JPH1071000A - Detection of telomerase activity - Google Patents

Abstract

PROBLEM TO BE SOLVED: To detect telomerase activity for e.g. cancer diagnoses by amplifying an oligonucleotide sequence extended by DNA-extending reaction using telomerase followed by hybridizing the amplified product with a nonradioactively labeled probe. SOLUTION: An oligonucleotide sequence extended by DNA-extending reaction using telomerase is amplified by PCR using e.g. an oligonucleotide primer containing at least a base sequence of the formula AGNGTT (N is A, T, G or C) on the 3' side, and the resultant amplified product is hybridized with a prove labeled with a nonradioactive labeling substance such as an acridine derivative of formula I [X is a halogen, a group of formula II (X<1> is N, P, B or As; R<1> is an alkoxy, alkyl, aryl, etc.; R<2> is H, R<1> , etc.), etc.; Y is O, S or NH; R<3> is H, OH, an alkoxy, an alkyl, etc.; R<4> is a (substituted) alkyl, (substituted) aryl, etc.] to detect the aimed telomerase activity.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting telomerase activity, a method for detecting cancer cells, a method for diagnosing cancer, and a kit for detecting cancer cells and / or a diagnostic kit for cancer.

[0002]

2. Description of the Related Art Human somatic cells have 22 pairs of autosomes and one pair of sex chromosomes. Although a single cell has a total of 46 chromosomes, each chromosome remains independent and rarely associates with each other. Telomeres are responsible for this important function, and telomerase is responsible for maintaining the presence of telomeres. The telomere is located at the end of the chromosome, and in humans, is composed of 6 bases, 5'-TTAGGG-
It has a characteristic sequence in which 3 'is repeated several hundred times. DNA replication is essential for cell division and proliferation.
Due to the mechanism of NA replication, once the DNA is replicated, the terminal telomere of the chromosome is shortened. In other words, each time cell division is repeated, the telomere sequence becomes shorter, and when this portion is deleted, chromosome-to-chromosome linkages that adversely affect cells are induced. In addition, other genetic abnormalities add to the death of the cell (cell aging and death). The telomere sequence plays an important role in the aging and death of cells, that is, in the generational change of cells. However, if telomerase constantly adds the telomere sequence of a cell group that should be dying (an aging cell group that has accumulated genetic abnormalities), it is thought that part of the population will become immortal and eventually become cancerous. . Therefore, detecting telomerase activity is extremely useful in diagnosing cancer and monitoring the prognosis of treatment.

Recently, this telomerase activity was determined by PCR (Pol
TRAP (Telomeric Repeat Amplification Protocol) for highly sensitive detection using the ymerase Chain Reaction) method
l) The method was developed (Kim NW et al., (1994) Science, 2
06, 2011-2015; Piatyszek MA et al., (1995) Meth. Ce
ll Sci., 17, 1-15)). This method is to detect telomerase by a single primer extension assay system, and is roughly divided into three steps. First, telomerase is extracted from the cells. Next, a TTAGGG chain extension reaction is carried out by telomerase, and the reaction product is amplified by PCR using two types of primers (TS primer and CX primer). Finally,
The amplified product is electrophoresed, and the ladder is confirmed by autoradiography to detect telomerase activity. This method improved the detection sensitivity and enabled the detection of telomerase activity with as few as 10 cells.

However, among the above three steps, the detection system must perform electrophoresis, and the operation is complicated and takes a long time. For example, analysis of ³² P-labeling reaction products and fluorescence labeling reaction products by polyacrylamide gel electrophoresis or HPLC is still required,
There is a limit to the number of samples that can be detected, and in the case of ³² P, handling (for example, treatment of a large amount of waste liquid or gel) is not easy. Further, a series of operations such as a time for separation (analysis) such as gel preparation and electrophoresis and an exposure (detection) time (usually 2 to 48 hours) require a long time.

[0005] For these reasons, it is difficult to rapidly diagnose the progress and prognosis of cancer, in particular, which requires real-time analysis, and it is also difficult to analyze a large amount of samples. Therefore, development of another detection system replacing the electrophoresis and autoradiography has been desired.

[0006]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method capable of detecting telomerase activity quickly and with high sensitivity.

[0007]

Means for Solving the Problems The present inventors have conducted intensive studies based on the above-mentioned problems, and as a result, have found that D-
The NA extension reaction was performed using the hybridization protection assay (Hybr
By constructing a system in combination with an idization protection assay (HPA), it was found that telomerase activity could be detected quickly and with high sensitivity, and the present invention was completed.

That is, the present invention detects telomerase activity by amplifying an oligonucleotide sequence extended by a DNA extension reaction using telomerase, and hybridizing the resulting amplification product with a probe labeled with a non-radioactive labeling substance. This is a method for detecting telomerase activity. Non-radioactive labeling substances are, for example, acridinium esters, luminol, isoluminol, pyrogallol, protohemin, aminobutylethyl-n-isoluminol, aminohexylethyl-n-ethyl-isoluminol, or acridine derivatives. Acridine derivatives include, for example, compounds of the following formula I:

[0009]

Embedded image

Wherein X is halogen or the following formula II:

[0011]

Embedded image

(Wherein X ¹ represents a nitrogen atom, a phosphorus atom, a boron atom or an arsenic atom, and R ¹ is alkoxy or aryloxy, or a substituted or unsubstituted alkyl,
R ² represents a hydrogen atom,
Represents alkoxy or aryloxy, or substituted or unsubstituted alkyl, alkenyl or aryl. )

Or the following formula III:

(Wherein X ² represents an oxygen atom or a sulfur atom, R ² is the same as described above), Y represents an oxygen atom, a sulfur atom or NH, and R ³ represents Hydrogen atom, amino, hydroxy, thiol, carboxylic acid,
Represents halogen, nitro, alkoxy or aryloxy, or substituted or unsubstituted acetyl, alkyl, alkenyl or aryl, R ⁴ is a substituted or unsubstituted alkyl, alkenyl or aryl, R ^1,
At least one of R ² , R ³ or R ⁴ contains a reactive site capable of chemically bonding. ])).
Here, the reactive site that can be chemically bonded refers to a site that is bonded to the probe. For example, when the partner is an amino linker (the linker terminal is an amino group) via a linker, the reactive site is a site that binds to the amino group. And as a substance capable of binding to this site, for example, a carboxylic acid derivative, preferably an acid halide,
Esters and the like.

However, the present invention is not limited to the above non-radioactive labeling substances. Accordingly, in addition to the acridine derivative represented by the above formula I, those represented by the chemical formula I described in Japanese Patent No. 2602315 can be mentioned.

The amplification of the oligonucleotide sequence extended by the DNA extension reaction by telomerase is carried out by using an oligonucleotide containing at least the base sequence represented by "AGNGTT" (N represents A, T, G or C) on the 3 'side. It is carried out by a polymerase chain reaction using a primer and / or an oligonucleotide primer containing the base sequence represented by SEQ ID NO: 21. In addition, in the amplification, an oligonucleotide primer containing at least the nucleotide sequence represented by “AGNGTT” (N represents A, T, G or C) on the 3 ′ side and / or the nucleotide sequence represented by SEQ ID NO: 21 The reaction is also performed by an RNA synthesis reaction using an oligonucleotide primer containing Here, a promoter sequence is added to at least one of the oligonucleotide primers used in the RNA synthesis reaction.

