverse transcriptase antigen are examples of suitable active ingredients.

When the substance to be measured is an antigen, the active ingredient means a specific antibody. For example, when measuring a viral antigen such as HIV core antigen or HBV surface antigen, the corresponding specific antibody is used, as well as other proteinaceous hormones such as insulin and thyroid stimulating hormone (TSH), and C-reactive protein. (CRP) and fibrin degradation products (F
Plasma proteins such as DP), α-fetoprotein (A
When measuring tumor markers such as FP) and carcinoembryonic antigen (CEA), and haptens such as thyroxine and vasopressin, the corresponding antibodies are meant. These specific antibodies may be polyclonal or monoclonal, and the class of the antibody is not limited. Also, Fa
It may be a fragment such as b, F (ab ') ₂ or Fab'. The method of binding using the SH group of the Hinge portion of the Fab ′ is one preferable form from the viewpoint of uniforming the directionality of the reaction site. In particular, an anti-p24 antibody Fab ′ for the measurement of p24 antigen, a kind of HIV antigen, or an anti-human growth hormone antibody Fab ′ for the measurement of human growth hormone, are examples of suitable active ingredients. As described above, in the present invention, by selecting an appropriate active ingredient, it is possible to measure all antibodies and antigens which can be measured by the immunological assay.

[0009] The term "solid support" means a material and a shape usually used in an immunoassay. For example, examples of the material include polystyrene, polyacryl, polycarbonate, polymethacrylate, Teflon, cellulose film, paper, glass, agarose, ferrite, and latex (natural rubber). Any form may be used, and examples thereof include beads, plates, fine particles, sticks, and gels.

The term "intermediate" means a substance (spacer) interposed between the solid support and the active ingredient, and is an essential element of the present invention. The material of the "intermediate" in the present invention is a naturally derived or chemically synthesized polymer, particularly a protein. However, nucleic acids, as long as they prevent steric hindrance of binding of the substance to be measured and do not adversely affect the measurement system,
Polynucleotides, dextrans, organic high molecular polymers and the like also belong to the technical scope of the present invention. The size (molecular weight) of the “intermediate” is not particularly limited, but it is preferable that the “intermediate” has a molecular size of a certain size or more in order to exert the effects of the present invention more strongly. Those having a molecular weight of about 10,000 to 1,000,000 are preferable, and those having a molecular weight of 30,000 to 500,000 are particularly preferable. The form of the "intervening substance" is not particularly limited, but is preferably a form that can secure the distance between the solid support and the active ingredient in order to more strongly exert the effects of the present invention. For proteins, globular proteins are preferred. albumin,
Examples include serum-derived proteins such as globulin, milk or egg white-derived proteins, various enzymes, and bacterial secreted proteins such as avidin, streptavidin, and maltose binding protein (MBP). However, fibrous proteins such as collagen and fibroin also prevent steric hindrance of binding of the analyte,
Anything that does not adversely affect the measurement system belongs to the technical scope of the present invention.

[0011] What is meant by "indirectly linked via two or more kinds of intervening substances" is that two or more kinds of said intervening substances or two or more molecules of the same kind are arranged in series, This is a state in which the solid phase carrier and the active ingredient are linked. (1) solid phase carrier and mediator, (2) mediators,
And (3) the binding between the intervening substance and the active ingredient may be basically performed by any method as long as it is not easily dissociated during the storage and measurement of the solid phase. An example of the joining method will be described below.

(1) For the binding between the solid phase carrier and the intervening substance,
Representative methods known in the art, such as a method of adsorbing a protein to a solid phase of polystyrene or activated carbon, and a method of covalently bonding to a functional group of a carrier substance using a polyvalent crosslinking reagent, are typical. .

(2) The method of bonding between the intervening substances is as follows: 1: a method of covalently bonding to a functional group of the intervening substance using a polyvalent crosslinking reagent; 2: introducing a hapten molecule into one of the intervening substances. , A method of binding to an anti-hapten antibody, 3: a method of binding by utilizing the affinity between substances originally or introduced by an intervening substance. Examples of the crosslinking reagent used in the method of 1: include glutaraldehyde, N
-(Ε-maleimidocaproyloxy) succinimide (E
MCS), N, N- (1,2-phenylene) bismaleimide, N-succinimidyl-3- (2-pyridyldithio) propionate (SPDP), 4,4′-dithiobisphenylazide (DTBPA) and the like. .

Examples of the hapten used in the method 2: include a dinitrophenyl group, a trinitrophenyl group, a fluorescein group, a digoxigenin group and the like. As a method of introducing a hapten into the intermediary substance, for example,
Using 2,4-dinitrophenyl-L-amino acid,
A known method for introducing a 4-dinitrophenyl group [Kono et al., Journal of Clinical Laboratory Analysis (J. Clin. Lab. Anal.), No. 6]
Vol. 105, 1992].

A typical example of using the affinity substance used in the method 3: is a method in which biotin is introduced into one of the intervening substances and bound to avidin (or streptavidin). As a method for introducing a biotin molecule into an intervening substance, for example, N-succinimidyl-D
A biotinylation reagent such as -biotin or sulfosuccinimidyl-N- (D-biotinyl) -6-aminohexanoate may be used. Avidin (streptavidin) is 1
Since the molecule has a plurality of biotin-binding sites, it is possible to link other two types of biotinylated substances, and it is suitable as an intervening substance. In addition, examples of the binding method utilizing affinity include a method using a combination of a sugar chain and a lectin, a metal and a chelating substance, a ligand and a receptor, a polynucleotide having a complementary sequence, and the like.

In addition to the above-mentioned methods of 1: 2, 3 :, it is also possible to use any protein as the first mediator and use an antibody that recognizes the protein as an antigen as the second mediator. good.

(3) For the binding between the intervening substance and the active ingredient,
Similarly to the above (2), 1: a method of covalently bonding to a functional group of the intervening substance and the active ingredient using a polyvalent crosslinking reagent, 2: introducing a hapten molecule to the active ingredient, and preparing an anti-hapten antibody. A method of binding by using as an intervening substance, 3: a method of binding by utilizing affinity between an active ingredient and an intervening substance inherently or introduced substance are used. Further, 4: an antigen-antibody reaction may be used. 5: It is also possible to fuse and express the active ingredient and the mediator by a known technique of genetic engineering, and to obtain both in a form linked by a peptide chain. It is a suitable method when the active ingredient is used as an epitope peptide of a virus antigen,
As a protein to be fusion-expressed, maltose binding protein (MBP), glutathione-S-transferase and the like can be used.

