JPH1057074A - Physiologically active protein p138 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new protein, comprising a peptide having a modified amino acid sequence of a myosin-bonding subunit and having the ability to bond to an active type Rho protein and further a site to be phosphorylated and useful for treatment, etc., of tumor, cardiac and cerebral infarctions. SOLUTION: This new protein or its modified protein comprises a peptide or a protein having a modified amino acid sequence or a myosin-bonding subunit or its equivalent sequence and has the ability to bond to an active type Rho protein and further a site to be phosphorylated present in its structure. The new protein is used as a therapeutic agent, etc., for diseases concerned with the active type Rho protein for treatment, etc., of tumorgenesis, infiltration or metastasis of cancer, diseases causing the acceleration of cell aggregation (cardiac infarction, cerebral infarction, inflammatory thombosis, etc.), circulatory diseases causing the acceleration of contraction in smooth muscles (hypertension, arteriosclerosis, asthma, etc.), etc. The protein is obtained by separating a crude membrane fraction from a bovine cerebra cinerea homogenate, extracting the resultant homogenate with a buffer and purifying the extract solution with an affinity column.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a novel protein having the ability to bind to active Rho protein.

2. Description of the Related Art In vivo, a molecular weight of 2 to 3 having no subunit structure
There are a large group of low molecular weight GTP binding proteins (G proteins). At present, more than 50 members have been found in the superfamily of low molecular weight G proteins, from yeast to mammals. The low molecular weight G protein has Ra
s, Rho, Rab, and other four families. In addition, the Rho family is Rh
o protein, Rac protein and Cdc42 protein. It has been revealed that this low-molecular-weight G protein controls various cell functions. , Cell aggregation, cell movement,
It is thought to control cell division and the like.

[0003] The Rho family of proteins, like other low molecular weight GTP-binding proteins, have a GDP / GTP
It exhibits binding ability and GTPase activity, and exists as an inactive form bound to GDP or an active form bound to GTP, and is mutually converted by a GDP / GTP exchange reaction or a reaction by GTPase. The GDP / GTP exchange reaction is
GDP / GTP exchange promoting proteins such as Smg GDS, Dbl, Ost, Tiam-1 and Rho GDI
And is controlled by a GDP / GTP exchange inhibitory protein such as The GTPase reaction is performed by Rho GTPas
e-activating protein (GAP), ie Ras GAP
(Settleman J. et al., Nature
, 359,153-154 (1992)), Rho GAP (Lancaster
CA et al., J. Biol. Chem., 269, 1137-1142 (1994).
), And Rho GAP p122 (Homma Y. & Em
ori Y., EMBO J., 14, 286-291 (1995)).

[0004] The C-terminus of the natural RhoA protein is C-terminal.
There is a ys-AA-Leu (A is an aliphatic amino acid) structure, a geranylgeranyl group transfer enzyme binds to a Cys residue, and the carboxyl group of the Cys residue is methylated. This post-translational modification by lipids is thought to be necessary not only for binding of the Rho protein to the cell membrane and interaction with the activity control protein, but also for expression of its function (Imazum
i, K. et al., Experimental Medicine 13, 646-656 (1995)). Rho
A protein, RhoB protein, RhoC protein, Rac1 protein, Rac2 protein, Cdc
Amino acid sequences of Rho family proteins, such as 42 proteins, are more than 50% similar to each other. This Rho family of proteins is involved in reactions that cause the formation of stress fibers and focal contacts in response to extracellular signals such as lysophosphatidylic acid and growth factors. It is thought (Ridley AJ & Hall
A., Cell, 70, 389-399 (1992), Ridley AJ & Hall
A., EMBO J., 13, 2600-2610 (1994)). In addition, Rho-family proteins are used for cell morphological changes (Paterson
HF et al., J. Cell Biol., 111, 1001-1007 (1990)), cell aggregation (Tominaga T. et al., J. Cell Biol., 120, 1529-15)
37 (1993), Morii, N. et al., J. Biol. Chem. 267, 20921-2092.
6 (1992)), cell motility (Takaishi K. et al., Oncogene, 9,
273-279 (1994)), cytokinesis (cytokinesis) (Kishi
K. et al., J. Cell Biol., 120, 1187-1195 (1993), Mabuc
hi I. et al., Zygote, 1, 325-331 (1993)) is also considered to be related to physiological functions with cytoskeletal rearrangement. In addition, the subfamily Rho proteins are characterized by smooth muscle contraction (Hirata K. et al., J. Biol. Chem., 2
67,8719-8722 (1992)), phosphatidylinositol 3-kinase (PI 3-kinase) (Zhang J. et a
Chem., 268, 22251-22254 (1993)), phosphatidylinositol 4-phosphate 5-kinase (P
I 4,5-kinase) (Chong LD et al., Cell, 79, 5
07-513 (1994)) and the expression of c-fos (Hill CSet al.,
Cell, 81, 1159-1170 (1995)).

[0005] As described above, the stimulation of an extracellular signal converts the Rho family protein from an inactive GDP-bound form to an active GTP-bound form. It is assumed that the binding of a specific target to an “active Rho protein” causes a unique physiological function (Nobes CD & Hall A., Curr-Opi
n-Genet-Dev., 4, 77-81 (1994)).

[0006] Phosphorylation of the myosin light chain plays an important role in smooth muscle contraction induced by vasoconstrictors (Kamm, KE & Stull, JT, Annu. Rev. Pharmacol.
xicol. 25,593-603 (1985)), and also plays an important role in the binding of myosin to the cytoskeleton in response to extracellular signals and the resulting reorganization of the cytoskeleton in non-muscle cells. Known (Jennings, LKet al., J. Bio
l. Chem. 256, 6927-6932 (1981), Fox, JE & Phillips, D.
R., J. Biol. Chem. 257, 4120-4126 (1982)). Furthermore, it is known that phosphorylation of myosin light chain is specifically regulated by myosin light chain kinase and myosin light chain phosphatase (Kamm, KE & Stull, JT, Annu.
harmacol.Toxicol.25,593-603 (1985)).

Here, myosin light chain phosphatase is composed of at least two subunits, a myosin binding subunit and a phosphatase catalytic subunit. Although the precise function of the myosin binding subunit has not yet been elucidated, it is believed that the myosin binding subunit enhances the phosphatase activity of the phosphatase catalytic subunit for myosin by directly binding to phosphorylated myosin. The amino acid sequence of the myosin-binding subunit has been deduced from chicken and rat cDNAs (Shimizu,
H. et al., J. Biol. Chem. 269, 30407-30411 (1994), Chen,
YH et al., FEBS Lett. 356, 51-55 (1994)). However, as far as the present inventors know, the cDNA of human-derived myosin binding subunit has not yet been isolated,
Therefore, its amino acid sequence is unknown.

Ca ²⁺ induces smooth muscle contraction and the binding of myosin to the cytoskeleton. Ca ²⁺ activates calmodulin-dependent myosin light chain kinase to phosphorylate the myosin light chain, Myosin ATPas
by activating e (Kamm, KE & Stull, JT, An
nu.Rev.Pharmacol.Toxicol.25,593-603 (1985), Jennin
gs, LK et al., J. Biol. Chem. 256, 6927-32 (1981), Fox,
JE & Phillips, DR, J. Biol. Chem. 257, 4120-4126 (198
2)).

[0009] However, the concentration of Ca ^{2+ in the} cytoplasm is not always proportional to the contraction of smooth muscle, and there is a further mechanism for controlling the contraction of smooth muscle (Bradley, A. et al.
B. & Morgan, KG, J. Physiol. 385, 437-448 (1987)). That is, GTPγS, an analog of GTP that does not hydrolyze
Is the Ca required for contraction in the membrane permeated smooth muscle.
It has been suggested that GTP-binding proteins may regulate the sensitivity of Ca ²⁺ to reduce ²⁺ concentrations (Kitaza
wa, T.et al., Proc.Natl.Acad.Sci.USA 88,9307-9310 (1
991), Moreland, S. et al., Am. J. Physiol. 263, C540-C544
(1992)). It has also been suggested that Rho protein is involved in GTP-enhanced Ca ²⁺ sensitivity in smooth muscle (Hirata, K. et al., J. Biol. Chem. 26).
7,8719-8722 (1992)). In addition, recent evidence has revealed that GTPγS is capable of submaximal C maxinization in transmembrane-treated smooth muscle via suppression of myosin light chain phosphatase activity by Rho proteins.
It has been suggested that a2 ⁺ concentration may increase the phosphorylation of myosin light chain (Noda, M. et al., FEBS Lett. 36
7,246-250 (1995)).

However, there has been no report that the myosin light chain phosphatase directly interacts with the Rho protein as far as the present inventors know.

[0011]

SUMMARY OF THE INVENTION The present inventors have now reported that active Rho protein and glutathione-S-transferase (GS
T) using Glutathione Sepharose column chromatography immobilized with the fusion protein
Signaling proteins that bind to the ho protein were analyzed. As a result, myosin light chain phosphatase
GTPγS · GS is adsorbed on a GST-Rho affinity column, and the myosin binding subunit produced by in vitro translation is GTPγS · GS.
Binding to T-Rho, the recombinant myosin binding subunit inhibiting the GTPase activity of the activated Rho protein stimulated by p122Rho GAP,
We found that it adsorbed to a PγS GST-Rho affinity column and that this protein had protein kinase activity and strongly phosphorylated the myosin binding subunit. The present invention is based on this finding.

That is, the present invention relates to a protein derived from mammals (hereinafter referred to as "p138 protein") which has an ability to bind to active Rho protein or has a phosphorylation site in its structure, and a protein thereof. The purpose is to provide a modified protein.

Further, the present invention relates to a peptide or protein having a modified amino acid sequence of a myosin-binding subunit having an active Rho protein binding ability or having a phosphorylation site in its structure or an equivalent sequence thereof, and a myosin. Therapeutic agent for a disease associated with a Rho protein comprising a binding subunit and the like, a gene therapeutic agent for a disease associated with a Rho protein comprising a base sequence encoding a myosin binding subunit and the like, active R
It is an object of the present invention to provide a method for screening a substance that inhibits the binding between a ho protein and a myosin binding subunit, and a method for screening a substance that inhibits phosphorylation of a myosin binding subunit.

[0014]

[Detailed Description of the Invention] p138 protein p138 protein has an active Rho protein binding ability. Here, Rho protein includes Rho
A protein, RhoB protein, RhoC protein, or RhoG protein.

In the present invention, a protein having “active Rho protein binding ability” refers to a protein which is evaluated by those skilled in the art as having been recognized as having bound to an active Rho protein. 4 means a protein evaluated to be recognized as bound to the active Rho protein when tested under the same conditions as in 4.

In the present invention, the term "protein having a site to be phosphorylated in its structure" refers to a protein having a site in its structure that is phosphorylated by protein kinase. 7 means a protein evaluated to be phosphorylated when tested under the same conditions as in Example 7 or Example 8. In addition, this “phosphorylation site” is an activated Rh
o It has the property of being specifically phosphorylated by a protein having protein binding activity and having protein kinase activity (hereinafter referred to as "p164"). Bovine brain-derived p164 had about 1 as measured by SDS-PAGE.
It has a molecular weight of 64 kDa. Here, “specifically” means that p164 phosphorylates the protein (the site to be phosphorylated), but the degree of phosphorylation of other substrate proteins is weaker or not at all. Shall be.

In the present invention, the term "modified protein" refers to a protein in which the amino acid sequence of the p138 protein has been modified by adding, inserting, deleting or substituting amino acids, and has at least an active Rho protein binding ability,
It has either GTPase inhibitory activity of activated Rho protein stimulated by Rho GAP or has the property of a substrate protein phosphorylated by protein kinase (particularly p164). Hereinafter, the “p138 protein according to the present invention” includes modified proteins.

The p138 protein according to the present invention may have the ability to bind to active Rho protein, and may have a site to be phosphorylated in its structure. The p138 protein according to the present invention is derived from animals (eg, mammals). Sources of the protein according to the present invention include, for example, chicken, rat, cow, human and the like.

The p138 protein according to the present invention binds to an active Rho protein. Also, Rh
oProtein aggregates platelets and lymphocytes, cell morphology,
Ridley AJ & Hall A., Cell, 70, 389-399.
(1992), Ridley AJ & Hall A., EMBO J., 13,2600-261
0 (1994), Paterson HF et al., J. Cell Biol., 111, 10.
01-1007 (1990), Tominaga T. et al., J. Cell Biol., 120,
1529-1537 (1993), Morii, N. et al., J. Biol. Chem. 267, 2.
0921-20926 (1992), Takaishi K. et al., Oncogene, 9,273
-279 (1994), Kishi K. et al., J. Cell Biol., 120, 1187-
1195 (1993), Mabuchi I. et al., Zygote, 1,325-331 (19
93)).

The Rho protein is closely related to tumor formation and metastasis as described below. Among the GDP / GTP exchange promoting proteins that activate Rho proteins,
Db1 (Hart MJ et al., J. Biol. Chem. 269, 62-65 (199
4)) and Ost (Horii Y. et al., EMBO J. 13, 4776-47).
86 (1994)) is a proto-oncogene. More recently, Rh
o protein promotes cell cycle (Olson MF et al., Sci.
ence, 1270-1272 (1995)), expression of the proto-oncogene c-fos (Hill CSet al., Cell, 81, 1159-1170 (1995)), tumor formation (Prendergast GC et al., Oncogene 10, 2289-).
2296 (1995), Khosravi-Far et al., Mol. Cell. Biol. 15,6.
443-6453 (1995)), cancer invasion and metastasis (Yoshioka
K. et al., FEBS Lett., 372, 25-28 (1995)).

Therefore, the p138 protein according to the present invention is useful for elucidating the functions of cells, particularly for elucidating mechanisms of tumor formation and metastasis, contraction of vascular smooth muscle, platelet aggregation and inflammation.

Active Rho Protein Binding Protein According to the present invention, a peptide or protein having a modified amino acid sequence of myosin binding subunit or its equivalent sequence, wherein the modified amino acid sequence is an active Rho protein
A protein having a protein binding ability (hereinafter referred to as “active Rho protein binding protein”) is provided.
Here, the “modified amino acid sequence” refers to an amino acid sequence that is modified by adding, inserting, deleting, deleting, or substituting an amino acid in a certain amino acid sequence. Therefore, the partial amino acid sequence of the myosin binding subunit composed of a part of the entire amino acid sequence of the myosin binding subunit and having the activity of binding the active Rho protein is also referred to as the “modified amino acid sequence of the myosin binding subunit”. "Is one aspect of the invention.

The entire amino acid sequence of the myosin binding subunit is known, for example, from rat and chicken. Among them, the sequence of the rat myosin binding subunit is as described in SEQ ID NO: 1. is there. Complete amino acid sequence of protein of rat and chicken species (e.g., human, cow, pig, rabbit, mouse, frog, Drosophila, nematode, yeast, etc.) having homology to the sequence of rat and chicken myosin binding subunit Are also included in the entire amino acid sequence of the myosin binding subunit referred to herein. In addition, we have now determined the entire amino acid sequence of the myosin binding subunit from humans. Its sequence is as set forth in SEQ ID NO: 3. The origin of the myosin-binding subunit is not particularly limited, and may be derived from animals including rats, chickens, cattle and humans, or may be derived from other sources.

The peptide or protein according to the present invention has an active Rho protein binding ability. here,
As the Rho protein, Rho protein is Rh
oA protein, RhoB protein, RhoC protein, RhoG protein and the like.

