JPH1072489A - Removal of n-terminal methionine - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for specifically selectively and efficiently removing an N-terminal methionine corresponding to a replicating coden by reacting an α-diketone with a peptide or a protein (salt) having an N-terminal (oxidized) methionine residue, and then hydrolyzing. SOLUTION: This method for specifically selectively, efficiently and chemically removing an N-terminal methionine residue corresponding to a replicating coden from a peptide and a protein (salt) containing the N-terminal methionine residue, is constituted by reacting the peptide or the salt thereof genetechnologically produced and added with methionine residue which may be oxidized, such as a growth hormone, neurotropin-3, β-cerulein, a parathyroid hormone or interleukin-2, with an α-diketone such as glyoxylic acid in the presence of a metal ion such as copper ion and a base such as pyridine, and then hydrolyzing the product by using a base consisting of a diamine such as o-phenylene diamine or a thio or a selenosemicarbazide.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a method for removing methionine from peptides (including proteins) having a methionine at the N-terminus or salts thereof.

[0002]

2. Description of the Related Art When proteins are biosynthesized in cells,
It is known that its N-terminus begins with methionine, which corresponds to the mRNA start codon AUG. However, since this methionine is removed by subsequent processing, it is usually no longer present in the completed mature protein molecule. Advances in gene recombination technology have made it possible to produce useful proteins using microorganisms and animal cells, for example, Escherichia coli, but the proteins produced by this method have the above-mentioned methionine remaining. Have been found. For example, in human growth hormone expressed in E. coli, the addition rate of methionine is almost 100% [Nature, 293 , 408].
(1981)] and 50% for interferon-α [J. Interferon Res., 1 , 381 (198)
1)] In the non-glycosylated human interleukin-2, in addition to the molecular species that starts with alanine (rIL-2) as in the case of natural human interleukin-2, a molecular species in which methionine is further added to the amino terminus (Met-rIL) −
The presence of 2) has been recognized. On the other hand, as a method for chemically removing the N-terminal amino acid, Dixon described in 1964
When DL-alanylglycine was reacted with glyoxylic acid, pyridine, and copper acetate in 1980, an amino group transfer reaction occurred to produce pyruvoylglycine [Biochemistry Journal (Biochem. J), 92 , 661 (1)
964)], and further report that when a compound is reacted with thiosemicarbazide, cleavage of an amide bond occurs to generate glycine [Biochemistry Journal (Biochem. J), 90 , 2C (1964)]. . Next, this reaction was performed using cytochrome C-551 (Pseudomonas
Application to cytochrome c-551) and reports that N-terminal glutamic acid is removed [Biochemistry Journal (Biochem. J), 94 , 463 (196)
5)]. However, these methods are limited to the removal of the N-terminal amino acid of the synthetic peptide or the mature protein, and there is no example in which the present reaction is effectively used for removing the methionine added to the N-terminus of the recombinant protein.

[0003]

Even if the same protein is used, there is a possibility that the molecular structure in which methionine is added to the N-terminus and the molecular type in which the methionine is not added may differ in the higher-order structure, biological activity and stability of the protein. Yes, and it is also possible that the addition of methionine to the N-terminus may result in increased antigenicity. Therefore, from the viewpoint of industrial use, it is considered significant to establish a method for removing the N-terminal methionine corresponding to this initiation codon. To solve this problem, a method for removing methionine by cyanogen bromide (BrCN) decomposition has been proposed [Science, 19
8 , 1056 (1977)], but in this case, it is premised that methionine residues are not present in the desired mature protein, and it is never satisfied by the method of subjecting proteins to severe chemical reactions. No result is obtained. From a peptide or protein having a methionine residue at the N-terminus,
Regardless of the type of peptide or protein, no chemical method is known that allows the selective and efficient removal of the N-terminal methionine residue, but this is not This is thought to be due to the difficulty in finding a chemical reaction that can remove the N-terminal methionine under mild conditions without denaturing the resulting peptide or protein. In particular, when removing extra methionine added to the N-terminus from a protein having a relatively large molecular weight and produced by genetic engineering, in particular, a protein intended for use as a medicine, the activity of the protein after methionine removal is reduced. It is generally required that the reaction proceed without heating in an aqueous solution of a weakly acidic to a weakly alkaline solution, and the chemical reaction conditions are often limited. It was the present situation that could not be found.

[0004]

Means for Solving the Problems The present inventors have aimed to provide a method for producing a protein having a natural amino acid sequence by cleaving only the N-terminal methionine in a protein produced by genetic engineering. As a result of extensive research, after converting methionine to an α-diketone in a protein to which methionine has been added, an organic diamine was allowed to act,
As a result of diligent efforts to find a method for removing the N-terminal methionine from a protein to which methionine has been added, the α-diketones glyoxylic acid, transition metal An amino group transfer reaction is carried out by reacting copper sulfate capable of donating ions and pyridine which is an amine to convert methionine into an α-diketone body, and further react with o-phenylenediamine which is a diamine to hydrolyze. By performing a decomposition reaction, the N-terminal methionine is removed from the methionine-added peptide or protein, and a method for obtaining a peptide or protein having no methionine added to the N-terminus without reducing its activity has been found. The research was advanced, and the present invention was completed.

Embedded image [In the formula (I), X may be any amino acid residue or a peptide chain having an arbitrary number of amino acids of 2 or more, but from a practical viewpoint, X of the protein produced by genetic engineering is The corresponding part of the peptide chain may be mentioned. In the present specification, when referred to as a protein or a peptide, the peptide or protein comprising a plurality of amino acids may be any of non-glycosylated or glycosylated peptide or protein. ]

That is, the present invention provides: (1) a method comprising reacting a peptide having an optionally oxidized methionine residue at the N-terminus or a salt thereof with an α-diketone, followed by hydrolysis. (2) the method according to the above (1), wherein the peptide having a methionine residue which may be oxidized at the N-terminus is a peptide produced by genetic engineering; (3) genetic engineering The method according to the above (2), wherein the peptide produced in step (2) is a growth hormone, neurotrophin-3, betacellulin, parathyroid hormone or interleukin-2 to which an optionally oxidized methionine residue is added at the N-terminal. (4) the method of the above (1), wherein the α-diketone is reacted in the presence of a transition metal ion; (5) the α-diketone in the presence of a base (6) The method according to (1), wherein α-diketones are reacted in the presence of a transition metal ion and a base; (7) ) The method according to the above (1), wherein the α-diketone is glyoxylic acid or a salt thereof; (8) The method according to the above (4), wherein the transition metal ion is a copper ion; (10) The method according to (1), wherein the hydrolysis is performed using a base; (11) the method according to (10), wherein the base is an amine; (12) a base. Is a diamine or thio or selenosemicarbazide; (13) a method according to (12), wherein the diamine is o-phenylenediamine; End Reacting human growth hormone or a salt thereof with methionine to glyoxylic acid or a salt thereof in the presence of copper sulfate and pyridine, and then reacting with o-phenylenediamine. (15) reacting neurotrophin-3 or a salt thereof produced by genetic engineering and having methionine added to the N-terminus with glyoxylic acid or a salt thereof in the presence of copper sulfate and pyridine; a method for producing neurotrophin-3 or a salt thereof, which is characterized by reacting with o-phenylenediamine; (16) human betacellulin or a salt thereof produced by genetic engineering and having a methionine added to the N-terminus; Or a salt thereof in the presence of copper sulfate and pyridine, followed by o-phenylenediamine. (17) a method for producing human betacellulin or a salt thereof characterized by reacting with human interleukin-2 or a salt thereof, which is produced by genetic engineering and has a methionine added to the N-terminus, and glyoxylic acid or a salt thereof Is reacted in the presence of copper sulfate and pyridine, and then reacted with o-phenylenediamine; (18) a method for producing human interleukin-2 or a salt thereof; Reacting parathyroid hormone or a salt thereof with methionine to glyoxylic acid or a salt thereof in the presence of copper sulfate and pyridine, and then reacting the reaction with o-phenylenediamine or a salt thereof. (19) Formula CH ₃ —S (O) _m — (CH ₂ ) ₂ —CO—CO—X wherein m is 0
And X represents an amino acid residue or a peptide chain. And (20) a method for producing an amino acid, a peptide, or a salt thereof, which comprises hydrolyzing the compound described in (19) above.

In the present specification, a methionine residue which may be oxidized indicates a methionine residue or an S-oxidized form thereof. Examples of the S-oxidized form of the methionine residue include sulfoxides and sulfone forms. Peptides or proteins having an optionally oxidized methionine residue at the N-terminus include those of the formula CH ₃ —S (O) _m — (CH ₂ ) ₂ —CH (NH ₂ ) —CO—X where Represents an integer of 0 to 2, and X represents an amino acid residue or a peptide chain. Which may form a salt, and any salt may be used as long as it does not inhibit the reaction of the present invention, and among them, pharmaceutically acceptable salts Preferably, hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, salts with inorganic acids such as phosphoric acid, acetic acid, phthalic acid, fumaric acid, tartaric acid, maleic acid,
Salts with organic acids such as citric acid, succinic acid, methanesulfonic acid and p-toluenesulfonic acid; alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt; and ammonium salts. .

In the above formula, m is preferably 0. X is preferably a peptide chain having two or more amino acids. Peptides used in the removal method of the present invention include:
Any of a so-called peptide having less than 50 amino acids or a so-called protein having 50 or more amino acids may be used. As described above, in the present specification, the term “peptide” includes not only a molecule having less than 50 amino acids but also a molecule having 50 or more amino acids. (So-called proteins) are preferably used. Preferred peptides include those having 2 to 1000 amino acids,
More preferred are peptides having 15 to 500 amino acids, and specific examples thereof include growth hormone (GH), parathyroid hormone (PTH), insulin, nerve growth factor, brain-derived neurotrophic factor, and ciliary body. Neurotrophic factor, glial-derived neurotrophic factor, neurotrophin-3, 4 or 6, central nerve growth factor, glial growth factor, lung-derived neurotrophic factor, epidermal growth factor, fibroblast growth factor, platelet-derived growth factor , Transforming growth factor α or β, vascular endothelial cell growth factor, tissue plasminogen activator, urokinase, protein C, thrombomodulin, osteogenic factor,
Calcitonin, insulin-like growth factor, interferon-α, β or γ, interleukin-1 (α, β)
~ 12, granule colony stimulating factor, granule macrophage
Colony stimulating factor, granular macrophage stimulating factor, thrombopoietin, erythropoietin, PACAP, atrial natriuretic peptide, endothelin, megakaryocyte growth factor, blood stem cell growth factor, hepatocyte growth factor, motilin, immunotoxin, tumor necrosis factor, hirudin , Corticotropin, angiotensin, angiotensin 2 and its peptide antagonists, angiotensin 3, bradykinins, bradykinin enhancer, α, β or γ endorphin, enkephalin, neutrophil chemotactic factor, gastrin, glucagon, growth hormone releasing factor, Kyorphin, kallidin, gonadotropin releasing hormone, mast cell degranulating peptide, melanocyte stimulating hormone, neurotensin, trypsin inhibitor, oxytocin, proinsulin Emissions C- peptide, secretin, somatostatin, thyrotropin releasing hormone, ubiquitin, urogastrone, vasopressin compounds,
Kinins, tuftsin, somatomedin, corticotropin-releasing factor, insulin-like growth factor, calcitonin gene-related peptide, PTHrP, VIP, DHI, insulinotropin, GRP, CCK-PZ, Galanin (galanin), acatrum peptide (Antrum Peptide), PP
Y, Pancreatic Polypeptide, PSP, Pancreatastatin, hCG, hCS, relaxin, serum thymus factor, thymopoietin, thymosin, factor XIII, factor VIII, prourokinase, SOD, factor VII
a, proteins such as antithrombin and their muteins (one or more amino acids of which are substituted, deleted or added to a naturally-occurring protein, and exhibit a biological or immunological activity equivalent to or greater than that of the naturally-occurring protein) Or a known or novel peptide produced by chemical synthesis or the like. Among them, a protein produced by genetic engineering, especially a protein produced by genetic engineering,
Growth hormone, neurotrophin-3, betacellulin, parathyroid hormone, interleukin-2, etc., to which an optionally oxidized methionine is added at the N-terminus, are preferably used. The above-mentioned natural protein may be derived from any animal species, but practically, human-derived protein is preferably used.

[0008] In this specification, alpha-ketones may be any ones which are capable of advancing the amino group transfer reaction of a peptide or a salt thereof described above, for example wherein R ¹ -CO
—CO—R ² wherein R ¹ represents hydrogen or a lower alkyl or a phenyl group (preferably hydrogen or methyl, more preferably hydrogen) which may be substituted with a carboxyl group, and R ² represents a hydroxyl group or a lower alkoxy group; And an amino group (preferably a hydroxyl group) which may be substituted with a group or lower alkyl. Or a salt thereof. In the above formula, examples of the lower alkyl group represented by R ¹ include an alkyl group having about 1 to 6 carbon atoms such as methyl, ethyl, propyl, i-propyl, butyl, i-butyl, sec-butyl and t-butyl. Examples of the lower alkoxy group represented by R ² include alkoxy groups having about 1 to 6 carbon atoms such as methoxy, ethoxy, propoxy, i-propoxy, butoxy, i-butoxy, sec-butoxy and t-butoxy. Is mentioned. Examples of the amino group optionally substituted with lower alkyl represented by R ² include the amino group optionally having one or two lower alkyl groups represented by R ¹ . Further, examples of the salt include those similar to the above-mentioned salt of the peptide or protein. α
-Specific examples of the ketones include glyoxylic acid, pyruvic acid, oxalacetic acid, phenylglyoxylic acid, 2-oxoglutaric acid, and among them, glyoxylic acid is preferably used.

The transamination reaction between a peptide having a methionine residue which may be oxidized at the N-terminus or a salt thereof and an α-diketone is usually carried out with a peptide or a salt thereof.
1 to 10,000 mol (preferably 2000
Α-diketones at about 0 to 70 ° C. (preferably about 20 to 40 ° C.) for about 5 minutes to 2 hours (preferably about 15 minutes to 1 hour). Any buffer that does not inhibit the above transamination reaction (eg, phosphate buffer,
Acetate buffer, citrate buffer, etc.)
Among them, an acetate buffer is preferably used. The pH of the reaction is about 2 to 9, especially about 4 to 7,
In particular, the reaction is preferably adjusted to about 5 to 6, and the reaction is allowed to proceed under conditions where the peptide having a methionine residue which may be oxidized at the N-terminus or a salt thereof is not denatured.
In order to promote the transamination reaction, it is preferable to react α-diketones in the presence of a transition metal ion,
Usually, 0.001 to 0.1 mol (preferably 0.01 to 0.05 mol) per mol of α-diketones.
It is preferred to use a degree of transition metal ion. Examples of the transition metal ions include copper ions (Cu ⁺ , Cu ²⁺ ), cobalt ions (Co ²⁺ , Co ³⁺ ), and nickel ions (Ni ²⁺ ,
Ni ³⁺ ), iron ions (Fe ²⁺ , Fe ³⁺ ), zinc ions (Z
n ²⁺ ), aluminum ion (Al ³⁺ ), manganese ion (Mn ²⁺ etc.), gallium ion (Ga ³⁺ ), indium ion (In ³⁺ ), magnesium ion (Mg ²⁺ ), calcium ion (Ca ²⁺ ) can be used, and among them, copper ions, cobalt ions and the like, particularly, copper ions (Cu ²⁺ ) are preferably used. These transition metal ions are usually added to the reaction solvent as a salt with an inorganic acid such as sulfuric acid, nitric acid, hydrochloric acid, or perchloric acid or a salt with an organic acid such as acetic acid, oxalic acid, citric acid, or carbonic acid. Can be
Among them, copper sulfate and copper acetate, particularly copper sulfate, are preferably used.

It is preferable to react the α-diketone in the presence of a base. It is preferred to use about) bases. Examples of the base include alkylamines such as triethylamine and tributylamine, N, N-dimethylaniline,
Aromatic amines such as pyridine, lutidine, collidine, 4- (dimethylamino) pyridine, and imidazole, and organic bases such as urea can be used. Among them, aromatic amines, particularly, pyridine are preferably used. .

Further, in the transamination reaction described above, it is preferable to react α-diketones in the presence of a transition metal ion and a base. A mixture containing components (for example, copper sulfate, pyridine and glyoxylic acid) is added to an aqueous solution containing a peptide having a methionine residue which may be oxidized at the N-terminus or a salt thereof, and transamination is performed. Allow the reaction to proceed. Obtained by the transamination reaction and having the formula CH ₃ —S (O) _m — (CH ₂ ) ₂ —CO—CO—X wherein m represents an integer of 0 to 2, X represents an amino acid residue or 2 shows a peptide chain. Is a novel compound, and is isolated and purified from a reaction solution by a known means for purifying a peptide or protein, for example, extraction, salting out, partitioning, recrystallization, chromatography and the like. However, it can be directly subjected to the next hydrolysis reaction. The diketone obtained by transamination is
Usually, it can be converted to an amino acid, a peptide or a salt thereof from which the optionally oxidized methionine residue at the N-terminal has been removed by hydrolysis reaction with a base.

Examples of the base used in the hydrolysis reaction include alkylamines such as cysteamine, triethylamine and tributylamine, N, N-dimethylaniline, pyridine, lutidine, collidine, 4- (dimethylamino) pyridine and imidazole. Aromatic amines,
Diamines such as o-phenylenediamine, tolylene-3,4-diamine, 3,4-diaminobenzoic acid, 2,3-diaminophenol, 4-chloro-o-phenylenediamine (preferably aromatic diamines, especially , O-
Phenylenediamines), thiosemicarbazide, acetone thiosemicarbazide, thiosemicarbazides such as phenylthiosemicarbazide, selenosemicarbazide, selenosemicarbazides such as acetone selenosemicarbazide, and the like amines, among which amines, Particularly, diamines or thiosemicarbazides are preferably used, and o-phenylenediamine is particularly preferably used.