The "p17 antigen" of human immunodeficiency virus type I is a protein having a molecular weight of about 17000 which is encoded and expressed by a gene region called gag of the virus.
It is a protein involved in maintaining the structure of virus particles. The “p24 antigen” is a protein having a molecular weight of about 24,000, which is also encoded in the gag region, forms a core (nucleus) of virus particles, and has a function of including viral RNA. Furthermore, “reverse transcriptase antigen” refers to p
ol, a protein with a molecular weight of about 66000 or 51,000 expressed by a gene region called a
A is a protein that has the function of replicating A [Gelderblom et al., Virology (Viro
156), vol. 156, p. 171 (1987)].

The solid phase of the present invention can be used in all immunoassays that have been carried out using a solid phase. For example, a non-specific signal of a measurement system is suppressed by transferring a test substance between two or more solid phases, and the detection sensitivity is remarkably improved. Highly Sensitive Enzyme Immunoassay ”, published by Gakkai Shuppan Center (1993)]. As described above, the measurement system may be a homogeneous system or a heterogeneous system, and the measurement substance can measure all antigens and antibodies. The test liquid may be any of biological fluids such as serum, plasma, saliva, urine, and cerebrospinal fluid and buffers, and the detection method is not limited to colorimetry, fluorescence, luminescence, radiation, turbidity, and the like.

[0020]

EXAMPLES Hereinafter, in order to explain the usefulness of the present invention, as examples, HIV-1 p17 antigen, p24 antigen, RT
Detection of an antibody against each antigen in a sample or an antigen against each antibody (Fab ') in a sample using a solid phase in which antigen, anti-p24 antibody (Fab') or anti-human growth hormone antibody (Fab ') is insolubilized in various forms. Are performed, and the results are compared with those of the prior art, but the present invention is not limited to these examples.

Example 1 In this example, a sample containing an anti-HIV antibody (positive sample) and a sample not containing the same (a negative sample) were prepared using a solid phase in which the HIV-1 and p17 antigens were insolubilized via two or more proteins. ) And each solid phase were examined for the difference in reactivity in the presence and absence of serum components. The details of the purification and preparation of each substance and the details of the experimental procedure are as follows. [Buffer] In this experiment, the following buffers were mainly used. Buffer A: 0.1 mol / L sodium phosphate buffer,
pH 7.0 Buffer B: 0.1 mol / L sodium phosphate buffer,
pH 6.0, 5 mmol / L ethylenediaminetetraacetic acid (EDTA) Buffer C: 0.01 mol / L sodium phosphate buffer, pH 7.0, 1 g / L bovine serum albumin (Fraction V, Intergen, New York), 1 mmol
1 / L magnesium chloride, 1g / L sodium azide

[Preparation of Recombinant HIV-1, p17 Antigen (rp17)] (1) Preparation of Plasmid HIV-1 Isolate NY5 (Genebank, Accession No. HI)
VNL43) and LAV [Wine Hobson (Wain)
-Hobson et al., Cell, Vol. 40, p. 9 (1985)].
NL4-3) [Adachi et al., Journal of Virology (J. Virol.), Vol. 59, p. 284 (19)
86)] as a template and DNA encoding the p17 antigen
The fragment was converted into two types of primers (5′-CGGGATCCGGTA) corresponding to the N-terminal and C-terminal nucleotide sequences of p17.
TTGAAGGTCGTATGGGTGGCGAGAGC
GTCGGGTA, 5'-GGTCTAGATCAGTAA
(TTTTGGCTGACCTGGCT, Vex, Tokyo) using the polymerase chain reaction method (PCR method). Subsequently, rp17 was converted to maltose binding protein (MB
P) to express it as a fusion protein with
The NA fragment was converted to a pMAL-c2 plasmid (New England Biolabs, Mass., USA)
Was introduced. At this time, in order to obtain rp17 having the same amino acid sequence as native p17, a sequence for cleavage by factor Xa was inserted into the N-terminal side primer on the amino group side of the original N-terminal amino acid of p17, and the C-terminal was obtained. The side primer was designed to include a stop codon next to the original C-terminal amino acid.

(2) Expression and Purification of Protein Next, this plasmid was transformed into Escherichia coli DH5α strain (Life Technologies Oriental, Tokyo), and the Escherichia coli was transformed with isopropyl-1-thio-β-
The cells were grown under induction with D-galactopyranoside. Subsequently, Escherichia coli was treated with a 15 mmol / L sodium phosphate buffer solution containing 5 mmol / L EDTA, pH 7.5.
The mixture was sonicated in water and the supernatant of the centrifugation was collected. Supernatant was treated with diethylaminoethyl (DEAE) equilibrated with the same buffer.
After application to Sepharose, elution was carried out with the same buffer containing 75 mmol / L sodium chloride, and rp17-MBP
A fraction containing the fusion protein was obtained. Further, using a kit of New England Biolabs, according to the operating procedure of the company, and using an amylose resin column, rp17
-Affinity purification of MBP was performed. Hereinafter, rp1
This product was used in experiments using 7-MBP. continue,
Using a kit from Boehringer Mannheim (Germany), rp17 and MBP were cleaved with biotinyl Xa factor and biotinyl factor Xa was removed with a streptavidin column according to the manufacturer's protocol. Finally, rp17 is an SP Sepharose Fast Flow column (Pharmacia Biotech A) equilibrated with 15 mmol / L sodium phosphate buffer, pH 6.7.
(Company B, Sweden) and eluted with 15 mmol / L sodium phosphate buffer containing 0.5 mol / L sodium chloride, pH 6.7. Purified rp17-
It was confirmed by electrophoresis that MBP and rp17 were each single.

[2,4-dinitrophenyl-MBP-r
Preparation of p17] (1) Preparation of mercaptoacetyl-MBP-rp17 0.1 m containing 1.2 mg of MBP-rp17 fusion protein
ol / L sodium phosphate buffer, pH 7.0, 0.
50 mmol / L N-succinimidyl-S- in 4 ml
13.5 μl of an N, N-dimethylformamide solution containing acetylmercaptoacetate was added, and the mixture was incubated at 30 ° C. for 30 minutes. Subsequently, 5 μl of 1 m was added to the reaction solution.
ol / L glycylglycine, pH 7.0 and 20 μl
0.1 mol / L, EDTA, pH 7.0
Incubate at 0 ° C. for 5 minutes and finally 50 μl of 1
mol / L hydroxylamine was added and incubated at 30 ° C. for 10 minutes.