In the present invention, the amino acid sequence “having the ability to bind to active Rho protein” has the same meaning as defined for p138 protein. In the present invention, the term "equivalent sequence" means that the amino acid sequence has the same function as the sequence before the modification even if there is a modification such as addition, insertion, deletion, deletion or substitution of an amino acid. An amino acid sequence in which a modification such as addition, insertion, deletion, deletion or substitution of an amino acid has occurred in a modified amino acid sequence capable of binding to a type Rho protein, and which still has a binding capability to an active Rho protein Means

Specific examples of the active Rho protein-binding protein according to the present invention include the sequence of No. 1 to 707 of the amino acid sequence shown in SEQ ID NO: 1 or 699 to
No. 976 or a modified amino acid sequence thereof or an equivalent sequence thereof, and the amino acid sequence shown in SEQ ID NO: 1 or 699 to 976 or a modified amino acid sequence thereof Or those comprising an equivalent sequence thereof. Further, as another specific example of the activated Rho protein binding protein according to the present invention, the entire amino acid sequence represented by SEQ ID NO: 3 and the sequence of positions 754 to 1030, or their modified amino acid sequences or their equivalent sequences And those comprising the entire amino acid sequence of SEQ ID NO: 3 or the sequence of positions 754 to 1030, or their modified amino acid sequences or their equivalent sequences. The “modified amino acid sequence” herein means the same content as described above. For example, the sequence of amino acids 1 to 707 of the amino acid sequence described in SEQ ID NO: 1 or 699
The partial amino acid sequence of the sequence from position to position # 976 or an equivalent sequence thereof having an active Rho protein binding ability is also one embodiment of the modified amino acid sequence herein.

The activated Rho protein-binding protein according to the present invention comprises a modified amino acid sequence of a myosin-binding subunit having an activated Rho protein-binding ability. In addition, the activated Rho protein is closely involved in the expression of cell functions such as aggregation of platelets and lymphocytes, tumor formation and metastasis, as well as cell morphology, cell motility, and cytokinesis, as described above. Therefore, the activated Rho protein-binding protein according to the present invention is useful for elucidating the functions of cells, particularly for elucidating the mechanisms of tumor formation and metastasis, contraction of vascular smooth muscle, platelet aggregation and inflammation.

According to the phosphorylation site occurring protein present invention, a peptide or protein having a modified amino acid sequence or an equivalent sequence of myosin binding subunit, wherein the modification amino acid sequence can be phosphorylation sites in their structure is What is present (hereinafter referred to as “protein having a phosphorylation site”) is provided. here,
The “modified amino acid sequence” has the same meaning as defined for the activated Rho protein-binding protein. For example, a partial amino acid sequence composed of a partial sequence of the entire amino acid sequence of the myosin binding subunit, and the partial amino acid sequence having a phosphorylation site in the structure is also referred to as the “modified amino acid sequence of the myosin binding subunit”. This is one embodiment.

The entire amino acid sequence of the myosin binding subunit is known, for example, from rat and chicken, and its sequence is as described in SEQ ID NO: 1. Complete amino acid sequence of protein of rat and chicken species (e.g., human, cow, pig, rabbit, mouse, frog, Drosophila, nematode, yeast, etc.) having homology to the sequence of rat and chicken myosin binding subunit Are also included in the entire amino acid sequence of the myosin binding subunit referred to herein. As described above, the entire amino acid sequence of human is set forth as SEQ ID NO: 3. The origin of the myosin binding subunit is not particularly limited, and may be derived from mammals including bovine and human, or may be derived from other sources.

In the present invention, the amino acid sequence “having a site to be phosphorylated in the structure” has the same meaning as defined for p138 protein. In the present invention, the `` equivalent sequence '' means that even if there is a modification such as addition, insertion, deletion, deletion or substitution of an amino acid in the amino acid sequence, it has the same function as the sequence before the modification. In a modified amino acid sequence in which a site to be phosphorylated exists in the structure, addition of an amino acid,
An amino acid sequence in which a modification such as insertion, deletion, deletion, or substitution has occurred, and which still has a phosphorylation site in its structure.

Specific examples of the protein having a phosphorylation site according to the present invention include those consisting of the amino acid sequence of No. 699 to 976 of the amino acid sequence shown in SEQ ID NO: 1 or a modified amino acid sequence thereof, or an equivalent sequence thereof. And 699 to 97 of the amino acid sequence described in SEQ ID NO: 1.
No. 6 or a modified amino acid sequence thereof, or an equivalent sequence thereof. The “modified amino acid sequence” herein means the same content as described above. For example, the modified amino acid sequence described in SEQ ID NO: 1 is a partial amino acid sequence of the amino acid sequence of positions 699 to 976 or an equivalent sequence thereof, wherein the phosphorylated site is specifically phosphorylated by p164. It is one embodiment of an amino acid sequence. Also, p
Phosphorylation of this subsequence by 164 results in activation of Rho
Markedly enhanced in the presence of protein.

The protein having a phosphorylation site according to the present invention comprises a modified amino acid sequence of a myosin-binding subunit capable of binding to active Rho protein. In addition, the activated Rho protein is closely involved in the expression of cell functions such as aggregation of platelets and lymphocytes, tumor formation and metastasis, as well as cell morphology, cell motility, and cytokinesis, as described above. Therefore, the protein having a phosphorylated site according to the present invention is useful for elucidating the functions of cells, particularly for elucidating the mechanisms of tumor formation and metastasis, contraction of vascular smooth muscle, plate aggregation and inflammation.

In the present invention, the active Rho protein-binding protein may have a phosphorylation site in its structure, and the protein having the phosphorylation site has an active Rho protein binding ability. You may have. That is, according to the present invention, there is provided a peptide or protein having a modified amino acid sequence of a myosin-binding subunit or an equivalent sequence thereof, wherein the sequence has an active Rho protein-binding ability and has The presence of a phosphorylation site is provided.

Hereinafter, the term “peptide or protein according to the present invention” is used to include the above-mentioned protein in addition to the active Rho protein-binding protein and the protein having a site to be phosphorylated.

The peptide or protein according to the present invention may not have myosin light chain phosphatase catalytic subunit and / or myosin binding ability. Here, "a protein having no binding ability"
Refers to a protein that is evaluated by those skilled in the art to have no binding to the myosin light chain phosphatase catalytic subunit and / or myosin. For example, as in Example 1 or 3, or as described in H. Simizu, et al. Means that the protein is evaluated as not binding to the myosin light chain phosphatase catalytic subunit or the like when tested under the conditions described in

According to another aspect of the present invention, the sequence of amino acids 1 to 707 or 6
A peptide or protein consisting of the sequence Nos. 99 to 976 or a modified amino acid sequence thereof, and SEQ ID NO: 1
Or a peptide or protein comprising the amino acid sequence of No. 1 to 707 or the sequence of No. 699 to 976 of the amino acid sequence described in or a modified amino acid sequence thereof. According to another aspect of the present invention, a peptide or protein comprising the entire amino acid sequence of SEQ ID NO: 3 and the sequence of positions 754 to 1030, or their modified amino acid sequences or their equivalent sequences, and sequences A peptide or protein comprising the entire amino acid sequence described in No. 3 or the sequence of positions 754 to 1030, or a modified amino acid sequence thereof or an equivalent sequence thereof is provided. Hereinafter, the term “peptide or protein according to the present invention” is used to include the above peptide or protein.

Salts encoding peptides or proteins
Base Sequence According to the present invention, a base sequence encoding the peptide or protein according to the present invention is provided. A typical sequence of this nucleotide sequence is the DNA described in SEQ ID NOs: 2 and 4.
It has part or all of the sequence. Further, as described above, the present invention also includes the partial sequence of the amino acid sequence shown in SEQ ID NO: 1, the entire sequence of the amino acid sequence shown in SEQ ID NO: 3, and the equivalent sequence of the partial sequence. Therefore, the nucleotide sequence according to the present invention further includes a nucleotide sequence encoding this equivalent sequence. In the present specification, the term “base sequence” refers to a DNA sequence and an RNA.
It shall mean any of the arrays.

Given the modified amino acid sequence, the nucleotide sequence encoding it is easily determined, and the amino acid sequence described in SEQ ID NO: 1 and its partial sequence, SEQ ID NO: 3
Various nucleotide sequences encoding the entire sequence of the amino acid sequence described in (1) and its partial sequence and its equivalent sequence can be selected. Therefore, the nucleotide sequence encoding the peptide or protein according to the present invention is represented by SEQ ID NOS: 2 and 4
In addition to a part or all of the DNA sequence described in (1), a sequence encoding the same amino acid and having a degenerate codon as a DNA sequence is also meant. Is also included.

The nucleotide sequence according to the present invention may be of natural origin or may be totally synthesized. In addition, a product synthesized using a part of a product derived from a natural product may be used. A typical method for obtaining DNA is a method commonly used in the field of genetic engineering from a chromosome library or a cDNA library, for example, screening by using an appropriate DNA probe created based on partial amino acid sequence information. And the like.

The nucleotide sequence according to the present invention includes, for example,
2185-301 of the DNA sequence set forth in SEQ ID NO: 2
And a sequence consisting of the sequence No. 8 or the sequence Nos. 2260 to 3090 of the DNA sequence described in SEQ ID NO: 4.

Vector and Transformed Host Cell According to the present invention, the above-mentioned nucleotide sequence of the present invention is contained in a state capable of replicating in a host cell and expressing a protein encoded by the nucleotide sequence. A vector is provided. Further, according to the present invention, there is provided a host cell transformed with the vector. The host-vector system is not particularly limited, and a fusion protein expression system with another protein can be used. Examples of the fusion protein expression system include those using MBP (maltose binding protein), GST (glutathione-S-transferase), HA (hemagglutinin), myc, Fas and the like.

Examples of the vector include a plasmid vector (eg, an expression vector in prokaryotic cells, yeast, insect cells, animal cells, etc.), a viral vector (eg, a retrovirus vector, an adenovirus vector, an adeno-associated virus vector, a herpes virus vector) , Sendai virus vectors, HIV vectors), liposome vectors (eg, cationic liposome vectors) and the like.

In order to express the desired amino acid sequence by actually introducing the vector into a host cell, the vector according to the present invention may be used in addition to the above-described nucleotide sequence according to the present invention, as well as a sequence for controlling its expression, a microorganism, or the like. It may contain a genetic marker or the like for selecting animal cultured cells and the like. This vector may contain the nucleotide sequence according to the present invention in a repeated form (tandem). These may be present in a vector according to a conventional method, and a method for transforming a microorganism or an animal cultured cell with the vector may be one commonly used in this field.

The procedure and method for constructing a vector according to the present invention may be those commonly used in the field of genetic engineering. Examples of host cells include Escherichia coli, yeast, insect cells, and animal cells (eg, COS cells,
Lymphocytes, fibroblasts, NIH / 3T3 cells, CHO cells, blood cells, tumor cells, etc.).

The transformed host cell is cultured in an appropriate medium, and a peptide or protein having the above-described modified amino acid sequence according to the present invention or an equivalent sequence thereof can be obtained from the culture. Therefore, according to another aspect of the present invention, there is provided a method for producing a peptide or protein having a modified amino acid sequence according to the present invention or an equivalent sequence thereof. The culture of the transformed host cells and their conditions may be essentially the same as for the cells used. Further, recovery and purification of the modified amino acid sequence and the like according to the present invention from the culture solution can also be performed according to a conventional method.

Use of Protein According to the present invention, the myosin-binding subunit and the active Rho protein-binding protein are each composed of an active Rho protein.
Has protein binding ability. Therefore, it is considered that signal transduction from the active Rho protein to its target protein can be blocked by neutralizing the active Rho protein using a myosin binding subunit or the like. Rho protein has also been shown to be involved in tumor formation or metastasis, cancer invasion and metastasis, cell aggregation, and smooth muscle contraction (Prendergast, GC et al., Supra).
hosravi-Far et al., Yoshioka K. et al., Tominaga,
T. et al., Morii, N. et al., Hirata, K. et al., Nob
a, M. et al.,).

The present inventors have found that myosin light chain phosphatase and one of its subunits, the myosin binding subunit, are one of the most suitable physiological substrates for p164 (see Examples). 5, Examples 7 and 8). In addition, it was found that phosphorylation of the myosin binding subunit contained in myosin light chain phosphatase suppresses the phosphatase activity (Examples 7 and 8). Furthermore, it was found that expression of the Rho protein in cells considered to endogenously express the p164 protein phosphorylates the myosin-binding subunit and myosin light chain (Example 8). Based on these findings, Rho protein is thought to promote smooth muscle contraction by the following mechanism. (1) Activated Rho protein binds to myosin-binding subunit and activated Rho protein is p1
64. (2) Depending on the binding to the active Rho protein, p1
64 phosphorylates the myosin binding subunit. (3) The phosphorylated myosin binding subunit suppresses the myosin light chain phosphatase activity of the phosphatase catalytic subunit. (4) Since myosin light chain phosphatase activity is suppressed, dephosphorylation of myosin is inhibited. (5) As a result of suppression of dephosphorylation, myosin cannot be depolymerized from actin. (6) As a result, smooth muscle contraction is enhanced and contraction is continued. This mechanism involves not only smooth muscle contraction but also tumor formation or metastasis involving Rho protein, cancer invasion or metastasis,
It is likely that it is also involved in cell aggregation.

Therefore, by administering the myosin-binding subunit or the active Rho-protein-binding protein, or by expressing them in vivo, including humans, the active Rho-protein binds to the myosin-binding subunit and the like. As a result, signal transduction from the active Rho protein to a target protein such as myosin light chain phosphatase is blocked,
It is thought that protein-related tumor formation or metastasis, cancer invasion or metastasis, cell aggregation, and smooth muscle contraction can be suppressed.

The active Rho protein-binding protein and the protein having a phosphorylation site have an active Rho protein-binding site and a phosphorylation site in their structures, respectively. In addition, as one embodiment thereof, a myosin light chain phosphatase catalytic subunit and / or a myosin light chain phosphatase having no myosin binding ability can be mentioned. By the way, the myosin-binding subunit is activated Rho
In addition to the protein binding ability and the property of a protein having a phosphorylation site, there is a property of myosin binding ability and catalytic subunit binding ability. Ibid. Shimizu H. et a
According to l. (1994), among the functions of myosin light chain phosphatase, myosin-binding ability and catalytic subunit-binding ability are considered to be present in the N-terminal 58 kDa fragment.

Therefore, an active Rho protein-binding protein or a protein having a phosphorylation site, which is a myosin light chain phosphatase catalytic subunit and / or a protein having no myosin-binding ability, is administered, or When expressed in vivo, including humans, these proteins and the like bind to the active Rho protein or undergo phosphorylation by p164, but cannot bind to myosin or the catalytic subunit. It is considered that the suppression of endogenous myosin light chain phosphatase by the activated Rho protein can be inhibited, and as a result, the suppression of myosin dephosphorylation can be inhibited. Therefore, an active Rho protein-binding protein or a protein having a phosphorylation site and having no myosin light chain phosphatase catalytic subunit and / or myosin-binding ability can be used for tumor formation or metastasis involving Rho protein. It is thought that it can suppress cancer invasion and metastasis, cell aggregation, and smooth muscle contraction.

Therefore, as another embodiment of the present invention,
There is provided a therapeutic agent for a disease associated with active Rho protein, comprising a myosin binding subunit or a protein or peptide according to the present invention.

Here, “myosin binding subunit”
Is used to include the p138 protein. The origin of the myosin binding subunit is human,
It may be derived from mammals including cattle or the like, or may be derived from other sources.

The term “myosin-binding subunit” is used to include its modified protein, and the term “modified protein” as used herein refers to a substance having the same meaning as defined in p138 protein. I do.

The “disease involving the active Rho protein” includes tumor formation (eg, tumor formation involving other low molecular weight G proteins (eg, Ras protein, Rac protein, cdc42 protein, Ral protein, etc.)). , Tumor formation involving a low molecular weight G protein activating protein (eg, Dbl, Ost, etc.), receptor tyrosine kinase (eg, PDGF receptor, EGF receptor, etc.), or transcriptional regulatory protein (myc, p53, etc.) ) Is involved in tumor formation, lysophosphatidic acid (WH Moolenaar, J. Biol. Chem. 27
0, 12949-12952 (1995)), diseases associated with tumor formation, cancer invasion and metastasis, enhanced cell aggregation (eg, myocardial infarction, cerebral infarction, inflammatory thrombosis, etc.), and enhanced smooth muscle contraction (Eg, hypertension, vasospasm, arteriosclerosis, asthma, etc.).