Further, the amplification is carried out by 5 ′ of an oligonucleotide primer containing the nucleotide sequence represented by SEQ ID NO: 21.
Or at least one nucleotide in the nucleotide sequence of the primer
On the 5 ′ side of an oligonucleotide primer containing a nucleotide sequence in which nucleotides have been deleted, substituted or added,
Furthermore, it is also performed by a polymerase chain reaction or an RNA synthesis reaction using an oligonucleotide primer to which an arbitrary sequence that does not hybridize with the sequence represented by “TTAGGG” is added. In the present invention, conditions for non-hybridization include, for example, 30 to 120 ° C., preferably 37 ° C.
9090 ° C.

Here, at least “AGNGTT” (N is A,
Represents T, G or C. The oligonucleotide primer containing the nucleotide sequence represented by 3) on the 3 'side is SEQ ID NO: 1
And an oligonucleotide primer containing the base sequence represented by SEQ ID NO: 21 includes a primer represented by SEQ ID NO: 2. As the promoter, a T7 RNA polymerase promoter,
T3 RNA polymerase promoter or SP6 RNA
A polymerase promoter is mentioned. Furthermore, the present invention is a method for detecting cancer cells, which comprises detecting telomerase activity in cancer cells by the method for detecting telomerase activity.

The cancer cells include those contained in specimens obtained invasively or non-invasively. Samples obtained invasively include bladder tissue, prostate tissue, uterine tissue,
Cervical tissue, breast tissue, pancreatic tissue, liver tissue, colon tissue, stomach tissue, lung tissue, peripheral blood cells, kidney tissue, skin tissue, esophagus tissue, brain tissue or oral tissue, obtained non-invasively Samples include urine, prostate fluid, bladder lavage fluid, uterine smear, pancreatic juice, duodenal fluid, feces, buccal lavage fluid, intestinal lavage fluid, saliva or sputum.

Further, the present invention is a method for diagnosing cancer, which comprises detecting cancer cells by the above-mentioned method for detecting cancer cells. Cancers include bladder cancer, prostate cancer, uterine cancer, cervical cancer, breast cancer, pancreatic cancer, liver cancer, colon cancer, stomach cancer, lung cancer,
Examples include kidney cancer, skin cancer, oral cancer, esophageal cancer, brain tumor or leukemia.

Further, the present invention relates to at least “AGNGTT”
(N represents A, T, G or C.) An oligonucleotide primer containing the base sequence shown at the 3 ′ end, an oligonucleotide primer containing the base sequence shown by SEQ ID NO: 21 or the base sequences of these primers And a diagnostic reagent kit comprising an oligonucleotide primer containing a nucleotide sequence in which at least one nucleotide has been deleted, substituted or added, and a probe labeled with a non-radioactive labeling substance. The kit also includes at least one primer to which a promoter has been added. Examples of the promoter are the same as described above. The diagnostic reagent kit includes a nucleotide sequence in which at least one nucleotide is deleted, substituted or added in the 5 ′ side of an oligonucleotide primer containing the nucleotide sequence represented by SEQ ID NO: 21, or the nucleotide sequence of the primer. 5 'to the oligonucleotide primer containing
An oligonucleotide primer to which an arbitrary sequence that does not hybridize with the sequence represented by "GG" is further included.

The diagnostic kit is used for detecting telomerase activity or diagnosing cancer. Targets for cancer diagnosis include, for example, bladder cancer, prostate cancer, uterine cancer, cervical cancer, breast cancer, pancreatic cancer, liver cancer, colon cancer, stomach cancer, lung cancer,
Examples include kidney cancer, skin cancer, oral cancer, esophageal cancer, brain tumor or leukemia.

Furthermore, the present invention relates to the use of telomerase
This is a method for detecting telomerase activity, comprising amplifying an oligonucleotide sequence extended by an NA extension reaction, and detecting the resulting amplification product without using a radiolabel. Hereinafter, the present invention will be described in detail.

[0024]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention is a method for detecting telomerase activity in a cell or tissue extract (hereinafter referred to as "cell extract"). The present invention provides telomerase activity,
The detection is performed by using the presence or absence of an oligonucleotide sequence extended by a DNA extension reaction of telomerase as an index. As a technique, the oligonucleotide sequence is amplified, and the amplified product is hybridized with a probe labeled with a non-radioactive labeling substance. It is characterized by the following.

(1) Preparation of Cell Extract and Amplification of Telomere Repeat Sequence First, a cell extract containing telomerase is prepared from a cancer tissue or cancer cell line. The types of cancer tissues and cancer cell lines are not particularly limited, but in addition to cancer tissues such as colon cancer and liver cancer, colon cancer, liver cancer, cervical cancer, chronic myelogenous leukemia, glioblastoma,
Breast cancer, cancer cell lines such as fibrosarcoma, such as K562, MKN1, He
La, U937, U373MG, T98G, A172, MCF-7, HT-1080, Lo
Vo, WiDr, SW857, VA-4 and the like. The extraction of cells can be performed by a known method or a known method with an improvement (Kim NW et al., (1994) Science, 206, 201).
1-2015).

Next, an oligonucleotide primer containing at least the base sequence "AGNGTT" (N represents A, T, G or C) on the 3 'side (hereinafter also referred to as "primer 1") (for example, No. 1) is added and a DNA extension reaction is performed. Here, it is preferable that the nucleotide sequence “AGNGTT” in the primer 1 is designed and synthesized so as to be a sequence at the 3 ′ end of the primer 1. The length of the primer 1 is not particularly limited, and at least the nucleotide sequence “AGAGTT”, “AGTGTT”, “AGGGTT” or “AGCGTT”
It can be arbitrarily designed as long as it is on the 3 'side. For example, the length of the sequence is preferably 6 to 100 bases, more preferably 11 to 60 bases.

Then, the DNA (telomere repeat sequence) extended by the telomerase extension reaction is amplified. The telomere repeat sequence can be amplified by, for example, a polymerase chain reaction method or an RNA synthesis method. By using the polymerase chain reaction or the RNA synthesis method, a highly sensitive detection result can be obtained.

When the polymerase chain reaction is carried out, the primer 1 and / or an oligonucleotide primer containing the base sequence represented by SEQ ID NO: 21 (hereinafter also referred to as “primer 2”) (eg, SEQ ID NO: 2) are used as primers. Used. These primers are commercially available DN
Chemical synthesis can be performed using an A synthesizer or the like. In addition,
The polymerase chain reaction is performed in a conventional assay buffer. A large amount of the target DNA can be obtained by the polymerase chain reaction.

When the telomere repeat sequence is amplified using the RNA synthesis method, for example, a known TMA method (Transcri
ption Mediated Amplification method; Japanese Patent Application Laid-Open No. 4-500759).

Preferably, amplification is performed by improving the TMA method. That is, as shown in FIG.
A promoter sequence (hereinafter referred to as "promoter") is added to the 5 'side of the DNA and a DNA extension reaction is carried out by telomerase (FIG. 1 (1)). As the promoter, for example, T
7 polymerase promoter (eg, SEQ ID NOs: 13-1)
9), T3 polymerase promoter (eg, SEQ ID NO: 2)
0) or SP6 polymerase promoter. However, the present invention is not limited to the promoter described in the above SEQ ID NO.