The amount of the base is usually about 1 to 10,000 mol, preferably about 500 to 2 mol per mol of the diketone compound.
000 mol. Usually, the hydrolysis reaction is preferably carried out at about 0 to 70 ° C (preferably about 20 to 40 ° C) for about 1 to 50 hours (preferably about 10 to 25 hours). In the reaction, a buffer is preferably used as a solvent, and examples of the buffer include a phosphate buffer, an acetate buffer, and a citrate buffer. Any buffer may be used as long as it does not inhibit the above-mentioned hydrolysis reaction, and among them, an acetate buffer is preferably used. The pH of the reaction is adjusted to about 2 to 9, especially about 3 to 7, especially about 4 to about 6 under neutral conditions so that the obtained amino acid, peptide or salt thereof is not denatured. It is better to proceed. The amino acid, peptide or salt thereof thus obtained can be isolated and purified from the reaction solution by known purification means, for example, extraction, salting out, partitioning, recrystallization, chromatography and the like, but is preferable. For example, for example, SP-Sepharose (Pharmacia Biotech)
Co., Ltd.) or a purification method by ion exchange chromatography through DEAE-5PW (Tosoh Corporation).

The polypeptide produced according to the present invention has no methionine at the N-terminus and is obtained as having the same amino acid sequence as the naturally-occurring biologically active polypeptide. It has low toxicity and can be safely used as pharmaceuticals and diagnostic agents. According to the present invention, N-terminal methionine can be specifically removed from a peptide to which methionine has been added. In the description of the present invention and in the drawings, when an abbreviation such as an amino acid is used, the IUPAC-IUB Commission on Bio
Abbreviations based on chemical nomenclature or conventional abbreviations in the field, examples of which are shown below. When amino acids have optical isomerism, L-form is shown unless otherwise specified.

SDS: sodium dodecyl sulfate Gly: glycine Ala: alanine Val: valine Leu: leucine Ile: isoleucine Ser: serine Thr: threonine Cys: cysteine Met: methionine Glu: glutamic acid GlnA: glutamic acid GlnA Lysine Arg: Arginine His: Histidine Phe: Phenylalanine Tyr: Tyrosine Trp: Tryptophan Pro: Proline Asx: Asp + Asn Glx: Glu + Gln

[0016]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described more specifically with reference to the following reference examples and examples, but the present invention is not limited to these examples.

【Example】

Reference Example 1 Production of Met-rhGH: Met-rhGH was produced according to the method described in Reference Example 4 of JP-A-62-171699. (I) Producer Bacterium Escherichia coli K12 @ 1776 /
pHGH 107 (ATCC 31538) was used. (Ii) Culture Transformant Escherichia coli K12 χ1776 / p
HGH 107 (ATCC 31538, IFO 14
505) to 2L Meyer Bacto Tripton 1%,
Bacto yeast 0.5%, salt 0.5%, tetracycline / hydrochloric acid 10mg / L, ampicillin sodium 10m
g / L, thymine 20 mg / L and diaminopimelic acid 10
One liter of a liquid medium (pH 7.0) containing 0 mg / L was inoculated and cultured at 37 ° C. overnight with rotary shaking. This culture solution was treated with 1.68% sodium monohydrogen phosphate and 0.5% potassium dihydrogen phosphate.
30%, ammonium chloride 0.10%, salt 0.05%,
Antifoam 200mg / L, glucose 1.00%, casamino acid 1.00%, magnesium sulfate 246mg / L, tetracycline / hydrochloric acid 10mg / L, ampicillin / sodium 1
Transfer to a 50-L jar fermenter containing 20 L of a liquid medium (pH 6.8) containing 0 mg / L, thymine 20 mg / L and diaminopimelic acid 100 mg / L.
The cells were cultured with aeration and stirring for 0 hours. The culture was centrifuged to collect the cells.

Reference Example 2 2 kg of the wet cells obtained in Reference Example 1 were taken out and 8 M
50 mM Tris-HCl buffer containing guanidine hydrochloride (pH
8.0) 6 L was added, and the mixture was thoroughly stirred until the cells no longer clumped to dissolve the cells, followed by centrifugation (10,000 rpm,
(60 minutes) to obtain about 6 L of bacterial cell extract. About 70 L of a 10 mM Tris-HCl buffer (pH 7.
0) was dialyzed twice, and ammonium sulfate was added to about 9 L of the inner dialysis solution obtained after completion of the dialysis so that the final concentration was 20% saturated ammonium sulfate, and the mixture was centrifuged (4,200 rpm, (60 minutes) to obtain about 10 L of a centrifuged supernatant. The supernatant is passed through a phenyl-Toyopearl 650C column (5 cmφ × 50 cm) in two portions,
After adsorption and washing, 10 mM Tris-HCl buffer (pH 7.0) containing 40% saturated ammonium sulfate and 10 mM
Elution was performed by a concentration gradient elution method with a Tris-HCl buffer (pH 7.0), and the Met-rhGH fraction was collected and dialyzed against a 50 mM sodium hydrogencarbonate solution (pH 8.2).
The obtained dialysis solution is centrifuged (4,200 rpm, 45 minutes)
Then, about 3.7 L of the centrifuged supernatant was obtained. The supernatant was divided into four times and a DEAE-Toyopearl 650M column (4 cmφ) was used.
× 50 cm), adsorbed and washed, and then a 10 mM sodium hydrogen carbonate solution (pH 8.2) and a 10 mM sodium hydrogen carbonate solution (pH 8.2) containing 1 M sodium chloride.
Met-rhGH was eluted by the concentration gradient elution method described in 2), and the collected Met-rhGH fraction was dialyzed against a 50 mM sodium hydrogen carbonate solution (pH 8.2). About 1.2 L of the obtained dialysis solution was applied to a DEAE-5PW column (55 mm).
φ × 20 cm, Tosoh) and 10 mM sodium hydrogen carbonate solution (pH 8.2) and 1 M sodium chloride
It was adsorbed and eluted by high performance liquid chromatography using a concentration gradient elution method with a 0 mM sodium hydrogen carbonate solution (pH 8.2) to obtain about 600 ml of a Met-rhGH fraction. This solution was converted to Amicon Diaflow (YM-10 membrane,
76mmφ, Amicon Co.)
94 ml of a 100 mM sodium bicarbonate solution (pH 8.
Toyopearl HW-50F column (8 cm) equilibrated in 2)
Gel filtration was performed using (φ × 50 cm) to obtain a Met-rhGH fraction. Then, the Milex GV filter (0.22
μm, Millipore) and 869 mg of Met-rhGH
I got

Example 1 50 mg of human growth hormone (Met-rhGH) obtained by adding methionine to the N-terminus obtained in Reference Example 2 was lyophilized and dissolved in 40 ml of 50 mM phosphate buffer (pH 8.0). Thereafter, a mixed solution of 5 ml of 0.1 M copper sulfate, 2.3 g of glyoxylic acid and 5 ml of pyridine was added, and the mixture was reacted at 25 ° C. for 1 hour.
After completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (25 mm ID × 600 mL) equilibrated with a 2 M acetic acid-2 M sodium acetate solution, and the solution used for the equilibration was flowed at a flow rate of 6 ml / min. It was developed and the diketone body fraction of Met-rhGH was pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 20 mM,
After degassing and sealing with nitrogen gas, the reaction was carried out at 37 ° C. for 20 hours. After completion of the reaction, the reaction solution was equilibrated with 20 mM Tris-HCl buffer (pH 8.0), and Sephadex G-25 was equilibrated.
The solution was passed through a column (25 mm ID × 600 mm L), the buffer used for equilibration was developed at a flow rate of 6 ml / min, and the human growth hormone (rhGH) fraction without methionine added to the N-terminal was pooled. The pooled rhGH fraction was DEAE-5P equilibrated with 20 mM Tris-HCl buffer (pH 8.0).
W (21.5mmID × 150mmL)
0% B (B = 20 mM Tris-HCl buffer + 1M NaCl,
Elution was performed with a step gradient of pH 8.0) for 30 minutes at a flow rate of 8.5 ml / min, and the rhGH fractions were pooled. In addition, 5%
Toyopearl HW-50 equilibrated with ethanol (20 mm
After passing the rhGH fraction through (ID × 600 mL) (Tosoh Corp.), the solution used for equilibration was developed at a flow rate of 6 ml / min. The rhGH fraction was pooled, freeze-dried, and then subjected to rhG
A lyophilized powder of H was obtained.

Example 2 (Characterization of rhGH) a) Analysis using SDS polyacrylamide gel electrophoresis The rhGH obtained in Example 1 was converted into a sample buffer [Laemmli,
Nature, 227 , 680 (197
0)], heated at 100 ° C. for 1 minute with 100 mM DTT, and electrophoresed on Multigel 10/20 (Daiichi Pure Chemicals Co., Ltd.). When the gel after electrophoresis was stained with Coomassie brilliant blue, a single band of protein was recognized, and the purified product was almost single. The results are shown in FIG. [Fig. 1]
In Lanes 1-3, rhGH (3 μg), blank and molecular weight markers are shown. b) N-terminal amino acid sequence analysis The N-terminal amino acid sequence of rhGH obtained in Example 1 was determined using a gas-phase protein sequencer (Applied Biosystems Model 477A). as a result,
The N-terminal amino acid sequence of the obtained rhGH coincided with the N-terminal amino acid sequence of rhGH deduced from the nucleotide sequence of the cDNA. The results are shown in [Table 1].

[Table 1]

C) Amino acid composition analysis Using about 20 μg of rhGH obtained in Example 1, the amino acid composition was measured with an amino acid analyzer (Beckman System 63).
00E). As a result, the rhGH cDNA
And the amino acid composition deduced from the nucleotide sequence of The results are shown in [Table 2].

[Table 2] d) C-terminal amino acid analysis Using 15 nmol of rhGH obtained in Example 1,
Terminal amino acids were determined with an amino acid analyzer (Beckman System 6300E). This coincided with the C-terminal amino acid deduced from the nucleotide sequence of the rhGH cDNA. The results are shown in [Table 3].

[Table 3]

Example 3 (Measurement of rhGH activity) "Journal of Clinical" using Nb2 cells
End Clinology and Metabolism (Journal of
Clinical Endocrinology & Metabolism), 51 , 1
058 (1980) ".
The purified rhGH product obtained in Example 1 had almost the same activity as the standard product.

Reference Example 3 Production of Met-NT-3: Met-NT-3 was produced according to the methods described in Reference Examples 1-3 and Examples 1-2 of Japanese Patent Application No. 8-74775. . (1) Cloning of NT-3 DNA Human glioma-derived λgt11 in E. coli Y1090
cDNA library (Clontech Laboratories, In
c.), about 6 × 10 ⁵ phages
ZCY medium (Molecular Cloning, A Laboratory Manua
l, Clod Spring Harbor Laboratory, 1982)
The seedlings were cultured at 37 ° C. for 5 hours. Next, a nylon membrane was placed on the plate, left for 1 minute, and then removed from the plate. This nylon membrane was treated with 0.5M NaOH-1.5M Na.
Cl followed by 1.5M NaCl-0.5M Tris-HCl p
H8.0, and further 2 × SSC [Molecular Clonin
g, A Laboratory Manual, supra).
It was left at 80 ° C. for 2 hours. A probe is prepared by chemically synthesizing DNA (about 0.38 kb) encoding human βNGF [Nature, 303 , 821 (1983)] and labeling with [α- ³² P] dCTP by nick translation. did. Using the nylon membrane and probe obtained above, Molecular Cloning, A
Laboratory Manual, Clod Spring Harbor Laboratory,
Hybridization was performed according to the method described in 1982. That is, the nylon membrane was immersed in a hybridization solution containing a probe and kept at 65 ° C. for 16 hours. The nylon membrane was treated at room temperature with 2 × SSC-0.1%
After washing with SDS, 1 × SSC-
Washed with 0.1% SDS. Next, a positive clone was obtained by autoradiography. The cDNA was cut out from the thus obtained clone λβGN1321 with EcoRI, and inserted into the EcoRI site of plasmid pUC118 (Takara Shuzo Co., Ltd.) to obtain plasmid pUNK5.

(2) Construction of NT-3 expression vector for Escherichia coli The NT-3 cDNA inserted into the plasmid pUNK5 obtained in Reference Example 3 (1) contains the 11th N-terminal of NT-3. ScaI was found near the tyrosine residue coding region.
The site is located N base 50 bases downstream of the stop codon of NT-3.
There is a siI site. Therefore, 0.3 kb from pUNK5
The ScaI-NsiI fragment was isolated and the adapter NGF
TE-1 (35mer), NGFTE-2 (33mer), N
After ligating GFTE-3 (7mer) and NGFTE-4 (15mer) with T4 DNA ligase, the restriction enzymes NdeI and B
Treatment with amHI yielded a 0.3 kb NdeI-BamHI fragment. The adapter is shown below. NGFTE-1: 5 'TATGTACGCGGAGCATAAGAGTCACCGAGGGGAGT 3' 35mer (SEQ ID NO: 1) NGFTE-2: 5 'ACTCCCCTCGGTGACTCTTATGCTCCGCGTACA 3' 33mer (SEQ ID NO: 2) NGFTE-3: 5 'TGCCAGG 3' 7mer NGFTE-4: 5 ' GATCCCTGGCATGCA 3 ′ 15mer (SEQ ID NO: 3) On the other hand, an expression vector pET- having a T7 promoter
3C [Rosenberg et al., Gene, 56 , 12
5 (1987)] was cut with NdeI and BamHI, and 4.4 k
b The NdeI-BamHI fragment was isolated. The 4.4 kb NdeI-BamHI fragment obtained above and 0.3 kb NdeI-B
After ligating the amHI fragment with T4 DNA ligase, Esch
E. coli DH1 / pEN, and the resulting ampicillin-resistant transformant [Escherichia coli DH1 / pEN
GFT103] was isolated from pENGFT.
103.

(3) Production of Met-NT-3 for E. coli NT-3 expression vector pEN obtained in Reference Example 3 (2)
Using Escherichia coli MM294 (DE3) [Mo
lecular Endocrinology, 4 , 869 (1990)], and transformants E. coli MM294 (D
E3) / pLysS, pENGFT103 (IFO 159
32, FERM BP-5483). Transformant
E. coli MM294 (DE3) / pLysS, pENGF
LB medium containing 50 μg / ml ampicillin and 15 μg / ml chloramphenicol [1% peptone,
The mixture was shake-cultured in a 2 liter flask containing 1 liter of 0.5% yeast extract and 0.5% sodium chloride at 30 ° C. for 8 hours. The resulting culture was added to 20 liters of the main fermentation medium [1.68% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1% ammonium chloride, 0.05% sodium chloride, 0.05%]. % Magnesium sulfate, 0.02%
Transplanted into a 50-liter fermenter containing defoamer, 0.00025% ferrous sulfate, 0.0005% thiamine hydrochloride, 1.5% dextrose, 1.5% casamino acid] and aerated at 30 ° C. Agitation culture was started. When the turbidity of the culture broth reached about 500 Klet units, 100 mg / L of isopropyl-β-D-thiogalactopyranoside (IPTG) was added, and the culture was further continued. After 7 hours, the culture was terminated. did. The culture termination liquid was centrifuged to obtain about 340 g of wet cells, which were stored frozen at -80 ° C.

(4) Production of Met-NT-3 for Escherichia coli (mass production) The above transformant E. coli MM294 (DE3) / pLy
sS, pENGFT103 was placed in a 2 liter flask containing 1 liter of LB medium (1% peptone, 0.5% yeast extract, 0.5% sodium chloride) containing 50 μg / ml ampicillin and 15 μg / ml chloramphenicol. 30
The cells were cultured with shaking for 16.5 hours. The obtained culture solution is
0 liter of LB medium [0.02% antifoam, 50 μg / ml
Ampicillin and 15 μg / ml of chloramphenicol) were fed into a 50-liter fermenter and cultured at 30 ° C. for 7 hours with aeration and stirring. This culture was added to 3
60 liters of main fermentation medium [1.68% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1% ammonium chloride, 0.05% sodium chloride, 0.05% magnesium sulfate, 0.05% Transplanted into a 500-liter fermenter charged with 02% antifoaming agent, 0.00025% ferrous sulfate, 0.0005% thiamine hydrochloride, 1.5% dextrose, 1.5% casamino acid] at 30 ° C. To start aeration and agitation culture.
When the turbidity of the culture reaches about 500 klet units,
100 mg / L of isopropyl-β-D-thiogalactopyranoside (IPTG) was added, and the culture was further continued.
After 5.5 hours, the culture was centrifuged to obtain about 6 kg of wet cells, which were stored frozen at -80 ° C.