[0055] The therapeutic agent of the present invention specifically includes an inhibitor of tumor formation or metastasis, an inhibitor of platelet aggregation,
Anti-inflammatory drugs, cardiovascular diseases (eg, hypertension, vasospasm,
Arteriosclerosis, asthma, myocardial infarction, cerebral infarction).

The therapeutic agent according to the present invention can also be administered orally or parenterally (eg, intramuscular, intravenous, subcutaneous, rectal, transdermal, nasal, etc.), preferably orally. It is used in humans and non-human animals in various dosage forms suitable for oral or parenteral administration as a medicament.

The therapeutic agent for a disease associated with the Rho protein may be, for example, an oral preparation such as a tablet, a capsule, a granule, a powder, a pill, a fine granule, a troche, an intravenous injection and an intramuscular injection, depending on its use. Injections, rectal administration, oily suppositories, etc.
It can be prepared in any formulation such as a water-soluble suppository. These various formulations, commonly used excipients, extenders, binders, wetting agents, disintegrants, surfactants,
It can be produced by a conventional method using a lubricant, a dispersant, a buffer, a preservative, a solubilizer, a preservative, a flavoring agent, a soothing agent, a stabilizer and the like. Examples of the nontoxic additives that can be used include lactose, fructose, glucose, starch, gelatin, magnesium carbonate, synthetic magnesium silicate, talc, magnesium stearate, methylcellulose, carboxymethylcellulose or salts thereof, gum arabic, polyethylene glycol Syrup, petrolatum, glycerin, ethanol, propylene glycol, citric acid, sodium chloride, sodium sulfite, sodium phosphate and the like.

The content of the peptide or protein in the drug varies depending on the dosage form, but is usually about 0.1 to about 50% by weight, preferably about 1 to about 20% by weight in the total composition. The dose is appropriately determined in consideration of the usage, the age of the patient, gender, degree of symptoms, and the like.
About 0.1 to about 500 mg per day, preferably about 0.5 to
The dose is preferably about 50 mg, which can be administered once or several times a day.

According to yet another aspect of the present invention, there is provided Rh comprising a base sequence encoding a mision binding subunit or a peptide or protein according to the present invention.
A gene therapy agent for treating a disease associated with o-protein is provided. This gene therapy agent transforms a target cell using the vector having a base sequence encoding a mision-binding subunit or a peptide or protein according to the present invention, for example, in such a manner as to suppress tumor formation or metastasis. Can be used.

Transformed cells include cancer cells in cancer patients, such as myeloid leukemia cells, lymphocytic leukemia cells, lung cancer cells, colon cancer cells, gastric cancer cells, stomach cancer cells, pancreatic cancer cells, breast cancer cells, and kidney cancer cells. Examples include cancer cells, head and neck cancer cells, liver cancer cells, skin cancer cells, brain tumor cells, and the like.

Gene therapy can be performed on malignant tumors and the like by introducing the vector having the nucleotide sequence encoding the protein or the like according to the present invention into cancer cells in vivo, including humans, by an appropriate method. Regarding the vector for gene therapy, reference can be made to Experimental Medicine (Extra Issue), Vol. 12, No. 15, “The Forefront of Gene Therapy” (1994) supervised by Fumima Takaku.

[0062] According to the screening method the present invention, (1) the subject to substance screening, be present in the screening system comprising a peptide or protein by activated Rho protein and myosin binding subunit or the invention, and (2 C) measuring the degree of inhibition of binding between the active Rho protein and the myosin binding subunit or the peptide or protein according to the invention, A method for screening for a substance that inhibits the binding of is provided.

Here, “measuring the degree of inhibition of binding”
The method includes a recombinant GTPγS · GS in a cell-free system.
A method for measuring the binding to T-RhoA protein using glutathione-sepharose beads;
Measurement method using an assay (Mancer, E. et al. J.
Biol. Chem. 267, 16025-16028 (1992)), a method for measuring the degree of suppression of Rho protein GTPase activation by Rho protein GAP, and the like.
The degree of inhibition of binding can be measured according to the methods described in Examples 1, 3, 4, and 6. The screening system further includes GTP of the active Rho protein.
ase activating protein may be present.

The screening system may be either a cell system or a cell-free system. Examples of the cell system include yeast cells, NIH / 3T3 cells, and COS cells. The cell line may be one expressing Rho protein, p164, myosin binding subunit, and the like. Screening was performed using the yeast two hybrid system (M. Kawabata Experimental Medicine 13,2111-2120 (1995), ABVojetk et al. Cell 74,2
05-214 (1993)). The target of the screening is not particularly limited, but includes, for example, peptides, peptide analogs, microbial cultures, and organic compounds.

In the above-mentioned screening method according to the present invention, a myosin-binding subunit expressed by in vitro translation or a peptide or protein according to the present invention can also be used.

According to the present invention, (1) the substances to be screened are p164, myosin light chain,
Being present in a screening system comprising a myosin binding subunit, myosin light chain phosphatase or a peptide or protein according to the invention; and (2) a myosin light chain, myosin binding subunit, myosin light chain phosphatase or a peptide or protein phosphor according to the invention. Measuring the degree of inhibition of oxidation, wherein the myosin light chain, myosin binding subunit,
A method for screening for a substance that inhibits phosphorylation of myosin light chain phosphatase or a peptide or protein according to the present invention is provided.

As a method for measuring the degree of inhibition of phosphorylation of the myosin-binding subunit and the like, the kinase p
A method for measuring the degree of phosphorylation of the myosin binding subunit or myosin light chain phosphatase by 164, for example, 69 of the amino acid sequence of SEQ ID NO: 1 according to the method described in Example 5 or 7.
The degree of phosphorylation inhibition can be measured using a fusion protein of a protein consisting of the sequence of positions 9 to 976 and MBP (maltose binding protein) or natural myosin light chain phosphatase.

Here, p164 is a protein having an active Rho protein binding ability and having a protein kinase activity. P164 derived from bovine brain is SDS
-Has a molecular weight of about 164 kDa as determined by PAGE. Further, p164 has a property that its protein kinase activity is enhanced by binding to active Rho protein. Here, “protein kinase activity” is used in a sense including serine / threonine / protein kinase activity.

In the present invention, p164 includes its modified protein. "Modified protein" refers to the addition of amino acids to the amino acid sequence of p164,
It has been modified by insertion, deletion or substitution, and has at least an active Rho protein binding ability and protein kinase activity. The origin of p164 is not particularly limited, and may be derived from mammals including cattle and humans, or may be derived from other sources.

In the above screening system, when a Rho protein (preferably, an active Rho protein) is further present, phosphorylation of a myosin binding subunit and the like is enhanced. Therefore, when the Rho protein is present in the screening system, the screening can be performed more clearly.

As shown in the examples below, the post-translationally modified Rho protein enhances the protein kinase activity of p164 over the Rho protein without post-translational modification. Therefore, the use of the Rho protein that has undergone post-translational modification enables the screening according to the present invention to be performed more clearly. The screening system and the subject of the screening system include those similar to the above-mentioned screening method.

In the above screening method, (1) a substance to be screened is present in a cell screening system containing a Rho protein and a myosin light chain, and (2) a phosphorylation of myosin light chain is detected. Also included is a method of screening for a substance that inhibits phosphorylation of myosin light chain, comprising measuring the degree of inhibition.

According to the present invention, (1) the substance to be screened is present in a screening system containing p164, myosin light chain phosphatase, a phosphate donor, and a phosphorylated substance. And (2) a method for screening a substance that inhibits the inhibition of myosin light chain phosphatase activity, which comprises measuring the degree of inhibition of myosin light chain phosphatase activity.

Here, examples of the phosphate donor include ATP and ATPγS, and ATPγS is preferable.
The phosphate donor provides a phosphate group upon phosphorylation of myosin light chain phosphatase by p164.

The phosphorylated substance refers to a substance in which orthophosphate, polyphosphoric acid, or the like is present.
The phosphorylated substance becomes a substrate for the phosphatase, and the phosphate bond is hydrolyzed by the action of the phosphatase. Phosphorylated as phosphorylated substances
(monophosphorylated or diphosphorylated)-myosin light chain and the like.

The myosin light chain phosphatase may be of natural origin extracted from a living body (eg, chicken, rat, cow) or commercially available, but is not limited thereto. For example, Shimizu, H, et
al., J. Biol. Chem., 269, 30407-30411 (1994), Chen, Y.
H. et al., FEBS Lett. 356, 51-55 (1994) or Example 1.
Can be prepared according to the method described in

As a method for measuring the degree of inhibition of the activity of myosin light chain phosphatase, a method for measuring the degree of phosphorylation-dephosphorylation of myosin light chain can be mentioned. The degree of inhibition of phosphatase activity can be measured according to the method described.

In the screening system described above, the presence of Rho protein activated Rho protein enhances the phosphorylation of myosin binding subunit, which is one of the subunits of myosin light chain phosphatase. In addition, myosin light chain phosphatase is phosphorylated by p164, thereby suppressing its phosphatase activity. Therefore, Rh was used in the screening system.
Screening can be performed more clearly when o protein is present.

As shown in the examples below, the post-translationally modified Rho protein enhances the protein kinase activity of p164 over the Rho protein without post-translational modification. Therefore, the use of the Rho protein that has undergone post-translational modification enables the screening according to the present invention to be performed more clearly.

The screening system and the subject of the screening system include those similar to the above-mentioned screening method.

As described above, it has been confirmed that the active Rho protein is closely involved in tumor formation or metastasis, cell aggregation, smooth muscle contraction and the like. In particular, the active Rho protein and myosin light chain phosphatase are closely involved in smooth muscle contraction and the like via the myosin binding subunit as described above. Therefore, the above 3
One screening method can also be used as a screening method for a substance that suppresses tumor formation or metastasis, cell aggregation, or smooth muscle contraction, particularly a method for screening a substance that suppresses smooth muscle contraction.

[0082]

The present invention will be described in detail with reference to the following Examples, but it should not be construed that the invention is limited thereto. Example 1 Purification of Activated Rho Protein Binding Protein
Ltd. (1) brain membranes extract prepared bovine brain gray matter a (190 g) into small pieces cut with scissors, 30
0 ml of homogenization buffer (25 mM Tr
is / HCl (pH 7.5), 5 mM EGTA, 1 m
M dithiothreitol (DTT), 10 mM MgC
l ₂ , 10 μM (ρ-amidinophenyl) -methanesulfonyl fluoride, 1 μg / l leupeptin, 1
0% sucrose). Potter the suspension
-Homogenized with an Elvehjem Teflon glass homogenizer and filtered through four layers of gauze. The homogenate was centrifuged at 20,000 xg for 30 minutes at 4 ° C. The precipitate was suspended in 360 ml of a homogenization buffer to obtain a crude membrane fraction. The protein contained in this fraction was extracted by adding an equal volume of a homogenization buffer containing 4 M NaCl. After shaking at 4 ° C. for 1 hour, the membrane fraction was centrifuged at 20,000 × g at 4 ° C. for 1 hour. The supernatant was buffer A (20 mM Tris /
HCl, pH 7.5, 1 mM EDTA, 1 mM DT
(T, 5 mM MgCl ₂ ) three times. Solid ammonium sulfate was added to a final concentration of 40% saturation.
The 0-40% precipitate was dissolved in 16 ml of buffer A, dialyzed three times against buffer A, and used as a membrane extract.

(2) Preparation of GST-low molecular weight G protein affinity column Shimizu, K. et al., J. Biol. Chem. 269, 22917-2292
GST-Rho according to the method described in
A, GST-RhoA ^Ala37 , GST-Rac1,
GST-H-Ras was purified from E. coli and guanine nucleotide was added. Preparation of guanine nucleotide-linked GST-low molecular weight G protein is performed by adding low molecular weight G protein (1.5 nmol) for 1 hour at 4 ° C. for 15 μm.
M GDP or GTPγS and 1 ml of the reaction solution (20
mM Tris-HCl (pH 7.5), 10 mM E
DTA, 1 mM DTT, 5 mM MgCl ₂ , 1 mM
L-α-dimyristoyl phosphatidylcholine, 0.
3% 3-[(3-cholamidopropyl) dimethylammonio] -1-propanesulfonate (CHAPS)
(Shimizu,
K. et al., J. Biol. Chem. 269, 22917-22920 (199
Four)). In order to prepare an affinity column for analyzing the binding activity of Rho protein-binding protein, GST-low molecular weight G protein (6 nmol each) was immobilized on a 0.25 ml glutathione-Sepharose 4B column (Pharmacia Biotech), Packed in columns. Affinity for Purification of Rho Protein Binding Protein for Primary Structure Determination of Peptides
To prepare the column, GST-low molecular weight G protein (24 nmol each) was immobilized on a 1 ml glutathione-Sepharose 4B column (Pharmacia Biotech) and packed into the column.

(3) GST-Low Molecular Weight G Protein Affinity Column Chromatography The membrane extract was passed through a 2.5 ml glutathione-Sepharose 4B column to remove endogenous GST. 1
0.25 ml of Glutathione Sepharose 4B bound with GST-low molecular weight G protein to which each guanine nucleotide was added was used for the 1/0 column flow-through fraction.
Put on the column. 0.825 with 0.2M NaCl
After washing three times with ml of buffer A, the bound proteins were combined with the respective GST-low molecular weight G proteins,
Elution was carried out with 0.825 ml of buffer A containing 10 mM glutathione. Glutathione eluted fraction 40 μl each
To SDS-PAGE (Laemmli, UK, Nature 227, 680
-685 (1970)), and the gel was stained with silver and analyzed.
The results were as shown in FIG.

As a result, a protein having a molecular weight of about 138 kDa (p138 protein) was converted to a protein having a molecular weight of about 164 kDa.
And a protein having a molecular weight of about 128 kDa,
It was detected in the fraction eluted from the TPγS · GST-RhoA affinity column (lane 3), but the GDP · G
It was not detected in the fraction eluted from the ST-RhoA affinity column. This indicated that p138 protein specifically binds to GTPγS-bound GST-RhoA. The p138 protein is a mutant of the effector region (GTPγS · GST-Rh
oA ^Ala37 ) (lane 4), GTPγS · GST-
H-Ras (lane 6), GDP / GST-H-Ras
(Lane 5) It was not eluted from the affinity column.

(4) Purification of p138 protein In order to identify the p138 protein, as described below, a large amount of the purified p138 protein was prepared and the primary structure of the peptide was determined. The flow-through fraction (16 ml) from the Glutathione Sepharose 4B column was collected at 24 nm
ol of GTPγS · GST-RhoA
Glutathione Sepharose column. The protein was eluted with 10 ml of buffer A containing 10 mM glutathione and 0.2 M NaCl, and 1 ml fractions were collected. The p138 protein was found in fractions 2-10. The same operation was repeated three times. All of these fractions were collected and used as a purified p138 protein sample.

(5) Purification of p164 To purify p164, GTPγS.GST-Rh
The eluted fractions (fractions 3 to 10) from the glutathione-Sepharose affinity column containing oA were diluted with the same amount of buffer A, and
Loaded on Q5 / 5 column. After washing the column with 10 ml of buffer A, the protein was eluted with buffer A adjusted to a linear density gradient of 0 to 0.5 M NaCl solution, and 0.5 ml of the eluted fraction was collected. The results were as shown in FIG. p164 is the fraction 10-1
2 was recovered as a single peak (FIG. 2, upper panel). A part of the eluted fraction (8 to 14) was subjected to SDS-PAGE electrophoresis and stained with silver. As a result, the purity of the purified sample was about 95% (lower part in FIG. 2).