Next, DNA was prepared using a reverse primer.
Is double-stranded (FIG. 1 (2)). Here, the reverse primer is a single-stranded DNA elongated by telomerase.
Refers to an oligonucleotide primer used to make the DNA double-stranded. As the reverse primer, for example, the aforementioned primer 2 can be used.

From the double-stranded DNA, RNA is synthesized using a polymerase corresponding to the promoter.
For example, RNA is synthesized using T7 RNA polymerase when using the T7 polymerase promoter, T3 RNA polymerase when using the T3 polymerase promoter, and SP6 RNA polymerase when using the SP6 polymerase promoter (FIG. 1 (3)).

However, in the present invention, an RNA synthesis reaction can be performed using one or both of the primer 1 and the primer 2. When any one of the above primers is used, a promoter is added to the 5 ′ side of the primer to perform an RNA synthesis reaction. When both of the above primers are used, an RNA synthesis reaction can be performed by adding a promoter to the 5 'side of either one of the primers or both of the primers.

The resulting RNA is subjected to a DNA extension reaction using a reverse primer (eg, primer 2) to form a hybrid of DNA and RNA (FIG. 1 (4)). Then, the RNA is decomposed and the DNA is extended, so that double-stranded DNA is obtained. Using this double-stranded DNA fragment as a template, RNA is synthesized using the various polymerases described above (FIG. 1 (6)). When a large amount of RNA is synthesized (amplified) by repeating the reactions in FIGS. 1 (3) to (6) and the reaction is stopped, the reaction solution is heated to, for example, 60 ° C. By the above method, the target RNA can be obtained in a large amount.

Alternatively, a sequence is selected at random on the reverse primer used in the above-described improved TMA method so as not to hybridize to an arbitrary sequence on the 5 ′ side, that is, a base sequence represented by “TTAGGG”. It is also possible to use those to which a synthesized base sequence is added (FIG. 1 (2)
reference). In the present invention, an oligonucleotide synthesized by randomly selecting a sequence is referred to as a tag sequence, and a reverse primer to which the tag sequence is linked is referred to as a tag sequence reverse primer. However, the tag sequence may be linked to a full-length reverse primer, and a part (1 to 8 bases, preferably 4 to 6 bases) on the 5 ′ side or 3 ′ side of the reverse primer is deleted, substituted or added. The primer may be ligated. Further, it is necessary to synthesize the tag sequence so as not to hybridize with the base sequence represented by “TTAGGG”. Therefore, the tag sequence only needs to be one that does not hybridize even if it is partially complementary to the nucleotide sequence represented by “TTAGGG”, and is a sequence completely unrelated to the nucleotide sequence represented by “TTAGGG”. You may. The length of the tag array is 1 to 40, but 5 to 30.
Are preferred in terms of high amplification efficiency. The conditions under which hybridization does not occur are, for example, 30 to 120 ° C., preferably
37-90 ° C.

(2) Detection of Telomerase Activity In order to detect oligonucleotides (DNA or RNA) obtained in large quantities as described above, the present invention
Hybridization developed by Probe
Hybridization Protection
Assay; HPA) method is used (Japanese Patent Publication No. Hei 2-503147).

The HPA method uses an oligomer labeled with a non-radioactive labeling substance as a probe, and detects chemiluminescence from the non-radioactive labeling substance when the probe hybridizes to DNA or RNA to be detected. Method. The feature is that instead of performing a physical separation operation such as washing performed in order to distinguish a hybridized probe from a probe that is free without hybridization, a labeling substance of the free probe is selectively used. Hydrolysis may deactivate the labeling substance.
Therefore, the operation is simple and the target (nucleic acid or oligonucleotide) can be detected in a short time.

Examples of the non-radioactive labeling substance include acridinium ester (hereinafter, referred to as “AE”), luminol, and isoluminol.
minol), pyrogallol (Pyrogallol), protohemin (Pro
tohaemin), aminobutylethyl-n-isoluminol
(Aminobutylethyl-n-isoluminol), aminohexylethyl-n-ethyl-isoluminol
thyl-isoluminol) or an acridine derivative. Acridine derivatives include, for example, compounds of the following formula I:

[0039]

Embedded image

(Wherein X is halogen or the following formula II:

[0041]

Embedded image

(Wherein X ¹ represents a nitrogen atom, a phosphorus atom, a boron atom or an arsenic atom, and R ¹ represents alkoxy or aryloxy, or a substituted or unsubstituted alkyl,
R ² represents a hydrogen atom,
Represents alkoxy or aryloxy, or substituted or unsubstituted alkyl, alkenyl or aryl. )

Or the following formula III:

(Wherein X ² represents an oxygen atom or a sulfur atom, and R ² is the same as described above), Y represents an oxygen atom, a sulfur atom or NH, and R ³ represents Hydrogen atom, amino, hydroxy, thiol, carboxylic acid,
Represents halogen, nitro, alkoxy or aryloxy, or substituted or unsubstituted acetyl, alkyl, alkenyl or aryl, R ⁴ is a substituted or unsubstituted alkyl, alkenyl or aryl, R ^1,
At least one of R ² , R ³ or R ⁴ contains a reactive site capable of chemically bonding. ])).
However, the present invention is not limited to the non-radioactive labeling substance.

Here, examples of the halogen include fluorine, chlorine, bromine, iodine and astatine.
Examples of the alkyl include those having 1 to 20 carbon atoms, preferably 1 to 5 carbon atoms, such as methyl, ethyl, propyl, butyl, and amyl. Alkenyl includes those having 1 to 10 carbon atoms, preferably 1 to 5 carbon atoms, such as vinyl and allyl. As aryl, for example, phenyl, tolyl,
Examples include naphthyl and xylyl. Examples of alkoxy include those having 1 to 10 carbon atoms, preferably 1 to 5 carbon atoms, such as methoxy and ethoxy, and examples of aryloxy include phenoxy and naphthoxy.

The probe used in the present invention is not particularly limited as long as it is extended by a telomerase extension reaction and is complementary to DNA or RNA amplified based on it. Usually, 10 to 40 base, preferably 15 to 30 base probes are used. Oligonucleotides used as probes can be obtained from commercially available D by the usual phosphoramidite method.
It can be synthesized using an NA synthesizer. At the time of chemical synthesis, an amino linker for labeling AE or the like is introduced.

The label such as AE of the DNA probe is composed of an amino linker introduced during DNA synthesis,
The reaction is carried out by reacting E with N-hydroxysuccinimide ester. The labeling position of AE or the like can be freely set depending on the position of the amino linker introduced during DNA synthesis (Yukio Matsuoka et al., Clinical Pathology, Special Issue No. 85,
82-91, 1990).

Detection using AE As shown in FIG. 2, AE-labeled probe and amplified D
When hybridized with NA or RNA (target), the AE is stable between the double helices of DNA. Since the AE ester bond is protected even after hydrolysis for a certain period of time, the acridinium ester can be chemiluminescent by adding alkali and hydrogen peroxide, and the target can be detected from the chemiluminescence. (Figure 2
(1)).