(2) Preparation of 2,4-dinitrophenyl-L-lysine-maleimide 30 μl of N, N-dimethylformamide solution containing 3 μmol of εN-2,4-dinitrophenyl-L-lysine
Then, 15 μl of an N, N-dimethylformamide solution containing 1.5 μmol of N-succinimidyl-6-maleimidohexanoate and 105 μl of buffer A were mixed and incubated at 30 ° C. for 90 minutes. (3) Preparation of 2,4-dinitrophenyl-MBP-rp17 The above solution of mercaptoacetyl-MBP-rp17 and 2,4-dinitrophenyl-L-lysine-maleimide solution were mixed and incubated at 30 ° C. for 60 minutes. After the reaction, the reaction solution is applied to a Sephadex G-50 fine column (Pharmacia Biotech AB), and 2,4-dinitrophenyl-MBP-rp17 is reacted with an unreacted low molecular reagent by gel filtration chromatography. Was isolated. Eisen et al. Method from the absorbance at 280 nm and 360 nm [Eisen et al., Journal of Immunology (J. Immunol.), Vol. 73, No. 29
6 (1954)], MBP-rp17, 1
The average number of 2,4-dinitrophenyl groups introduced per molecule was 3.9.

[Preparation of biotinyl-MBP-rp17]
In the preparation process of 2,4-dinitrophenyl-MBP-rp17 described above, the biocytin-maleimide solution prepared by the following operation was converted to 2,4-dinitrophenyl-L-
The same procedure was repeated, except that the lysine-maleimide solution was used. (1) Preparation of biocytin-maleimide 3.1 μmol of buffer A containing biocytin, 113 μm
was mixed with 37 μl of an N, N-dimethylformamide solution containing 1.5 μmol of N-succinimidyl-6-maleimidohexanoate and incubated at 30 ° C. for 90 minutes.

[Preparation of biotinyl-rp17] (1) Preparation of mercaptoacetyl-rp17 Buffer A containing 0.87 mg (51 nmol) of rp17, 480 μl containing 5 mmol / L N-succinimidyl-S-acetylmercaptoacetate 22.5 μl of an N, N-dimethylformamide solution was added, and the mixture was incubated at 30 ° C. for 30 minutes. Subsequently, 25 μl was added to the reaction solution.
of 1 mol / L Tris-HCl buffer, pH 7.0 and 25 μl of 0.1 mol / L EDTA, pH 7.0, and incubate at 30 ° C. for 10 minutes.
Add 0 μl of 1 mol / L hydroxylamine and add 30
Incubated at 10 ° C for 10 minutes. (2) Preparation of biocytin-maleimide Buffer A containing 0.33 μmol of biocytin, 15 μm
was mixed with 4.6 μl of an N, N-dimethylformamide solution containing 0.2 μmol of N-succinimidyl-6-maleimidohexanoate and incubated at 30 ° C. for 90 minutes. (3) Preparation of biotinyl-rp17 The above-mentioned mercaptoacetyl-rp17 solution and biocytin-maleimide solution were mixed and incubated at 30 ° C for 60 minutes. Subsequently, 13.3 μl was added to the reaction solution (633 μl).
After adding 3 mg of urea (final concentration 0.35 mol / L), a Sephadex G-25 column (Pharmacia.
(Biotech AB) by gel filtration chromatography. The average number of biotin residues introduced per molecule of rp17 was estimated to be 0.7 from the reduced number of thiol groups.

[Preparation of β-D-galactosidase-rp17] Mercaptoacetyl-rp17 and maleimide-β
-A known method of reacting D-galactosidase [Hashida et al., Journal of Clinical Laboratory Analysis (J. Clin. Lab. Anal.), No. 7.
353, 1993].

[Preparation of biotinyl-bovine serum albumin] N-
A known method of reacting biotinyl-2-mercaptoethylamine [Kono et al., Journal of Clinical.
Laboratory Analysis (J. Clin. Lab. A)
nal. ), Vol. 2, p. 19 (1988)], and biotinyl-bovine serum albumin was prepared. The average number of biotins introduced per bovine serum albumin molecule was 13.

[Preparation of affinity purified rabbit anti-2,4-dinitrophenyl-bovine serum albumin antibody] (1) Purification of rabbit anti-2,4-dinitrophenyl-bovine serum albumin antibody Rabbit anti-2,4-dinitrophenyl-bovine A known method using salting out and ion exchange chromatography from serum albumin antiserum (Shibagoat, Gunma) [Ishikawa et al., Journal of Immunoassay (J. Immunoassa).
y), Vol. 4, p. 209 (1983)]
The 4-dinitrophenyl-bovine serum albumin antibody was purified. (2) Preparation of 2,4-dinitrophenyl-bovine serum albumin Bovine serum albumin into which a thiol group was introduced was subjected to ε via N-succinimidyl-6-maleimidohexanoate.
A known method of reacting N-2,4-dinitrophenyl-L-lysine [Hashida et al., Journal of Clinical Laboratory Analysis (J Clin Lab)
Anal, Vol. 8, p. 86 (1994)] to prepare 2,4-dinitrophenyl-bovine serum albumin. 2, bound per molecule of bovine serum albumin
The average number of 4-dinitrophenyl groups was 6. (3) Preparation of protein-Sepharose 4B 2,4-dinitrophenyl-bovine serum albumin was insolubilized in CNBr-activated Sepharose 4B according to the manual of Pharmacia. (4) Preparation of affinity purified rabbit anti-2,4-dinitrophenyl-bovine serum albumin antibody A rabbit anti-2,4-dinitrophenyl-bovine serum albumin antibody (IgG) solution was applied to a 2,4-dinitrophenyl-bovine serum albumin column. After adsorption, elution is carried out at pH 2.5 [Hashida et al., Analytical Letters (A
nal. Lett. ), Volume 16, Page 31 (198
3) Affinity purification was performed.

[Preparation of Various rp17 Antigen-Insolubilized Polystyrene Beads] The first protein is insolubilized into polystyrene beads (3.2 mm in diameter, Immunochemical, Okayama) by a known method performed by physical adsorption [Ishikawa et al. Scandinavian Journal of Immunology (Scan)
d. J. Immunol), Volume 8 (Supplement 7), Page 43 (1978)], [Hashida et al., Journal of Clinical Microbiology (J. Clin. Micr).
obiol. 33), p. 298 (1995)]
After that, each protein was sequentially reacted and prepared. (1) Bovine serum albumin-streptavidin-MB
Preparation of P-rp17 solid phase Biotinyl-bovine serum albumin (0.1 mg / ml,
Streptavidin (0.1 mg / m2) was added to polystyrene beads in which 0.1 mol / L sodium phosphate buffer (pH 7.5) containing 1 g / L sodium azide was insolubilized.
0.1 mol / l containing 1 g / L sodium azide
L sodium phosphate buffer, pH 7.5) and reacted with buffer C containing 0.1 mol / L sodium chloride. After that, each polystyrene bead was treated with biotinyl-MBP-rp17 (50-1000 fmol / 15).
It was prepared by reacting overnight with 0 μl of a buffer C containing 0.1 mol / L sodium chloride (FIG. 1, A). (2) Bovine serum albumin-streptavidin-rp
Preparation of Solid Phase 17 In (1), instead of biotinyl-MBP-rp17, biotinyl-rp17 (100-4000 fmo)
1) (FIG. 1, B). (3) Preparation of anti-2,4-dinitrophenyl-bovine serum albumin antibody-MBP-rp17 solid phase Affinity purified rabbit anti-2,4-dinitrophenyl antibody (0.1 mg / ml, containing 1 g / L sodium azide .1 mol / L sodium phosphate buffer, pH
7.5) was insolubilized and washed with buffer C containing 0.1 mol / L sodium chloride, and then each polystyrene bead was treated with 2,4-dinitrophenyl-MBP-rp.
17 (50-300 fmol / 150 μl, 0.1 mol
1 / L sodium chloride (buffer solution C) and reacted overnight (FIG. 1, C). (4) Preparation of streptavidin-MBP-rp17 solid phase Streptavidin (5 to 50 μg / ml, 0.1 mol / L sodium phosphate buffer containing 1 g / L sodium azide, pH 7.5) was insolubilized, and .1mol / L
After washing with buffer C containing sodium chloride, each polystyrene bead was washed with biotinyl-MBP-rp.
17 (50-1000 fmol / 150 μl, 0.1 m
ol / L sodium chloride (buffer solution C) overnight and prepared (FIG. 1, D).