Example 2 Identification of p138 Protein (1) Determination of Primary Structure of Peptide In order to identify the p138 protein, amino acid sequence analysis was performed. The purified p138 protein was purified by SDS-
PAGE, polyvinylidene difluoride membrane (Problot) (Applied Biosystems)
Transferred to. The band corresponding to the p138 protein was digested with Achromobacter protease I (Wako Pure Chemical Industries, Ltd.) which is a lysine-specific endonuclease (Iwamatsu, A., Electrophoresis 13, 14).
2-147 (1992)). The resulting peptide was fractionated by C18 column chromatography and subjected to amino acid sequence analysis for identification. As a result, primary structures of peptides derived from nine kinds of p138 proteins were determined. They are: 1) R
WIGSE, 2) SLLQM, 3) GYTEVL, 4)
ETLIIEPEK, 5) DESPA, 6) AYVAP
TV, 7) SLQGI, 8) AQLHDTNMAL,
9) It was DENGALIRVIS. All of these nine peptide sequences are the 110 kDa regulatory subunit of rat smooth muscle protein phosphatase 1M (supra).
Chen, YH et al.) (SEQ ID NO: 1). This rat protein is the rat counterpart of the myosin-binding subunit of chicken myosin light chain phosphatase (Shimizu, supra).
H. et al.) The homology search for the above proteins was performed using BL
The AST program was used (Altschul, SF et al.,
J. Mol. Biol. 215, 403-410 (1990)).

(2) Immunoblot analysis In order to further confirm that the p138 protein corresponds to the myosin binding subunit of myosin light chain phosphatase, an immunoblot analysis using an anti-myosin binding subunit antibody was performed. 130 from chicken
Rabbit polyclonal antibodies against the kDa myosin binding subunit and rabbit polyclonal antibodies against the 20 kDa regulatory subunit were prepared by preparing respective recombinant proteins according to a conventional method and using them as antigens. Rabbit polyclonal antibody against the 37 kDa type 1 phosphatase catalytic subunit was purchased from Santa Cruz Biotechnology. Immunoblot analysis was performed by Harlow, E. & Lame, D., C.
old Spring Habor Laboratory, Cold Spring Harbor, N
Performed according to the method described in Y, 1988. The results were as shown in FIG.

As a result, the p138 protein was recognized by the above-mentioned anti-myosin-binding subunit antibody, and immune cross-reactivity was detected in the glutathione-eluted fraction (lane 3) from the GTPγS.GST-RhoA affinity column. , GDP GST-RhoA (lane 2), GTPγS GST-RhoA ^Ala37 (lane 4), GDP GST-Rac1 (lane 5), G
TPγS · GST-Rac1 (lane 6), GDP · G
ST-H-Ras (lane 7), GTPγS · GST-
None was detected in the eluted fraction from the H-Ras affinity column (lane 8). The glutathione eluted fraction used for the immunoblot analysis was 40 each.
μl.

The molecular weight of the chicken and rat myosin binding subunits was approximately 130 kD by SDS-PAGE.
a (see Shimizu, H. et al., Chen, supra).
YHet al.). Therefore, it was concluded that the p138 protein is a bovine counterpart of the myosin binding subunit. Myosin light chain phosphatase is composed of a myosin binding subunit, a 37 kDa type 1 phosphatase catalytic subunit and a 20 kDa regulatory subunit (Shimizu, H. et al., Supra).
Chen, YH et al.). Therefore, the catalyst subunit is G
Whether or not it was bound to the TPγS · GST-RhoA affinity column was examined by immunoblot analysis using an anti-catalytic subunit antibody. The results were as shown in FIG.

As a result, the immune cross-reactivity was GTPγS.
Although detected in the eluted fraction from the GST-RhoA affinity column (lane 3), GDP · GST-Rh
oA (lane 2), GTPγS · GST-RhoA
^Ala37 (lane 4), GDP / GST-Rac1
(Lane 5), GTPγS · GST-Rac1 (lane 6), GDP · GST-H-Ras (lane 7), GT
None was detected in the eluted fraction (lane 8) from the PγS · GST-H-Ras affinity column. On the other hand, i corresponding to the 20 kDa regulatory subunit
No immunoreactive band was detected (data omitted). The glutathione eluted fraction used in the immunoblot analysis was 40 μl each.

(3) Measurement of protein phosphatase activity Next, it was examined whether or not myosin light chain phosphatase activity was detected in elution fractions (20 μl each) from various low molecular weight G protein affinity columns. did.
Myosin light chain phosphatase activity was determined by Ishihara, H. e.
t al., Biochem. Biophis. Res.Commun. 159, 871-877
(1989). As a result, the myosin light chain phosphatase activity was GTPγS · GS
It was specifically detected in the fraction eluted from the T-RhoA affinity column (FIG. 5). As a result of quantitative immunoblot analysis, the purified preparation was GTPγS · GST-Rh
The molar ratio of myosin binding subunit to catalytic subunit bound to the oA affinity column was found to be about 2: 1 (data not shown). On the other hand, in the experiment using the crude extract, about 90% of myosin-binding subunits bind to the GTPγS.GST-RhoA affinity column, but only about 10% of the catalytic subunits bind to the GTPγS.GST-RhoA affinity column. It was found not to be combined (data omitted). From this, the holoenzyme of myosin light chain phosphatase is
It was shown to bind to the active Rho protein via the myosin binding subunit.

Example 3 In Vitro Translation
Myosin-binding subunit and Rhota
Protein binding test Recombinant myosin binding subunit was GTPγS-Rho
To investigate whether it binds to A, a recombinant myosin binding subunit was prepared by in vitro translation. In vitro translation of the plasmid pCRII (Invitrogen) incorporating the rat myosin binding subunit (amino acid sequence Nos. 1-976 of SEQ ID NO: 1) was performed using the erythroid lysate system (Promega, Inc.) bound to TNT T7. ) Was performed based on the instruction manual of Promega. The protein obtained by in vitro translation is
As a result of analysis by SDS-PAGE, it showed the same mobility as that of the natural purified rat myosin binding subunit (data not shown).

GST-low molecular weight G protein (each 0.7
5 nmol) was immobilized on 31 μl of glutathione-Sepharose 4B beads, and washed with 310 μl (10-fold volume) of buffer A. To the immobilized beads, 40 μl of the reaction solution for in vitro translation was added, and incubated at 4 ° C. for 1 hour with gentle mixing. Thereafter, the beads were washed three times with 102 μl (3.3 times) of buffer A and 102 μl (3.3 times) of 10 mM.
By adding buffer A containing glutathione, the bound protein was eluted together with GST-low molecular weight G protein. 40 μl of each eluate was subjected to SDS-PA
It was subjected to GE, dried under vacuum, and analyzed by autoradiography.

As a result, the myosin-binding subunit produced by in vitro translation was G
It was eluted in large quantities with TPγS • GST-RhoA (lane 3), but GST (lane 1), GDP • GST
-RhoA (lane 2) or GTPγS · GST-R
Only a relatively small amount was eluted with hoA ^Ala37 (lane 4) (FIG. 6). This confirmed that the myosin binding subunit binds to active RhoA.

Example 4 Rho protein GTPase
Activity test The effect of the myosin light chain subunit on the GTPase activity of the Rho protein stimulated by p122 Rho GAP was examined by the method described below. In order to confirm whether the Rho protein directly acts on the myosin-binding subunit, the N-terminal region of the rat myosin-binding subunit (1-707 of the amino acid sequence described in SEQ ID NO: 1) and the C-terminal region (699- 9
No. 76) was expressed in Escherichia coli by genetic engineering as a fusion protein with a maltose binding protein according to a conventional method, and the recombinant proteins ("MBP-N",
"MBP-C") was prepared.

The plasmid used for this was prepared by the following method. First, plasmid pMAL-c2 containing the N-terminal portion and the C-terminal portion of rat myosin-binding subunit
Was prepared by the following method. A 2.1-kilobase pair cDNA fragment containing the N-terminal amino acid No. 1-707 was ligated to 5 'ATTAGGATCCATGAAGATGCC
GGACCGCG 3 'and 5' AATTGGATCCGTA
Using the TGTTCTGGAACTACTTTGCTT3 'as a primer, rat brain quick clone cD
NA (Clontech) was amplified by PCR and obtained. C
A 840 base pair cDNA fragment containing the above-mentioned amino acids 699-976 was a rat myosin-binding subunit cDNA clone, which was named 5'ATATGGATCCCAA.
GCAAAAGTATTCCAGAACATAC 3 'and 5'ATTTGGATCCTACTTGGAAAGT
Using the primer of TTGCTTTATAAC3 ', P
It was obtained by amplification by the CR method. The cDNA fragment was incorporated into pMAL-c2 at the BamHI site.

The RhoA protein GTPase activity test was performed according to Homma, Y. & Emori, Y., EMBOJ. 14, 286-291 (199).
This was performed according to the method described in 5). The GTPase activity of the RhoA protein is [γ- ³² P] GTP · GS
It was determined by measuring the decrease in T-RhoA radioactivity. [Γ- ³² P] GTP used at this time was purchased from Amersham. [Γ- ³² P] GTP · GST-
RhoA (10 pmol) was added to various amounts of MBP, M
BP-N, or MBP-C and GST-p122 Rh
100 μg in the presence and absence of oGAP (5 pmol)
l of the reaction solution (20 mM Tris / HCl (pH 7.
5), 10 mM EDTA, 1 mM DTT, 10 mM
MgCl ₂ , 1 mM GTP, 0.075% CHA
Treated in PS at 25 ° C. for 2 minutes. The reaction was run with 3 ml of ice cold stop buffer (20 mM Tris / HCl pH
8.0, 100 mM NaCl, 25 mM MgC
l ₂₎ was added to stop, loaded onto a nitrocellulose filter. Filters were run in the same ice-cold stop buffer for 3 hours.
After washing twice, the bound radioactivity was measured using a scintillation counter. The results were as shown in FIG.

As a result, the hydrolysis rate of [γ- ³² P] GTP catalyzed by Rho protein was
It was not affected by BP-C. In contrast, p122 Rho GAP is the Rho protein G
The ability to stimulate TPase activity is determined by MBP-N, MBP
It was found that -C could suppress the concentration-dependently. This suggested that the Rho protein could bind to both the N-terminal and C-terminal of the myosin binding subunit. MBP-N and MBP-C suppressed GAP-stimulated Rho protein GTPase activity with IC ₅₀ of about 100 nM and about 150 nM, respectively (FIG. 7).

Example 5 Rat myosi by p164
In order to examine the phosphorylation activity of the p- binding subunit phosphorylation test p164, the following experiment was performed. The kinase activity test was performed using purified p164 (1
0 ng protein amount) and 2 μM [γ- ³² P]
50 containing ATP (600-800 MBq / mmol)
μl of kinase buffer (50 mM Tris / HC
1, pH 7.5, 1 mM EDTA, 5 mM MgCl
₂ , 0.06% CHAPS) in the presence or absence of a substrate (myosin binding subunit, S6 peptide, or cytoskeletal regulatory protein described below, 40 μM each). After incubation at 30 ° C for 10 minutes,
The reaction solution is boiled in SDS sample buffer,
The sample was subjected to DS-PAGE electrophoresis. Radiolabeled bands were detected by autoradiography. The reaction solution was prepared using Whatman p8 for the kinase activity test.
I spotted one payer. The incorporation of ³² P into the substrate was measured with a scintillation counter. The results were as shown below. In addition, [γ- ³² P] ATP
Was purchased from Amersham.

(1) Test using rat myosin-binding subunit as a substrate Since Rho protein is considered to be involved in cytoskeletal rearrangement, vinculin, a cytoskeletal regulatory protein by p164, is used. , Talin, metavinculin (metavin)
culin), caldesmon,
Filamin, vimentin (vimenti)
n), α-actinin (EA Clark & JS Brugge, Sc
ience, 268, 233-239 (1995)), MAP-4 (H. Aiza
wa et al., J. Biol. Chem., 265,13849-13855 (1990).
), The myosin-binding subunit of myosin phosphatase (YH Chen et al., FEBS Lett., 356, 51-55).
(1994)) was studied according to the above conditions. However, regarding the myosin binding subunit of myosin phosphatase, the C-terminal of rat myosin binding subunit (699 of the amino acid sequence of SEQ ID NO: 1) was used.
No. 976) and a maltose binding protein (see Example 4). As a result, p164
Phosphorylated these substrates in the absence of GST-RhoA or in the presence of GDP.GST. Vinculin, Tallinn, Metavinculin, Caldesmon, Filamine,
When vimentin, α-actinin or MAP-4 was used as a substrate, the degree of enhancement of phosphorylation in the presence of GTPγS · RhoA was low (data not shown). However, when the myosin-binding subunit (50 nM) was used as a substrate, the degree of phosphorylation was significantly enhanced in the presence of GTPγS.GST-RhoA (FIG. 8). GT
The degree of enhancement of phosphorylation of myosin subunit by PγS.GST-RhoA was about 15-fold as compared with the case where another protein was used as a substrate. The concentrations of GST-RhoA used were 1 μM each.

(2) Effect of post-translational modification of RhoA protein H. Horiuchi et al., Mol. Cell. Biol., 12, 451
5-4520 (1992) and T. Itoh, et al., J. Biol.
According to the method described in Chem., 268, 3025-3028 (1993), a post-translationally modified RhoA protein was prepared.
This was used to examine the effect on p164 kinase activity according to the method described above. The results were as shown in FIG. The post-translationally modified GTPγS-binding RhoA protein enhanced the phosphorylation of the S6 peptide more than the unmodified form.

Example 6 Yeast two hybrid cis
Rho protein and myosin binding subunit
Determination of binding to wild-type H-Ras and C-terminal Cys- according to the method described in AB Vojetk et al. Cell 74, 205-214 (1993).
The constitutively activated mutant RhoA ^Val4 cDNA fragment from which the AA-Leu structure was removed was transformed into pBTM11
6 (abVojetk et al., Supra) to express LexA and LexA as fusion proteins in yeast cells (pB, respectively).
TM116-RasWT, pBTM116-Rho
^Val4 ), and yeast (L)
(40 strains). In addition, cDNAs of the amino acid sequence of Nos. 1 to 707 (MBS-N) and 699 to 976 (MBS-C) of the amino acid sequence described in SEQ ID NO: 1
ACT vectors (Clontech, MATCHMAKER library kit) are introduced into the BamHI site to express GAL4 and GAL4 as fusion proteins in yeast cells (pACTI, respectively).
IHK-MBS-N, pACTIIHK-MBS-C). Using these vectors, pBT
M116-RasWT, pBTM116-Rho
^The yeast transformed with ^Val4 was transformed. Each transformant was selected for histidine requirement (ABVoj
etket al. Cell 74, 205-214 (1993)). As a result, FIG.
As shown in the above, MBS-C is a mutant RhoA ^{Val4
Binds to} MBS-N and mutant RhoA ^Val4
Was found to be weaker than this.

Example 7 Chicken Mio by p164
Phosphorylation of the syn-binding subunit and thus myosin
Inhibition of light chain phosphatase activity (1) Phosphorylation test of chicken myosin binding subunit by p164 p164 phosphorylated chicken myosin binding subunit even when it was used. Chicken myosin binding subunit (Shimizu, H. et al., J. Biol. Che
m., 269, 30407-30411 (1994)) and a fusion protein (MBS-C) of a C-terminal peptide fragment (amino acids 753 to 1004) and a maltose binding protein was prepared in Example 2 (3).
And the degree of phosphorylation by p164 was measured using this as a substrate according to the method described in Example 2 (3) (FIG. 11). As a result, p
The degree of phosphorylation of MBS-C by 164 was higher than that of control (GST in the presence of GST, lane 1).
In the presence of GST-RhoA, the activity was enhanced 5 times or more (lane 3). In contrast, GDP GST-RhoA (lane 2), GTPγS GST-RhoA ^Ala37 (lane 4), GDP GST-Rac1 (lane 5), GT
No increase in phosphorylation was observed in PγS.GST-Rac1 (lane 6). In addition, chicken myosin binding subunit (Shimizu, H. et al., J. Biol. Chem.,
269, 30407-30411 (1994)), when p164 was used as a substrate instead of MBS-C as a substrate (amino acids 1 to 721), p164 did not phosphorylate it (data not shown). .