On the other hand, if the probe and target do not hybridize, AE cannot be stabilized between double helices. When hydrolysis is performed in this state, the ester bond of AE undergoes hydrolysis. As a result, no chemiluminescence occurs and the target cannot be detected (Fig. 2 (2)
).

The probes used for detection include, for example, probe 1 (SEQ ID NO: 3), probe 2 (SEQ ID NO: 4), probe 3 (SEQ ID NO: 5), probe 4 (SEQ ID NO: 6), probe 5 (SEQ ID NO: 6) No. 7), probe 6 (SEQ ID NO: 8), probe 7 (SEQ ID NO: 9) or probe 8
(SEQ ID NO: 10). Probes 1 and 2,
The probes 3 and 4, the probes 5 and 6, and the probes 7 and 8 have the same sequence, but have different AE binding positions. The position to which AE binds is the 14th position for probe 1 in the base sequence of each probe.
Between the 15th, 15th and 16th for probe 2, 9th and 10th for probe 3, 10th and 11th for probe 4, 13th for probe 5 Between the 14th and 14th, between the 14th and 15th for the probe 6, between the 15th and 16th for the probe 7, and between the 16th and 17th for the probe 8.

A probe labeled with AE is added to the DNA or RNA amplified as described in (1) above,
Incubate for ~ 30 minutes. Add a hydrolysis reagent to remove chemiluminescence based on unreacted probe, and incubate at 60 ° C for 5-10 minutes. After incubation, the AE chemiluminescence is detected using a photomultiplier (eg, Reader I). In addition, HP using AE
A can also be performed using a kit from Gen-Probe according to the instructions.

Detection Using Acridine Derivative or Other Non-Radioactive Labeling Substance An appropriate amount of a probe labeled with the acridine derivative is added to a solution containing the DNA or RNA and reacted. After the reaction, after performing a treatment such as hydrolysis, chemiluminescence is detected in the same manner as the detection of AE.

The chemiluminescence of luminol, isoluminol, pyrogallol, protohemin, aminobutylethyl-n-isoluminol, aminohexylethyl-n-ethyl-isoluminol was detected in the same manner as described above or by other methods. can do.

In the present invention, the telomerase activity can be detected by amplifying an oligonucleotide sequence extended by a DNA extension reaction using telomerase, and then detecting the resulting amplification product without using a radioactively labeled substance. . For example, FITC (Fluorescein
Isothiocyanate), Rhodamine, Coumarin
Using a fluorescent substance such as (Coumarin), a fluorescent label is applied to the 5 ′ side of the primer of SEQ ID NO: 1, electrophoresis is performed, and the amplification product can be detected by a predetermined detection device. According to the method of the present invention, a highly sensitive detection result can be obtained as compared with the conventional detection method.

Further, since no radioactive material is used, no special waste treatment equipment is required, and there is no need to separate the reaction product from the radioactive material that has not been taken up as in the prior art. As a result, detection can be performed quickly. That is, since the results can be obtained within one hour from the start of the HPA operation, all the detection processes can be completed within one day as a whole. Furthermore, the present invention can easily detect telomerase activity with good reproducibility,
Large volumes of samples can be handled easily.

Detection of telomerase activity of a tissue or the like obtained clinically using the method of the present invention is useful for detecting cancer cells and diagnosing cancer, and monitors progress of cancer and prognosis of treatment. Above is very useful. Here, the cancer cells to be detected include, for example, those contained in specimens obtained invasively or non-invasively.

In the present invention, when a human tissue or organ is physically or chemically injured (wounded) and a specimen is collected, bleeding accompanying the collection is said to be invasive.
For example, surgery, tissue resection with an endoscope, biopsy with a needle,
Injection for blood collection and the like are exemplified as an invasive method.
Examples of invasively obtained specimens include bladder tissue, prostate tissue, uterine tissue, cervical tissue, breast tissue, pancreas tissue, liver tissue, large intestine tissue, stomach tissue, lung tissue, peripheral blood cells, kidney tissue, skin Examples include tissue, esophageal tissue, brain tissue, and oral tissue.

On the other hand, according to the present invention, a specimen can be collected without physically or chemically damaging a human tissue or organ, and as a result, non-invasive without bleeding. For example, non-invasive methods such as a method of collecting excreta from the body and washing of organs are exemplified.
And non-invasively obtained specimens include, for example, urine,
Examples include prostate fluid, bladder washing solution, uterine smear, pancreatic juice, duodenal juice, feces, oral washing solution, intestinal washing solution, saliva or sputum.

(3) Kit for detecting cancer cells and / or kit for diagnosing cancer The kit of the present invention comprises a reagent used in the method of detecting telomerase of the present invention, ie, at least “AGNGTT” (N
Represents A, T, G or C. ), An oligonucleotide primer containing the nucleotide sequence represented by SEQ ID NO: 21 or at least one nucleotide in the nucleotide sequence of these primers is deleted, substituted or added. Oligonucleotide primer containing the base sequence,
And a probe labeled with a non-radioactive labeling substance.

The kit of the present invention also includes those in which a promoter is added to the 5 ′ side of these oligonucleotide primers. These kits are used to detect telomerase activity, to detect cancer cells,
Alternatively, it is used to diagnose cancer.

[0061]

The present invention will be described more specifically with reference to the following examples. However, the present invention is not limited to these examples.

[Example 1] Amplification by TRAP method and H
Detection of telomerase activity by PA method Materials and Methods (1) Preparation of Extract Containing Telomerase from Cell Line Cancer cell lines K562 and MKN1 were cultured, and the culture was centrifuged to remove the supernatant. Next, 200μl ice-cold lysis buf
fer (10 mM Tris, 1 mM MgCl ₂ , 1 mM EGTA, 0.5% CH
APS (Cholamidopropyl-dimethyl-ammonio-1-propanesul
fonate), 10% Glycerol, 5 mM β-mercaptoethanol, 0.1 mM AEBSF (4- (2-aminoethyl) -benzenesu
After adding lfonyl fluoride hydrochlorine (pH 7.5), the mixture was stirred 4 to 5 times with a pipette. After 30 minutes on ice,
After centrifugation at 000 rpm for 20 minutes at 4 ° C., the supernatant was collected in another tube (corresponding to 500 cells / μl).

(2) Synthesis of Primer Primer 1 having SEQ ID NO: 1 was replaced with Primer 2
(Reverse primer) having SEQ ID NO: 2
It was synthesized using a DNA synthesizer manufactured by BI.

(3) TRAP method Telomerase was extracted from a cancer cell line, and TRA was extracted as follows.
The P method was performed. First, the following reagents were added to a tube. 5μl 10xTRAP-PCR buffer (0.2M Tris, 15mM
_{MgCl 2, 680mM KCl, 0.05%} Tween20, 5mM EGTA pH 8.
3) 0.25 μl 10 mM dNTPs 2 μl Primer 1 (50 ng / μl) (SEQ ID NO: 1) 0.2 μl T4g32 protein (5 μg / μl) (Boehringer Mannheim) 0.4 μl Ampli Taq (5 U / μl) When ³² P is used Is 0.4 μL of α-dCTP (3,0
00 Ci / mmol; 4 μCi / assay).