[Measurement of β-D-galactosidase activity]
β-D-galactosidase can be measured by a known method using 4-methylumbelliferyl galactoside as a substrate [Imakawa et al., Annals Clinical Biochemistry (A
nn. Clin. Biochem. ), Volume 21, Volume 3
10 (1984)], and the fluorescence intensity of 4-methylumbelliferone produced was measured using a spectrofluorometer (RF-
510, Shimadzu Corporation, Kyoto). The fluorescence value is 1
Correction was performed with the fluorescence intensity of 4-methylumbelliferone of ^10-8 mol / L as 100.

[Measurement of Anti-p17 Antibody in Sample] rp17
The reactivity of the HIV-1 antibody negative sample and the positive sample with various solid phases in which the antigen was insolubilized was examined. Buffer C containing 0.4 mol / L sodium chloride as a negative sample,
As positive specimens were used as the infected person sera were diluted ¹⁰⁴ times with the same buffer. 10 μl of each sample and the same buffer 140
One polystyrene bead in which rp17 was insolubilized by various methods was immersed in a solution containing μl, and reacted at room temperature overnight. The polystyrene beads were washed twice with 2 ml of buffer C containing 0.1 mol / L sodium chloride, then 50 μg of inactive β-D-galactosidase (Mutein, Boehringer Mannheim), β-D-galactosidase-rp17, 100 fmol and 0.4 mol /
The reaction was carried out at room temperature for 3.5 hours in 150 μl of buffer C containing L sodium chloride. After washing the polystyrene beads in the same manner as described above, the activity of β-D-galactosidase bound to the polystyrene beads was measured. Also,
The same assay as described above was performed by reacting various polystyrene beads with a sample solution to which 10 μl of anti-HIV-1 antibody-negative normal serum was added in 150 μl of a reaction solution containing each sample.

When the solid phase was reacted with the anti-HIV-1 antibody-negative sample and the positive serum in each of the cases where no normal serum was contained and in the case where normal serum was not contained, β- Table 1 shows the measured values of the activity of -D-galactosidase. In preparing various rp17-insolubilized solid phases, solid phases were prepared by changing the amount of constituents to be reacted in various ways, and a study was conducted. Table 1 shows that an assay was performed using each of these solid phases. The examples in which the activity value in the most positive specimen showed the highest value among them were described as the measured values in the solid phase of each form.

Comparative Example 1 In this comparative example, the measurement of anti-HIV-1 and p17 antibodies in a sample was carried out using an rp17 solid phase prepared by a conventionally known method. Details of purification and preparation of each substance are the same as those in Example 1 except for the following. [Preparation of various rp17 antigen-insoluble polystyrene beads] (1) Preparation of rp17 solid phase rp17 (1 to 100 µg / ml, 0.1 mol / L sodium phosphate buffer containing 1 g / L sodium azide, pH 7.5) (FIG. 1, E). (2) Preparation of MBP-rp17 solid phase MBP-rp17 (1 to 100 μg / ml, 0.1 mol / L sodium phosphate buffer containing 1 g / L sodium azide, pH 7.5) was reacted and prepared. Figure 1,
F). (3) Preparation of Streptavidin-rp17 Solid Phase Streptavidin (5 to 50 μg / ml, 0.1 mol / L sodium phosphate buffer containing 1 g / L sodium azide, pH 7.5) was insolubilized, and 0.1% was dissolved. 1 mol /
After washing with buffer C containing L sodium chloride, each polystyrene bead was washed with biotinyl-rp17.
(100-40,000 fmol / 150 μl, 0.1
It was prepared by reacting overnight with a buffer C) containing mol / L sodium chloride (FIG. 1, G).

[Measurement of anti-rp17 antibody in sample]
Using the same type of rp17 insolubilized polystyrene beads, the same operation as in Example 1 was performed, and the anti-HIV-
The reactivity of the anti-p17 antibody in one antibody negative sample and the positive sample was examined in a system containing 10 μl of normal serum and a system not containing it. However, the positive sample in the measurement using the rp17 solid phase and the MBP-rp17 solid phase was 0.4% of the serum of the infected person.
It was prepared by diluting 10 ^3-fold with buffer C containing mol / L sodium chloride.

The results are shown in Table 1 together with the results of Example 1. As in Example 1, an example in which the measured value of the most positive specimen showed a high value among the solid phases prepared under various conditions was described as the value of the solid phase in each mode. Since the measurement dilution ratio of the positive sample is partially different depending on the solid phase, the measurement value is shown as a value corrected by multiplying the difference in the dilution ratio so as to be a value uniformly at 10 ³ -fold dilution.

[0038]

[Table 1]

Example 2 In this example, an experiment was conducted on the detection sensitivity of anti-HIV-1 and p17 antibodies in a sample using the solid phase prepared by the method of the present invention. The purification / preparation method of each substance is described in Example 1.
Is the same as [Measurement of anti-p17 antibody in sample] Two types of anti-HIV-1
A sample obtained by serially diluting the antibody-positive serum with the antibody-negative normal pool serum was used as a sample, and the bovine serum albumin-streptavidin-MBP-rp prepared in Example 1 was used as a solid phase.
Using 17 solid phases (FIG. 1, A), anti-HIV-
1. The p17 antibody was detected. Table 2 shows the measured values of each serum sample for each diluted sample. In addition, the measurement results (mean value and standard deviation) obtained by assaying 50 negative sera using the same solid phase as a control are also shown in the table.