(2) Inhibition of chicken myosin light chain phosphatase activity by p164 Purification of native myosin light chain phosphatase from chicken gizzard was performed according to Shimizu, H. et al., J. Biol. Chem., 26
9, 30407-30411 (1994). In the presence of various concentrations of p164 from natural bovine brain,
Phosphorylation of myosin light chain phosphatase was measured (Experiment 1). In addition, the enzymatic activity of phosphorylated myosin light chain phosphatase in the presence of various concentrations of p164 was measured (Experiment 2). As a result, it was revealed that the myosin-binding subunit in myosin light chain phosphatase was phosphorylated in a concentration-dependent manner of p164, and that the enzymatic activity of myosin light chain phosphatase was suppressed by phosphorylation by p164. Was. FIG. 12 shows the concentration of p164 on the horizontal axis, combining the results of the above two independent experiments (Experiment 1 and Experiment 2). The specific methods of Experiment 1 and Experiment 2 are as described below.

Phosphorylation of native myosin light chain phosphatase by p164 (Experiment 1) resulted in varying amounts of p16
4 in the presence or absence of 1 μM GTPγS.GST-RhoA in the presence or absence of 40 μl of a buffer (34 mM Tris / HCl, pH 7.0) containing purified myosin light chain phosphatase (1.0 μg protein).
5, 34 mM KCl, 4.0 mM MgCl ₂ , 1.
625 mM EDTA, 1.2 mM DTT, 1.3%
Sucrose, 0.38% CHAPS, 10 μM
[ ³⁵ S] ATPγS). After incubation for 3 minutes, the reaction mixture was subjected to SDS-PAGE electrophoresis, and the degree of phosphorylation of the myosin-binding subunit was determined by autoradiography (Fuji BAS-20).
00). In order to examine the effect of phosphorylation on myosin light chain phosphatase activity (Experiment 2), myosin light chain phosphatase (1.0 μg protein) purified by the same method as described above was obtained by the presence of 10 μM ATPγS not labeled with radioactivity. In the presence or absence of 1 μM GTPγS.GST-RhoA in the presence or absence, phosphorylation was performed by various concentrations of p164. The reaction was stopped by adding 5 μl of 46 mM EDTA. Then 30 μl containing 5 μl of radiolabeled myosin light chain.
mM Tris / HCl, pH 7.5, 30 mM KC
1, 0.5 mM DTT was added, and the reaction was started as a total of 50 μl reaction mixture (containing 5 μM 32P-myosin light chain). The reaction was performed at 30 ° C. for 6 minutes. After stopping the reaction, ³² P bound to the myosin light chain
Amount of Ishihara, H. et al., Biochem. Biophys. Res.
Commun. 159, 871-877 (1989). The results, as shown in FIG. 12, P164 concentration dependent manner ³⁵ S- thiophosphoric acid was incorporated in myosin light chain phosphatase. On the other hand, in the presence of ATPγS, p1
Inhibition of myosin light chain phosphatase activity was found in a 64 concentration-dependent manner, but this suppression was not observed in the absence of ATPγS. The above results revealed that phosphorylation by p164 suppresses the enzymatic activity of myosin light chain phosphatase.

Example 8 Rh in NIH / 3T3 cells
Myosin binding subunit and myosin light chain by o
Measurement of enhanced phosphorylation of Rho as described below in NIH / 3T3 cells.
Whether the phosphorylation of the myosin-binding subunit was enhanced by the treatment. Manufacturer (Stratagene
NIH / 3T3 cells according to the manufacturer's instructions
3′SS and pOPRSVI-HA-RhoA or pOPRSVI-HA-RhoA ^Val14 were stably transfected. These plasmids are IP
Hemagglutinin (HA) -RhoA or HA-RhoA ^Val14 can be expressed under TG control.
Culture in a 35mm dish and confluent (conflu
ent), the NIH / 3T3 cell line (parent strain, NIH /
3T3-RhoA-5, NIH / 3T3-RhoA-2
4, NIH / 3T3-RhoA ^Val14-7 and N
IH / 3T3-RhoA ^Val14-24 ) at 5 mM
Treated with IPTG for 24 hours. For the last 12 hours, the cells were cultured in a serum-free medium, and then 9.25 MB
Labeled with q [ ³² P] -orthophosphoric acid for 2 hours. Thereafter, the cells labeled with ³² P were lysed and the myosin-binding subunit was immunoprecipitated. The washed immunoprecipitate is transferred to SD
S-PAGE and autoradiography. RhoA or RhoA ^Val14 is ^converted to NI by the above method.
The overexpression in H / 3T3 cells was previously described (AJ Ridley & A. Hall, Cell 70, 389-399 (199
2) and AJ Ridley & A. Hall, EMBO J., 13, 2600
-2610 (1994)), high levels of stress fiber and focal contact formation were observed. The amount of myosin-binding subunit was almost the same in all NIH / 3T3 cell lines including the parent strain (data not shown), but myosin-binding subunit in NIH / 3T3 cells overexpressing RhoA or RhoA ^Val14. Was significantly higher than the degree of phosphorylation of the myosin binding subunit in the parent strain NIH / 3T3 cells (FIG. 13). Next, the parent strain and RhoA
Or NIH / RhoA ^Val14 overexpressed
The degree of phosphorylation of myosin light chain in 3T3 cells was measured according to the method described below. NIH / IPTG treatment and serum removal operation performed in 100 mm dish
10% TCA was added to the 3T3 cell line. To determine the degree of phosphorylation of the myosin light chain, the trichloroacetic acid (TCA) precipitate was subjected to glycerol-urea gel electrophoresis and phosphorylated (monophosphorylated (ML).
CP) and diphosphorylated (MLCP ₂ )) relative amounts of myosin light chain and non-phosphorylated myosin light chain were determined by immunoblotting (DA Taylor & JT Stu
II, J. Biol. Chem. 263, 14456 (1988)). At this time, when the cells were treated with 0.1 μM phosphatase inhibitor (calyculin-A (CLA)) for 10 minutes, the degree of phosphorylation of the myosin light chain was increased (FIG. 1).
4). The degree of phosphorylation of myosin light chain in NIH / 3T3 cells overexpressing RhoA or RhoA ^Val14 was clearly higher than the degree of phosphorylation of myosin light chain in parental NIH / 3T3 cells ( (FIG. 14).
Essentially identical results were obtained with three different strains of NIH / 3T3 cells overexpressing RhoA or RhoA ^Val14 . Without being bound by the following theory, the above results indicate that expression-induced RhoA or
RhoA ^Va114 activates the p164 protein endogenously present in NIH / 3T3 cells, resulting in enhanced phosphorylation of the myosin binding subunit and inhibition of myosin light chain phosphatase activity. It is interpreted that chain dephosphorylation was suppressed.

Example 9 Details of Myosin Binding Subunit
Effect of activated Rho on intracellular distribution Myosin binding subunit (MBS) in COS-7 cells
The subcellular distribution of the myosin-binding subunit when was expressed was examined. Specifically, the experiment was performed according to the following method.

MB fused with Myc epitope tag
To express S (Myc-MBS), rat MB
S for pEF-BOS-Myc (Mizushima, S. & Nagat
a, S., Nucleic. Acids Res., 18, 5322 (1990)) to obtain pEF-BOS-Myc-MBS. HA-RhoA and HA-RhoA fused with a hematoagglutinin (HA) tag
^Val14 (Mukai, H. et al., Biochem. Biopys. Re.
s. Commun., 204, 348-356 (1994)) to express pEF-BOS-HA-RhoA and pEF-.
BOS-HA-RhoA ^Val14 was obtained. pEF-B
PEF-BO obtained by substituting Myc in OS-Myc with HA
Cloned in S-HA, plasmid pEF-BO
S-Myc-MBS and pEF-BOS-HA-Rh
oA or pEF-BOS-HA-RhoA ^Val14
Was transfected into COS-7 cells according to the method described in Ridley, A. et al., Cell 70, 401-410 (1992). After 40 hours, the cells were collected, and a cell lysis buffer (20 mM Tris-HCl (pH 7.5),
The suspension was suspended in 1 mM EDTA, 5 mM MgCl ₂ , 10 mM sodium pyrophosphate, 2.5 μg / ml leupeptin, 0.15 M NaCl) and homogenized with a Dounce homogenizer. Nuclei and cell debris were sedimented by centrifugation at 4000 xg for 5 minutes. The supernatant was centrifuged at 100,000 × g for 30 minutes to remove cytosolic fractions and membranes (partic
ulate) fractions were obtained. The cytosolic fraction and the membrane fraction were each treated with an antibody against Myc-epitope (9E10)
For immunoblot analysis.

The results were as shown in FIG. That is, about 40% of the myosin binding subunit (Myc-M
BS) was found in the cytosol fraction and the remaining 60% was in the membrane fraction. When cells were transfected with RhoA, the number of myosin-binding subunits present in the cytosolic fraction decreased and the number of myosin-binding subunits present in the membrane fraction increased. HA
-This effect was higher with RhoA ^Val14 than with RhoA. From the above, it is considered that RhoA promotes the distribution of myosin-binding subunit to the membrane, and that this action of RhoA is manifested by RhoA forming a complex with myosin-binding subunit.

Example 10 Human myosin-binding subunit
CD encoding cDNA Cloning (1) human myosin binding subunit encoding bets
Cloning of NA cD encoding human myosin binding subunit (MBS)
In order to clone NA, first, a partial fragment Z3 of MBS cDNA from chicken gizzard (ShimizuH et al.,
J. Biol. Chem. 269, 30407-30411 (1994))
Pulmonary artery λ Uni-ZAP XR cDN
Screening A library (Stratagene)
Partial cDNA of rat lung MBS (base sequence 236)
4 to 3364). Using this as a probe,
Human lung Uni-ZAP XR cDNA library (Stratagene
Was screened. As a result, M derived from human lung
A partial sequence of BS cDNA (base sequence 495 to 2112 described in SEQ ID NO: 4) was obtained. Using the human lung-derived partial cDNA as a probe, human brain λgt10 cDN
The A library (CLONTECH) (1.0 × 10 ⁶ plaques) was screened. The above screening was performed by J.
Sambrook et.al., Molecular Cloning: A Laboratory M
anual: Cold Spring Habor Laboratory, Cold Spring H
arbor, NY (1989). As a result, two clones covering the N- and C-terminals of about 1 kbp (each encoding the nucleotide sequence 1 to 653 and the nucleotide sequence 1941 to 3102 described in SEQ ID NO: 4) were obtained. The central portion of the human MBS cDNA (base sequence 623 to 2014 described in SEQ ID NO: 4) is a human Brain QUICK-CloneT
Using M cDNA (CLONTECH) as a template, primer (5'CT
G GAG GTA CAG CAC TTCACG TTG CAG CTG 3 'and 5'TTT
GGG ATT CAG ACT CTT CAT CCC TAA CAG 3 ') was used to perform amplification using TAKARA LA-PCR kit (Takara Shuzo). These three clones, which cover the open reading frame of the human MBS cDNA,
pBluscriptII SK (-) (MAAlting-Mees et. al., Nucleus
ic Acids Res., 17, 9494 (1989)) (Stratagene). For sequencing, use the Pharmacia double-stranded Nested Deletion Kit.
A letion mutant was prepared and sequenced using an ABI 377 DNA sequencer.

(2) Sequence Analysis The nucleotide sequence of the full-length human MBS cDNA and the amino acid sequence deduced therefrom were as described in SEQ ID NO: 4 and SEQ ID NO: 3, respectively. MB from human brain
The sequence of the S cDNA was determined to be the MBS from the determined human lung.
Completely matched the partial cDNA sequence. The deduced amino acid sequence of human MBS was composed of 1030 amino acid residues, and the deduced molecular weight was about 115 kDa. The amino acid sequence of human MBS was determined for rat (SEQ ID NO: 1) and chicken (Sh
imizu, H. et al., J. Biol. Chem. 269, 30407-30411
(1994)), there was an ankyrin repeat on the N-terminal side and a leucine zipper-like domain on the C-terminal side. The human MBS ankyrin repeats (amino acid sequences 39 to 295 described in SEQ ID NO: 3) are 99% of rat MBS ankyrin repeats (amino acid sequences 39 to 253 described in SEQ ID NO: 1), and chicken MBS ankyrin repeats (amino acid sequence). 39-295) (Shimizu,
H. et al., J. Biol. Chem. 269, 30407-30411 (199
4)) and 96% identity. And full length human M
The amino acid sequence of BS (amino acid sequence 1 to 1030 described in SEQ ID NO: 3) is 89% that of rat (amino acid sequence 1 to 976 described in SEQ ID NO: 1), and that of chicken (amino acid sequence 1 to 963) (Shimizu , H. et al., J. Bio
l. Chem. 269, 30407-30411 (1994)).

Example 11 Using the two-hybrid method
Of the binding between the human MBS and the activated Rho protein, using a cDNA fragment corresponding to the amino acid sequence of 754 to 1030 of human MBS as a template with the cDNA of SEQ ID NO: 4 as a template, 5'-CTAGCGGCCGCAATTTGGAA
AGTTTGCTTATTACTCTGATC-3 ',
And 5'-AAAGCGGCCGCTATATAAA
Amplified by PCR using CAAAAGACTCTCGAGAAC-3 'as a primer, plasmid pVP16
(Vojtek, ABet. Al. Cell, 74, 205-214 (1993))
This was inserted into the otI site to prepare a yeast expression vector (pVP16-hMBS) for the VP16-MBS fusion protein. Vojtek, ABet. Al. Cell, 74, 205-214 (199
According to 3), plasmid pBT116 (Vojtek, ABet.
al. Cell, 74, 205-214 (1993)), low-molecular-weight G proteins (wild-type H-Ras, active H-Ras ^Val12 ,
Wild-type Rho and activated Rho ^Val14 ) cD
By inserting NA, LexA-wild type H-Ra
s fusion protein, LexA-activated H-Ras
^Vectors for yeast expression of ^Val12 fusion protein, LexA-wild type Rho fusion protein, and LexA-active Rho ^Val14 fusion protein were prepared. LiCl
Method (Ito, H.et. al. J. Bacteriol., 153, 163-168 (198
3) According to), pVP16-hMBS and each pB
TM116-low molecular weight G protein was converted to yeast (S. cerevis
iae) L40 strain (Mat a trp1 leu2 his3 ade2 LYS2 ::
(LexAop) 4-HIS3 URA3: :( LexAop) 8-LacZ)
P16-MBS fusion protein and LexA-wild type H-
Ras fusion protein, LexA-activated H-Ras
^Val12 fusion protein, LexA-wild type Rho fusion protein, or LexA-activated Rho
^{The Val14} fusion protein was expressed. The cells were cultured on a selective medium (containing no leucine, tryptophan, or histidine), and histidine requirement was examined. As a result, only the strain co-expressing the active Rho ^Val14 and the VP16-MBS fusion protein survived on the selective medium (data not shown). From this, the C-terminal side of the human myosin binding subunit (the amino acid sequence 754 of SEQ ID NO: 3)
-1030) was found to specifically bind to activated Rho, similarly to the C-terminal side of the rat myosin binding subunit (Example 6). The Rho-binding region of the human myosin-binding subunit (amino acid sequence 754 to 1030 described in SEQ ID NO: 3) is a region corresponding to the rat myosin-binding subunit (amino acid sequence 699 to 976 described in SEQ ID NO: 1). Or the corresponding region of the chicken myosin binding subunit (see Shimizu, H. et al., Supra).
al. (1994)).
And 92% and 74% identity, respectively.