The total volume was adjusted to 48 μl with H ₂ O treated with DEPC (diethyl pyrocarbonate). To this, 2 μl of the extract containing telomerase was added, and after stirring, the mixture was incubated at 20 ° C. for 30 minutes. One drop of mineral oil was overlaid, incubated at 90 ° C. for 3 minutes, and 2 μl reverse primer (SEQ ID NO: 2) (50 ng / μl) was added to perform PCR. PC
R was carried out for 31 cycles of one cycle of 94 ° C. for 40 seconds, 50 ° C. for 40 seconds and 72 ° C. for 60 seconds, and finally incubated at 72 ° C. for 120 seconds (IWAKI TSR-300). The sample was prepared by serially diluting the two kinds of extracts prepared in (1) with a lysis buffer by a factor of 10 (corresponding to 1,000, 100, 10 and 1 cell /
Tube).

(4) Detection by HPA Probe sensitivity comparison test In order to compare the sensitivity of each probe in the present invention, HPA was performed in a pure system using a synthetic oligomer as a target. Target 500 oligomer (SEQ ID NO: 12) with H ₂ O
, 50, 10, 5, 1 and 0.5 fmol / 10 μl. 10 μl of each concentration of target was added to the tube, and 90 μl of H ₂ O was added. Chemiluminescence 3.
After 100 μl of a probe solution prepared with a hybridization solution was added at 0 × 10 ⁶ rlu / 100 μl (rlu: relative light units), the mixture was incubated at 60 ° C. for 20 minutes. To this, 300 μl of DH solution (600 mM boric acid, 182 mM sodium hydroxide, 1% Triton X-100) was added, and after stirring, the mixture was incubated at 60 ° C. for 10 minutes. After the incubation, the tube was quenched in water for about 3 minutes, and the amount of chemiluminescence was measured with Reader I (Gen-Probe).

As shown in FIGS. 3 and 4, the pure system HP
The detection sensitivity of A is 0,000 when the cut-off value is 10,000 rlu.
The probe having the highest sensitivity was 5 to 1 fmol, and the probe having the highest sensitivity was the probe 1 and then the probe 3. Therefore, in the present invention, among the probes 1 to 8 that can be used as probes, the probe 1 was used as a preferable probe for detecting telomerase activity. FIG. 4 is an enlarged view of the transition at the target of 0 to 10 fmol in FIG.

Detection of Telomerase Activity 5 μl of TRAP product was added to a tube containing 100 μl of H ₂ O, and heat denaturation was performed at 95 ° C. for 5 minutes. After quenching in ice water (about 3 minutes), 100 µl of probe 1
(SEQ ID NO: 3) (3 × 10 ⁶ rlu / 100 μl) was added.
After incubating at 60 ° C. for 20 minutes, 300 μl of DH solution was added and stirred. Incubated at 60 ° C. for 10 minutes. Subsequently, the tube was quenched in water for about 3 minutes, then returned to room temperature, and the amount of chemiluminescence was measured with a reader I.

As a control, an existing method ( ³² P after electrophoresis) was used.
SYBR Green staining (FM label)
C))). That is, the number of cells is 1,000
And 100 or more TRAP products were diluted 10, 100 and 1,000 times and electrophoresed in the same manner as above (stained with ³² P or SYBR Green)
Regarding the detection sensitivity, the detection sensitivity was compared with that obtained by HPA.

The electrophoresis was carried out using 10 μl of TRAP product on a 12% polyacrylamide gel.
(Electrophoresis was performed at 100 V for 15 minutes and at 300 V for about 1 hour). ^{When 32} P was used, the gel was dried at 80 ° C. for 30 minutes after electrophoresis. Next, autoradiography was performed at -80 ° C.
The presence of a ladder was checked. In addition, SYBR Green staining is 0.
5 x TBE (0.045M Tris-borate, 0.001M EDTA (pH8.
After staining with SYBR Green diluted 10,000 times in (0)) for about 30 minutes, the ladder was confirmed under UV.

II. Results In FIG. 5, the extract was serially diluted 10-fold (1,000 cells,
When TRAP was carried out using a sample containing 100, 10, or 1 telomerase), the ladder could be confirmed up to 10 cells by ³² P labeling (FIG. 5 (1)). 10 pieces (M
KN1) and up to 100 (K562) (FIG. 5 (2)
). On the other hand, the detection sensitivity of HPA cuts 10,000 rlu
In the case of an off value, one (MKN1) and ten (KKN1)
562) (Fig. 5 (3)).

Further, in FIG.
Number equivalent extract TRAP product 10-fold serial dilutions to 3's sensitivity compared the results of using, if labeled with ³² P confirmed the ladder up to 100-fold diluted with TRAP Products 1,000 equivalent (FIG. 6 (1) A), a ladder could be confirmed only up to 10-fold dilution for 100 TRAP products (FIG. 6 (1) B). When stained with SYBR Green, ladders could be confirmed only up to 10-fold dilution for 1,000 or 100 TRAP products (FIG. 6 (2)).
In the case of HPA, 1,000 and 100 TRAP products were positive up to 100-fold dilution (FIG. 6 (3)).
From the above, the detection sensitivity of HPA is almost the same as that of ³² P, which is at least 10 times higher than that of SYBR Green staining.
It was confirmed to be twice as high.

[Example 2] Amplification by RNA synthesis and H
Detection of telomerase activity by PA (1) The present inventors have proposed a primer (hereinafter referred to as "T7 primer") in which a T7 RNA polymerase promoter (SEQ ID NO: 13) is bound to the 5 'side of primer 1;
11), an extension reaction is carried out by telomerase activity, and a single-stranded DN containing a T7 RNA promoter region
A was synthesized. TMA was performed using this single-stranded DNA as a target, and finally a large amount of RNA was synthesized.

I. Materials and Methods (1) Amplification reagent 4 mM ATP, Disodium, Trihydrate 4 mM CTP, Disodium, Dihydrate 4 mM GTP, Disodium, Monohydrate 4 mM UTP, Disodium, Dihydrate 40 mM Trizma, Base 12.5 mM Potassium chloride 1 mM dATP, Disodium 1 mM dCTP, Trisodium 1 mM dGTP , Trisodium 1mM dTTP, Trisodium pH 7.5 ± 0.1 18mM Magnesium chloride

(2) Enzyme reagent 1 mM EDTA 140 mM Trizma, Base 70 mM potassium chloride 10% Triton X-102 2% glycerol 2,000 U RTase 2,000 U T7 RNA polymerase

(3) Primer Primer of SEQ ID NO: 11 (10 pmol / assay) Primer of SEQ ID NO: 21 (30 pmol / assay)

50 μl of the amplification reagent (containing the primer of SEQ ID NO: 11) was added to the tube, 2 μl of a diluted K562 cell extract containing telomerase was added thereto, and the mixture was incubated at 20 ° C. for 30 minutes. 200 μl
Of mineral oil and 25 μl of a 2 × concentration of amplification reagent (including the primer of SEQ ID NO: 21) were added, and incubated at 95 ° C. for 5 minutes, then at 60 ° C. for 10 minutes, and at 42 ° C. for 5 minutes. 25 μl of enzyme reagent was added and incubated at 42 ° C. for 2 hours. After amplification, add 10 μl of TMA product
Add to the tube containing 100 μl H ₂ O and add another 100
μl of probe (3 × 10 ⁶ rlu / 100 μl) solution was added.