(5) Activation of Met-NT-3 40 g of the wet cells obtained in Reference Example 3 (3) were taken out.
The cells were suspended by adding 240 ml of 10 mM EDTA (pH 7.0), and the cells were disrupted by sonication using a Sonifier 450 (Branson) under ice-cooling, and centrifuged (10000 rpm, 1 hour). Was done. The obtained pellets were washed by performing the same operation twice. Then 50
160 ml of mM Tris-hydrochloric acid / 4 M urea / 5 mM dithiothreitol (DTT) (pH 8.0) was added and homogenized, followed by centrifugation. After dissolution, centrifugation was performed to separate the supernatant and the sediment, and the same operation was performed again on the sediment, and the obtained supernatant and the previously obtained supernatant were mixed, and 240 ml of the supernatant was mixed. Was obtained. This solution was diluted by adding 760 ml of 100 mM acetic acid solution, and passed through a Sephadex G-25 column (11.3 cmφ × 50) also equilibrated with 100 mM acetic acid.
1640 ml of a modified Met-NT-3 solution from which urea had been removed was obtained. This solution was allowed to stand at 4 ° C. for 2 days, and then 8.5 mM by adding 50 mM phosphate buffer / 12.5% sucrose (pH 6.8).
L and p with 5M sodium hydroxide or concentrated phosphoric acid.
H was adjusted to 6.0, and the mixture was allowed to stand again at 4 ° C. for 2 days for activation. After standing, 200 mM copper sulfate was added to a final concentration of 10 μM, and after stirring, the mixture was again left at 4 ° C. for 2 days in order to continue activation.

(6) Purification of Met-NT-3 The solution that had been activated in Reference Example 3 (5) was treated with 100 mM
SP-Sepharose Fast Flow column (2.5 cmφ) equilibrated with phosphate buffer / 0.1% 3-[(3-cholamidopropyl) dimethylammonio] -1-propanesulfonate (CHAPS) (pH 6.0) × 12 cm, Pharmacia Biotech), and after adsorption, 200 ml of 100 mM phosphate buffer / 0.1% CHAPS / 200 m
Wash the column with M sodium chloride (pH 6.0), then 100 mM phosphate buffer / 0.1% CHAPS / 400
Elution with mM sodium chloride (pH 6.0) was performed using Met-NT.
An eluate containing -3 was obtained. This eluate is referred to as Resource 1
After adsorbing on a 5RPC column (2 cmφ × 30 cm, Pharmacia Biotech), 16% acetonitrile /
0.1% TFA and 36% acetonitrile / 0.1% TF
Elution was performed by the concentration gradient elution method using A, and the eluate was freeze-dried to obtain about 28 mg of a white powder of Met-NT-3.

Example 4 Glyoxylic acid 9 was added to a solution of 50 mg of Met-NT-3 obtained in Reference Example 3 (6) dissolved in 4.6 ml of distilled water.
2.5 mg, 200 μl of pyridine, 100 mM copper sulfate solution 2
A solution mixed with 00 μl was added, and the mixture was stirred gently and allowed to stand at room temperature for 15 minutes to react. After completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (2.5 cmφ × 59 cm) equilibrated with 2 M acetate buffer (pH 4.9) to collect 36 ml of the diketone of Met-NT-3. Was. 78 mg of o-phenylenediamine was added to this solution,
After reaction for 15 hours, the reaction-terminated liquid was treated with Sephadex G-2 equilibrated with 2 M acetate buffer (pH 4.9).
The solution was passed through 5 columns (2.5 cmφ × 59 cm) and the obtained N
The NT-3 fraction obtained after purifying 75 ml of the T-3 fraction by HPLC using a ODP-50 column with a gradient elution method using 0.1% TFA and 0.1% TFA / 80% acetonitrile was used. The freeze-dried fraction was freeze-dried to obtain a freeze-dried powder of NT-3.

Example 5 (Determination of characteristics of NT-3) a) Analysis using SDS polyacrylamide gel electrophoresis The NT-3 obtained in Example 4 was used as a sample buffer [Laemml].
i, Nature, 227 , 680 (197
0)], heated at 100 ° C. for 1 minute with 100 mM DTT, and electrophoresed on Multigel 10/20 (Daiichi Pure Chemicals Co., Ltd.). When the gel after electrophoresis was stained with Coomassie brilliant blue, a single band of protein was recognized, and the purified product was almost single (FIG. 2).
In FIG. 2, Lanes 1-2 show molecular weight markers and NT-3.

B) Analysis of N-terminal amino acid sequence Analysis of the N-terminal amino acid sequence of NT-3 obtained in Example 4 was carried out using the gas-phase protein sequencer 477A (model 4).
77A, Applied Biosystems). As a result, the N-terminal amino acid sequence of NT-3 obtained coincided with the N-terminal amino acid sequence of NT-3 deduced from the nucleotide sequence of cDNA. The results are shown in [Table 4].

[Table 4]

C) Amino acid composition analysis Using about 20 μg of NT-3 obtained in Example 4, the amino acid composition was measured with an amino acid analyzer (System 6300E,
Beckman). As a result, NT-3
It was in good agreement with the amino acid composition deduced from the cDNA base sequence. The results are shown in [Table 5].

[Table 5]

D) Analysis of C-terminal amino acid Using 15 nmol of NT-3 obtained in Example 4, the C-terminal amino acid was analyzed with an amino acid analyzer (System 6300).
E, Beckman). As a result, NT-
The amino acid sequence was identical to the C-terminal amino acid deduced from the nucleotide sequence of the cDNA of No. 3. The results are shown in [Table 6].

[Table 6]

Reference Example 4: Production of Met-human BTC Met-human BTC was produced according to the method described in Examples 4 to 6, 8 and 13 of JP-A-6-87894. (1) Construction of Escherichia coli Human BTC cDNA Expression Plasmid A 0.6 Kb EcoRI-BamHI fragment encoding mature human BTC (1-147 amino acid residues) was prepared as described in
87894, plasmid pTB151 described in Example 5
5 isolated. ATG translation initiation codon (SEQ ID NO: 4:
5'TATGGATGGG 3 '; SEQ ID NO: 5: 5'A
After ligating a synthetic adapter having ATTCCCATCCA 3 ′) to the EcoRI site of the above 0.6 Kb fragment,
The resulting 0.6 Kb NdeI-BamHI fragment was inserted into plasmid pET-3c containing the T7 promoter (Gene, 56 , 125 (1987)) and the plasmid pT
B1505 was constructed. 80 amino acid residues of human BTC (Fig. 10-1 to
2] (from 1 (Asp) to 80 (Tyr)), a plasmid pTB1 was used as a template.
505, two oligonucleotides as primers (SEQ ID NO: 6: 5 'ATACATATGGATGGGA
ATTCCA 3 '; SEQ ID NO: 7: 5' CCGGATC
CTAGTAAAACAAGTTCACTCT 3 ')
Was used to perform PCR. The product was purified with NdeI and BamHI.
And fractionated by 2.0% agarose gel electrophoresis.
The desired 0.25 Kb DNA fragment was isolated. This 0.
The 25 Kb NdeI-BamHI fragment was ligated with pET-3c T7
It was ligated and inserted downstream of the promoter with T4 DNA ligase to obtain plasmid pTB1516 (JP-A-6-87894).
Of FIG. 13).

(2) Expression of human BTC in E. coli E. coli MM294 was lysogenized with lambda phage (Studier, Supra) recombined with the T7 phage RNA polymerase gene. Thereafter, this plasmid pLysS was introduced into E. coli MM294 (DE3) to obtain E. coli MM294 (DE3) / pLysS.
The plasmid pTB obtained in Reference Example 4 (1) was added to the cells.
1516, whereby E. coli MM294 was introduced.
(DE3) / pLysS, pTB1516 was obtained. This transformed cell E. coli MM294 (DE3) / pLysS, p
TB1516 was deposited on April 21, 1992 with the Accession No. FERM BP-3836 at the Research Institute of Microorganisms, Ministry of International Trade and Industry of the Ministry of International Trade and Industry, and
Deposited with the IFO as accession number IFO 15282 by date.

(3) BT produced from recombinant E. coli
Purification of C E. coli MM294 (DE obtained in Reference Example 4 (2))
3) After culturing / pLysS and pTB1516 overnight, the culture solution was inoculated into an LB medium so as to be diluted 20-fold.
After culturing at 37 ° C. for 2 hours, IPTG was added to a final concentration of 0.1 mM, and the cells were further cultured for 3 hours. The cells were collected by centrifugation and stored at -20 ° C until use. Thaw a cell stock equivalent to 5 liters of culture and ice-cold 50 mM Tr.
is · HCl (pH 7.4), 10 mM EDTA-0.2M
The suspension was suspended in 300 ml of a buffer containing NaCl, 10% sucrose and 1 mM APMSF. Egg white lysozyme 4
After dissolving 0 mg and incubating at 4 ° C. for 2 hours, sonication was performed and centrifuged at 20,000 × g for 1 hour to obtain a supernatant. After passing the supernatant through a 200 ml Q-Sepharose svet, TCA was added to a final concentration of 4%, and the mixture was allowed to stand at 40 ° C for 10 minutes. 20,000 ×
g of the precipitate collected by centrifugation for 20 minutes.
Tris (pH 7.4), 1 mM EDTA-0.15 M Na
The suspension was suspended in a buffer containing Cl, 1 mM MAPMSF, and homogenized in a mortar, to which 5 M NaOH was added.
Was adjusted. The homogenate was centrifuged at 100,000 × g for 1 hour, and the obtained supernatant was applied to an S-Sepharose column (1.6 × 10 cm, pharmacia). The column was 0.1M potassium phosphate (pH 6.0), 1mMED
After washing with a buffer containing TA, 0.5 mM PMSF, a NaCl concentration gradient of 0 M to 1 M was applied to 400 ml, 20 ml.
The eluate was collected every 5 ml over 0 minutes. High biological activity of the fractions number 20 from 27, which was found E. coli
Pooled as BTC fraction. TFA was added to the E. coli BTC fraction to a final concentration of 0.1%.
Reversed phase HPLC column (diameter 1.0 × 25 cm; Asahipak OD)
P-50, Asahi chemical). Column is 0.1
After washing with% TFA, a gradient of acetonitrile from 0% to 63% was applied over 340 ml for 170 minutes to obtain BT.
The C fraction was collected. According to this method, 630 μg of E. coli
BTC was obtained. The N-terminal amino acid sequence of E. coli BTC was determined up to 20 amino acid residues. BTC was found to be a molecule with the expected N-terminus beginning with the translation initiation methionine.

Example 6 20 mg of human betacellulin (Met-BTC) obtained by adding methionine to the N-terminal obtained in Reference Example 4 (3) was added to 50
After dissolving in 16 ml of mM phosphate buffer (pH 8.0),
A mixed solution of 2 ml of 0.1 M copper sulfate, 0.92 g of glyoxylic acid, and 2 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, a Sephadex G-25 column (25 mm) equilibrated with 2 M acetic acid-2 M sodium acetate solution
(ID × 600 mmL), the solution used for equilibration was developed at a flow rate of 6 ml / min, and the diketone fraction of Met-BTC was pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 20 mM, degassed,
After sealing with nitrogen gas, the reaction was carried out at 37 ° C. for 20 hours. After the reaction was completed, a Sephadex G-25 column (25 mm ID × 25 mm) equilibrated with 20 mM Tris buffer (pH 8.0) was used.
(600 mmL), the buffer used for equilibration was developed at a flow rate of 6 ml / min, and the human betacellulin (BTC) fraction without methionine added to the N-terminus was pooled. After adjusting the pooled BTC fraction to pH 6.0, 10
After adsorption on SP-Sepharose (10 mmID × 200 mmL) equilibrated with 0 mM phosphate buffer (pH 6.0),
0-100% B (B = 100 mM phosphate buffer + 1M
NaCl, pH 6.0) with a step gradient of 2.0 ml / min for 60 min.
Elution was performed at a flow rate of 1 minute and the BTC fractions were pooled. Further, ODP-50 (10 mmI) equilibrated with 0.1% TFA
D × 250 mmL, adsorbed on Showa Denko KK
Elution was performed with a step gradient of 0% B (B = acetonitrile / 0.1% TFA) for 40 minutes at a flow rate of 2 ml / min. After pooling the BTC fractions, freeze-dry
Of lyophilized powder was obtained.

Example 7: (BTC characterization) a) Analysis using SDS polyacrylamide gel electrophoresis 1 μg of the BTC obtained in Example 6 was used as a sample buffer.
[Laemmli, Nature, 227 , 680
(1970)] and 1 mM with 100 mM DTT.
After heating at 00 ° C. for 1 minute, electrophoresis was carried out using Multigel 15/25 (Daiichi Pure Chemicals Co., Ltd.). The gel after electrophoresis is washed with Coomassie brilliant b
lue), a single band of protein was observed, and the purified product was almost single. The results are shown in FIG. In FIG. 3, Lanes 1-2 indicate molecular weight markers and BTC.

B) Analysis of N-terminal amino acid sequence Using 1 nmol of the BTC obtained in Example 6, its N-terminal amino acid sequence was determined by a gas phase protein sequencer (Applied Biosystems Model 477A). As a result, it was consistent with the N-terminal amino acid sequence deduced from the nucleotide sequence of the BTC cDNA. The results are shown in [Table 7].

[Table 7]

C) Amino acid composition analysis Using about 20 μg of the BTC obtained in Example 6, the amino acid composition was measured with an amino acid analyzer (Beckman System 6).
300E). As a result, the BTC cDN
It was consistent with the amino acid composition deduced from the nucleotide sequence of A. The results are shown in [Table 8].

[Table 8]

D) Analysis of C-terminal amino acid Using 15 nmol of the BTC obtained in Example 6,
Terminal amino acids were determined with an amino acid analyzer (Beckman System 6300E). As a result, the obtained BT
This coincided with the C-terminal amino acid deduced from the nucleotide sequence of the C cDNA. The results are shown in [Table 9].

[Table 9]

E) Biological activity of BTC Molecular Cell Biology, 8 , 588 (19)
88), the method described in BALB / C3T3 A3
The activity was measured using 1-714 clone 4 (International Journal of Cancer, 12 , 463, (1973), and the purified BTC product obtained in Example 6 had the same activity as the standard product. It was confirmed.

Reference Example 5 Methionyl human interleukin-2 (Met-IL-
2) Production Met-IL-2 was produced according to the method described in Reference Example 2 of JP-A-62-171699. (I) Construction of plasmid for expression Plasmid pILOT 1 having human IL-2 gene
35-8 [Example 1 of JP-A-60-115528 (vi
i) was cut with the restriction enzyme Hgi AI. 1 obtained
The 294 bp DNA fragment was blunt-ended with T4 polymerase, and EcoRI linker d using T4 DNA ligase.
TGCCATGAATTCATGGCA (SEQ ID NO:
8) was bound. The resulting DNA was digested with Eco RI, to obtain a DNA fragment having translation initiation codon ATG and a human IL-2 gene. This DNA fragment was inserted into ptrp 781 [Nucleic Acids Research, Vol. 11, p. 3077 (1983)] digested with the Eco RI- Pst I site in advance using T4 DNA ligase. The thus obtained expression plasmid pTF1 is trp
Translation disclosure codon downstream of the promoter and human IL-2
Gene (see Japanese Patent Application Laid-Open No. 62-171699,
See Figure]). Plasmid pTF1 was digested with restriction enzyme Stu I, was combined with Bam HI linker. The plasmid DNA was treated with restriction enzyme B am HI and Eco RI, one was inserted into the plasmid pTB281 having the λPL promoter <br/> Ide Eco RI-Bam HI site. The expression plasmid thus obtained was named pTB285 (Japanese Patent Application Laid-Open No.
2-171699 (see FIG. 5)).

(Ii) Production of Transformant Escherichia coli N4830 was transformed with the plasmid pTB285 obtained above according to the method of Cohen et al.
National Academy of Sciences (Pr
Natl. Acad. Sci. USA), 69, 2110 (1972)], and a transformant Escherichia coli N4830 / pT containing the above plasmid.
B285 was obtained. (Iii) Culture of transformant Transformant E. coli N4830 / pTB285 (IFO
14437, FERM BP-852), 1% Bacto Tripton (Difco Laboratories, USA), 0.5% Bacto Yeast Extract (Difco Laboratories, USA) in a 250 ml flask, 0.5% salt.
Liquid medium containing 5% and 50 μg / ml ampicillin (p
H7.0), and incubated at 37 ° C. overnight with rotary shaking. This culture solution is casamino acid 0.5%, glucose 0.5.
M9 medium containing 5% and 50 μg / ml ampicillin 2.
Transfer to a 5L jar fermenter containing 5L at 35 ° C
For 6 hours and then at 42 ° C. for another 3 hours with aeration and stirring to obtain 2.5 L of a culture solution. The culture was centrifuged to collect the cells, frozen at -80 ° C and stored.

(Iv) Extraction: 20 g of the frozen cells were added to 7 M guanidine hydrochloride 0.1 M Tris-H.
After uniformly suspending in 100 ml of an extract (pH 7.0) containing Cl and stirring at 4 ° C. for 1 hour, the suspension was stirred at 28,000 × g for 20 hours.
After centrifugation for minutes, a supernatant was obtained. (V) Partial purification of methionyl interleukin-2 protein The obtained supernatant was purified with 0.01M Tris-HCl buffer (pH 8.
After dialysis against 5), the supernatant obtained by centrifugation at 19,000 xg for 10 minutes was added to a 0.01 M Tris-HCl buffer (p
After adsorbing the protein through a DE52 (DEAE-cellulose, Whatman, UK) column (50 ml) equilibrated with H8.5), the NaCl concentration linear gradient (0 to 0.1).
5M NaCl, 1 L) was prepared, and Met-IL-2 was eluted to obtain an active fraction.