[0116]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 976 Sequence type: amino acid Number of chains: single-chain Topology: linear Sequence type: protein Origin: Biological name: rat Sequence Met Lys Met Ala Asp Ala Lys Gln Lys Arg Asn Glu Gln Leu Lys Arg 1 5 10 15 Trp Ile Gly Ser Glu Thr Asp Leu Glu Pro Pro Val Val Lys Arg Gln 20 25 30 Lys Thr Lys Val Lys Phe Asp Asp Gly Ala Val Phe Leu Ala Ala Cys 35 40 45 Ser Ser Gly Asp Thr Asp Glu Val Leu Lys Leu Leu His Arg Gly Ala 50 55 60 Asp Ile Asn Tyr Ala Asn Val Asp Gly Leu Thr Ala Leu His Gln Ala 65 70 75 80 Cys Ile Asp Asp Asn Val Asp Met Val Lys Phe Leu Val Glu Asn Gly 85 90 95 Ala Asn Ile Asn Gln Pro Asp AsnGlu Gly Trp Ile Pro Leu His Ala 100 105 110 Ala Ala Ser Cys Gly Tyr Leu Asp Ile Ala Glu Phe Leu Ile Gly Gln 115 120 125 Gly Ala His Val Gly Ala Val Asn Ser Glu Gly Asp Thr Pro Leu Asp 130 135 140 Ile Ala Glu Glu Glu Ala Met Glu Glu Leu Leu Gln Asn Glu Val Asn 145 150 155 160 Arg Gln Gly Val Asp Ile Glu Ala Ala Arg Lys Glu Glu Glu Arg Ile 165 170 175 Met Leu Arg Asp Ala Arg Gln Trp Leu Asn Ser Gly His Ile Ser Asp 180 185 190 Val Arg His Ala Lys Ser Gly Gly Thr Ala Leu His Val Ala Ala Ala 195 200 205 Lys Gly Tyr Thr Glu Val Leu Lys Leu Leu Ile Gln Ala Gly Tyr Asp 210 215 220 Val Asn Ile Lys Asp Tyr Asp Gly Trp Thr Pro Leu His Ala Ala Ala 225 230 235 240 His Trp Gly Lys Glu Glu Ala Cys Arg Ile Leu Val Asp Asn Leu Cys 245 250 255 Asp Met Glu Thr Val Asn Lys Val Gly Gln Thr Ala Phe Asp Val Ala 260 265 270 Asp Glu Asp Ile Leu Gly Tyr Leu Glu Glu Leu Gln Lys Lys Gln Asn 275 280 285 Leu Leu His Ser Glu Lys Arg Asp Lys Lys Ser Pro Leu Ile Glu Ser 290 295 300 Thr Ala Asn Met Glu Asn Asn Gln Pro Gln Lys Thr Phe Lys Asn Lys 305 310 315 320 Glu Thr Leu Ile Ile Glu Pro Glu Lys Asn Ala Ser Arg Ile Glu Ser 325 330 335 Leu Glu Gln Glu Lys Ala Asp Glu Glu Glu Glu Gly Lys Lys Asp Glu 340 345 350 Ser Ser Cys Ser Ser Glu Glu Asp Glu Glu Asp Asp Ser Glu Ser Glu 355 360 365 Ala Glu Thr Asp Lys Thr Lys Pro Met Ala Ser Val Thr AsnAla His 370 375 380 Thr Ala Ser Thr Gln Ala Ala Pro Ala Ala Val Thr Thr Pro Thr Leu 385 390 395 400 Ser Ser Asn Gln Gly Thr Pro Thr Ser Pro Val Lys Lys Phe Pro Thr 405 410 415 Ser Thr Thr Lys Ile Ser Pro Lys Glu Glu Glu Arg Lys Asp Glu Ser 420 425 430 Pro Ala Ser Trp Arg Leu Gly Leu Arg Lys Thr Gly Ser Tyr Gly Ala 435 440 445 445 Leu Ala Glu Ile Thr Ala Ser Lys Glu Ala Gln Lys Glu Lys Asp Thr 450 455 460 Ala Gly Val Ile Arg Ser Ala Ser Ser Pro Arg Leu Ser Ser Ser Leu 465 470 475 480 Asp Asn Lys Glu Lys Glu Lys Asp Asn Lys Gly Thr Arg Leu Ala Tyr 485 490 495 Val Ala Pro Thr Ile Pro Arg Arg Leu Gly Ser Thr Ser Asp Ile Glu 500 505 510 Glu Lys Glu Asn Arg Glu Ser Ser Asn Leu Arg Thr Ser Ser Ser Tyr 515 520 525 Thr Arg Arg Lys Trp Glu Asp Asp Leu Lys Lys Asn Ser Ser Ile Asn 530 535 540 Glu Gly Ser Thr Tyr His Arg Ser Thr Ser Asn Arg Leu Trp Ala Glu 545 550 555 560 Asp Ser Thr Glu Lys Glu Lys Asp Ser Ala Pro Thr Ala Ala Thr Ile 565 570 575 Leu Val Ala Pro Thr Val Val Ser Ala Ala Ala Ser Ser Thr Thr Ala 580 585 585 590 Leu Thr Thr Thr Thr Ala Gly Thr Leu Ser Ser Thr Ser Glu Val Arg 595 600 605 Glu Arg Arg Arg Ser Tyr Leu Thr Pro Val Arg Asp Glu Glu Ser Glu 610 615 620 620 Ser Gln Arg Lys Ala Arg Ser Arg Gln Ala Arg Gln Ser Arg Arg Ser 625 630 635 640 Thr Gln Gly Val Thr Leu Thr Asp Leu Gln Glu Ala Glu Lys Thr Ile 645 650 655 Gly Arg Ser Arg Ser Thr Arg Thr Arg Glu Gln Glu Asn Glu Glu Lys 660 665 670 Asp Lys Glu Glu Lys Glu Lys Gln Asp Lys Glu Lys Gln Glu Glu Lys 675 680 685 Lys Glu Ser Glu Val Ser Arg Glu Asp Glu Tyr Lys Gln Lys Tyr Ser 690 695 700 Arg Thr Tyr Asp Glu Thr Tyr Ala Arg Tyr Arg Pro Val Ser Thr Ser 705 710 715 720 Ser Ser Ser Thr Pro Ser Ser Ser Ser Leu Ser Thr Leu Gly Ser Ser 725 730 735 Leu Tyr Ala Ser Ser Gln Leu Asn Arg Pro Asn Ser Leu Val Gly Ile 740 745 750 Thr Ser Ala Tyr Ser Arg Gly Leu Thr Lys Asp Asn Glu Arg Glu Gly 755 760 765 Glu Lys Lys Glu Glu Glu Lys Glu Gly Glu Asp Lys Ser Gln Pro Lys 770 775 780 Ser Ile Arg Glu Arg Arg Arg Pro Arg Glu Lys Arg Arg Ser Thr Gly 785 790 795 800 Val Ser Phe Trp Thr Gln Asp Ser Asp Glu Asn Glu Gln Glu Arg Gln Ser Asp Thr Glu Asp Gly Ser Ser Lys Arg Asp Thr Gln Thr Asp Ser 820 825 830 Val Ser Arg Tyr Asp Ser Ser Ser Ser Thr Ser Ser Ser Asp Arg Tyr Asp 835 840 845 Ser Leu Leu Gly Arg Ser Ala Ser Tyr Ser Tyr Leu Glu Glu Arg Lys 850 855 860 Pro Tyr Gly Ser Arg Leu Glu Lys Asp Asp Ser Thr Asp Phe Lys Lys 865 870 875 880 Leu Tyr Glu Gln Ile Leu Ala Glu Asn Glu Lys Leu Lys Ala Gln Leu 885 890 895 His Asp Thr Asn Met Glu Leu Thr Asp Leu Lys Leu Gln Leu Glu Lys 900 905 910 Ala Thr Gln Arg Gln Glu Arg Phe Ala Asp Arg Ser Leu Leu Glu Met 915 920 925 Glu Lys Arg Glu Arg Arg Ala Leu Glu Arg Arg Ile Ser Glu Met Glu 930 935 940 Glu Glu Leu Lys Met Leu Pro Asp Leu Lys Ala Asp Asn Gln Arg Leu 945 950 955 960 Lys Asp Glu Asn Gly Ala Leu Ile Arg Val Ile Ser Lys Leu Ser Lys 965 970 975