Comparative Example 2 In this comparative example, HIV-1, p1 produced by a conventional technique were used.
The same sample as in Example 2 was assayed using the 7 insolubilized solid phase, and a comparative experiment was performed on the detection sensitivity of anti-HIV-1 and p17 antibodies. The purification / preparation method of each substance is the same as in Example 1 and Comparative Example 1. [Western blotting detection of anti-p17 antibody] Western blot kit "HIV-ortho" (Ort
ho Diagnostic Systems, New Jersey, U.S.A.) according to the kit operating instructions.

[Measurement of Anti-p17 Antibody in Sample] Example 2
Rp prepared in Comparative Example 1
Using 17 solid phases (FIG. 1, E), anti-HIV-1,
The p17 antibody was detected. Furthermore, the same sample was subjected to Western blotting, and the presence or absence of the expression of an anti-p17 antibody band was examined. The results are shown in Table 2 along with the results of Example 2. The result of "HIV-ortho" is p
The presence or absence of a reaction to 17 antigens (+,-) was expressed.

[0042]

[Table 2]

Example 3 In this example, the anti-p17 antibody in the HIV-1 positively converted panel serum was measured using the solid phase prepared by the method of the present invention, and the early detection was examined. The purification / preparation method of each substance is the same as in Example 1. [HIV-1 Positive Converted Panel Sera] HIV-1 positive converted panel sera was purchased from North American Biologicals (Florida, USA) and Boston Biomedica (Massachusetts, USA).

[Measurement of anti-p17 antibody in panel serum]
Using the HIV-1 positive converted panel sera as a sample, and using the bovine serum albumin-streptavidin-MBP-rp17 solid phase (FIG. 1, A) prepared in Example 1 as a solid phase, anti-HIV- 1. The p17 antibody was detected. Table 3 shows the measured values of the respective panel sera in the samples on each blood collection day.

Comparative Example 3 In this comparative example, the same sample as in Example 3 was assayed using a commercially available anti-HIV-1 antibody detection kit, and the anti-H
A comparative experiment of the timing of detecting the IV-1 antibody was performed. [Anti-HIV-1 Antibody Detection Kit] As a spread kit for EIA, "RECOMBINANT HIV-1 / HIV-
2 3RD GENERATION EIA "kit (Abbott Laboratories, Illinois, USA) was used as a kit for the agglutination method," Serodia-H ".
The IV kit (Fujirebio, Tokyo) and the kit for Western blotting were the kits of Ortho Diagnostic Systems used in Comparative Example 2. All the measurements were performed according to the operation manual of the kit. The measured value of each kit is the measured absorbance of the EIA kit, the maximum specimen dilution ratio of the agglutination kit showing the agglutination image,
In the Western blot kit, the presence or absence (+,-) of the reaction to each band was represented.

[Detection of anti-HIV antibody in positively converted panel serum] The same HIV-1 positively converted panel serum as in Example 3 was used as a sample, and the anti-HIV antibody was detected using an EIA kit, an agglutination kit and a Western blot kit. A measurement was made. Table 3 shows the measured values of the panel sera in the samples on each blood collection day, along with the results of Example 3.

[0047]

[Table 3]

Example 4 In this example, a sample containing an anti-HIV-1 antibody (positive sample) and a sample containing no anti-HIV-1 antibody (positive sample) were obtained using a solid phase in which the HIV-1 p24 antigen was insolubilized via two or more proteins. The difference in reactivity of the negative sample) was examined in the presence and absence of serum components. The details of the purification and preparation of each substance and the details of the experimental procedure are as follows. [Genetically modified HIV-1, p24 antigen (rp24)
Preparation] The recombinant p24 (rp24) was expressed in Escherichia coli as a fusion protein with MBP in the same manner as in the preparation method of rp17 described in Example 1, and once purified as MBP-rp24, MBP was digested with factor Xa. Prepared.

[Preparation of β-D-galactosidase-rp24] β-D-galactosidase-rp24 was prepared in the same manner as in the aforementioned β-D-galactosidase-rp17. The average number of rp24 bound per molecule of β-D-galactosidase was about 2 molecules.

[2,4-dinitrophenyl-MBP-r
Preparation of p24] 2,4-dinitrophenyl-MB described above
2,4-Dinitrophenyl-MBP-rp24 was prepared in the same manner as for P-rp17. MBP-rp2
4. The average number of 2,4-dinitrophenyl groups introduced per molecule was 2.9.

[Preparation of rp24 antigen-insolubilized polystyrene beads] Affinity purified rabbit anti-2,4-dinitrophenyl-bovine serum albumin antibody (0.1 mg / m2)
0.1g / L containing 1g / L sodium azide
Sodium phosphate buffer, pH 7.5)
After washing with buffer C containing 0.1 mol / L sodium chloride, the polystyrene beads were washed with 2,4-dinitrophenyl-MBP-rp24 (50 to 300 fmol / 1).
It was prepared by reacting overnight with 50 μl of a buffer solution C containing 0.1 mol / L sodium chloride (FIG. 2, H).

[Measurement of Anti-p24 Antibody in Sample] The above-mentioned anti-2,4-dinitrophenyl-bovine serum albumin antibody
Using MBP-rp24 insolubilized polystyrene beads,
The same operation as the method for measuring the anti-p17 antibody in Example 1 was performed, and the anti-HIV-1 antibody negative sample and the positive sample (10 ³
The doubling dilution was tested for the system with and without 10 μl of anti-HIV-1 antibody negative normal serum. The results are shown in Table 4. In addition, the amount of MBP-rp24 is set to 50 to 300 fm.
Table 4 shows examples in which the most positive sample showed a high value among the solid phases prepared by changing the solid phase to ol / 150 μl.

Comparative Example 4 In this comparative example, the measurement of anti-HIV-1 and p24 antibodies was carried out using a rp24 solid phase insolubilized by a conventionally known method. The details of purification and preparation of each substance are as follows, except for the following.
And 4. [Preparation of rp24 antigen-insoluble polystyrene beads] Purified rp24 (5 to 50 µg / ml, 0.1 mol / L sodium phosphate buffer containing 1 g / L sodium azide, pH 7.5) was reacted and prepared (FIG. 2). , I).

[Measurement of Anti-p24 Antibody in Sample]
Example 4 using 24 antigen insolubilized polystyrene beads
The same measurement was performed. The results are shown in Table 4 along with the results of Example 4.

[0055]

[Table 4]

Example 5 In this example, an anti-H enzyme was prepared using a solid phase in which the reverse transcriptase (RT) antigen of HIV-1 was insolubilized via two or more proteins.
The difference in reactivity between a sample containing the IV-1 antibody (positive sample) and a sample not containing the antibody (negative sample) was examined in the presence and absence of serum components. The details of the purification / preparation of each substance and the experimental procedure are as follows. [Preparation of Recombinant HIV-1, RT Antigen (rRT)] Recombinant RT (rRT) is prepared by incorporating an expression plasmid containing a cDNA encoding a protein into Escherichia coli and expressing it, followed by salting out and various column chromatography methods. [Saito et al., Microbiology and Immunology (Microbio)
l. & Immunol. ), 34, 509 (1990)].