(Vi) Purification of Methionyl Interleukin-2 Protein The active fraction obtained above was concentrated to 5 ml using a YM-5 membrane (manufactured by Amicon, USA) and concentrated to 0.1 M.
Gel filtration was carried out using a Sephacryl S-200 (Pharmacia, Sweden) column (500 ml) equilibrated with Tris-HCl (pH 8.0) -1M NaCl buffer. The active fraction (40 ml) was concentrated to 3 ml with a YM-5 membrane. The obtained concentrated liquid is used for Ultrapore RPSC.
(Altex Corporation, USA) The mixture was adsorbed on a column, and high-performance liquid chromatography was performed using a trifluoroacetic acid-acetonitrile system as an elution solvent. Column, Ultrapore RPSC (4.6 x 75 mm); Column temperature, 30
° C: elution solvent A, 0.1% trifluoroacetic acid-99.9%
Water; elution solvent B, 0.1% trifluoroacetic acid-99.9%
Acetonitrile; elution program, 0 min (68% + 32
% B) -25 minutes (55% A + 45% B) -35 minutes (45%
% A + 55% B) -45 minutes (30% A + 70% B) -4
8 min (100% B); elution rate, 0.8 ml / min; detection wavelength, 230 nm. Met-I with a retention time of about 39 minutes under these conditions
The L-2 fraction was collected.

(Vii) Met- by SP-5PW column
Purification of IL-2 0.55 M ammonium acetate buffer containing Met-IL-2 (pH 5.0, protein concentration 1.03 mg / ml) 0.5 ml
Was placed on a SP-5PW column for high performance liquid chromatography (0.75 × 7.5 cm; manufactured by Tosoh Corporation) equilibrated with 0.025M phosphate buffer (pH 7.4), and 0.02
The protein was eluted using a 5M phosphate buffer (pH 7.4). Column temperature is 35 ° C, buffer flow rate is 0.5 ml / m
set to in. The chromatographic system used was a Varian 5500 liquid chromatograph. Under these conditions, a Met-IL-2 fraction having a retention time of about 70 minutes was collected.

Example 8 Methionyl human interleukin obtained in Reference example 5
20 mg of 2 (Met-IL-2) was dissolved in 27 ml of 20 mM ammonium acetate buffer (pH 5.0), and a mixture of 1.55 g of glyoxylic acid, 3.375 ml of 25 mM copper sulfate and 3.375 ml of pyridine was added. The reaction was performed at room temperature for 1 hour. After completion of the reaction, a 20 mM ammonium acetate buffer solution (pH
The reaction solution was passed through a Sephadex G-25 column (25 mm ID × 600 mL) equilibrated in 5.0) at a flow rate of 300 ml / h, and the diketone fraction of Met-IL-2 was pooled. Subsequently, 20 parts of o-phenylenediamine were added to this fraction.
The mixture was added to a concentration of mM, degassed and sealed with nitrogen gas, and then reacted at 37 ° C. for 21 hours. After the reaction, 2
Sephadex G-25 column (25 mm ID × 600 mm) equilibrated with 0 mM ammonium acetate buffer (pH 5.0)
The reaction solution was passed through L) at a flow rate of 300 ml / h, and the human interleukin-2 (IL-2) fraction was pooled. The pooled IL-2 fraction was pooled with 25 mM phosphate buffer (pH 7.
After adsorption on SP-5PW equilibrated in 0), 30-8
Elution was performed with a 0% B (B: 25 mM phosphate buffer, pH 8.0) pH gradient for 25 minutes at a flow rate of 1.0 ml / min.
-2 fractions were pooled. Furthermore, 0.1% TFA and 0.1% TFA + 80% acetonitrile (80%: 20
%) And an ODP-50 column (4.6 mm ID × 1)
After elution with a 20-100% B concentration gradient for 15 minutes at a flow rate of 0.8 ml / min, purification I was performed.
L-2 was obtained. The obtained IL-2 fraction was lyophilized,
A freeze-dried powder of L-2 was obtained.

Example 9 (Characterization of IL-2) a) Analysis using SDS polyacrylamide gel electrophoresis 3 μg of IL-2 obtained in Example 8 was used as a sample buffer.
[Laemmli, Nature, 227 , 680
(1970)], and then subjected to a reduction treatment with 100 mM DTT at 100 ° C. for 5 minutes.
Electrophoresis was performed at / 20 (first chemical). When the gel after electrophoresis was stained with Coomassie Brilliant Blue,
It showed the same mobility as the standard and was a single band. The results are shown in FIG. In FIG. 4, Lanes 1-2 are IL
-2 and molecular weight markers are shown.

B) Analysis of N-terminal amino acid sequence Using 1 nmol of IL-2 obtained in Example 8,
The terminal amino acid sequence was determined by a gas phase protein sequencer (Applied Biosystems model 477A). As a result, it was consistent with the N-terminal amino acid sequence predicted from the nucleotide sequence of the cDNA of IL-2. [Table 1
0].

[Table 10]

C) Analysis of Amino Acid Composition Using about 20 μg of IL-2 obtained in Example 8, the amino acid composition was determined by an amino acid analyzer (Beckman System 6300E). As a result, IL-2 c
It was consistent with the amino acid composition predicted from the DNA base sequence. The results are shown in [Table 11].

[Table 11]

D) Analysis of C-terminal amino acid Using 15 nmol of the IL-2 obtained in Example 8, the C-terminal amino acid was determined by an amino acid analyzer (Beckman System 6300E). As a result, IL-2
This was consistent with the C-terminal amino acid predicted from the nucleotide sequence of the cDNA. The results are shown in [Table 12].

[Table 12]

E) Biological activity The biological activity was measured by the method of Hinuma et al. Using interleukin-2-dependent cells [Biochemical Biophysical Research Communications (Biochem. Bioph.
ys. Res. Commun.), 109 , 363 (1982)], and confirmed that the purified product of IL-2 obtained in Example 8 had an activity equivalent to that of the standard.

Reference Example 6 (Construction of Human Growth Hormone (hGH) Expression Vector Using T7 Promoter) The structural gene of hGH is plasmid pHGH107 (described in Japanese Patent Publication No. 6-12996, accession number ATCC 31538).
And ATCC40011) from EcoRI and Ec
An approximately 0.75 kb fragment was isolated by digestion with oRV. On the other hand, pET-3C [Rosenberg et a
l. , Gene, 56, 125 (198
7 years)] with NdeI and BamHI, and an approximately 4.6 kb fragment containing the T7 promoter and the ampicillin resistance gene was isolated. Both fragments were blunt-ended with T4 DNA polymerase (DNA Blunting kit, manufactured by Takara Shuzo Co., Ltd.), ligated with T4 DNA ligase, introduced into Escherichia coli JM109, and transformants were selected using ampicillin resistance as an index. From the colonies that appeared, 12 were picked, plasmids were prepared from them, and the cleavage pattern with the restriction enzyme PstI was examined. As a result, it was found that the hGH gene was inserted in the plasmid from the 6 colonies in the correct direction. . The plasmid obtained from one of these strains was named pTGA201.

Reference Example 7 (Expression of Met-hGH in Escherichia coli) Escherichia coli JM109 was lysogenized with lambda phage (Studier, Supra) which was recombined with the T7 phage RNA polymerase gene. Thereafter, the hGH expression vector pTGA201 obtained in Reference Example 6 was introduced into Escherichia coli JM109 (DE3), and Escherichia coli JM109 (D
E3) / pTGA201 was obtained. This transformed cell is
In a 2 liter flask containing 1 liter of LB medium (1% peptone, 0.5% yeast extract, 0.5% sodium chloride) containing 50 μg / ml ampicillin,
The cells were shake-cultured at 16 ° C for 16 hours. The obtained culture solution was used for 0.1 mL.
20 containing 02% Newpol LB-625 (an antifoaming agent; manufactured by Sanyo Chemical Industries) and 50 μg / ml of ampicillin
One liter of LB medium was transferred to a 50-liter fermenter, and cultured at 37 ° C. for 6 hours with aeration and stirring. This culture was used in 360 liters of the main fermentation medium (1.68% sodium monohydrogen phosphate, 0.3% potassium dihydrogen phosphate, 0.1%).
1% ammonium chloride, 0.05% sodium chloride,
0.0246% magnesium sulfate, 0.02% Newpol LB-625, 0.0005% thiamine hydrochloride, 1.
500 with 5% glucose, 1.5% casamino acid)
The cells were transferred to a 1-liter fermenter, and aeration and stirring culture was started at 37 ° C. When the turbidity of the culture reaches about 500 Klet units, 5.95 mg / liter of isopropyl-
β-D-thiogalactopyranoside (IPTG) was added, and the culture was further continued. After 4 hours, the culture was centrifuged to obtain about 4.5 kg of wet cells, which were frozen and stored at -80 ° C. . The above transformed Escherichia coli JM109 (DE3) / pT
GA201 has a deposit number of FERM BP-5632 under the Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology.
BH) and deposited with the Fermentation Research Institute (IFO) under the accession number IFO 16001.

Reference Example 8 (Activation of Met-hGH) 50 kg of Tris / HC was added to 2 kg of the cells obtained in Reference Example 7.
l, 6 L of 8M guanidine hydrochloride solution (pH 8.0) was added to dissolve the cells, and then centrifuged (10000 rpm).
m, 120 minutes). To 6 liters of the obtained supernatant, 50 mM Tris / HCl, 0.28 mM GSSG,
1.4 mM GSH, 0.7 M arginine (pH 8.0)
After adjusting the pH to 8.0 by adding 18 liters, activation was performed at 4 ° C. for 5 days.

REFERENCE EXAMPLE 9 (Purification of Met-hGH) The regenerated solution which was activated in Reference Example 8 was subjected to a Pellicon cassette system (PTGC membrane, Millipore) with 20 mM Tris / HCl, 2.5 M urea (pH 8.0). ) While desalting and concentrating until the electric conductivity becomes 10 mS or less, and then centrifuging (10000 rpm,
(60 minutes) to obtain 5 liters of the supernatant of the concentrated solution. This solution was then added to 20 mM Tris / HCl, 2.5 M urea (pH
8.0) adsorbed on a DEAE-Toyopearl 650M column (20 cmφ × 84 cm, Tosoh Corporation) equilibrated in
After washing thoroughly, 0-25% B (B = 20 mM Tris / HCl, 2.5 M urea, 1 M sodium chloride, pH
Elution was performed at a flow rate of 300 ml / min for 100 minutes with a concentration gradient of 8.0) to obtain 10 L of an eluate as a Met-hGH fraction. Further, the eluate was concentrated and desalted using a Pellicon cassette system (PTGC membrane, Millipore). Furthermore, high performance liquid chromatography (Gilson HP
LCA, Gilson)
After passing through a E-5PW column (21 cm × 30 cm, Tosoh Corporation) and adsorbing, A = 50 mM Tris / HCl + 2.
5 M urea (pH 8.0), B = 50 mM MES [2-
(N-morpholino) ethanesulfonic acid] +2.5 M urea (pH 4.0) with a 70-85% B pH gradient,
Elution was performed at a flow rate of 320 ml / min for 70 minutes.
-6 liters of the hGH fraction were obtained. To this eluate, add 300 ml of 2M Tris / HCl (pH 7.8) solution, and add pH.
7.2 and then the Pellicon cassette system (P
The solution was concentrated and desalted with a TGC membrane (Millipore) to obtain 9,979 mg of Met-hGH.

Example 10 (Removal of N-terminal Met) In 1650 ml of the Met-hGH solution obtained in Reference Example 9, 2.
413 ml of a 5 M glyoxylic acid, 35 mM copper sulfate, 6 M pyridine solution was added, and the mixture was stirred well and reacted at 25 ° C. for 60 minutes. Then 20 mM Tris / HCl, 2.5 M
Sephadex G-2 equilibrated with urea (pH 8.0)
The solution was passed through a 5 column (11.3 cmφ × 125 cm, Pharmacia) at a flow rate of 3 liter / h, developed using the same buffer solution as for equilibration, and the eluted diketone body fraction of Met-hGH was thoroughly removed. 4M acetic acid, 4M directly with stirring
Sodium acetate, 80 mMo-phenylenediamine, 3
M urea solution was added in 4 liters. After the elution was completed, 8 liters of the reaction solution was left still at 4 ° C. for 3 days. After standing, the mixture was concentrated to 4 liters using a Pellicon cassette system (PTGC membrane, Millipore), and the solution was concentrated to 20 mM Tris / HCl, 2.5 mM.
Sephadex G- equilibrated with M urea (pH 8.0)
The solution was passed through a 25 column (11.3 cmφ × 140 cm, Pharmacia) at a flow rate of 3 L / h, and 4.7 L of the hGH fraction was collected. Further, this solution was applied to a DEAE-5PW column (21 cm × 3) by high performance liquid chromatography (Gilson HPLC system, Gilson).
0 cm, Tosoh Corporation), A = 50 mM
Tris / HCl + 2.5M urea (pH 8.0), B = 5
70-85 with 0 mM MES [2- (N-morpholino) ethanesulfonic acid] +2.5 M urea (pH 4.0)
Elution was performed with a pH gradient of% B for 70 minutes at a flow rate of 320 ml / min to obtain 10 liters of an hGH fraction. This hG
The 2H Tris / HCl (pH 7.8) solution was added to the H fraction for 50 minutes.
After adjusting the pH to 7.2 by adding 0 ml, Minitan II (PTG
C membrane, Millipore), and 500 ml of this concentrated solution was equilibrated with distilled water to obtain a Sephacryl S-100 column (1).
13. (cmφ × 50 cm, Pharmacia) at a flow rate of 2 liters / h and developed to obtain 1651 ml of an hGH fraction. Further, this solution was applied to Millipak 60 (Millipore).
And 1487 ml of hGH solution (3309 mg of h
GH).

Example 11 (Characterization of hGH) (a) Analysis using SDS polyacrylamide gel electrophoresis Sample buffer containing 100 mM DTT in hGH obtained in Example 10 [Laemmli, Nature, 227 , 680 (197)
0)], stirred well, heated at 95 ° C. for 2 minutes, and electrophoresed on Multigel 10/20 (Daiichi Pure Chemicals). Run the gel after electrophoresis with Coomassie Brilliant
As a result of staining with blue (Coomassie brilliant blue),
Since a single band was observed at about 22 kd, the purified h
It was confirmed that GH was almost single (FIG. 5). FIG.
In lanes 1-2, molecular weight markers and hGH
Is shown.

(B) Analysis of amino acid composition The amino acid composition was determined using an amino acid analyzer (L-8500A, Hitachi). As a result, the amino acid composition of the obtained hGH was consistent with the amino acid composition deduced from the nucleotide sequence of cDNA (Table 13).

Table 13: hGH base sequence per mole of hGH amino acid residue number predicted from ------------------------- Asx 20.2 20 Thr ¹⁾ 10.0 10 Ser ¹⁾ 16.7 18 Glx 27 0.027 Pro 8.1 8 Gly 8.2 28 Ala 7.67 Cys ²⁾ N.I. D. 4 Val 7.07 Met 3.03 Ile 7.78 Leu 27.926 Tyr 8.18 Phe 12.7 13 His 3.23 Lys 8.999 Arg 10.9 11 Trp 0.8 1... Acid hydrolysis (6N HCl-4% thioglycolic acid, 110 ° C., 24 and 48 hours) (Average value of interhydrolysis) 1) Extrapolated value at 0 hour 2) Not detected Analysis was performed using about 20 μg.

(C) Analysis of N-terminal amino acid sequence The N-terminal amino acid sequence was determined using a gas phase protein sequencer (Applied Biosystems, Model 477A). As a result, the N-terminal amino acid sequence of the obtained hGH is the N-terminal amino acid sequence of the hGH deduced from the nucleotide sequence of the cDNA.
It was consistent with the terminal amino acid sequence (Table 14).

Table 14: Base sequence of hGH detected Residue No. PTH ¹⁾ -Amino acid predicted (pmol) Amino acid ----------- (404) Pro 3 Thr (422) Thr 4 Ile (744) Ile 5 Pro (283) Pro 6 Leu (514) Leu 7 Ser (136) Ser 8 Arg (36) Arg 9 Leu (377) Leu10 Ph Phe 11 Asp (77) Asp 12 Asn (230) Asn 13 Ala (435) Ala 14 Met (334) Met 15 Leu (398) Leu 16 Arg (67) Arg 17 Ala (488) Ala 18 His 19 Arg (42) Arg 20 Leu (406) Leu -------- -------------------- 1) was analyzed using a phenylthiohydantoin 1 nmol.

(D) C-terminal amino acid analysis The C-terminal amino acid was determined using an amino acid analyzer (L-8500A, Hitachi). The C-terminal amino acid of the obtained hGH coincided with the C-terminal amino acid deduced from the nucleotide sequence of cDNA (Table 15).

[Table 15]

Example 12 (Measurement of hGH activity) Proliferation of purified hGH obtained in Example 10 on Nb2 cells [Journal of Clinical Endocrinology and Metabolism, vol. 51, p. 1058 (1980)] The accelerating effect was equivalent to a standard product (Chemicon International, Temecula, California, USA).

Example 13 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
1 ml of a 4M glyoxylic acid, 20 mM nickel chloride, 6M urea (pH 7.0) solution was added, and the mixture was stirred well and reacted at room temperature for 60 minutes. Next, the reaction solution was separated with a Sephadex G-25 column (10 mm ID × 30 cm) equilibrated with 20 mM Tris / HCl, 4 M urea (pH 8.0).
L, Pharmacia) and eluted Met-
The diketone fraction of hGH was collected, and an equal amount of 4 was added to the eluate.
M acetic acid, 4 M sodium acetate and 80 mMo-phenylenediamine solution were added, and the mixture was stirred well and reacted at 37 ° C. for 15 hours. After the reaction, 20 mM Tris / HCl (pH 8.
0) equilibrated in Sephadex G-25 column (10
mmID × 40 cmL, Pharmacia), and h
After collecting the GH fraction, the solution was further applied to a DEAE-5PW column (2.15 cm × 15) by high performance liquid chromatography (Gilson HPLC system, Gilson).
A, 50 mM Tris / HCl + 2.5 M urea (pH 8.0), B = 50
70-85 with mM MES [2- (N-morpholino) ethanesulfonic acid] +2.5 M urea (pH 4.0)
Elution was performed with a pH gradient of% B for 70 minutes at a flow rate of 7.5 ml / min to obtain hGH.