The probe has the following sequence,
The one labeled with AE between the 14th (T) and the 15th (A) was used. Probe sequence: 5'-CTAACCCTAACCCTAACCCTAACCCTAACTC
T-3 ′ (SEQ ID NO: 29) After incubation at 65 ° C. for 20 minutes, 300 μl of DH solution was added and stirred. After incubation at 65 ° C. for 10 minutes, the tubes were quenched in water for about 3 minutes. After returning to room temperature, the amount of chemiluminescence was measured with Reader I.

II. Results As shown in FIG. 9, even when 10 K562 cell extracts were used, the results were positive, and telomerase activity could be detected with high sensitivity.

[Example 3] Amplification by RNA synthesis and H
Detection of telomerase activity by PA (2) In this example, RNA synthesis was performed using a tag sequence reverse primer, and telomerase activity was detected in the same manner as in Example 2. However, the amplification temperature and time after the addition of the enzyme reagent were 40 ° C. and 75 minutes, respectively.

The primers used are shown below. In addition,
The lowercase letters of the alphabet indicate the tag arrangement.

CX primer: CCCTTACCCTTACCCTTACCCTAA (SEQ ID NO: 2) CX-A-2: TTACCCTTACCCTTACCCT (SEQ ID NO: 21) CX-A-2-III: acgtagcgttagTTACCCTTACCCTTACCCT (SEQ ID NO: 22) CX-A-2-II-11: cgtagcgttagTTACCCTTACCCTTACCCT ( SEQ ID NO: 23) CX-A-2-II-10: gtagcgttagTTACCCTTACCCTTACCCT (SEQ ID NO: 24) CX-A-2-II: tagcgttagTTACCCTTACCCTTACCCT (SEQ ID NO: 25) CX-A-2-II-8: agcgttagTTACCCTTACCCTTACCCT (SEQ ID NO: 26) CX-A-2-II-7: gcgttagTTACCCTTACCCTTACCCT (SEQ ID NO: 27) CX-A-2-1: cgttagTTACCCTTACCCTTACCCT (SEQ ID NO: 28)

Further, K562 cells were used as a target for detection,
A predetermined number was prepared and tested. As a result, 500
When K562 cells were detected, as shown in FIG.
When a primer to which a tag of base was added (CX-A-2-II (SEQ ID NO: 25) and a primer to which a tag of 12 bases was added (CX-A-2-III (SEQ ID NO: 22)) was used, RNA was
It was found that the synthesis efficiency was enhanced and the detection sensitivity was enhanced.

When the number of K562 cells was reduced to 100 and the detection was carried out, when the primer (SEQ ID NOS: 22 to 25) to which a tag of 9 to 12 bases was added was used, RNA was detected.
It was found that the synthesis efficiency was increased and the detection sensitivity was increased even with a small number of cells (FIG. 8).

Further, 0 to 50 K562 cells were prepared, and 1
Primer (CX-A-2-II-10) with a tag of 0 bases added
(SEQ ID NO: 24)), the RNA synthesis reaction and detection were performed even with 2.5 cells (FIG. 10).
The cells could be detected with high sensitivity by the method of the present invention.

[Example 4] Detection of cancer cells Cells and tissues (1) Cancer cell lines HeLa cells (cervical cancer), U937 (histiocytic lymphoma), K562
(Chronic myeloid leukemia), U373MG (glioblastoma), T98G (glioblastoma) A172 (glioblastoma), MCF-7 (breast cancer), HT-1080 (fibrosarcoma), LoVo (colorectal cancer), WiDr ( Colon cancer), SW857 (colorectal cancer) and VA-4 (SV40-transformed fibroblasts) were cultured in RPMI medium containing 10% FCS. As normal cells, cells collected from healthy human peripheral nuclei (MNC) and healthy human fibroblasts (HNF) were used.

(2) Liver Cancer Tissues Tissues obtained from surgically resected liver cancer and 83 cases of liver disease were frozen in liquid nitrogen and stored at -80 ° C until use. (3) Colorectal cancer tissue Tissue obtained from 26 surgically resected colorectal cancers was frozen in liquid nitrogen and stored at -80 ° C until use.

III. TRAP Method According to a conventional method, an extract containing telomerase activity was obtained from the cells or tissues in the same manner as in Example 1. Next, elongation reaction by telomerase and gene amplification were performed on cell extracts of each cancer cell line, colon cancer tissue and liver cancer tissue.

The extension reaction by telomerase was carried out at 20 ° C. for 30 minutes using the oligonucleotide represented by SEQ ID NO: 1. The amplification of the gene was performed using the oligonucleotide represented by SEQ ID NO: 2 at 94 ° C for 40 seconds, 50 ° C for 40 seconds and
One cycle of the reaction at 72 ° C for 60 seconds was carried out for 31 cycles, followed by a final incubation at 72 ° C for 120 seconds (IWAKI
TSR-300).

IV. The amplification product obtained by the HPA TRAP method was denatured at 94 ° C. for 5 minutes, and an AE-labeled probe hybridizing with the amplification product was added.
The reaction was carried out at 20 ° C for 20 minutes. Then, DH buffer was added and 60
The reaction was performed at 10 ° C. for 10 minutes. The chemiluminescence (RLU; relative light units) of the reaction solution was measured with a luminometer (measurement time: 2 seconds / tube).

V. As a positive control (control) for quantitative HPA telomerase activity, K5
A serial dilution of a 62-cell extract was prepared, and TRAP was performed in the same manner as in the cancer cell line. Then, HPA was performed according to the method described in IV. However, in order to obtain a wide range of linearity of the telomerase activity-positive control, the amount of the AE-labeled probe and the amount of luminescence were adjusted to obtain two calibration curves (FIG. 11).

From the calculation formula of the calibration curve, the number of cancer cells contained in the sample corresponding to the standard control was calculated. That is, based on the obtained HPA data, how many positive cells (K562 cells) each cancer cell contained in the sample corresponded to was calculated by a calibration curve. 0 to the obtained value.
Multiplied by 1 to obtain an HPA unit.

VI. Results As shown in FIG. 12, various cancer cells had remarkable telomerase activity as compared with normal cells. Further, as a result of measuring telomerase activity in liver cancer (HCC; Hepatocellular carcinoma) tissue, as shown in Table 1 and FIG. Telomerase activity was remarkably observed as compared with chronic hepatitis and cirrhosis. Similar results were obtained for colorectal cancer.

[0094]

[Table 1]

The method of the present invention is also effective for a method of detecting or quantifying cell-derived telomerase activity contained in a sample obtained non-invasively or invasively for use in cancer diagnosis. Examples of cancer types that can be diagnosed and the corresponding specimens in parentheses include bladder cancer (urine, bladder washing fluid, tissue obtained by endoscopy or surgery), prostate cancer (prostate fluid, needle biopsy, surgery) Tissue) cervical cancer (tissue obtained by smear, endoscope or operation), uterine cancer (tissue obtained by endoscope or operation),
Breast cancer (needle biopsy, tissue obtained by surgery), pancreatic cancer (pancreatic juice, duodenal juice, tissue obtained by surgery), liver cancer (needle biopsy, tissue obtained by surgery), oral cancer (mouthwash, tissue obtained by surgery) ), Esophageal cancer (tissue obtained by endoscope or surgery), colorectal cancer (feces, intestinal washings, tissue obtained by endoscope or surgery), gastric cancer (tissue obtained by endoscope or surgery), lung cancer (Sputum, tissue obtained by endoscope or surgery), brain tumor (tissue obtained by surgery), and the like. In addition, if nucleated cells in peripheral blood show telomerase activity, it can be used for diagnosis of leukemia. If the peripheral blood is derived from a solid cancer patient, metastasis can be predicted.