SEQ ID NO: 2 Sequence length: 3300 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: cDNA Origin: Organism name: rat Sequence CGGTCGCACA CCCCCCGGTG TCCCCTCGCC TCCCTCGCCG CCGCCCCCTT CCCCCGCTCG 60 CGATAAGAAG AGCCGGCGGC AGGAGAGGGG ATG AAG ATG GCG GAC GCG AAG CAG 114 Met Lys Met Ala Asp Ala Lys Gln 15 AAG CGG AAC GAG CAG CTG AAG CGC TGG ATC GGC TCC GAG ACG GAC CTC 162 Lys Arg Asn Glu Gln Leu Lys Arg Trp Glu Thr Asp Leu 10 15 20 GAG CCT CCC GTG GTG AAG CGC CAG AAG ACC AAG GTG AAG TTC GAC GAT 210 Glu Pro Pro Val Val Lys Arg Gln Lys Thr Lys Val Lys Phe Asp Asp 25 30 35 40 GGC GCC GTC TTC CTC GCC GCC TGC TCC AGC GGC GAC ACG GAC GAG GTC 258 Gly Ala Val Phe Leu Ala Ala Cys Ser Ser Gly Asp Thr Asp Glu Val 45 50 55 CTC AAG CTG CTG CAC CGC GGC GCC GAC ATC AAT TAC GCC AAT GTG GAC 306 Leu Lys Leu Leu His Arg Gly Ala Asp Ile Asn Tyr Ala Asn Val Asp 60 65 70 GGA CTC ACC GCC CTG CAC CAG GCT TGC ATT GAT GAC AA T GTT GAT ATG 354 Gly Leu Thr Ala Leu His Gln Ala Cys Ile Asp Asp Asn Val Asp Met 75 80 85 GTG AAG TTT CTG GTA GAA AAT GGA GCA AAT ATC AAT CAA CCT GAC AAT 402 Val Lys Phe Leu Val Glu Asn Gly Ala Asn Ile Asn Gln Pro Asp Asn 90 95 100 GAA GGC TGG ATT CCA CTC CAT GCA GCC GCT TCC TGT GGA TAT CTG GAT 450 Glu Gly Trp Ile Pro Leu His Ala Ala Ala Ser Cys Gly Tyr Leu Asp 105 110 115 120 ATT GCA GAA TTT TTG ATT GGT CAA GGA GCA CAT GTA GGA GCT GTC AAC 498 Ile Ala Glu Phe Leu Ile Gly Gln Gly Ala His Val Gly Ala Val Asn 125 130 135 AGT GAA GGT GAC ACA CCT TTA GAT ATT GCA GAG GAG GAA GCA ATG GAA 546 Ser Glu Gly Asp Thr Pro Leu Asp Ile Ala Glu Glu Glu Ala Met Glu 140 145 150 GAG CTA CTT CAA AAT GAG GTT AAT CGG CAA GGT GTT GAT ATA GAA GCA 594 Glu Leu Leu Gln Asn Glu Val Asn Arg Gln Gly Val Asp Ile Glu Ala 155 160 165 GCT CGA AAA GAA GAG GAA CGC ATA ATG CTT AGA GAC GCG AGG CAG TGG 642 Ala Arg Lys Glu Glu Glu Arg Ile Met Leu Arg Asp Ala Arg Gln Trp 170 175 180 TTG AAC AGT GGT CAC ATC AGT GAC GTC CGG CAT GCA AAG TCC GGA GGC 690 Leu Asn Ser Gly His Ile Ser Asp Val Arg His Ala Lys Ser Gly Gly 185 190 195 200 ACA GCA CTC CAC GTG GCA GCG GCC AAA GGG TAT ACA GAA GTT TTA AAA 738 Thr Ala Leu His Val Ala Ala Ala Lys Gly Tyr Thr Glu Val Leu Lys 205 210 215 CTT TTA ATA CAG GCA GGC TAT GAT GTT AAT ATT AAA GAT TAT GAT GGC 786 Leu Leu Ile Gln Ala Gly Tyr Asp Val Asn Ile Lys Asp Tyr Asp Gly 220 225 230 TGG ACA CCT CTT CAT GCT GCA GCT CAC TGG GGT AAA GAA GAA GCA TGT 834 Trp Thr Pro Leu His Ala Ala Ala His Trp Gly Lys Glu Glu Ala Cys 235 240 245 CGG ATT TTA GTG GAC AAT CTG TGT GAT ATG GAG ACG GTC AAC AAA GTG 882 Arg Ile Leu Val Asp Asn Leu Cys Asp Met Glu Thr Val Asn Lys Val 250 255 260 GGC CAA ACA GCC TTT GAT GTA GCA GAT GAA GAC ATT TTG GGA TAT CTA 930 Gly Gln Thr Ala Phe Asp Val Ala Asp Glu Asp Ile Leu Gly Tyr Leu 265 270 275 280 GAG GAG TTG CAA AAA AAA CAA AAT CTG CTC CAT AGT GAA AAG CGG GAT 978 Glu Glu Leu Gln Lys Lys Gln Asn Leu Leu His Ser Glu Lys Arg Asp 285 290 295 AAG AAA TCT CCA CTG ATT GAA TCA ACA GCA AAT ATG GAA AAT AAT CAA 1026 Lys Lys Ser Pro Leu Ile Glu Ser Thr Ala Asn Met Glu Asn Asn Gln 300 305 310 CCA CAG AAG ACT TTT AAA AAC AAG GAA ACG TTG ATT ATT GAG CCA GAG 1074 Pro Gln Lys Thr Phe Lys Asn Lys Glu Thr Leu Ile Ile Glu Pro Glu 315 320 325 AAA AAT GCA TCT CGA ATC GAG TCT CTG GAG CAA GAA AAG GCT GAT GAG 1122 Lys Asn Ala Ser Arg Ile Glu Ser Leu Glu Gln Glu Lys Ala Asp Glu 330 335 340 GAG GAG GAA GGC AAG AAG GAT GAG TCC AGC TGC TCC AGT GAG GAG GAT 1170 Glu Glu Glu Gly Lys Lys Asp Glu Ser Ser Cys Ser Ser Glu Glu Asp 345 350 355 360 GAG GAG GAT GAC TCC GAG TCC GAA GCG GAG ACA GAT AAG ACA AAA CCC 1218 Glu Glu Asp Asp Ser Glu Ser Glu Ala Glu Thr Asp Lys Thr Lys Pro 365 370 375 ATG GCT TCT GTA ACT AAT GCT CAC ACT GCC AGC ACT CAG GCA GCT CCT 1266 Met Ala Ser Val Thr Asn Ala His Thr Ala Ser Thr Gln Ala Ala Pro 380 385 390 GCC GCT GTG ACA ACA CCT ACT CTG TCT TCC AAC CAG GGG ACC CCT ACA 1314 Ala Ala Val Thr Thr Pro Thr Leu Ser Ser Asn Gln Gly Thr Pro Thr 395 400 405 TCA CCT GTT AAA AAG TTT CCT ACA TCA ACT ACA AAA ATT TCT CCC AAA 1362 Ser Pro Val Lys Lys Phe Pro Thr Ser Thr Thr Lys Ile Ser Pro Lys 410 415 420 GAA GAA GAA AGA AAA GAT GAA TCT CCT GCA TCC TGG AGG TTA GGA CTT 1410 Glu Glu Glu Arg Lys Asp Glu Ser Pro Ala Ser Trp Arg Leu Gly Leu 425 430 435 440 AGA AAG ACT GGC AGT TAT GGT GCC CTG GCT GAG ATC ACT GCA TCT AAA 1458 Arg Lys Thr Gly Ser Tyr Gly Ala Leu Ala Glu Ile Thr Ala Ser Lys 445 450 455 GAA GCT CAG AAG GAG AAA GAC ACT GCA GGC GTG ATA CGT TCA GCT TCG 1506 Glu Ala Gln Lys Glu Lys Asp Thr Ala Gly Val Ile Arg Ser Ala Ser 460 465 470 470 AGT CCC AGA CTC TCG TCC TCT TTG GAT AAT AAA GAA AAG GAG AAA GAC 1554 Ser Pro Arg Leu Ser Ser Ser Leu Asp Asn Lys Glu Lys Glu Lys Asp 475 480 485 AAT AAA GGA ACA AGA CTT GCA TAT GTC GCC CCT ACA ATC CCA AGG CGA 1602 Asn Lys Gly Thr Arg Leu Ala Tyr Val Ala Pro Thr Ile Pro Arg Arg 490 495 500 CTA GGC AGT ACG TCT GAC ATT GAA GAG AAG GAA AAC AGA GAG TCT TCA 1650 Leu Gly Ser Thr Ser Asp Ile Glu Glu Lys Glu Asn Arg Glu Ser Ser 5 05 510 515 520 AAT TTG CGA ACA AGT AGT TCT TAC ACA AGA AGA AAA TGG GAA GAT GAT 1698 Asn Leu Arg Thr Ser Ser Ser Tyr Thr Arg Arg Lys Trp Glu Asp Asp 525 530 535 CTT AAA AAA AAT AGT TCA ATC AAT GAA GGA TCT ACT TAC CAT AGA AGT 1746 Leu Lys Lys Asn Ser Ser Ile Asn Glu Gly Ser Thr Tyr His Arg Ser 540 545 550 ACC TCA AAT CGT TTG TGG GCT GAG GAT AGT ACT GAG AAA GAG AAG GAC 1794 Thr Ser Asn Arg Leu Trp Ala Glu Asp Ser Thr Glu Lys Glu Lys Asp 555 560 565 AGT GCT CCT ACC GCA GCG ACC ATT CTT GTT GCT CCA ACT GTT GTA AGT 1842 Ser Ala Pro Thr Ala Ala Thr Ile Leu Val Ala Pro Thr Val Val Ser 570 575 575 580 GCT GCA GCT TCT TCT ACC ACA GCC CTG ACC ACA ACT ACT GCT GGC ACT 1890 Ala Ala Ala Ser Ser Thr Thr Ala Leu Thr Thr Thr Thr Ala Gly Thr 585 590 595 600 600 CTT TCC TCC ACA TCA GAG GTC AGG GAG AGA CGC AGG TCA TAC CTC ACT 1938 Leu Ser Ser Thr Ser Glu Val Arg Glu Arg Arg Arg Ser Tyr Leu Thr 605 610 615 CCT GTT AGG GAT GAA GAG TCT GAA TCC CAA AGG AAA GCA AGA TCT AGA 1986 Pro Val Arg Asp Glu Glu Ser Glu Ser Gln Ar g Lys Ala Arg Ser Arg 620 625 630 CAA GCA AGA CAG TCT AGA CGG TCA ACA CAG GGG GTG ACA CTG ACT GAC 2034 Gln Ala Arg Gln Ser Arg Arg Ser Thr Gln Gly Val Thr Leu Thr Asp 635 640 645 CTC CAG GAA GCC GAA AAG ACA ATA GGA AGA AGC CGT TCT ACG AGA ACC 2086 Leu Gln Glu Ala Glu Lys Thr Ile Gly Arg Ser Arg Ser Thr Arg Thr 650 655 660 AGA GAA CAA GAA AAC GAA GAA AAA GAC AAA GAA GAA AAG GAA AAG CAG 2130 Arg Glu Gln Glu Asn Glu Glu Lys Asp Lys Glu Glu Lys Glu Lys Gln 665 670 675 680 GAT AAA GAG AAA CAA GAA GAA AAG AAG GAG TCA GAA GTA TCT AGA GAA 2178 Asp Lys Glu Lys Gln Glu Glu Lys Lys Glu Ser Glu Val Ser Arg Glu 685 690 695 GAT GAA TAT AAG CAA AAG TAT TCC AGA ACA TAC GAT GAG ACT TAT GCA 2226 Asp Glu Tyr Lys Gln Lys Tyr Ser Arg Thr Tyr Asp Glu Thr Tyr Ala 700 705 710 CGT TAC AGA CCA GTG TCA ACT TCA AGT TCA AGC ACT CCG TCG TCC TCC 2274 Arg Tyr Arg Pro Val Ser Thr Ser Ser Ser Ser Thr Pro Ser Ser Ser 715 720 725 TCA CTT TCT ACT CTA GGC AGT TCA CTC TAT GCC TCA AGT CAG CTC AAC 2322 Ser Leu Ser Thr Leu Gl y Ser Ser Leu Tyr Ala Ser Ser Gln Leu Asn 730 735 740 AGG CCA AAC AGC CTT GTA GGT ATA ACC TCT GCC TAC TCC CGG GGA TTA 2370 Arg Pro Asn Ser Leu Val Gly Ile Thr Ser Ala Tyr Ser Arg Gly Leu 745 750 755 760 ACC AAA GAC AAT GAA AGA GAG GGA GAG AAA AAA GAA GAG GAA AAA GAA 2418 Thr Lys Asp Asn Glu Arg Glu Gly Glu Lys Lys Glu Glu Glu Lys Glu 765 770 775 775 GGG GAA GAT AAG TCA CAA CCT AAA TCA ATC AGA GAA CGA CGG CGA CCA 2466 Gly Glu Asp Lys Ser Gln Pro Lys Ser Ile Arg Glu Arg Arg Arg Pro 780 785 790 AGA GAA AAA CGG AGG TCT ACT GGA GTC TCC TTC TGG ACA CAA GAT AGT 2514 Arg Glu Lys Arg Arg Ser Thr Gly Val Ser Phe Trp Thr Gln Asp Ser 795 800 805 GAT GAA AAT GAG CAA GAG CGG CAG TCA GAC ACC GAG GAT GGC TCC AGC 2562 Asp Glu Asn Glu Gln Glu Arg Gln Ser Asp Thr Glu Asp Gly Ser Ser 810 815 820 AAG AGG GAC ACT CAG ACG GAT TCT GTT TCC AGG TAT GAC AGC AGT TCC 2610 Lys Arg Asp Thr Gln Thr Asp Ser Val Ser Arg Tyr Asp Ser Ser Ser 825 830 835 840 ACG TCA TCA AGC GAT CGG TAT GAC TCC TTG CTG GGT CGT TCT GCC TCA 2658 Thr Ser Ser Ser Asp Arg Tyr Asp Ser Leu Leu Gly Arg Ser Ala Ser 845 850 855 TAC AGT TAC TTA GAA GAA AGG AAA CCA TAT GGT AGC CGA CTA GAA AAG 2706 Tyr Ser Tyr Leu Glu Glu Arg Lys Pro Tyr Gly Ser Arg Leu Glu Lys 860 865 870 GAT GAC TCA ACT GAC TTC AAA AAG CTT TAT GAA CAA ATC TTA GCT GAA 2754 Asp Asp Ser Thr Asp Phe Lys Lys Leu Tyr Glu Gln Ile Leu Ala Glu 875 880 885 885 AAT GAA AAA CTA AAG GCA CAG CTACAT GAC ACA AAT ATG GAA CTA ACG 2802 Asn Glu Lys Leu Lys Ala Gln Leu His Asp Thr Asn Met Glu Leu Thr 890 895 900 GAT CTA AAG TTG CAG TTG GAA AAA GCT ACC CAG AGA CAA GAA CGA TTT 2850 Asp Leu Lys Leu Gln Leu Glu Lys Ala Thr Gln Arg Gln Glu Arg Phe 905 910 915 920 GCT GAC AGG TCA CTA TTG GAG ATG GAA AAA AGG GAA CGA AGA GCT CTA 2898 Ala Asp Arg Ser Leu Leu Glu Met Glu Lys Arg Glu Arg Arg Ala Leu 930 930 GAA AGA AGA ATA TCT GAG ATG GAA GAG GAG CTC AAA ATG TTA CCA GAC 2946 Glu Arg Arg Ile Ser Glu Met Glu Glu Glu Leu Lys Met Leu Pro Asp 940 945 950 TTA AAA GCA GAC AAC CAG AGG CTA AAG GAT GAA AAT G GG GCC TTG ATC 2994 Leu Lys Ala Asp Asn Gln Arg Leu Lys Asp Glu Asn Gly Ala Leu Ile 955 960 965 AGA GTT ATA AGC AAA CTT TCC AAG TAGGACAGAA AACACACAAG CGAAGCAGCG3048 Arg Val Ile Ser Lys Leu ACGGAC ACT ACT TG CTGGACGCCA GAAAGAACCC 3108 CTGGAGACTG TCATTTTCCG ATATCCTGCC AAACGCCCTC TTATCTAGGA GTTTTGTTTC 3168 GTTTAATCTT CTGCCCCACC CCCTTGGTTA TCAAGACCAT TGTTTCATGT TAAAGCCGCT 3228 GCTGAGAAGA TTTTTTTTCA ATGACTGAGA AAACTTGTTT ACAGCTCCAG CAAATAAAGA 3288 AAGTGTTCAA GG 3300

SEQ ID NO: 3 Sequence length: 1030 Sequence type: amino acid Number of chains: single chain Topology: linear Sequence type: protein Origin: Biological name: human Sequence Met Lys Met Ala Asp Ala Lys Gln Lys Arg Asn Glu Gln Leu Lys Arg 1 5 10 15 Trp Ile Gly Ser Glu Thr Asp Leu Glu Pro Val Val Lys Arg Gln 20 25 30 Lys Thr Lys Val Lys Phe Asp Asp Gly Ala Val Phe Leu Ala Ala Cys 35 40 45 Ser Ser Gly Asp Thr Asp Glu Val Leu Lys Leu Leu His Arg Gly Ala 50 55 60 Asp Ile Asn Tyr Ala Asn Val Asp Gly Leu Thr Ala Leu His Gln Ala 65 70 75 80 Cys Ile Asp Asp Asn Val Asp Met Val Lys Phe Leu Val Glu Asn Gly 85 90 95 Ala Asn Ile Asn Gln Pro Asp Asn Glu Gly Trp Ile Pro Leu His Ala 100 105 110 Ala Ala Ser Cys Gly Tyr Leu Asp Ile Ala Glu Phe Leu Ile Gly Gln 115 120 125 Gly Ala His Val Gly Ala Val Asn Ser Glu Gly Asp Thr Pro Leu Asp 130 135 140 Ile Ala Glu Glu Glu Ala Met Glu Glu Leu Leu Gln Asn Glu Val Asn 145 150 155 160 Arg Gln Gly Val Asp Ile Glu Ala Al a Arg Lys Glu Glu Glu Arg Ile 165 170 175 Met Leu Arg Asp Ala Arg Gln Trp Leu Asn Ser Gly His Ile Asn Asp 180 185 190 Val Arg His Ala Lys Ser Gly Gly Thr Ala Leu His Val Ala Ala Ala 195 200 205 Lys Gly Tyr Thr Glu Val Leu Lys Leu Leu Ile Gln Ala Gly Tyr Asp 210 215 220 Val Asn Ile Lys Asp Tyr Asp Gly Trp Thr Pro Leu His Ala Ala Ala 225 230 235 240 His Trp Gly Lys Glu Glu Ala Cys Arg Ile Leu Val Asp Asn Leu Cys 245 250 255 Asp Met Glu Met Val Asn Lys Val Gly Gln Thr Ala Phe Asp Val Ala 260 265 270 Asp Glu Asp Ile Leu Gly Tyr Leu Glu Glu Leu Gln Lys Lys Gln Asn 275 280 285 Leu Leu His Ser Glu Lys Arg Asp Lys Lys Ser Pro Leu Ile Glu Ser 290 295 300 Thr Ala Asn Met Asp Asn Asn Gln Ser Gln Lys Thr Phe Lys Asn Lys 305 310 315 320 Glu Thr Leu Ile Ile Glu Pro Glu Lys Asn Ala Ser Arg Ile Glu Ser 325 330 335 Leu Glu Gln Glu Lys Val Asp Glu Glu Glu Glu Gly Lys Lys Asp Glu 340 345 350 Ser Ser Cys Ser Ser Glu Glu Asp Glu Glu Asp Asp Ser Glu Ser Glu 355 360 365 Ala Glu Thr Asp Lys Thr Lys Pro Leu A la Ser Val Thr Asn Ala Asn 370 375 380 Thr Ser Ser Thr Gln Ala Ala Pro Val Ala Val Thr Thr Pro Thr Val 385 390 395 400 Ser Ser Gly Gln Ala Thr Pro Thr Ser Pro Ile Lys Lys Phe Pro Thr 405 410 415 Thr Ala Thr Lys Ile Ser Pro Lys Glu Glu Glu Arg Lys Asp Glu Ser 420 425 430 Pro Ala Thr Trp Arg Leu Gly Leu Arg Lys Thr Gly Ser Tyr Gly Ala 435 440 445 445 Leu Ala Glu Ile Thr Ala Ser Lys Glu Gly Gln Lys Glu Lys Asp Thr 450 455 460 Ala Gly Val Thr Arg Ser Ala Ser Ser Pro Arg Leu Ser Ser Ser Leu 465 470 475 480 Asp Asn Lys Glu Lys Glu Lys Asp Ser Lys Gly Thr Arg Leu Ala Tyr 485 490 490 495 Val Ala Pro Thr Ile Pro Arg Arg Leu Ala Ser Thr Ser Asp Ile Glu 500 505 510 Glu Lys Glu Asn Arg Asp Ser Ser Ser Leu Arg Thr Ser Ser Ser Tyr 515 520 525 Thr Arg Arg Lys Trp Glu Asp Asp Leu Lys Lys Asn Ser Ser Val Asn 530 535 540 Glu Gly Ser Thr Tyr His Lys Ser Cys Ser Phe Gly Arg Arg Gln Asp 545 550 555 560 Asp Leu Ile Ser Ser Ser Val Pro Ser Thr Thr Ser Thr Pro Thr Val 565 570 575 Thr Ser Ala Ala Gly Leu Gln Lys Ser L eu Leu Ser Ser Thr Ser Thr 580 585 590 Thr Thr Lys Ile Thr Thr Gly Ser Ser Ser Ala Gly Thr Gln Ser Ser 595 600 605 Thr Ser Asn Arg Leu Trp Ala Glu Asp Ser Thr Glu Lys Glu Lys Asp 610 615 620 Ser Val Pro Thr Ala Val Thr Ile Pro Val Ala Pro Thr Val Val Asn 625 630 635 640 Ala Ala Ala Ser Thr Thr Thr Leu Thr Thr Thr Thr Ala Gly Thr Val 645 650 655 Ser Ser Thr Thr Glu Val Arg Glu Arg Arg Arg Ser Tyr Leu Thr Pro 660 665 670 Val Arg Asp Glu Glu Ser Ser Glu Ser Gln Arg Lys Ala Arg Ser Arg Gln 675 680 685 Ala Arg Gln Ser Arg Arg Ser Thr Gln Gly Val Thr Leu Thr Asp Leu 690 695 700 Gln Glu Ala Glu Lys Thr Ile Gly Arg Ser Arg Ser Thr Arg Thr Arg 705 710 715 720 Glu Gln Glu Asn Glu Glu Lys Glu Lys Glu Glu Lys Glu Lys Gln Asp 725 730 735 Lys Glu Lys Gln Glu Glu Lys Lys Glu Ser Glu Thr Ser Arg Glu Asp 740 745 750 Glu Tyr Lys Gln Lys Tyr Ser Arg Thr Tyr Asp Glu Thr Tyr Gln Arg 755 760 765 Tyr Arg Pro Val Ser Thr Ser Ser Ser Thr Thr Pro Ser Ser Ser Leu 770 775 780 780 Ser Thr Met Ser Ser Ser Leu Tyr Ala SerSer Gln Leu Asn Arg Pro 785 790 795 800 Asn Ser Leu Val Gly Ile Thr Ser Ala Tyr Ser Arg Gly Ile Thr Lys 805 810 815 Glu Asn Glu Arg Glu Gly Glu Lys Arg Glu Glu Glu Lys Glu Gly Glu 820 825 830 Asp Lys Ser Gln Pro Lys Ser Ile Arg Glu Arg Arg Arg Pro Arg Glu 835 840 845 Lys Arg Arg Ser Thr Gly Val Ser Phe Trp Thr Gln Asp Ser Asp Glu 850 855 860 Asn Glu Gln Glu Gln Gln Ser Asp Thr Glu Glu Gly Ser Asn Lys Lys 865 870 875 880 Glu Thr Gln Thr Asp Ser Ile Ser Arg Tyr Glu Thr Ser Ser Thr Ser 885 890 895 Ala Gly Asp Arg Tyr Asp Ser Leu Leu Gly Arg Ser Gly Ser Tyr Ser 900 905 910 Tyr Leu Glu Glu Arg Lys Pro Tyr Ser Ser Arg Leu Glu Lys Asp Asp 915 920 925 925 Ser Thr Asp Phe Lys Lys Leu Tyr Glu Gln Ile Leu Ala Glu Asn Glu 930 935 940 Lys Leu Lys Ala Gln Leu His Asp Thr Asn Met Glu Leu Thr Asp Leu 945 950 955 960 Lys Leu Gln Leu Glu Lys Ala Thr Gln Arg Gln Glu Arg Phe Ala Asp 965 970 975 Arg Ser Leu Leu Glu Met Glu Lys Arg Glu Arg Arg Ala Leu Glu Arg 980 985 990 Arg Ile Ser Glu Met Glu Glu Glu Leu LysMet Leu Pro Asp Leu Lys 995 1000 1005 Ala Asp Asn Gln Arg Leu Lys Asp Glu Asn Gly Ala Leu Ile Arg Val 1010 1015 1020 Ile Ser Lys Leu Ser Lys 1025 1030