Example 14 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
1 ml of a 4M glyoxylic acid, 20 mM cobalt chloride, 6 M urea (pH 7.0) solution was added, and the mixture was stirred well and reacted at room temperature for 60 minutes. Next, the reaction solution was separated with a Sephadex G-25 column (10 mm ID × 30 cm) equilibrated with 20 mM Tris / HCl, 4 M urea (pH 8.0).
L, Pharmacia) and eluted Met-
The diketone fraction of hGH was collected, and an equal amount of 4 was added to the eluate.
M acetic acid, 4 M sodium acetate and 80 mMo-phenylenediamine solution were added, and the mixture was stirred well and reacted at 37 ° C. for 15 hours. After the reaction, 20 mM Tris / HCl (pH 8.
0) equilibrated in Sephadex G-25 column (10
mmID × 40 cmL, Pharmacia), and h
After collecting the GH fraction, the solution was further applied to a DEAE-5PW column (2.15 cm × 15) by high performance liquid chromatography (Gilson HPLC system, Gilson).
A, 50 mM Tris / HCl + 2.5 M urea (pH 8.0), B = 50
70-85 with mM MES [2- (N-morpholino) ethanesulfonic acid] +2.5 M urea (pH 4.0)
Elution was performed with a pH gradient of% B for 70 minutes at a flow rate of 7.5 ml / min to obtain hGH.

Example 15 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
4 M glyoxylic acid, 20 mM zinc sulfate, 6 M urea (p
H7.0) 1 ml of the solution was added, and the mixture was stirred well.
Allowed to react for minutes. Next, the reaction solution was separated with a Sephadex G-25 column (10 mm ID × 30 cmL, equilibrated with 20 mM Tris / HCl, 4 M urea (pH 8.0).
Met-hG that has passed through and eluted
The diketone body fraction of H was collected, an equal volume of 4M acetic acid, 4M sodium acetate and 80 mMo-phenylenediamine solution was added to the eluate, and the mixture was stirred well and reacted at 37 ° C. for 15 hours. After the reaction, a Sephadex G-25 column (10 mmI) equilibrated with 20 mM Tris / HCl (pH 8.0) was used.
D × 40 cmL, Pharmacia), and after collecting the hGH fraction, the solution was further subjected to a DEAE-5PW column (2.15 cm × 15 cm, A: 50 mM Tris / H
Cl + 2.5M urea (pH 8.0), B = 50 mMME
S [2- (N-morpholino) ethanesulfonic acid] +2.
70-85% B pH with 5M urea (pH 4.0)
Elution was performed with a gradient at a flow rate of 7.5 ml / min for 70 minutes to obtain hGH.

Example 16 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
4M glyoxylic acid, 20mM copper acetate, 6M urea (pH
7.0) 1 ml of the solution was added, and the mixture was stirred well and reacted at room temperature for 60 minutes. Then, the reaction solution was added to 20 mM Tris /
Met-hGH eluted by passing through a Sephadex G-25 column (10 mm ID × 30 cmL, Pharmacia) equilibrated with HCl and 4 M urea (pH 8.0)
The diketone body fraction was collected, an equal volume of 4M acetic acid, 4M sodium acetate and 80 mMo-phenylenediamine solution was added to the eluate, and the mixture was stirred well and reacted at 37 ° C. for 15 hours. After the reaction, a Sephadex G-25 column (10 mmI) equilibrated with 20 mM Tris / HCl (pH 8.0) was used.
D × 40 cmL, Pharmacia), and after collecting the hGH fraction, the solution was further subjected to a DEAE-5PW column (2.15 cm × 15 cm, A: 50 mM Tris / H
Cl + 2.5M urea (pH 8.0), B = 50 mMME
S [2- (N-morpholino) ethanesulfonic acid] +2.
70-85% B pH with 5M urea (pH 4.0)
Elution was performed with a gradient at a flow rate of 7.5 ml / min for 70 minutes to obtain hGH.

Example 17 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
4 M glyoxylic acid, 20 mM copper sulfate, 6 M urea (pH
7.0) 1 ml of the solution was added, and the mixture was stirred well and reacted at room temperature for 60 minutes. Then, the reaction solution was added to 20 mM Tris /
Met-hGH eluted by passing through a Sephadex G-25 column (10 mm ID × 30 cmL, Pharmacia) equilibrated with HCl and 4 M urea (pH 8.0)
The diketone fractions were collected and equal amounts of 4 M acetic acid, 4 M sodium acetate, 80 mM trilen-3,4-
After adding a diamine solution and stirring well, the mixture was reacted at 37 ° C. for 15 hours. After the reaction, 20 mM Tris / HCl (pH 8.
0) equilibrated in Sephadex G-25 column (10
mmID × 40 cmL, Pharmacia), and h
After collecting the GH fraction, the solution was further applied to a DEAE-5PW column (2.15 cm × 15) by high performance liquid chromatography (Gilson HPLC system, Gilson).
A, 50 mM Tris / HCl + 2.5 M urea (pH 8.0), B = 50
70-85 with mM MES [2- (N-morpholino) ethanesulfonic acid] +2.5 M urea (pH 4.0)
Elution was performed with a pH gradient of% B for 70 minutes at a flow rate of 7.5 ml / min to obtain hGH.

Example 18 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
4 M glyoxylic acid, 20 mM copper sulfate, 6 M urea (pH
7.0) 1 ml of the solution was added, and the mixture was stirred well and reacted at room temperature for 60 minutes. Then, the reaction solution was added to 20 mM Tris /
Met-hGH eluted by passing through a Sephadex G-25 column (10 mm ID × 30 cmL, Pharmacia) equilibrated with HCl and 4 M urea (pH 8.0)
The diketone body fraction was collected, an equal volume of 4M acetic acid, 4M sodium acetate, and 80 mM 4-chloro-o-phenylenediamine solution was added to the eluate, and the mixture was stirred well.
Reacted for hours. After the reaction, 20 mM Tris / HCl (pH
8.0), and the solution was passed through a Sephadex G-25 column (10 mm ID x 40 cmL, Pharmacia) equilibrated with the above method, and the hGH fraction was collected. This solution was applied to a DEAE-5PW column (2.15 cm
× 15 cm, Tosoh Corporation) and A = 50
mM Tris / HCl + 2.5M urea (pH 8.0), B
= 50 mM MES [2- (N-morpholino) ethanesulfonic acid] + 2.5 M urea (pH 4.0)
Elution was performed at a flow rate of 7.5 ml / min for 70 minutes with a pH gradient of 85% B to obtain hGH.

Example 19 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
4 M glyoxylic acid, 20 mM copper sulfate, 6 M urea (pH
7.0) 1 ml of the solution was added, and the mixture was stirred well and reacted at room temperature for 60 minutes. Then, the reaction solution was added to 20 mM Tris /
Met-hGH eluted by passing through a Sephadex G-25 column (10 mm ID × 30 cmL, Pharmacia) equilibrated with HCl and 4 M urea (pH 8.0)
The diketone fractions were collected, and an equal volume of 4M acetic acid, 4M sodium acetate and 80 mM 3,4-diaminobenzoic acid solution were added to the eluate, and the mixture was stirred well and reacted at 37 ° C. for 15 hours. After the reaction, 20 mM Tris / HCl (pH 8.0)
Sephadex G-25 column (10 mm
ID × 40cmL, Pharmacia)
After collecting the fractions, the solution was further applied to a DEAE-5PW column (2.15 cm × 15 cm, by high performance liquid chromatography (Gilson HPLC system, Gilson)).
A = 50 mM Tris /
HCl + 2.5 M urea (pH 8.0), B = 50 mM
ES [2- (N-morpholino) ethanesulfonic acid] +
Elution was performed with a 70-85% B pH gradient with 2.5 M urea (pH 4.0) for 70 minutes at a flow rate of 7.5 ml / min to obtain hGH.

Example 20 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 8
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 10 mg / ml. 1 ml of this solution contains 4 M sodium acetate, 20 mM acetic acid, 0.1 mM
4 M glyoxylic acid, 20 mM copper sulfate, 6 M urea (pH
7.0) 1 ml of the solution was added, and the mixture was stirred well and reacted at room temperature for 60 minutes. Then, the reaction solution was added to 20 mM Tris /
HCl was passed through a Sephadex G-25 column (10 mm ID × 30 cmL, Pharmacia) equilibrated with 4 M urea (pH 8.5) to elute Met-hGH.
The diketone body fraction was collected, cysteamine was added to this eluate to a concentration of 40 mM, and the mixture was stirred well and then stirred at 37 ° C. for 15 minutes.
Reacted for hours. After the reaction, 20 mM Tris / HCl (pH
8.0), and the solution was passed through a Sephadex G-25 column (10 mm ID x 40 cmL, Pharmacia) equilibrated with the above method, and the hGH fraction was collected. This solution was applied to a DEAE-5PW column (2.15 cm
× 15 cm, Tosoh Corporation) and A = 50
mM Tris / HCl + 2.5M urea (pH 8.0), B
= 50 mM MES [2- (N-morpholino) ethanesulfonic acid] + 2.5 M urea (pH 4.0)
Elution was performed at a flow rate of 7.5 ml / min for 70 minutes with a pH gradient of 85% B to obtain hGH.

Example 21 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 3
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 5 mg / ml. 4 ml of 4 M sodium acetate, 0.8 M acetic acid, 0.4 ml
After adding 2 ml of M glyoxylic acid, 10 mM copper sulfate and 2.5 M urea solution, the mixture was stirred well and reacted at room temperature for 60 minutes. Then, the reaction solution was added with 20 mM Tris / HCl,
The solution was passed through a Sephadex G-25 column (10 mm ID × 30 cmL, Pharmacia) equilibrated with 2.5 M urea (pH 8.0), and the eluted Met-hGH diketone fractions were collected. Equal amounts of 4M acetic acid, 4
M sodium acetate, 3M urea and 80 mMo-phenylenediamine solution were added, and the mixture was stirred well and reacted at 4 ° C. for 3 days. After the reaction, the mixture is passed through a Sephadex G-25 column (10 mm ID × 40 cmL, Pharmacia) equilibrated with 20 mM Tris / HCl, 2.5 M urea (pH 8.0), and the hGH fraction is collected. This solution was applied to a DEAE-5PW column (2.15c) by liquid chromatography (Gilson HPLC system, Gilson).
(m × 15 cm, Tosoh Corporation), A = 5
0 mM Tris / HCl + 2.5 M urea (pH 8.0),
B = 70 with 50 mM MES [2- (N-morpholino) ethanesulfonic acid] +2.5 M urea (pH 4.0).
Elution was performed with a pH gradient of ８５85% B for 70 minutes at a flow rate of 7.5 ml / min to obtain hGH.

Example 22 (Removal of N-terminal Met) A Met-hGH solution obtained by the same method as in Reference Example 9 was subjected to an ultrafiltration system (Diaflow membrane YM10, 43 m
20 mM Tris / HCl, 3
M urea (pH 8.0) and Met-hG
It was concentrated so that the concentration of H became 5 mg / ml. To 2 ml of this solution was added 2 ml of a 1 M imidazole, 0.5 M glyoxylic acid, 20 mM copper sulfate, 2.5 M urea solution, and the mixture was stirred well and reacted at room temperature for 60 minutes. Next, this reaction solution was added to 20 mM Tris / HCl, 2.5 M urea (pH
8.0), and the mixture was passed through a Sephadex G-25 column (10 mm ID x 30 cmL, Pharmacia), and the eluted Met-hGH diketone fractions were collected. After adding 4M sodium acetate, 3M urea, and 80 mM Mo-phenylenediamine solution, the mixture was stirred well and reacted at 4 ° C. for 3 days. After the reaction, 2
Sephadex G-25 column (10 mmI) equilibrated with 0 mM Tris / HCl, 2.5 M urea (pH 8.0)
D × 40 cmL, Pharmacia), and after collecting the hGH fraction, the solution was further subjected to a DEAE-5PW column (2.15 cm × 15 cm, A: 50 mM Tris / H
Cl + 2.5M urea (pH 8.0), B = 50 mMME
S [2- (N-morpholino) ethanesulfonic acid] +2.
70-85% B pH with 5M urea (pH 4.0)
Elution was performed with a gradient at a flow rate of 7.5 ml / min for 70 minutes to obtain hGH.

Example 23 (Removal of Net-terminal Met) Met- obtained by adding Met to the N-terminal obtained in Reference Example 4
After dissolving 10 mg of BTC in 4 ml of a 3M urea solution,
0.5 ml of 0 mM copper sulfate, 0.25 g of glyoxylic acid,
A mixture of 0.5 ml of pyridine (pH 5.0) was added, and 2
The reaction was performed at 5 ° C. for 1 hour. After the reaction is completed, the reaction solution is
The solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated with urea + 50 mM phosphate buffer (pH 6.0), and the solution used for equilibration was developed at a flow rate of 6 ml / min. Met-BTC
Were pooled. Subsequently, an equal amount of 4M acetic acid-4M sodium acetate solution was added to this fraction, and o-
Phenylenediamine was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated with 50 mM phosphate buffer (pH 6.0), and the buffer used for equilibration was supplied at a flow rate of 6 ml / min. And the BTC fraction without Met added to the N-terminus was pooled. After adjusting the pooled BTC fraction to pH 6.0, SP-5PW (7.5 mm ID × 75 mm) equilibrated with 100 mM phosphate buffer + 200 mM NaCl (pH 5.0)
L), after being adsorbed on Tosoh Corporation, 0-100% B
(B = 100 mM phosphate buffer + 200 mM NaC
1, pH 9.0) with a step gradient of 0.8 ml /
The BTC fractions were pooled, and the BTC fractions were further eluted with 0.1% TFA in ODP-
50 (10 mm ID × 250 mm L), adsorbed on Showa Denko KK, and eluted with a step gradient of 20 to 60% B (B = 80% acetonitrile / 0.1% TFA) for 40 minutes at a flow rate of 2 ml / min. did. After pooling the fractions of BTC, freeze-drying was carried out, and the
g was obtained.

Example 24 (Characterization of BTC) (a) Analysis using SDS polyacrylamide gel electrophoresis The BTC obtained in Example 23 was sample buffered with 100 mM DTT in Samplebuffer [Laemmli, Nature, 2
27 , 680 (1970)], heated at 95 ° C. for 1 minute, and electrophoresed on Multigel 15/25 (Daiichi Pure Chemicals). Run the gel after electrophoresis with Coomassie Brilliant
As a result of staining with blue (Coomassie brilliant blue),
A single band protein was observed at about 16 Kd. From this, it was found that the purified BTC was almost single and that a strong dimer was formed even under the conditions of reduction with DTT (FIG. 6). In FIG. 6, lanes 1-2 show molecular weight markers and BTC.

(B) Analysis of Amino Acid Composition The amino acid composition was determined using an amino acid analyzer (Beckman System 6).
300E). As a result, the BTC cD
This was consistent with the amino acid composition deduced from the nucleotide sequence of NA (Table 16).

Table 16: Base sequence of BTC per 1 mol of BTC amino acid number of residues as predicted from --------------------------- Asx 7.07 Thr ¹⁾ 5.9 6 Ser ¹⁾ 4.8 5 Glx 9 Asx 7.07 Thr ¹⁾ 5.9 6 Ser ¹⁾ .19 Pro 4.04 Gly 7.17 Ala 4.04 Cys ²⁾ D. 8 Val 4.64 Met 00 Ile 1.9 2 Leu 3.03 Tyr 4.04 Phe 3.03 His 2.42 Lys 5.15 Arg 7.07 Trp ²⁾ D. 0 Acid hydrolysis (6N HCl-1% phenol, 110 ° C., 24 and 48 hours hydrolysis) 1) Value extrapolated at 0 hour 2) Not detected Analysis was performed using about 20 μg.

(C) Analysis of N-terminal amino acid sequence The N-terminal amino acid sequence was determined using a gas-phase protein sequencer (Applied Biosystem Model 477A). The results were consistent with the N-terminal amino acid sequence of BTC deduced from the nucleotide sequence of BTC cDNA (Table 1).
7).

Table 17 Base Sequence of Detected BTC Residue No .:----------- (Pmol) Amino acid predicted from PTH ¹⁾ -amino acid Amino acid -1 Asp (271) Asp 2 Gly (432) Gly 3 Asn (249) Asn 4 Ser (95) Ser 5 Thr (150) Thr 6 Arg (98) Arg 7 Ser (89) Ser 8 Pro (255) Pro 9 Glu (177) Glu10 ) Thr 11 Asn (139) Asn 12 Gly (187) Gly 13 Leu (227) Leu 14 Leu (281) Leu 15 N. D. Cys 16 Gly (126) Gly 17 Asp (70) Asp 18 Pro (100) Pro 19 Glu (44) Glu 20 Glu (75) Glu ---------------- 1) Analysis was performed using 1 nmol of phenylthiohydantoin.

(D) Analysis of C-terminal amino acid The C-terminal amino acid was determined using an amino acid analyzer (Beckman System 6300E). The C-terminal amino acid of the obtained BTC coincided with the C-terminal amino acid deduced from the nucleotide sequence of cDNA (Table 18).

[Table 18]

Example 25 (Biological activity of BTC) According to the method described in Molecular Cell Biology, Vol. 8, page 588 (1988), BALB / c 3
The activity was measured using T3 A31-714 clone 4 (International Journal of Cancer, vol. 12, p. 463 (1973)), and Example 23 was obtained.
Is a standard product (JP-A-6-87894).
Has the same cell growth promoting activity as purified BTCI) described in Example 13.