[Preparation of 2,4-dinitrophenyl-bovine serum albumin-rRT] (1) Preparation of 2,4-dinitrophenyl-bovine serum albumin Prepared by the method of Example 1. (2) Preparation of 2,4-dinitrophenyl-bovine serum albumin-rRT 2,4-dinitrophenyl-bovine serum albumin having a maleimide group introduced using N-succinimidyl-6-maleimidohexanoate, and N-succinimidyl -S-
A known method for preparing 2,4-dinitrophenyl-bovine serum albumin-rRT by reacting rRT into which a mercaptoacetyl group has been introduced using acetylmercaptoacetate [Hashida et al., Journal of Clinical Laboratory Analysis (J Clin.Lab.Ana
l. ), Vol. 7, p. 353 (1993)].
The average number of rRT bound per molecule of 2,4-dinitrophenyl-bovine serum albumin was about 3.

[Preparation of β-D-galactosidase-rRT] (1) Preparation of mercaptoacetyl-rRT Prepared by the above method. (2) Preparation of maleimide-thiopyridyl-β-D-galactosidase Thiopyridyl-β- using 4,4′-dithiopyridine
After preparing D-galactosidase, a known method for preparing maleimide-thiopyridyl-β-D-galactosidase using N-succinimidyl-6-maleimidohexanoate [Hashinaka et al., Journal of Immunological Methods ( J. Immunol.Method
s), Vol. 172, p. 179 (1994)]. One to two maleimide groups were introduced per molecule of β-D-galactosidase. (3) Preparation of β-D-galactosidase-rRT A known method of reacting mercaptoacetyl-rRT with maleimide-thiopyridyl-β-D-galactosidase to prepare β-D-galactosidase-rRT [Hashinaka et al., Journal. Of Immunological Methods (supra)]. The number of rRT bound per molecule of β-D-galactosidase was 1-2.

[Preparation of rRT antigen-insolubilized polystyrene beads] Affinity-purified rabbit anti-2,4-dinitrophenyl-bovine serum albumin antibody (0.1 mg / mL buffer A) was immobilized on 2,4-polystyrene beads.
Dinitrophenyl-bovine serum albumin-rRT (50
~ 300 fmol, buffer solution A containing 0.1 mol / L sodium chloride was prepared by reaction (Fig. 3, J).

[Measurement of anti-RT antibody in sample]
Using 4-dinitrophenyl-bovine serum albumin-rRT insolubilized polystyrene beads, the anti-p17
The same operation as the measurement of the antibody was performed, and the reactivity of the anti-HIV-1 antibody negative sample and the positive sample was determined by 10 μl of the anti-HIV-1 antibody.
The tests were performed with and without the antibody negative serum. Table 5 shows the measurement results. The amount of 2,4-dinitrophenyl-bovine serum albumin-rRT was adjusted to 50 to 300 fmol.
Table 5 shows examples in which the most positive sample showed a high value among the solid phases prepared in the same manner.

Comparative Example 5 In this comparative example, the measurement of anti-HIV-1 and RT antibodies was carried out using a solid phase in which rRT was insolubilized by a conventionally known method. The details of purification and preparation of each substance are the same as in Examples 1 and 5, except for the following. [Preparation of rRT antigen-insoluble polystyrene beads]
RT (5, 10 μg / mL, 0.1 mol / L sodium phosphate buffer containing 1 g / L sodium azide, p
H7.5) was reacted (FIG. 3, K).

[Measurement of Anti-RT Antibody in Sample]
The same measurement as in Example 5 was performed using antigen-insoluble polystyrene beads. The results are shown in Table 5 along with the results of Example 5.

[0063]

[Table 5]

Example 6 In this example, in the measurement of HIV-1 and p24 antigens in a sample, a positive sample and a solid sample in which an anti-p24 antibody (Fab ') was insolubilized through two or more proteins were used. The difference in reactivity of the negative samples was examined in the presence and absence of serum components. The details of the purification / preparation of each substance and the experimental procedure are as follows. [Preparation of affinity purified rabbit anti-p24 Fab ′]
Anti-p24 antiserum was prepared by immunizing rabbits with rp24 [Hashida et al., Journal of Clinical Microbiology (supra)]. Subsequently, affinity purification of anti-p24 Fab was performed by a series of operations of purification of IgG by salting out and ion exchange chromatography, digestion of Fc fragment by pepsin, affinity purification by rp24-nonspecific rabbit IgG binding column, and reduction by 2-mercaptoethylamine. [Hashida et al., Journal of Clinical Laboratory Analysis (J.
Clin. Lab. Anal. Vol. 10, p. 302 (1996)].

[Preparation of Biotinyl-Bovine Serum Albumin-Affinity Purified Rabbit Anti-p24 Fab '] Bovine serum albumin into which a thiol group was introduced using N-succinimidyl-S-acetylmercaptoacetate and N-succinimidyl-6-maleimidohexanoate Was reacted with biocytin into which a maleimide group was introduced to prepare biotinyl-bovine serum albumin. Further, biotinyl-bovine serum albumin having a maleimide group introduced thereto was reacted with affinity-purified anti-p24Fab 'using N-succinimidyl-6-maleimidohexanoate to prepare biotinyl-bovine serum albumin-affinity-purified anti-p24Fab'.

[Β-D-galactosidase-mouse anti-p
Preparation of 24 Monoclonal Fab ′] Mouse anti-p24 monoclonal antibody was obtained from Innogenetics Inc. (Inno
Genetics, Belgium), and Fab 'was prepared in the same manner as the above polyclonal antibody. Subsequently, a maleimide group was introduced using N, N′-o-phenylenedimaleimide, and then reacted with β-D-galactosidase derived from Escherichia coli to prepare β-D-galactosidase-anti-p24 monoclonal Fab ′. The average number of Fab ′ bound per molecule of β-D-galactosidase was 1.5.

[Preparation of Rabbit Anti-p24 Fab ′ Insolubilized Polystyrene Beads] Streptavidin (0.1 mg / ml, 1 mg / ml) was added to polystyrene beads in which biotinyl-bovine serum albumin (0.1 mg / ml buffer A) was insolubilized.
g / L sodium azide in 0.1 mol / L sodium phosphate buffer, pH 7.5), and further reacted with biotinyl-bovine serum albumin-rabbit anti-p24Fa.
b ′ (buffer A containing 50 to 200 fmol, 0.1 mol / L sodium chloride) was prepared by reaction (FIG. 4,
L).