In diagnosing cancer from a sample obtained non-invasively, urine is mentioned as an example of the sample. For information on obtaining samples from urine, see, for example, Journal of Nationa
l Institute, Vol.89, No.10, p724-730, May 21,1997, and International Journal of Oncology 9:
1169-1173, 1996, American Cancer Society (1997) p36
2-369. For urine obtained by these methods, by measuring telomerase activity using the method of the present invention, bladder cancer, prostate cancer,
Diagnosis of kidney cancer is possible. From these, it was found that the method of the present invention is extremely useful for cancer diagnosis.

[0097]

According to the present invention, there are provided a method for detecting telomerase activity, a method for detecting cancer cells, a method for diagnosing cancer, and a kit for detecting cancer cells and / or a diagnostic kit for cancer. INDUSTRIAL APPLICABILITY The present invention is useful for diagnosis of cancer and the like in that telomerase activity can be detected quickly and with high sensitivity.

[0098]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 18 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Other information: TS Primer sequence: AATCCGTCGA GCAGAGTT 18

SEQ ID NO: 2 Sequence length: 24 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Other information: CX Primer Sequence: CCCTTACCCT TACCCTTACC CTAA 24

SEQ ID NO: 3 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Characteristic symbol: modified base Location: 14..15 Characteristic determination method: E Other information: acridinium ester Sequence: CCCTTACCCT AACCCTAACT CTGCTCGAC 29

SEQ ID NO: 4 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Characteristic symbol: modified base Location: 15..16 Characteristic determination method: E Other information: acridinium ester Sequence: CCCTTACCCT AACCCTAACT CTGCTCGAC 29

SEQ ID NO: 5 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Characteristic symbol: modified base Location: 9..10 Characteristic determination method: E Other information: acridinium ester Sequence: ACCCTAACCC TAACTCTGCT CGACGGATT 29

SEQ ID NO: 6 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Characteristic symbol: modified base Location: 10..11 Characteristic determination method: E Other information: acridinium ester Sequence: ACCCTAACCC TAACTCTGCT CGACGGATT 29

SEQ ID NO: 7 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids (synthetic DNA) Sequence characteristics Characteristic symbols: modified base Location: 13..14 Characteristic determination method: E Other information: acridinium ester Sequence: CCTAACCCTA ACCTAACCC TAACC
twenty five

SEQ ID NO: 8 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids (synthetic DNA) Sequence: sequence characteristics Characteristic symbols ： Modified base Location ： 14..15 Method for determining characteristics ： E Other information ： acridinium ester CCTAACCCTA ACCCTAACCC TAACC 25

SEQ ID NO: 9 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Characteristic symbol: modified base Location: 15..16 Characteristic determination method: E Other information: acridinium ester Sequence: ACCCTAACCC TAACCCTAAC CCTAACCCT 29

SEQ ID NO: 10 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Characteristic symbol: modified base Location: 16..17 Method for determining characteristics: E Other information: acridinium ester Sequence: ACCCTAACCC TAACCCTAAC CCTAACCCT 29

SEQ ID NO: 11 Sequence length: 53 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: AATTTAATAC GACTCACTAT AGGGAGACTC TCTCTCTCTC TCTCTCTAGA GTT 53

SEQ ID NO: 12 Sequence length: 34 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids (synthetic DNA) Sequence: AATCCGTCGA GCAGAGTTAG GGTTAGGGTT AGGG 34

SEQ ID NO: 13 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: AATTTAATAC GACTCACTAT AGGGAGA 27

SEQ ID NO: 14 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GAAATTTAAT ACGACTCACT ATAGGGAGA 29

SEQ ID NO: 15 Sequence length: 35 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GTCCCTAAAT TAATACGACT CACTATAGGG AGATA 35

SEQ ID NO: 16 Sequence length: 35 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GCCGGGAATT TAATACGACT CACTATAGGG AGACC 35

SEQ ID NO: 17 Sequence length: 35 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: ACTTCGAAAT TAATACGACT CACTATAGGG AGACC 35

SEQ ID NO: 18 Sequence length: 35 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GGCTCGAAAT TAATACGACT CACTATAGGG AGAAC 35

SEQ ID NO: 19 Sequence length: 35 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GCGTAGGAAA TAATACGACT CACTATAGGG AGAGG 35

SEQ ID NO: 20 Sequence length: 22 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: ATTAACCCTC ACTAAAGGGA AC 22

SEQ ID NO: 21 Sequence length: 19 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: TTACCCTTAC CCTTACCCT 19

SEQ ID NO: 22 Sequence length: 31 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: ACGTAGCGTT AGTTACCCTT ACCCTTACCC T 31

SEQ ID NO: 23 Sequence length: 30 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: CGTAGCGTTA GTTACCCTTA CCCTTACCCT 30

SEQ ID NO: 24 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GTAGCGTTAG TTACCCTTAC CCTTACCCT 29

SEQ ID NO: 25 Sequence length: 28 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: TAGCGTTAGT TACCCTTACC CTTACCCT 28

SEQ ID NO: 26 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: AGCGTTAGTT ACCCTTACCC TTACCCT 27

SEQ ID NO: 27 Sequence length: 26 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: GCGTTAGTTA CCCTTACCCT TACCCT 26

SEQ ID NO: 28 Sequence length: 25 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence: CGTTAGTTAC CCTTACCCTT ACCCT 25

SEQ ID NO: 29 Sequence length: 32 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid (synthetic DNA) Sequence characteristics Characteristic symbol: modified base Location: 14..15 Characteristic determination method: E Other information: acridinium ester Sequence: CTAACCCTAA CCCTAACCCT AACCCTAACT CT 32

[Brief description of the drawings]

FIG. 1 is a schematic diagram showing an outline of detecting telomerase activity using an RNA synthesis reaction using an RNA polymerase.

FIG. 2 is a diagram showing the principle of the HPA method.

FIG. 3 is a diagram showing measurement results of the sensitivities of probes 1 to 8;

FIG. 4 is a diagram showing measurement results of the sensitivities of probes 1 to 8;

FIG. 5 is an electrophoretic photograph showing the results of a comparison test of sensitivity between the HPA method and the conventional detection method.

FIG. 6 is an electrophoretic photograph showing the results of a comparison test of the sensitivity between the HPA method and the conventional detection method.

FIG. 7 is a diagram showing the results of detecting telomerase activity when using an oligonucleotide primer to which a tag sequence has been added.

FIG. 8 is a diagram showing the results of detecting telomerase activity when using an oligonucleotide primer to which a tag sequence has been added.

FIG. 9 is a diagram showing the results of detecting telomerase activity when using an oligonucleotide primer to which a tag sequence has been added.