Example 26 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 40 mg of t-BTC in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.2 glyoxylic acid were added.
A mixture of 5 g and 0.5 ml of pyridine was added.
Reacted for hours. After completion of the reaction, the reaction solution was treated with 2.5 M urea + 5
Sephadex G-25 column (25 mm ID ×) equilibrated with 0 mM phosphate buffer (pH 6.0)
(600 mmL), and the solution used for equilibration is 6 ml.
/ Min and the diketone fractions of Met-BTC were pooled. Subsequently, an equal amount of 4M acetic acid-4M was added to this fraction.
After adding the sodium acetate solution, tolylene-3,4-diamine was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was performed in the same manner as in Example 23, and BTC was purified.
I got

Example 27 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 40 mg of t-BTC in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.2 glyoxylic acid were added.
A mixture of 5 g and 0.5 ml of pyridine was added.
Reacted for hours. After completion of the reaction, the reaction solution was treated with 2.5 M urea + 5
Sephadex G-25 column (25 mm ID ×) equilibrated with 0 mM phosphate buffer (pH 6.0)
(600 mmL), and the solution used for equilibration is 6 ml.
/ Min and the diketone fractions of Met-BTC were pooled. Subsequently, an equal amount of 4M acetic acid-4M was added to this fraction.
After adding the sodium acetate solution, 2,3-diaminophenol was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was performed in the same manner as in Example 23, and BTC was purified.
I got

Example 28 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 40 mg of t-BTC in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.2 glyoxylic acid were added.
A mixture of 5 g and 0.5 ml of pyridine was added.
Reacted for hours. After completion of the reaction, the reaction solution was treated with 2.5 M urea + 5
Sephadex G-25 column (25 mm ID ×) equilibrated with 0 mM phosphate buffer (pH 6.0)
(600 mmL), and the solution used for equilibration is 6 ml.
/ Min and the diketone fractions of Met-BTC were pooled. Subsequently, an equal amount of 4M acetic acid-4M was added to this fraction.
After adding the sodium acetate solution, 3,4-diaminobenzoic acid was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 29 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 40 mg of t-BTC in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.2 glyoxylic acid were added.
A mixture of 5 g and 0.5 ml of pyridine was added.
Reacted for hours. After completion of the reaction, the reaction solution was treated with 2.5 M urea + 5
Sephadex G-25 column (25 mm ID ×) equilibrated with 0 mM phosphate buffer (pH 6.0)
(600 mmL), and the solution used for equilibration is 6 ml.
/ Min and the diketone fractions of Met-BTC were pooled. Subsequently, an equal amount of 4M acetic acid-4M was added to this fraction.
After adding the sodium acetate solution, 4-chloro-o-phenylenediamine was added to a concentration of 40 mM,
After degassing and nitrogen gas sealing, the reaction was carried out at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 30 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 40 mg of t-BTC in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.2 glyoxylic acid were added.
A mixture of 5 g and 0.5 ml of pyridine was added.
Reacted for hours. After completion of the reaction, the reaction solution was treated with 2.5 M urea + 5
Sephadex G-25 column (25 mm ID ×) equilibrated with 0 mM phosphate buffer (pH 6.0)
(600 mmL), and the solution used for equilibration is 6 ml.
/ Min and the diketone fractions of Met-BTC were pooled. Subsequently, 40 mM cysteamine was added to this fraction.
After adjusting to pH 8.5, the mixture was degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 31 Me with methionine added to the N-terminus obtained in Reference Example 4
After dissolving 20 mg of t-BTC in 2 ml of a 3 M urea solution, 2 ml of a solution of 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM nickel sulfate, and 6 M urea
Was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was mixed with 2.5 M urea + 50 mM phosphate buffer (pH 6.
Sephadex G-25 equilibrated in 0)
The solution was passed through a column (25 mm ID × 600 mm L), and the solution used for equilibration was developed at a flow rate of 6 ml / min.
The diketone fractions of NT-3 were pooled. Subsequently, an equal amount of a 4M acetic acid-4M sodium acetate solution was added to this fraction, o-phenylenediamine was added to a concentration of 40 mM, degassing was performed, and nitrogen gas sealing was performed.
The reaction was performed for 5 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 32 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 20 mg of t-BTC in 2 ml of a 3 M urea solution, 2 ml of a solution of 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM cobalt chloride, and 6 M urea
Was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was mixed with 2.5 M urea + 50 mM phosphate buffer (pH 6.
Sephadex G-25 equilibrated in 0)
The solution was passed through a column (25 mm ID × 600 mm L), and the solution used for equilibration was developed at a flow rate of 6 ml / min.
The diketone fractions of BTC were pooled. Subsequently, an equal amount of a 4M acetic acid-4M sodium acetate solution was added to this fraction, o-phenylenediamine was added to a concentration of 40 mM, degassing was performed, and nitrogen gas sealing was performed.
The reaction was performed for 5 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 33 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 20 mg of t-BTC in 2 ml of a 3 M urea solution, 2 ml of a solution of 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM zinc sulfate, and 6 M urea were added, and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated with 2.5 M urea + 50 mM phosphate buffer (pH 6.0), and the solution used for equilibration was used. Was developed at a flow rate of 6 ml / min, and Met-BTC was developed.
Were pooled. Subsequently, an equal amount of 4M acetic acid-4M sodium acetate solution was added to this fraction, and o-
Phenylenediamine was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 34 Me obtained by adding methionine to the N-terminus obtained in Reference Example 4
After dissolving 40 mg of t-BTC3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper acetate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min and the diketone fractions of Met-BTC were pooled. Subsequently, an equal amount of 4M acetic acid-4 was added to this fraction.
After the addition of the M sodium acetate solution, o-phenylenediamine was added to a concentration of 40 mM, degassing and nitrogen gas sealing were performed, and the reaction was carried out at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 35 Me with methionine added to the N-terminus obtained in Reference Example 4
After dissolving 20 mg of t-BTC in 2 ml of a 3 M urea solution, 2 ml of a solution of 4 M sodium acetate, 0.8 M acetic acid, 0.4 M glyoxylic acid, 10 mM copper sulfate, and 3 M urea were added, and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated with 2.5 M urea + 50 mM phosphate buffer (pH 6.0), and the solution used for equilibration was used. Was developed at a flow rate of 6 ml / min, and Met-BTC was developed.
Were pooled. Subsequently, an equal amount of 4M acetic acid-4M sodium acetate solution was added to this fraction, and o-
Phenylenediamine was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 36 Me obtained by adding methionine to the N-terminal obtained in Reference Example 4
After dissolving 20 mg of t-BTC in 2 ml of a 3 M urea solution, 1 M imidazole, 0.5 M glyoxylic acid, 20 M
2 ml of a solution of 3 mM urea was added thereto and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min and the diketone fractions of Met-BTC were pooled. Subsequently, an equal amount of 4M acetic acid-4 was added to this fraction.
After the addition of the M sodium acetate solution, o-phenylenediamine was added to a concentration of 40 mM, degassing and nitrogen gas sealing were performed, and the reaction was carried out at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 23 to obtain BTC.

Example 37 Methionine added Me at the N-terminus obtained in Reference Example 3
After dissolving 40 mg of t-NT-3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min, and the diketone body fractions of Met-NT-3 were pooled. Subsequently, an equal amount of 4M acetic acid-
After the addition of a 4M sodium acetate solution, o-phenylenediamine was added to a concentration of 40 mM, degassing and nitrogen gas sealing were performed, and the reaction was carried out at 37 ° C for 15 hours. After the completion of the reaction, the reaction solution was washed with a 50 mM phosphate buffer (pH 6.0).
Sephadex G-25 column (25 mm
(ID × 600 mmL), the buffer used for equilibration was developed at a flow rate of 6 ml / min, and the NT-3 fraction having no methionine added to the N-terminus was pooled. Pooled N
After adjusting the T-3 fraction to pH 6.0, the T-3 fraction was adsorbed on SP-5PW (21.5 mm ID x 150 mm L, Tosoh Corporation) equilibrated with 100 mM phosphate buffer + 200 mM NaCl (pH 5.0), -100% B (B = 10
0 mM phosphate buffer + 200 mM NaCl, pH 9.
Elution was performed with a step gradient of 0) for 55 minutes at a flow rate of 6 ml / min, and the NT-3 fractions were pooled. Further, ODP-50 (10 m) in which the NT-3 fraction was equilibrated with 0.1% TFA.
After adsorbing to mID × 250 mmL, Showa Denko KK, 20-60% B (B = 80% acetonitrile / 0.1%).
Elution was performed with a step gradient of 1% TFA) for 40 minutes at a flow rate of 2 ml / min. After pooling the fractions of NT-3,
Lyophilization was performed to obtain about 600 μg of NT-3.

Example 38 (Characterization of NT-3) a) Analysis using SDS polyacrylamide gel electrophoresis The NT-3 obtained in Example 37 was sample buffer containing 100 mM DTT [Laemmli, Nature, 227 , 680 (197
0)] and heated at 100 ° C. for 1 minute, and then electrophoresed on Multigel 15/25 (Daiichi Pure Chemicals). Run the gel after electrophoresis with Coomassie Brilliant Blue (Coomas
When stained with sie brilliant blue), a single band of protein was observed, and the purified product was almost single (FIG. 7).
In FIG. 7, lanes 1-2 are molecular markers and N
3 shows T-3.

N-Terminal Amino Acid Sequence Analysis The N-terminal amino acid sequence of NT-3 obtained in Example 37 was determined using a gas-phase protein sequencer (Applied Biosystems Model 477A). as a result,
The N-terminal amino acid sequence of the obtained NT-3 was identical to the N-terminal amino acid sequence of NT-3 deduced from the nucleotide sequence of the cDNA. (Table 19)

Table 19 Base sequence of NT-3 Detected Residue No. − − ＮＴ ＮＴ １９ １９ １９ Predicted from PTH-amino acid (pmol) Amino acid----------------------1 Tyr (499) Tyr 2 Ala (762 ) Ala 3 Glu (609) Glu 4 His (371) His 5 Lys (725) Lys 6 Ser (190) Ser 7 His (285) His 8 Arg (254) Arg 9 Gly (474) Gly 3 Glu 10 Glu 11 Tyr (391) Tyr 12 Ser (128) Ser 13 Val (412) Val 14 N. D. Cys 15 Asp (219) Asp 16 Ser (56) Ser 17 Glu (141) Glu 18 Ser (68) Ser 19 Leu (142) Leu 20 Trp (40) Trp ---------------- Analysis was performed using 1 nmol.

B) Analysis of amino acid composition The amino acid composition of NT-3 obtained in Example 37 was determined using an amino acid analyzer (Beckman System 6300E). The results were consistent with the amino acid composition estimated from the nucleotide sequence of the NT-3 cDNA (Table 20).

[Table 20] Amino acid composition analysis --------------------------------------------------------------------------------------------------------- Base sequence of NT-3 per mole of amino acid Number of amino acid residues Expected value from Asx 11.1 11 Thr ¹⁾ 9.0 9 Ser ¹⁾ 12 Asx 11.1 11 Thr ¹⁾ 12 0.012 Glx 11.011 Pro 2.02 Gly 7.88 Ala 4.75 Cys ²⁾ 6 Val 9.09 Met 00 Ile 6.6 7 Leu 5.15 Tyr 4.85 Phe 0.91 His 4.14 Lys 10.0 10 Arg 9.8 10 Trp ²⁾ 4 −−−−−−−−−−−−−−−−−−−−−−−−−−−− --- Acid hydrolysis (6N HCl-1% phenol, average value of hydrolysis at 110 ° C for 24 and 48 hours) 1) Extrapolated value at 0 hour ) N. D. The analysis was performed using about 20 μg.

C-terminal amino acid analysis The C-terminal amino acid of NT-3 obtained in Example 37 was determined using an amino acid analyzer (Beckman System 6300E). The C-terminal amino acid sequence of the obtained NT-3 was consistent with the C-terminal amino acid deduced from the nucleotide sequence of cDNA (Table 21).

[Table 21]

Example 39 (Measurement of Biological Activity of NT-3) The biological activity of NT-3 obtained in Example 37 was measured using a DRG, and NT-3 obtained from CHO cells was measured.
It was confirmed to have activity equivalent to 3.

Example 40 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 40 mg of t-NT-3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min, and the diketone body fractions of Met-NT-3 were pooled. Subsequently, an equal amount of 4M acetic acid-
After adding a 4 M sodium acetate solution, trilen-3,4
-Diamine was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 41 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 40 mg of t-NT-3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min, and the diketone body fractions of Met-NT-3 were pooled. Subsequently, an equal amount of 4M acetic acid-
After adding a 4 M sodium acetate solution, 2,3-diaminophenol was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 42 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 40 mg of t-NT-3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min, and the diketone body fractions of Met-NT-3 were pooled. Subsequently, an equal amount of 4M acetic acid-
After adding a 4 M sodium acetate solution, 3,4-diaminobenzoic acid was added to a concentration of 40 mM, and the mixture was degassed.
Nitrogen gas sealing was performed, and the reaction was performed at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37, and NT
-3 was obtained.

Example 43 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 40 mg of t-NT-3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min, and the diketone body fractions of Met-NT-3 were pooled. Subsequently, an equal amount of 4M acetic acid-
After addition of a 4M sodium acetate solution, 4-chloro-o-
Phenylenediamine was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 44 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 40 mg of t-NT-3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper sulfate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min, and the diketone body fractions of Met-NT-3 were pooled. Subsequently, cysteamine was added to this fraction for 4 hours.
The solution was added to a concentration of 0 mM, adjusted to pH 8.5, degassed, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 45 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 20 mg of t-NT-3 in 2 ml of a 3 M urea solution, a solution of 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM nickel sulfate, 6 M urea 2 m
1 was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was mixed with 2.5 M urea + 50 mM phosphate buffer (pH 6.
Sephadex G-25 equilibrated in 0)
The solution was passed through a column (25 mm ID × 600 mm L), and the solution used for equilibration was developed at a flow rate of 6 ml / min.
The diketone fractions of NT-3 were pooled. Subsequently, an equal amount of a 4M acetic acid-4M sodium acetate solution was added to this fraction, o-phenylenediamine was added to a concentration of 40 mM, degassing was performed, and nitrogen gas sealing was performed.
The reaction was performed for 5 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 46 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 20 mg of t-NT-3 in 2 ml of a 3 M urea solution, a solution of 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM cobalt chloride, and 6 M urea solution 2 m
1 was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was mixed with 2.5 M urea + 50 mM phosphate buffer (pH 6.
Sephadex G-25 equilibrated in 0)
The solution was passed through a column (25 mm ID × 600 mm L), and the solution used for equilibration was developed at a flow rate of 6 ml / min.
The diketone fractions of NT-3 were pooled. Subsequently, an equal amount of a 4M acetic acid-4M sodium acetate solution was added to this fraction, o-phenylenediamine was added to a concentration of 40 mM, degassing was performed, and nitrogen gas sealing was performed.
The reaction was performed for 5 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 47 Methionine added Me at the N-terminal obtained in Reference Example 3
After dissolving 20 mg of t-NT-3 in 2 ml of a 3 M urea solution, 2 ml of a solution of 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM zinc sulfate, and 6 M urea was added, and reacted at 25 ° C. for 1 hour. After the completion of the reaction, the reaction solution was treated with 2.5 M urea + 50 mM phosphate buffer (pH 6.0).
The solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated in step 2, and the solution used for equilibration was developed at a flow rate of 6 ml / min.
The diketone body fraction of -3 was pooled. Subsequently, an equal volume of 4M acetic acid-4M sodium acetate solution was added to this fraction,
o-Phenylenediamine was added to a concentration of 40 mM, deaerated, sealed with nitrogen gas, and reacted at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 48 Me obtained by adding Methionine to the N-terminal obtained in Reference Example 3
After dissolving 40 mg of t-NT-3 in 4 ml of a 3M urea solution, 0.5 ml of 50 mM copper acetate and 0.5 g of glyoxylic acid were added.
A mixed solution of 25 g and 0.5 ml of pyridine was added and reacted at 25 ° C. for 1 hour. After completion of the reaction, the reaction solution was treated with 2.5 M urea +
Sephadex G-25 column (25 mm ID) equilibrated with 50 mM phosphate buffer (pH 6.0)
× 600 mmL) and the solution used for equilibration was 6 m
It was developed at a flow rate of 1 / min, and the diketone body fractions of Met-NT-3 were pooled. Subsequently, an equal amount of 4M acetic acid-
After the addition of a 4M sodium acetate solution, o-phenylenediamine was added to a concentration of 40 mM, degassing and nitrogen gas sealing were performed, and the reaction was carried out at 37 ° C for 15 hours. After completion of the reaction, purification was performed in the same manner as in Example 37, and NT-
3 was obtained.

Example 49 Me obtained by adding methionine to the N-terminus obtained in Reference Example 3
After dissolving 20 mg of t-NT-3 in 2 ml of a 3 M urea solution, 2 ml of a solution of 4 M sodium acetate, 0.8 M acetic acid, 0.4 M glyoxylic acid, 10 mM copper sulfate, and 3 M urea are added, and reacted at 25 ° C. for 1 hour. did. After completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated with 2.5 M urea + 50 mM phosphate buffer (pH 6.0), and the solution used for equilibration was used. Is developed at a flow rate of 6 ml / min, and Met-NT-
The three diketone fractions were pooled. Subsequently, an equal volume of 4M acetic acid-4M sodium acetate solution was added to this fraction,
-Phenylenediamine was added to a concentration of 40 mM, degassed, sealed with nitrogen gas, and reacted at 37 ° C for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37 to obtain NT-3.