[Measurement of p24 antigen in sample] 0.4 mo
A solution containing or not containing 50 μl of normal serum per tube in buffer C containing 1 / L sodium chloride was used as a negative sample, and a solution obtained by adding 100 amol of each purified p24 antigen to each was used as a positive sample. The anti-Fab ′ insolubilized polystyrene beads 1
Immersed in an additional 50 μg per tube of inactive β-D
-Galactosidase (Mutein) and 10 fmo
1 β-D-galactosidase-mouse anti-p24Fa
b ′ was added (total volume of the reaction solution was 150 μl), and the mixture was incubated with shaking at room temperature overnight. Subsequently, after washing the polystyrene beads, the activity of β-D-galactosidase bound to the solid phase was measured at 30 ° C. for 1 hour. Table 6 shows the measurement results.

Comparative Example 6 In this comparative example, the measurement of HIV-1 and p24 antigen in a sample was performed using a solid phase in which an anti-p24 antibody (IgG) was insolubilized by a conventionally known method. The details of the purification / preparation of each substance and the experimental procedure are as described in Example 6, except for the following. [Affinity purified rabbit anti-p24 IgG
Preparation of Insolubilized Polystyrene Beads] Affinity purified rabbit anti-p24 IgG (a sodium phosphate buffer containing 0.1 mg / ml, 1 g / L sodium azide, pH
7.5) was reacted (FIG. 4, M).

[Measurement of p24 Antigen in Sample] The same measurement as in Example 5 was carried out using affinity-purified rabbit anti-p24 IgG insolubilized polystyrene beads. The results are shown in Table 6 along with the results of Example 6.

[0071]

[Table 6]

Example 7 In this example, HIV-1,
In the measurement of p24 antigen, the reactivity of a solution containing a certain amount of HIV-1, p24 antigen was determined using a solid phase in which an anti-p24 antibody (Fab ') was insolubilized via two or more proteins as the first solid phase. Was examined in the presence and absence of serum components. The details of the preparation and implementation procedures for each substance are as follows. However, those not particularly described are the same as the method of the sixth embodiment. [Preparation of bovine serum albumin-streptavidin solid phase] In the same manner as in Example 1, biotinyl / bovine serum albumin (30 µg / mL) and then streptavidin (30 µg / mL) were microplated (Maxisorp, Nunc). Insolubilized. The amount of the insolubilized solution used per well was 150 μL.

[Biotinyl affinity purified anti-2,
Preparation of solid phase insolubilized with 4-dinitrophenyl / bovine serum albumin Fab '] In the same manner as in Example 6, biotinyl affinity purified anti-2,4-dinitrophenyl / bovine serum albumin Fab' was converted into bovine serum albumin-
It was insolubilized in a streptavidin-insoluble microplate (FIG. 4, L). The insolubilizing solution used per well is 2p
It was 150 μL containing mol biotinyl Fab ′.
Subsequently, after washing the inside of the wells with buffer C containing 0.1 mol / L sodium chloride, 170 μL of the same buffer containing 75 pmol of biocytin was added to the wells, shaken at room temperature for 2 hours, and allowed to stand for 1 hour. Prepared.

[Measurement of HIV-1, p24 antigen] 0.4
50 μL of a buffer C containing mol / L sodium chloride, 10 μL of the same buffer containing 50 μg of inactive β-D-galactosidase, 10 μL of the same buffer containing 10 fmol of β-D-galactosidase-mouse monoclonal anti-HIV-1, p24Fab ′, 2,4-dinitrophenyl / biotinyl / bovine serum albumin-affinity Purified rabbit anti-HIV-1, 10 μL of the same buffer containing 100 fmol of p24Fab ′ and 10 μL of nonspecific rabbit serum were mixed, and the mixture (90 μL) was mixed with human normal serum or 50 μL of a buffer (buffer C containing 0.15 mol / L sodium chloride) was added, and HIV-1 and p24 antigen 1 were further added.
10 μL of the above buffer solution (0.4 mol / L sodium chloride) containing 00 amol was added, and the mixture was allowed to stand and react at room temperature for 4 hours. Subsequently, after adding 1 μL of deionized water containing 3 pmol of biocytin to this solution, the reaction solution was added to a biotinyl affinity purified anti-2,4-dinitrophenyl / bovine serum albumin Fab ′ insolubilized microplate well, and the mixture was added at room temperature. The reaction was performed by shaking for 1 hour.
After washing the wells with buffer C containing 0.1 mol / L sodium chloride, 150 μL of the same buffer containing 1 mmol / L εN-2,4-dinitrophenyl-L-lysine
Was added and shaken for 30 minutes. After the reaction, the solution was transferred to a microplate well in which bovine serum albumin-streptavidin was insolubilized and shaken at room temperature for 1 hour. After the inside of the well was washed in the same manner as above, the activity of β-D-galactosidase bound to the microplate well was measured for 1 hour. Table 7 shows the fluorescence intensities with and without human normal serum and the ratio (%) between the two.

Comparative Example 7 In this comparative example, the biotinyl affinity-purified anti-2,4-dinitrophenyl / bovine serum albumin Fab ′ insolubilized microplate well used in Example 7 was replaced with the solid phase of Comparative Example 6. Affinity purified anti 2,4
-Biocytin was not added to the immune complex formation reaction using a dinitrophenyl / bovine serum albumin IgG-insolubilized microplate well (Fig. 4, M). Other reagents and operations were the same as in Example 7. Table 7 shows the respective fluorescence intensities with and without the addition of human normal serum and the ratio (%) of the two together with the results of Example 7.

[0076]

[Table 7]

Example 8 In this example, in the measurement of human growth hormone in a sample, an anti-human growth hormone (HGH) antibody (Fab ′) was insolubilized through two or more proteins using a solid phase. The measurement of human growth hormone in serum samples was performed by changing the sample amount. The details of the purification / preparation of each substance and the experimental procedure are as follows. [Preparation of rabbit anti-human growth hormone IgG, F (ab ′) ₂ and Fab ′] Rabbit anti-human growth hormone IgG,
F (ab ') ₂ and Fab' have already been reported [Hashida et al., Endocrinol. Japonica.
an), 35, 171 (1988)] and [Ishikawa et al., Journal of Immunoassay (supra)]. [Preparation of biotinylated rabbit anti-human growth hormone Fab ′] Rabbit anti-human growth hormone Fab ′ (250 μg)
And 0.1 mol / L sodium phosphate buffer containing 5 mmol / L EDTA, pH 6.0, 560 μL and about 1
After mixing 10 μL of 0 mmol / L 6-maleimidohexanoyl-biocytin and incubating at 30 ° C. for 1 hour, small molecules were removed by gel filtration. 6-maleimidohexanoyl-biocytin is 40 mmol / L N-succinimidyl-6-maleimidohexanoate dissolved in N, N-dimethylformamide, 2.5 μl.
L and 2 dissolved in sodium phosphate buffer, pH 7.0
After mixing 7 mmol / L biocytin and 7.5 μL, 30
The mixture was prepared by incubating at 1 ° C. for 1 hour.