FIG. 10 shows the results of detecting telomerase activity when using an oligonucleotide primer to which a tag sequence has been added.

FIG. 11 is a diagram showing a calibration curve of telomerase activity.

FIG. 12 is a diagram showing telomerase activity of various cancer cells.

FIG. 13 is a view showing telomerase activity of liver cancer tissue.

Claims (22)

[Claims] 1. A method for detecting telomerase activity by amplifying an oligonucleotide sequence extended by a DNA extension reaction by telomerase and hybridizing the obtained amplification product with a probe labeled with a non-radioactive labeling substance. For detecting telomerase activity. 2. The non-radioactive labeling substance is acridinium ester, luminol, isoluminol, pyrogallol,
The method for detecting telomerase activity according to claim 1, which is protohemin, aminobutylethyl-n-isoluminol, aminohexylethyl-n-ethyl-isoluminol, or an acridine derivative. 3. An acridine derivative having the following formula I: (Wherein X is halogen or the following formula II: (Wherein X ¹ represents a nitrogen atom, a phosphorus atom, a boron atom or an arsenic atom, R ¹ represents alkoxy or aryloxy, or substituted or unsubstituted alkyl, alkenyl or aryl, R ² represents a hydrogen atom, alkoxy Or aryloxy, or substituted or unsubstituted alkyl, alkenyl or aryl.) Or the following formula III: (Wherein, X ² represents an oxygen atom or a sulfur atom, R ² is the same as described above), Y represents an oxygen atom, a sulfur atom or NH, R ³ represents a hydrogen atom, Represents amino, hydroxy, thiol, carboxylic acid, halogen, nitro, alkoxy or aryloxy, or substituted or unsubstituted acetyl, alkyl, alkenyl or aryl, and R ⁴ is substituted or unsubstituted alkyl,
Represents alkenyl or aryl, wherein at least one of R ¹ , R ² , R ³ or R ⁴ contains a reactive site capable of chemical bonding. ] The method for detecting telomerase activity according to claim 2, which is represented by: 4. An oligonucleotide primer comprising at least the nucleotide sequence represented by “AGNGTT” (N represents A, T, G or C) on the 3 ′ side and / or SEQ ID NO: 21 The method for detecting telomerase activity according to any one of claims 1 to 3, which is performed by a polymerase chain reaction using an oligonucleotide primer containing a base sequence represented by the following formula: 5. The method for amplifying an oligonucleotide sequence comprises: an oligonucleotide primer containing at least a nucleotide sequence represented by “AGNGTT” (N represents A, T, G or C) on the 3 ′ side and / or SEQ ID NO: 21. 4. An RNA synthesis reaction is carried out using an oligonucleotide primer containing a base sequence represented by: and a promoter sequence is added to at least one of the oligonucleotide primers. The method for detecting telomerase activity according to the above item. 6. An oligonucleotide comprising a nucleotide sequence in which at least one nucleotide has been deleted, substituted or added in the 5 ′ side of an oligonucleotide primer comprising the nucleotide sequence represented by SEQ ID NO: 21 or in the nucleotide sequence of the primer. On the 5 'side of the nucleotide primer, add "TTAGGG"
The method for detecting telomerase activity according to claim 4 or 5, wherein an oligonucleotide primer to which an arbitrary sequence that does not hybridize with the sequence represented by the above is added. 7. At least “AGNGTT” (N is A, T, G
Or C. ) Is the oligonucleotide primer containing the nucleotide sequence represented by SEQ ID NO: 1 on the 3 ′ side, and the oligonucleotide primer containing the nucleotide sequence represented by SEQ ID NO: 21 is represented by SEQ ID NO: 2. The method for detecting telomerase activity according to any one of claims 4 to 6, which is a method for detecting telomerase activity. 8. The method for detecting telomerase activity according to claim 5, wherein the promoter sequence is a T7 RNA polymerase promoter sequence, a T3 RNA polymerase promoter sequence, or an SP6 RNA polymerase promoter sequence. 9. A method for detecting cancer cells, comprising detecting telomerase activity in cancer cells by the method for detecting telomerase activity according to any one of claims 1 to 8. 10. The method for detecting cancer cells according to claim 9, wherein the cancer cells are contained in a specimen obtained invasively or noninvasively. 11. A sample obtained invasively, comprising: bladder tissue;
The prostate tissue, the uterine tissue, the cervical tissue, the breast tissue, the pancreas tissue, the liver tissue, the large intestine tissue, the stomach tissue, the lung tissue, the peripheral blood cells, the kidney tissue, the skin tissue, the esophagus tissue, the brain tissue or the oral tissue. The method for detecting a cancer cell according to the above. 12. The non-invasively obtained specimen is urine, prostate fluid, bladder lavage fluid, uterine smear, pancreatic juice, duodenal fluid, feces, buccal lavage fluid, intestinal lavage fluid, saliva or sputum. Method for detecting cancer cells. 13. A method for diagnosing cancer, comprising detecting a cancer cell by the method for detecting a cancer cell according to any one of claims 9 to 12. 14. The cancer may be bladder cancer, prostate cancer, uterine cancer, cervical cancer, breast cancer, pancreatic cancer, liver cancer, colon cancer, stomach cancer, lung cancer,
14. The method for diagnosing cancer according to claim 13, wherein the cancer is kidney cancer, skin cancer, oral cancer, esophageal cancer, brain tumor or leukemia. 15. At least “AGNGTT” (N is A, T,
Represents G or C. ), An oligonucleotide primer containing the nucleotide sequence represented by SEQ ID NO: 21 or at least one nucleotide in the nucleotide sequence of these primers is deleted, substituted or added. A diagnostic kit comprising an oligonucleotide primer containing the base sequence thus obtained, and a probe labeled with a non-radioactive labeling substance. 16. The diagnostic reagent kit according to claim 15, wherein a promoter sequence is added to at least one primer. 17. The diagnostic reagent kit according to claim 16, wherein the promoter sequence is a T7 RNA polymerase promoter sequence, a T3 RNA polymerase promoter sequence, or an SP6 RNA polymerase promoter sequence. 18. An oligonucleotide comprising a nucleotide sequence in which at least one nucleotide has been deleted, substituted or added at the 5 ′ side of an oligonucleotide primer comprising the nucleotide sequence represented by SEQ ID NO: 21, or at least one nucleotide in the nucleotide sequence of the primer. On the 5 'side of the nucleotide primer, add "TTAGG
The diagnostic reagent kit according to any one of claims 15 to 17, further comprising an oligonucleotide primer to which an arbitrary sequence that does not hybridize with the sequence represented by "G" is added. 19. The diagnostic kit according to any one of claims 15 to 18 for detecting telomerase activity. 20. The diagnostic kit according to any one of claims 15 to 18 for diagnosing cancer. 21. The cancer is bladder cancer, prostate cancer, uterine cancer, cervical cancer, breast cancer, pancreatic cancer, liver cancer, colon cancer, stomach cancer, lung cancer,
21. The diagnostic kit according to claim 20, wherein the kit is kidney cancer, skin cancer, oral cancer, esophageal cancer, brain tumor or leukemia. 22. A method for detecting telomerase activity, comprising amplifying an oligonucleotide sequence extended by a DNA extension reaction using telomerase, and detecting the resulting amplification product without using a radioactive label.