Example 50 Me obtained by adding methionine to the N-terminal obtained in Reference Example 3
After dissolving 20 mg of t-NT-3 in 2 ml of 3M urea solution, 1M imidazole, 0.5M glyoxylic acid, 2M
Add 2 ml of 0 mM copper sulfate, 3 M urea solution, and add
For 1 hour. After the completion of the reaction, the reaction solution was equilibrated with 2.5 M urea + 50 mM phosphate buffer (pH 6.0), and was separated on a Sephadex G-25 column (25 mm I).
D × 600 mmL), and the solution used for equilibration
The mixture was developed at a flow rate of ml / min, and the diketone fractions of Met-NT-3 were pooled. Subsequently, an equal amount of a 4M acetic acid-4M sodium acetate solution was added to this fraction, and o-phenylenediamine was added to a concentration of 40 mM, followed by degassing.
Nitrogen gas sealing was performed, and the reaction was performed at 37 ° C. for 15 hours. After completion of the reaction, purification was carried out in the same manner as in Example 37, and NT
-3 was obtained.

The activation of the modified Met-NT-3 and the purification of the activated Met-NT-3 can be carried out, for example, by the following method. That is, after the pellet solution obtained in Reference Example 3 (5) was centrifuged (10000 rpm), the supernatant was 1.8 M urea, 0.2 M Arg, 0.1 M argin.
Diluted about 20 times with 2 mM GSSG, 1.0 mM GSH, 100 mM phosphate buffer (pH 8.5),
Refolding of denatured Met-NT-3 can be performed in 4 weeks. After the refolding was completed, the regenerating solution was adjusted to pH 6.0, and adsorbed on an SP-Sepharose column (22 mm ID × 120 mm L) equilibrated with 100 mM phosphate buffer (pH 6.0).
mM NaCl / 100 mM phosphate buffer (pH 6.
0), fractions containing Met-NT-3 were pooled, followed by ODP-equilibrated with 0.1% TFA.
50 (21.5 mm ID × 300 mm L) (Showa Denko KK) and eluted with a step gradient of 0 to 80% B (B = acetonitrile / 0.1% TFA) for 60 minutes at a flow rate of 5 ml / min. The obtained fraction of NT-3 can be lyophilized to obtain a powder of Met-NT-3. Furthermore, refolding can be performed using citrulline, alanine, valine, lysine, aspartic acid, or the like instead of arginine described above.

Example 51 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Glyoxylic acid 1.55 g, 0.1 M nickel chloride 3.375 ml, 4 M sodium acetate, 20 g
3.375 ml of a solution of mM acetic acid and 6 M urea was added, and reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with a 20 mM ammonium acetate buffer solution (pH 5.0) using a Sephadex G-25 column (25 mm ID × 600 mm).
L) at a flow rate of 300 ml / h, and Met-IL-
The 2 diketone fractions were pooled. Then add o to this fraction
-Phenylenediamine was added to a concentration of 40 mM, degassed and sealed with nitrogen gas, and reacted at 37 ° C for 21 hours. After completion of the reaction, IL was prepared according to the method of Example 8.
-2 lyophilized powder was obtained.

Example 52 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Glyoxylic acid 1.55 g, 0.1M cobalt chloride 3.375 ml, 4M sodium acetate, 20 g
3.375 ml of a solution of mM acetic acid and 6 M urea was added, and reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with a 20 mM ammonium acetate buffer solution (pH 5.0) using a Sephadex G-25 column (25 mm ID × 600 mm).
L) at a flow rate of 300 ml / h, and Met-IL-
The 2 diketone fractions were pooled. Then add o to this fraction
-Phenylenediamine was added to a concentration of 40 mM, degassed and sealed with nitrogen gas, and reacted at 37 ° C for 21 hours. After completion of the reaction, IL was prepared according to the method of Example 8.
-2 lyophilized powder was obtained.

Example 53 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Glyoxylic acid 1.55 g, 0.1 M zinc sulfate 3.375 ml, 4 M sodium acetate, 20 mM
3.375 ml of a solution of acetic acid and 6 M urea was added, and the mixture was reacted at room temperature for 1 hour. After completion of the reaction, a Sephadex G-25 column (25 mm ID × 600 mm L) in which the reaction solution was equilibrated with a 20 mM ammonium acetate buffer (pH 5.0).
At a flow rate of 300 ml / h, and the diketone body fraction of Met-IL-2 was pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 40 mM,
After degassing and sealing with nitrogen gas, the reaction was carried out at 37 ° C. for 21 hours. After completion of the reaction, IL-2 was prepared according to the method of Example 8.
Of lyophilized powder was obtained.

Example 54 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Then, 1.55 g of glyoxylic acid, 3.375 ml of 0.1 M copper acetate, a solution of 4 M sodium acetate, 20 mM acetic acid, and 6 M urea, and 3.375 ml, were added at room temperature.
Reacted for hours. After the completion of the reaction, the reaction solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated with a 20 mM ammonium acetate buffer (pH 5.0) at a flow rate of 300 ml / h, and the diketone of Met-IL-2 was obtained. Body fractions were pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 40 mM, and after degassing and sealing with nitrogen gas, the mixture was reacted at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 55 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Then, a mixed solution of 1.55 g of glyoxylic acid, 3.375 ml of 0.1 M copper sulfate and 3.375 ml of pyridine was added, and the mixture was reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with a 20 mM ammonium acetate buffer (pH 5.0) using a Sephadex G-25 column (25 mm ID ×
(600 mmL) at a flow rate of 300 ml / h.
The diketone fractions of t-IL-2 were pooled. Subsequently, this fraction was adjusted to pH 8.5, and cysteamine was added to 40%.
After adding to a concentration of mM, degassing and sealing with nitrogen gas, the reaction was carried out at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 56 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminal obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Then, a mixed solution of 1.55 g of glyoxylic acid, 3.375 ml of 0.1 M copper sulfate and 3.375 ml of pyridine was added, and the mixture was reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with a 20 mM ammonium acetate buffer (pH 5.0) using a Sephadex G-25 column (25 mm ID ×
(600 mmL) at a flow rate of 300 ml / h.
The diketone fractions of t-IL-2 were pooled. Subsequently, to this fraction, tolylene-3,4-diamine was added to a concentration of 40 mM, and after performing degassing and nitrogen gas sealing,
The reaction was performed at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 57 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Then, a mixed solution of 1.55 g of glyoxylic acid, 3.375 ml of 0.1 M copper sulfate and 3.375 ml of pyridine was added, and the mixture was reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with a 20 mM ammonium acetate buffer (pH 5.0) using a Sephadex G-25 column (25 mm ID ×
(600 mmL) at a flow rate of 300 ml / h.
The diketone fractions of t-IL-2 were pooled. Subsequently, 4-chloro-o-phenylenediamine was added to this fraction for 40 m.
After adding M concentration and performing degassing and nitrogen gas sealing, the reaction was carried out at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 58 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Then, a mixed solution of 1.55 g of glyoxylic acid, 3.375 ml of 0.1 M copper sulfate and 3.375 ml of pyridine was added, and the mixture was reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with a 20 mM ammonium acetate buffer (pH 5.0) using a Sephadex G-25 column (25 mm ID ×
(600 mmL) at a flow rate of 300 ml / h.
The diketone fractions of t-IL-2 were pooled. Subsequently, 3,4-diaminobenzoic acid was added to this fraction to a concentration of 40 mM, degassed, and sealed with nitrogen gas.
The reaction was performed at 7 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 59 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminal obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
Then, a mixed solution of 1.55 g of glyoxylic acid, 3.375 ml of 0.1 M copper sulfate and 3.375 ml of pyridine was added, and the mixture was reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with a 20 mM ammonium acetate buffer (pH 5.0) using a Sephadex G-25 column (25 mm ID ×
(600 mmL) at a flow rate of 300 ml / h.
The diketone fractions of t-IL-2 were pooled. Subsequently, 2,3-diaminophenol was added to this fraction to a concentration of 40 mM, and after degassing and sealing with nitrogen gas,
The reaction was performed at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 60 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
And dissolved in 0.5M glyoxylic acid, 20mM zinc sulfate, 40mM ammonium acetate buffer (pH 5), 6M
An equal volume of a solution of M urea was added and reacted at room temperature for 1 hour. After completion of the reaction, the reaction solution was diluted with a 20 mM ammonium acetate buffer (p
The mixture was passed through a Sephadex G-25 column (25 mm ID × 600 mm L) equilibrated with H5.0) at a flow rate of 300 ml / h, and the diketone body fraction of Met-IL-2 was pooled. Subsequently, o-phenylenediamine was added to this fraction for 2 hours.
After adding to a concentration of 0 mM, degassing and sealing with nitrogen gas, the reaction was carried out at 37 ° C. for 21 hours. After the reaction,
According to the method of Example 8, a lyophilized powder of IL-2 was obtained.

Example 61 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
And dissolved in 0.5 M glyoxylic acid, 20 mM copper acetate, 40 mM ammonium acetate buffer (pH 5), 6 M
An equal amount of a urea solution was added and reacted at room temperature for 1 hour. After completion of the reaction, the reaction solution was washed with 20 mM ammonium acetate buffer (pH
The solution was passed through a Sephadex G-25 column (25 mm ID × 600 mmL) equilibrated in 5.0) at a flow rate of 300 ml / h, and the diketone body fraction of Met-IL-2 was pooled. Subsequently, o-phenylenediamine was added to this fraction for 2 hours.
After adding to a concentration of 0 mM, degassing and sealing with nitrogen gas, the reaction was carried out at 37 ° C. for 21 hours. After the reaction,
According to the method of Example 8, a lyophilized powder of IL-2 was obtained.

Example 62 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
And dissolved in 0.5M glyoxylic acid, 20 mM nickel chloride, 40 mM ammonium acetate buffer (pH
5) An equal volume of a 6 M urea solution was added and reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with 20 mM ammonium acetate buffer (pH 5.0) and Sephadex G-2 was equilibrated.
300ml in 5 columns (25mmID x 600mmL)
/ H, and the diketone fraction of Met-IL-2 was pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 20 mM, and after degassing and sealing with nitrogen gas, the mixture was reacted at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 63 20 mg of human interleukin 2 (Met-IL-2) having methionine added to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
And dissolved in 0.5 M glyoxylic acid, 20 mM cobalt chloride, 40 mM ammonium acetate buffer (pH
5) An equal volume of a 6 M urea solution was added and reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was equilibrated with 20 mM ammonium acetate buffer (pH 5.0) and Sephadex G-2 was equilibrated.
300ml in 5 columns (25mmID x 600mmL)
/ H, and the diketone fraction of Met-IL-2 was pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 20 mM, and after degassing and sealing with nitrogen gas, the mixture was reacted at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 64 20 mg of human interleukin-2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
And dissolved in 20 mM Tris HCl containing 3 M urea
(PH 8) Dialysis was performed against 2 L. This dialysis solution contains 1
Equivalent amounts of M imidazole, 0.5 M glyoxylic acid, 20 mM copper sulfate, and 2.5 M urea solution were mixed and reacted at room temperature for 1 hour. After the completion of the reaction, the reaction solution was separated with Sephadex G-equilibrated with 20 mM ammonium acetate buffer (pH 5.0).
300m in 25 columns (25mmID x 600mmL)
The solution was passed at a flow rate of 1 / h, and the diketone body fraction of Met-IL-2 was pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 20 mM, and after degassing and sealing with nitrogen gas, the mixture was reacted at 37 ° C. for 21 hours. After completion of the reaction, a freeze-dried powder of IL-2 was obtained according to the method of Example 8.

Example 65 20 mg of human interleukin 2 (Met-IL-2) obtained by adding methionine to the N-terminus obtained in Reference Example 5 was added.
27 ml of 0 mM ammonium acetate buffer (pH 5.0)
And dissolved in 20 mM Tris HCl containing 3 M urea
(PH 8) Dialysis was performed against 2 L. 4
M sodium acetate, 0.4 M glyoxylic acid, 10 mM
Mix equal amounts of copper sulfate, 0.8M acetic acid and 2.5M urea solution,
The reaction was performed at room temperature for 1 hour. After the reaction is completed, the reaction solution is
Sephadex G-25 column (25 mm ID × 600 m) equilibrated with ammonium acetate buffer (pH 5.0)
mL) at a flow rate of 300 ml / h, and Met-IL
-2 diketone fractions were pooled. Subsequently, o-phenylenediamine was added to this fraction to a concentration of 20 mM, deaerated and sealed with nitrogen gas.
Reacted for hours. After completion of the reaction, I
A freeze-dried powder of L-2 was obtained.

Reference Example 10 E. coli MM294 (DE3) / pE-C35PTH (I
FO15213; FERM BP-3508) (Japanese Unexamined Patent Publication (Kokai) No. Hei 5-304976) was prepared by adding 1%
% Yeast extract, 0.5% sodium chloride, 50μg
The suspension was inoculated into 1 L of a liquid medium (pH 7) containing / ml of ampicillin, and cultured at 30 ° C. with rotary shaking. 1 L of this culture
1% bactotripton, 0.5% yeast extract,
Liquid medium containing 0.5% sodium chloride (pH 7) 19
L was inoculated and cultured with aeration and stirring at 30 ° C. for 8 hours. Transfer 17 L of this culture solution to a 500 L fermenter containing 343 L of M-9 medium (1.5% casamino acid, 1.5% glucose, 0.0005% vitamin B ₁ ), and carry out aeration stirring at 37 ° C. for 7 hours. The culture was performed to obtain about 350 L of a culture solution. This culture was centrifuged to obtain about 4 kg of wet cells,
It was stored frozen at 80 ° C. The above E. coli MM294 (DE
3) / pE-C35PTH has accession number IFO1521
No. 3 has been deposited with the Institute of Fermentation (IFO).

Reference Example 11 To 10 g of frozen cells, 40 ml of 20 mM ammonium acetate buffer (pH 5) containing 7 M guanidine hydrochloride was added to dissolve the cells, followed by centrifugation (10,000 rpm, 60 rpm).
Min) to obtain about 40 ml of a bacterial cell extract. About 2 L of a 20 mM ammonium acetate buffer solution (p
H5), and then centrifuged (4,200 rpm, 2
0 min) to obtain about 2 L of the centrifuged supernatant. The supernatant is applied to an SP-Toyopearl 650M column (5 cm × 30 c).
m), adsorbed and washed, and eluted with 20 mM ammonium acetate buffer (pH 5) containing 1 M sodium chloride. This eluate is applied to an ODS-120T column (21.
5 cm × 30 cm, TOSOH) and high-performance liquid chromatography using a concentration gradient elution method using 0.1% trifluoroacetic acid and 80% acetonitrile containing 0.1% trifluoroacetic acid.
The et [Cys ³⁵ ] PTH (1-84) fraction was obtained. This solution was dialyzed against 5 L of 0.1 M acetic acid containing 6 M urea to obtain a dialysate. About 4 mg of DMA was added to the obtained dialysate.
P-CN (1-cyano-4-dimethylaminopyridinium tetrafluoroborate) was added and reacted at room temperature for 15 minutes to give Met- [Cys (CN) ³⁵ ] PTH (1-84).
I got The obtained reaction solution was SP-Toyopearl 650M
(2.0 cm x 30 cm) and adsorbed.
After washing with 20 mM ammonium acetate buffer (pH 5) containing 0 mM sodium chloride to remove the reagent,
Elution was carried out with a 20 mM ammonium acetate buffer (pH 5) containing 1 M sodium chloride. The eluate is 5 L of 6 M
Dialysis was performed against urea to obtain about 8 ml of a dialysate. The obtained dialysate was ice-cooled, 400 μl of 1N sodium hydroxide was added, and reacted at 0 ° C. for 10 minutes. The obtained reaction solution was
Gel filtration was performed using Toyopearl HW-50F (2 cm × 50 cm) equilibrated with 0 mM ammonium acetate buffer (pH 5), and the MetPTH (1-34) fractions were pooled. The obtained MetPTH (1-34) fraction was OD
Adsorption by high performance liquid chromatography using a S-120T column (21.5 cm × 30 cm, Tosoh) and a gradient elution method using 0.1% trifluoroacetic acid and 80% acetonitrile containing 0.1% trifluoroacetic acid, Eluted and approximately 50 ml of MetPTH (1-34)
Fractions were obtained. This eluate was lyophilized to obtain about 5 mg of Me.
tPTH (1-34) was obtained.

Example 66 M obtained by adding methionine to the N-terminal obtained in Reference Example 11
After dissolving 5 mg of et-PTH (1-34) in 1 ml of distilled water, 46.4 mg of glyoxylic acid, 2.5 m of copper sulfate
g and 94.8 mg of pyridine were added and reacted at room temperature for 1 hour. After the completion of the reaction, centrifugation was performed, and the supernatant was subjected to an ODP-50 column (1 cm × 25 cm, Showa Denko) and 20 mM ammonium acetate (pH 5) containing 10% acetonitrile and 20% containing 60% acetonitrile.
It was adsorbed and eluted by high performance liquid chromatography using a concentration gradient elution method with M ammonium acetate (pH 5), and about 5.4 ml of the diketone fraction of Met-PTH (1-34) was pooled. Next, this fraction was freeze-dried, and distilled water was added to the obtained freeze-dried product to make up to 4 ml.
4M acetic acid, 4 mM, containing 0 mM o-phenylenediamine
After adding 4 ml of a mixed solution of M sodium acetate and performing degassing nitrogen gas sealing, the mixture was reacted at 37 ° C. for 17 hours. After completion of the reaction, the reaction solution was applied to an ODP-50 column (1 cm × 25 c
m, Showa Denko) and high-performance liquid chromatography using a concentration gradient elution method using 0.1% trifluoroacetic acid and 80% acetonitrile containing 0.1% trifluoroacetic acid. 34) Fractions were pooled. The pooled PTH (1-34) fraction was diluted 5-fold with 20 mM ammonium acetate (pH 5),
M urea in 20 mM ammonium acetate buffer (pH
SP-5PW column (7.5 mm × 7) equilibrated in 5)
5 mm, Tosoh), 0-50% B (B: 2
0 mM MES-2M urea-0.5M sodium chloride, p
H8) Concentration gradient was performed for 30 minutes at a flow rate of 0.8 ml / min, and PTH (1-34) fractions were pooled. This fraction was dialyzed against 1 L of distilled water, freeze-dried, and
A freeze-dried powder of (1-34) was obtained.