[Biotinylated rabbit anti-human growth hormone F
Preparation of ab 'insolubilized polystyrene beads] The protein to be insolubilized was dissolved in a sodium phosphate buffer containing 0.1% sodium azide, pH 7.5. For insolubilization,
Polystyrene beads (3.2 mm in diameter, Immunochemical, Okayama) were immersed in the protein solution and allowed to stand at 4 ° C. overnight to react. Before the second and subsequent insolubilization, the polystyrene beads were washed five times with the same buffer. Biotinylated Fab '
Are 0.1% sodium azide, 1 mg / mL bovine serum albumin, 1 mmol / L magnesium chloride and 0.1% sodium chloride.
0.01 mol / L containing 1 mol / L sodium chloride
It was dissolved in L sodium phosphate buffer, pH 7.0, and 150 μL thereof and one polystyrene bead were allowed to stand at 4 ° C. overnight to be insolubilized (N, O, P in Table 8 and FIG. 5).

[0079]

[Table 8]

[Preparation of monoclonal mouse anti-human growth hormone Fab'-β-D-galactosidase] Monoclonal mouse anti-human growth hormone Fab'-β-
D-galactosidase has already been reported [Hashida et al., Journal
Of Clinical Laboratory Analysis (JC)
lin. Lab. Anal. ), Volume 5, Page 38 (1
991)] and [Ishikawa et al., Journal of Immunoassay (supra)]. [Sandwich Enzyme Immunoassay for Human Growth Hormone in Sample] 0, 2 or 20 μL of human serum and 0.1% sodium azide, 1 mg / mL bovine serum albumin, 1 mm
ol / L magnesium chloride and 0.01 mol / L sodium chloride buffer containing 0.1 mol / L sodium chloride, pH 7.0 to make a total volume of 150 μL, and various biotinylated rabbit anti-human growth hormone Fab ′.
One insolubilized polystyrene bead was added and shaken at room temperature for 2 hours to react. After washing the polystyrene beads with the same buffer, the activity of β-D-galactosidase bound to the beads was measured. Table 9 shows the respective fluorescence intensities and calculated values when measurement was performed on 0, 2, and 20 μL of human serum using various anti-human growth hormone Fab ′ insoluble polystyrene beads.

Comparative Example 8 In this comparative example, human growth hormone in a sample was measured using an anti-human growth hormone antibody (IgG, Fab ′) insolubilized solid phase prepared by a conventionally known method. Of human growth hormone was measured by changing the sample amount. The details of the purification / preparation of each substance and the experimental procedure are as follows. [Biotinylated rabbit anti-human growth hormone Fab ′ insolubilized polystyrene beads and rabbit anti-human growth hormone Ig
Preparation of G-Insoluble Polystyrene Beads] Biotinylated rabbit anti-human growth hormone Fab ′ was insolubilized in streptavidin-insoluble polystyrene beads by the method of Example 8 (Table 8 and FIG. 5, Q). Rabbit anti-human growth hormone IgG was insolubilized in polystyrene beads by the same method as in Example 8 (100 μg / mL) (Table 8 and FIG. 5, R). [Sandwich Enzyme Immunoassay for Human Growth Hormone in Sample] The same measurement as in Example 8 was performed using solid phases Q and R. The results are shown in Table 9 along with the results of Example 8.

[0082]

[Table 9]

[0083]

According to Examples 1 to 8 and Comparative Examples 1 to 8, the following four points were confirmed. (1) Effect of improving specific reaction in the method of the present invention When a solid phase in which an antigen is bound via two or more proteins is used in a specific antibody measurement system, a solid phase produced by a conventional technique is used. Compared with the case, it was confirmed that the reactivity of the antibody was dramatically improved and the specific signal amount was increased. (2) Serum interference suppression effect in the method of the present invention In both measurement systems for antibody measurement and antigen measurement, the use of the solid phase prepared by the method of the present invention is more effective than the case of using the solid phase prepared by the conventional technique. It was confirmed that the decrease in reactivity due to interference was significantly suppressed. (3) Usefulness of anti-p17 antibody measurement in early detection of HIV-1 infection In early detection of HIV-1 infection,
Antibodies were not considered useful markers,
By using the solid phase insolubilized by the method of the present invention,
Anti-p24 antibody and anti-gp of existing anti-HIV antibody measurement kit
The anti-p17 antibody was detected as early as the 160 antibody, confirming its usefulness in early detection. (4) Serum interference suppression effect in immunocomplex transfer method In the immunocomplex transfer method, when the solid phase prepared by the method of the present invention is used as the first solid phase, the solid phase produced by the conventional technique can be used as the first solid phase. It was confirmed that the decrease in reactivity due to serum interference was suppressed as compared with the case where the phase was used.

[0084]

[Brief description of the drawings]

FIG. 1 shows HIV-1 used in Example 1 and Comparative Example 1,
It is the schematic of the rp17 antigen insolubilized solid phase.

FIG. 2 shows HIV-1 and HIV-1 used in Example 4 and Comparative Example 4.
It is the schematic of the rp24 antigen insolubilized solid phase.

FIG. 3 shows anti-HIV- used in Example 5 and Comparative Example 5.
FIG. 1 is a schematic view of a 1, rRT antigen insolubilized solid phase.

FIG. 4 is a schematic diagram of the HIV-1, p24 antibody insolubilized solid phase used in Examples 6 and 7 and Comparative Examples 6 and 7.

FIG. 5 is a schematic view of an anti-human growth hormone (HGH) antibody insolubilized solid phase used in Example 8 and Comparative Example 8.

Claims (9)

[Claims] 1. A solid phase carrier comprising two or two substances (active ingredients) capable of specifically forming an immune complex with a substance to be measured.
A solid phase for immunoassay, wherein the solid phase is indirectly bound via an intermediary substance of at least a molecule. 2. The solid phase for immunoassay according to claim 1, wherein the intervening substance is a protein. 3. The solid phase for immunoassay according to claim 2, wherein the intervening substance is a protein having a molecular weight of 10,000 or more. 4. The solid phase for immunoassay according to claim 3, wherein the active ingredient is a specific antigen. 5. The solid phase for immunoassay according to claim 3, wherein the active ingredient is a specific antibody. 6. The method according to claim 6, wherein the active ingredient is p of human immunodeficiency virus type I.
The solid phase for immunoassay according to claim 4, which is 17 antigen, p24 antigen or reverse transcriptase antigen. 7. The p-type of the human immunodeficiency virus type I as an active ingredient.
The solid phase for immunoassay according to claim 5, which is an antibody against 24 antigens or an antibody against human growth hormone. 8. An immunoassay wherein the solid phase for immunoassay according to claim 1 is used as a first solid phase in an immunocomplex transfer method. 9. An immunoassay kit comprising the solid phase according to claim 1.