Example 67 (Characterization of PTH (1-34)) a) Analysis using SDS polyacrylamide gel electrophoresis The PTH (1-34) obtained in Example 66 was added to a sample buffer [NOVEX JAPAN]. After suspending, Peptide-PAGE m
Electrophoresis was performed with ini [TEFCO]. When the gel after electrophoresis was stained with Coomassie Brilliant Blue, it was a single band (FIG. 8). In FIG. 8, lanes 1-2 are shown.
Indicates a molecular weight marker and PTH (1-34).

B) Analysis of N-terminal amino acid sequence The N-terminal amino acid sequence was determined using a gas phase protein sequencer (Applied Biosystems model 477A). As a result, it was consistent with the N-terminal amino acid sequence predicted from the base sequence of PTH (1-34). (Table 22)

[Table 22] N-terminal amino acid sequence analysis-----------------Detected PTH (1-34) residue No. . Amino acid predicted (pmol) from the base sequence of PTH ¹⁾ -amino acid --------------------------- 1 Ser (71) Ser 2 Val (243) Val 3 Ser (91) Ser 4 Glu (139) Glu 5 Ile (198) Ile 6 Gln (55) Gln 7 Leu (86) Leu 8 Met (118) Met 9 His (His) Asn (95) Asn 11 Leu (135) Leu 12 Gly (77) Gly 13 Lys (50) Lys 14 His (30) His 15 Leu (103) Leu 16 Asn (40) Asn 17 Ser (17 Ser) 36) Met 19 Glu (35) Glu 20 Arg (27) Arg ----------- ------------------- were analyzed by using the 400 pmol. ¹⁾ phenylthiohydantoin

C) Amino acid composition analysis The amino acid composition was determined using an amino acid analyzer (Hitachi L-8500A).
Amino Acid Analyzer). as a result,
It was consistent with the amino acid composition predicted from the cDNA base sequence of PTH (1-34) (Table 23).

[Table 23] Amino acid composition analysis Number of residues Predicted value from base sequence ---------------------------------------------------------- Asx 4.04 Thr 00 Ser 2.8 3 Glx 4.95 Pro 0 Gly 1.01 Ala 00 Cys-0 Val 2.93 Met 2.0 2 Ile 0.91 Leu 5.05 Tyr 00 Phe 1.0 1 His 3.0 3 Lys 2.9 3 Arg 2.0 2 Trp 1.0 1 -------------------------- -------------------------- -Acid hydrolysis (6N HCl-4% thioglycolic acid, hydrolysis at 110 ° C for 24 hours)-Not detected

D) C-terminal amino acid analysis The C-terminal amino acid was analyzed using an amino acid analyzer (Hitachi L-8500A).
Amino Acid Analyzer). as a result,
This coincided with the C-terminal amino acid predicted from the nucleotide sequence of PTH (1-34). (Table 24)

[Table 24] C-terminal amino acid analysis C-terminal amino acid recovery (%)----------------------------- −−−−−−−−−−−− PTH (1-34) Phe 94.4 −−−−−−−−−−−−−−−−−−−−−−−−−−−−− Gas phase hydrazine decomposition method (100 ° C., 6 hours) e) Biological activity The biological activity was measured using a osteoblast-like cell line MC3T3-E1 cell [Nakagawa, S et al., BIOCHEMICAL AND B
IOPHYSICAL RESEARCH COMMUNICATIONDS, 200 , 1735-17
41 (1994)], and confirmed to have the same activity as the standard.

Example 68 Me obtained by adding methionine to the N-terminal obtained in Reference Example 11
5 mg of t-PTH (1-34) is dissolved in 1 ml of 4 M urea, and 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM nickel chloride, 4 M urea solution 1
and reacted at room temperature for 1 hour. After the reaction,
After centrifugation, the supernatant was subjected to ODP in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a -50 column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was lyophilized and dissolved in 4 ml of distilled water, and then containing 4OmM o-phenylenediamine.
After adding 4 ml of a solution of M acetic acid and 4 M sodium acetate and performing degassing nitrogen gas sealing, the mixture was reacted at 37 ° C. for 17 hours. After the completion of the reaction, purification was performed in the same manner as in Example 66,
A freeze-dried powder of PTH (1-34) was obtained.

Example 69 Me obtained by adding methionine to the N-terminal obtained in Reference Example 11
5 mg of t-PTH (1-34) is dissolved in 1 ml of 4 M urea, and 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM cobalt chloride, 4 M urea solution 1
and reacted at room temperature for 1 hour. After the reaction,
After centrifugation, the supernatant was subjected to ODP in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a -50 column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was lyophilized and dissolved in 4 ml of distilled water, and then containing 4OmM o-phenylenediamine.
After adding 4 ml of a solution of M acetic acid and 4 M sodium acetate and performing degassing nitrogen gas sealing, the mixture was reacted at 37 ° C. for 17 hours. After the completion of the reaction, purification was performed in the same manner as in Example 66,
A freeze-dried powder of PTH (1-34) was obtained.

Example 70 Me obtained by adding methionine to the N-terminal obtained in Reference Example 11
5 mg of t-PTH (1-34) is dissolved in 1 ml of 4 M urea, and 1 ml of 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM zinc sulfate, and 4 M urea solution
And reacted at room temperature for 1 hour. After completion of the reaction, centrifugation was performed, and the supernatant was subjected to ODP-5 in the same manner as in Example 66.
Purification by high performance liquid chromatography using a 0 column gave a diketone fraction of Met-PTH (1-34). Next, this fraction was freeze-dried, dissolved in 4 ml of distilled water, 4 ml of a 4 M acetic acid, 4 M sodium acetate solution containing 80 mM o-phenylenediamine was added, and after degassing nitrogen gas sealing, Reaction was performed at 17 ° C. for 17 hours. After completion of the reaction, purification was performed in the same manner as in Example 66, and PTH was purified.
A freeze-dried powder of (1-34) was obtained.

Example 71 Me with methionine added to the N-terminus obtained in Reference Example 11
5 mg of t-PTH (1-34) was dissolved in 1 ml of 4 M urea, mixed with 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM copper acetate, and 1 ml of 4 M urea solution, and reacted at room temperature for 1 hour. . After the completion of the reaction, centrifugation was performed, and the supernatant was subjected to ODP-50 in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was freeze-dried, dissolved in 4 ml of distilled water, 4 ml of a 4 M acetic acid, 4 M sodium acetate solution containing 80 mM o-phenylenediamine was added, and after degassing nitrogen gas sealing, Reaction was performed at 17 ° C. for 17 hours. After completion of the reaction, purification was performed in the same manner as in Example 66, and PTH was purified.
A freeze-dried powder of (1-34) was obtained.

Example 72 Me with methionine added to the N-terminus obtained in Reference Example 11
5 mg of t-PTH (1-34) was dissolved in 1 ml of 4 M urea, mixed with 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM copper sulfate, and 1 ml of a 4 M urea solution, and reacted at room temperature for 1 hour. . After the completion of the reaction, centrifugation was performed, and the supernatant was subjected to ODP-50 in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was lyophilized, dissolved in 4 ml of 50 mM Tris · HCl (pH 8.5), cysteamine was added to a final concentration of 40 mM, and the mixture was degassed with nitrogen gas. Reacted for hours. After completion of the reaction, purification was carried out in the same manner as in Example 66, and PTH (1-34)
Of lyophilized powder was obtained.

Example 73 Me with methionine added to the N-terminus obtained in Reference Example 11
5 mg of t-PTH (1-34) was dissolved in 1 ml of 4 M urea, mixed with 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM copper sulfate, and 1 ml of a 4 M urea solution, and reacted at room temperature for 1 hour. . After the completion of the reaction, centrifugation was performed, and the supernatant was subjected to ODP-50 in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was lyophilized and dissolved in 4 ml of distilled water, and then containing 4OmM of trilen-3,4-diamine.
After adding 4 ml of a solution of M acetic acid and 4 M sodium acetate and performing degassing nitrogen gas sealing, the mixture was reacted at 37 ° C. for 17 hours. After the completion of the reaction, purification was performed in the same manner as in Example 66,
A freeze-dried powder of PTH (1-34) was obtained.

Example 74 Me obtained by adding methionine to the N-terminal obtained in Reference Example 11
5 mg of t-PTH (1-34) was dissolved in 1 ml of 4 M urea, mixed with 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM copper sulfate, and 1 ml of a 4 M urea solution, and reacted at room temperature for 1 hour. . After the completion of the reaction, centrifugation was performed, and the supernatant was subjected to ODP-50 in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was freeze-dried, dissolved in 4 ml of distilled water, and 4 ml of a 4 M acetic acid and 4 M sodium acetate solution containing 80 mM 4-chloro-o-phenylenediamine was added, followed by degassing nitrogen gas sealing. After that, the reaction was carried out at 37 ° C. for 17 hours. After completion of the reaction, purification was carried out in the same manner as in Example 66 to obtain a lyophilized powder of PTH (1-34).

Example 75 Me with methionine added to the N-terminus obtained in Reference Example 11
5 mg of t-PTH (1-34) was dissolved in 1 ml of 4 M urea, mixed with 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM copper sulfate, and 1 ml of a 4 M urea solution, and reacted at room temperature for 1 hour. . After the completion of the reaction, centrifugation was performed, and the supernatant was subjected to ODP-50 in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was lyophilized, dissolved in 4 ml of distilled water, and then dissolved in 4M containing 80 mM 3,4-diaminobenzoic acid.
Acetic acid, 4 ml of a 4 M sodium acetate solution were added, and after degassing nitrogen gas sealing, the reaction was carried out at 37 ° C. for 17 hours.
After completion of the reaction, purification was carried out in the same manner as in Example 66, and PT
A freeze-dried powder of H (1-34) was obtained.

Example 76 Me obtained by adding methionine to the N-terminal obtained in Reference Example 11
5 mg of t-PTH (1-34) was dissolved in 1 ml of 4 M urea, mixed with 4 M sodium acetate, 20 mM acetic acid, 0.4 M glyoxylic acid, 20 mM copper sulfate, and 1 ml of a 4 M urea solution, and reacted at room temperature for 1 hour. . After the completion of the reaction, centrifugation was performed, and the supernatant was subjected to ODP-50 in the same manner as in Example 66.
Purification was performed by high performance liquid chromatography using a column to obtain a diketone fraction of Met-PTH (1-34). Next, this fraction was freeze-dried, dissolved in 4 ml of distilled water, and then added with 80 mM 2,3-diaminophenol.
After adding 4 ml of a solution of M acetic acid and 4 M sodium acetate and performing degassing nitrogen gas sealing, the mixture was reacted at 37 ° C. for 17 hours. After the completion of the reaction, purification was performed in the same manner as in Example 66,
A freeze-dried powder of PTH (1-34) was obtained.

Example 77 Me obtained by adding methionine to the N-terminal obtained in Reference Example 11
5 mg of t-PTH (1-34) was added to 1 ml of 3M urea-2.
It was dissolved in 0 mM Tris / HCl (pH 8.0), mixed with 1 M imidazole, 0.5 M glyoxylic acid, 20 mM copper sulfate and 1 ml of a 2.5 M urea solution, and reacted at room temperature for 1 hour. After completion of the reaction, centrifugation was performed, and the supernatant was purified by high performance liquid chromatography using an ODP-50 column in the same manner as in Example 66, and Met-PTH (1
A diketone fraction of -34) was obtained. Next, this fraction was freeze-dried, dissolved in 4 ml of distilled water, 4 ml of a 4 M acetic acid solution containing 80 mM o-phenylenediamine, and 4 ml of a 4 M sodium acetate solution were added.
The reaction was performed at 37 ° C. for 17 hours. After completion of the reaction, purification was carried out in the same manner as in Example 66 to obtain a lyophilized powder of PTH (1-34).

Example 78 Me with methionine added to the N-terminal obtained in Reference Example 11
5 mg of t-PTH (1-34) was added to 1 ml of 3M urea-2.
It was dissolved in 0 mM Tris / HCl (pH 8.0), mixed with 4 M sodium acetate, 0.8 M acetic acid, 0.4 M glyoxylic acid, 10 mM copper sulfate, and 1 ml of 2.5 M urea solution, and reacted at room temperature for 1 hour. . After completion of the reaction, centrifugation was performed, and the supernatant was purified by high performance liquid chromatography using an ODP-50 column in the same manner as in Example 66.
A diketone body fraction of et-PTH (1-34) was obtained.

Next, this fraction was lyophilized, dissolved in 4 ml of distilled water, 4 ml of a 4M acetic acid solution containing 4OmM o-phenylenediamine and 4 ml of a 4M sodium acetate solution were added thereto, followed by degassing nitrogen gas sealing. At 37 ° C. for 17 hours. After completion of the reaction, purification was carried out in the same manner as in Example 66 to obtain a lyophilized powder of PTH (1-34).

[0142]

According to the present invention, only a methionine residue can be selectively and efficiently removed from a peptide, a protein or a salt thereof having a methionine residue which may be oxidized at the N-terminus. In addition, according to the method of the present invention, methionine residues at the N-terminal can be chemically removed under mild conditions regardless of the type of peptide or protein. Using a protein to which methionine is added as a raw material, a protein having a natural amino acid sequence can be industrially advantageously produced.

[0143]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 35 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TATGTACGCG GAGCATAAGA GTCACCGAGG GGAGT 35. SEQ ID NO: 2 Sequence length: 33 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence ACTCCCCTCG GTGACTCTTA TGCTCCGCGT ACA33.

SEQ ID NO: 3 Sequence length: 15 Sequence type: number of nucleic acid strands: single strand Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GATCCCTGGC ATGCA15. SEQ ID NO: 4 Sequence length: 10 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TATGGATGGG 10.

SEQ ID NO: 5 Sequence length: 12 Sequence type: number of nucleic acid strands: single stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AATTCCCATC CA12. SEQ ID NO: 6 Sequence length: 22 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence ATACATATGG ATGGGAATTC CA22.

SEQ ID NO: 7 Sequence length: 28 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence CCGGATCCTA GTAAAACAAG TCAACTCT 28. SEQ ID NO: 8 Sequence length: 18 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence TGCCATGAAT TCATGGCA18.

[Brief description of the drawings]

FIG. 1 shows the results of the electrophoresis obtained in Example 2a).

FIG. 2 shows the results of electrophoresis obtained in Example 5a).

FIG. 3 shows the results of the electrophoresis obtained in Example 7a).

FIG. 4 shows the results of electrophoresis obtained in Example 9a).

FIG. 5 shows the results of electrophoresis obtained in Example 11a).

FIG. 6 shows the results of electrophoresis obtained in Example 24a).

FIG. 7 shows the results of the electrophoresis obtained in Example 38a).

FIG. 8 shows the results of the electrophoresis obtained in Example 67a).

──────────────────────────────────────────────────の Continuation of front page (51) Int.Cl. ⁶ Identification number Agency reference number FI Technical indication C12R 1:19) (72) Inventor Shinji Tsuji 3-6-1-207 Minami Koshien, Nishinomiya City, Hyogo Prefecture issue

Claims (16)

[Claims] 1. A method for removing a methionine residue, comprising reacting a peptide having an optionally oxidized methionine residue at the N-terminus or a salt thereof with an α-diketone, followed by hydrolysis. 2. The method according to claim 1, wherein the peptide having an optionally oxidized methionine residue at the N-terminus is a peptide produced by genetic engineering. 3. A genetically engineered peptide comprising a growth hormone, neurotrophin-3, betacellulin, parathyroid hormone or interleukin-2 to which an optionally oxidized methionine residue is added at the N-terminus. 3. The method of claim 2, wherein: 4. The method according to claim 1, wherein the α-diketone is reacted in the presence of a transition metal ion. 5. The method according to claim 1, wherein the α-diketone is reacted in the presence of a base. 6. The method according to claim 6, wherein α-
The method according to claim 1, wherein the diketone is reacted. 7. The method according to claim 1, wherein the α-diketone is glyoxylic acid or a salt thereof. 8. The method according to claim 4, wherein the transition metal ion is a copper ion.
The described method. 9. The method according to claim 5, wherein the base is pyridine. 10. The method according to claim 1, wherein the hydrolysis is carried out using a base. 11. The method according to claim 10, wherein the base is an amine. 12. The method according to claim 10, wherein the base is a diamine or a thio or selenosemicarbazide. 13. The method according to claim 12, wherein the diamine is o-phenylenediamine. 14. A peptide selected from human growth hormone, neurotrophin-3, human betacellulin, parathyroid hormone and human interleukin-2, which is produced by genetic engineering and has a methionine added to the N-terminus, or a salt thereof. And glyoxylic acid or a salt thereof in the presence of copper sulfate and pyridine, and then reacting with o-phenylenediamine. 15. A compound of the formula CH ₃ —S (O) _m — (CH ₂ ) ₂ —CO—CO—X wherein
m represents an integer of 0 to 2, and X represents an amino acid residue or a peptide chain. Or a salt thereof. 16. A method for producing an amino acid, a peptide or a salt thereof, which comprises hydrolyzing the compound according to claim 15.