SEQ ID NO: 4 Sequence length: 3102 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Origin: Biological name: Human sequence ATG AAG ATG GCG GAC GCG AAG CAG AAG CGG AAC GAG CAG CTG AAA CGC 48 Met Lys Met Ala Asp Ala Lys Gln Lys Arg Asn Glu Gln Leu Lys Arg 1 5 10 15 TGG ATC GGC TCC GAG ACG GAC CTC GAG CCT CCG GTG GTG AAG CGC CAG 96 Trp Ile Gly Ser Glu Thr Asp Leu Glu Pro Pro Val Val Lys Arg Gln 20 25 30 AAG ACC AAG GTG AAG TTC GAC GAT GGC GCC GTC TTC CTG GCT GCT TGC 144 Lys Thr Lys Val Lys Phe Asp Asp Gly Ala Val Phe Leu Ala Ala Cys 35 40 45 TCC AGC GGC GAC ACG GAC GAG GTC CTC AAG CTG CTG CAC CGC GGC GCC 192 Ser Ser Gly Asp Thr Asp Glu Val Leu Lys Leu Leu His Arg Gly Ala 50 55 60 GAC ATC AAT TAC GCC AAT GTG GAC GGA CTC ACT GCC CTG CAC CAG GCT 240 Asp Ile Asn Tyr Ala Asn Val Asp Gly Leu Thr Ala Leu His Gln Ala 65 70 75 80 TGC ATT GAT GAC AAT GTT GAT ATG GTG AAG TTT CTG GTA GAA AAT GGA 288 Cys Ile Asp Asp A sn Val Asp Met Val Lys Phe Leu Val Glu Asn Gly 85 90 95 GCA AAT ATT AAT CAA CCT GAT AAT GAA GGC TGG ATA CCA CTA CAT GCA 336 Ala Asn Ile Asn Gln Pro Asp Asn Glu Gly Trp Ile Pro Leu His Ala 100 105 110 GCA GCT TCC TGT GGA TAT CTT GAT ATT GCA GAG TTT TTG ATT GGT CAA 384 Ala Ala Ser Cys Gly Tyr Leu Asp Ile Ala Glu Phe Leu Ile Gly Gln 115 120 125 GGA GCA CAT GTA GGG GCT GTC AAC AGT GAA GGA GAT ACA CCT TTA GAT 432 Gly Ala His Val Gly Ala Val Asn Ser Glu Gly Asp Thr Pro Leu Asp 130 135 140 ATT GCG GAG GAG GAG GCA ATG GAA GAG CTA CTT CAA AAT GAA GTT AAT 480 Ile Ala Glu Glu Glu Ala Met Glu Glu Leu Leu Gln Asn Glu Val Asn 145 150 155 160 CGG CAA GGG GTT GAT ATA GAA GCA GCT CGA AAG GAA GAA GAA CGG ATC 528 Arg Gln Gly Val Asp Ile Glu Ala Ala Arg Lys Glu Glu Glu Arg Ile 165 170 175 ATG CTT AGA GAT GCC AGG CAG TGG CTA AAT AGT GGT CAT ATA AAT GAT 576 Met Leu Arg Asp Ala Arg Gln Trp Leu Asn Ser Gly His Ile Asn Asp 180 185 190 GTC CGG CAT GCA AAA TCT GGA GGT ACA GCA CTT CAC GTT GCA GCT GCT 624 Val Arg His Ala Lys Ser Gly Gly Thr Ala Leu His Val Ala Ala Ala 195 200 205 AAA GGC TAT ACG GAA GTT TTA AAA CTT TTA ATA CAG GCA GGC TAT GAT 672 Lys Gly Tyr Thr Glu Val Leu Lys Leu Leu Ile Gln Ala Gly Tyr Asp 210 215 220 GTT AAT ATT AAA GAC TAT GAT GGC TGG ACA CCT CTT CAT GCT GCA GCT 720 Val Asn Ile Lys Asp Tyr Asp Gly Trp Thr Pro Leu His Ala Ala Ala Ala 225 230 235 240 CAT TGG GGT AAA GAA GAA GCA TGT CGA ATT TTA GTG GAC AAT CTG TGT 768 His Trp Gly Lys Glu Glu Ala Cys Arg Ile Leu Val Asp Asn Leu Cys 245 250 255 GAT ATG GAG ATG GTC AAC AAA GTG GGC CAA ACA GCC TTT GAT GTA GCA 816 Asp Met Glu Met Val Asn Lys Val Gly Gln Thr Ala Phe Asp Val Ala 260 265 270 270 GAT GAA GAC ATT TTA GGA TAT TTA GAA GAG TTG CAA AAG AAA CAA AAT 864 Asp Glu Asp Ile Leu Gly Tyr Leu Glu Glu Leu Gln Lys Lys Gln Asn 275 280 285 CTG CTC CAT AGT GAA AAA CGG GAC AAG AAA TCT CCA CTA ATT GAA TCA 912 Leu Leu His Ser Glu Lys Arg Asp Lys Lys Ser Pro Leu Ile Glu Ser 290 295 300 ACA GCA AAT ATG GAC AAT AAT CAG TCA CAG AAG ACC TTT AAA AAC AAA 960 Thr Ala Asn Met Asp Asn Asn Gln Ser Gln Lys Thr Phe Lys Asn Lys 305 310 315 320 GAG ACG TTG ATT ATT GAA CCA GAG AAA AAT GCA TCC CGT ATT GAA TCT 1008 Glu Thr Leu Ile Ile Glu Pro Glu Lys Asn Ala Ser Arg Ile Glu Ser 325 330 335 CTG GAA CAA GAA AAG GTT GAT GAA GAA GAA GAA GGA AAG AAG GAT GAG 1056 Leu Glu Gln Glu Lys Val Asp Glu Glu Glu Glu Gly Lys Lys Asp Glu 340 345 350 TCT AGC TGC TCT AGT GAA GAA GAT GAG GAA GAT GAC TCG GAA TCA GAA 1104 Ser Ser Cys Ser Ser Glu Glu Asp Glu Glu Asp Asp Ser Glu Ser Glu 355 360 365 GCT GAA ACA GAT AAG ACA AAA CCC CTG GCT TCT GTA ACT AAT GCC AAC 1152 Ala Glu Thr Asp Lys Thr Lys Pro Leu Ala Ser Val Thr Asn Ala Asn 370 375 380 ACT TCT AGT ACA CAA GCA GCT CCT GTA GCT GTT ACA ACA CCT ACT GTG 1200 Thr Ser Ser Thr Gln Ala Ala Pro Val Ala Val Thr Thr Pro Thr Val 385 390 395 400 TCA TCA GGT CAA GCA ACA CCT ACA TCA CCT ATT AAA AAG TTT CCA ACC 1248 Ser Ser Gly Gln Ala Thr Pro Thr Ser Pro Ile Lys Lys Phe Pro Thr 405 410 415 ACA GCT ACA AAA ATT TCT CCC AAA GAA GAA G AG AGA AAA GAT GAG TCT 1296 Thr Ala Thr Lys Ile Ser Pro Lys Glu Glu Glu Arg Lys Asp Glu Ser 420 425 430 CCT GCA ACT TGG AGG TTA GGA CTT AGA AAG ACG GGC AGC TAT GGT GCA 1344 Pro Ala Thr Trp Arg Leu Gly Leu Arg Lys Thr Gly Ser Tyr Gly Ala 435 440 445 CTT GCT GAA ATC ACA GCA TCT AAA GAG GGT CAG AAA GAA AAA GAT ACT 1392 Leu Ala Glu Ile Thr Ala Ser Lys Glu Gly Gln Lys Glu Lys Asp Thr 450 455 460 GCA GGT GTT ACA CGT TCA GCT TCA AGT CCC AGA CTT TCC TCC TCT TTG 1440 Ala Gly Val Thr Arg Ser Ala Ser Ser Pro Arg Leu Ser Ser Ser Leu 465 470 475 480 GAT AAT AAA GAA AAG GAG AAA GAT AGT AAA GGA ACT AGG CTT GCA TAT 1488 Asp Asn Lys Glu Lys Glu Lys Asp Ser Lys Gly Thr Arg Leu Ala Tyr 485 490 495 GTT GCA CCT ACA ATA CCA AGA CGA CTA GCC AGT ACA TCT GAC ATT GAA 1536 Val Ala Pro Thr Ile Pro Arg Arg Leu Ala Ser Thr Ser Asp Ile Glu 500 505 510 GAG AAA GAA AAC AGA GAT TCT TCA AGT TTG CGA ACA AGT AGT TCA TAT 1584 Glu Lys Glu Asn Arg Asp Ser Ser Ser Leu Arg Thr Ser Ser Ser Tyr 515 520 525 ACA AGG AGA AAA TGG GA A GAT GAT CTT AAA AAA AAT AGC TCA GTT AAT 1632 Thr Arg Arg Lys Trp Glu Asp Asp Leu Lys Lys Asn Ser Ser Val Asn 530 535 540 540 GAA GGA TCA ACG TAT CAT AAA AGT TGC TCC TTT GGT AGA AGA CAA GAT 1680 Glu Gly Ser Thr Tyr His Lys Ser Cys Ser Phe Gly Arg Arg Gln Asp 545 550 555 560 GAT TTG ATT AGT TCT AGT GTT CCA AGC ACC ACA TCA ACA CCA ACA GTT 1728 Asp Leu Ile Ser Ser Ser Val Pro Ser Thr Thr Ser Thr Pro Thr Val 565 570 575 ACC TCT GCA GCT GGG CTT CAG AAA AGC CTG CTT TCC AGC ACA AGC ACT 1776 Thr Ser Ala Ala Gly Leu Gln Lys Ser Leu Leu Ser Ser Thr Ser Thr 580 585 590 ACT ACA AAG ATT ACA ACG GGT TCT TCC TCA GCA GGC ACA CAA AGC AGT 1824 Thr Thr Lys Ile Thr Thr Gly Ser Ser Ser Ala Gly Thr Gln Ser Ser 595 600 605 ACC TCA AAT CGT TTG TGG GCT GAG GAT AGT ACT GAG AAA GAA AAG GAC 1872 Thr Ser Asn Arg Leu Trp Ala Glu Asp Ser Thr Glu Lys Glu Lys Asp 610 615 620 AGT GTT CCT ACG GCA GTG ACC ATT CCT GTT GCT CCA ACT GTT GTA AAT 1920 Ser Val Pro Thr Ala Val Thr Ile Pro Val Ala Pro Thr Val Val Asn 625 630 635 64 0 GCT GCA GCT TCT ACC ACA ACC CTG ACT ACA ACT ACT GCT GGC ACT GTC 1968 Ala Ala Ala Ser Thr Thr Thr Leu Thr Thr Thr Ala Gly Thr Val 645 650 655 TCC TCC ACA ACA GAG GTC AGG GAG AGA CGC AGA TCA TAC CTC ACT CCT 2016 Ser Ser Thr Thr Glu Val Arg Glu Arg Arg Arg Ser Tyr Leu Thr Pro 660 665 670 GTT AGG GAT GAA GAG TCT GAA TCC CAA AGA AAA GCA AGA TCT AGA CAA 2064 Val Arg Asp Glu Glu Ser Glu Ser Gln Arg Lys Ala Arg Ser Arg Gln 675 680 685 GCA AGA CAA TCT AGA AGA TCA ACA CAG GGA GTG ACA TTA ACT GAT CTT 2112 Ala Arg Gln Ser Arg Arg Ser Thr Gln Gly Val Thr Leu Thr Asp Leu 690 695 700 CAA GAA GCT GAG AAA ACA ATA GGA AGA AGT CGT TCT ACC CGA ACC AGA 2160 Gln Glu Ala Glu Lys Thr Ile Gly Arg Ser Arg Ser Thr Arg Thr Arg 705 710 715 720 GAA CAA GAA AAT GAA GAA AAA GAA AAA GAG GAA AAA GAG AAA CAA GAT 2208 Glu Gln Glu Asn Glu Glu Lys Glu Lys Glu Glu Lys Glu Lys Gln Asp 725 730 735 AAA GAG AAA CAA GAA GAA AAG AAG GAG TCA GAA ACA TCT AGA GAA GAT 2256 Lys Glu Lys Gln Glu Glu Lys Lys Glu Ser Glu Thr Ser Arg Glu Asp 740 745 750 GAA TAT AAA CAA AAG TAC TCC AGA ACG TAT GAT GAG ACT TAC CAG CGT 2304 Glu Tyr Lys Gln Lys Tyr Ser Arg Thr Tyr Asp Glu Thr Tyr Gln Arg 755 760 765 TAT AGG CCA GTA TCA ACT TCA AGT TCA ACC ACT CCA TCC TCT TCA CTT 2352 Tyr Arg Pro Val Ser Thr Ser Ser Ser Thr Thr Pro Ser Ser Ser Leu 770 775 780 TCT ACT ATG AGC AGT TCA CTG TAT GCT TCA AGT CAA CTA AAC AGG CCA 2400 Ser Thr Met Ser Ser Ser Leu Tyr Ala Ser Ser Gln Leu Asn Arg Pro 785 790 795 800 AAT AGT CTT GTA GGC ATA ACT TCT GCT TAC TCC AGA GGA ATA ACA AAA 2448 Asn Ser Leu Val Gly Ile Thr Ser Ala Tyr Ser Arg Gly Ile Thr Lys 805 810 815 815 GAA AAT GAA AGA GAG GGA GAA AAA AGA GAA GAG GAG AAA GAA GGA GAA 2496 Glu Asn Glu Arg Glu Gly Glu Lys Arg Glu Glu Glu Lys Glu Gly Glu Glu 820 825 830 GAT AAA TCA CAA CCT AAA TCA ATC AGA GAA CGA CGA CGA CCA AGA GAG 2544 Asp Lys Ser Gln Pro Lys Ser Ile Arg Glu Arg Arg Arg Pro Arg Glu 835 840 845 AAA AGA AGA TCT ACA GGA GTT TCA TTT TGG ACA CAA GAT AGT GAT GAA 2592 Lys Arg Arg Ser Thr Gly Val Ser Phe Trp Thr Gln Asp Ser Asp Glu 850 855 860 AAT GAA CAA GAA CAA CAA TCA GAC ACA GAA GAG GGA TCC AAT AAG AAA 2640 Asn Glu Gln Glu Gln Gln Ser Asp Thr Glu Glu Gly Ser Asn Lys Lys 865 870 875 880 880 GAA ACT CAG ACG GAT TCC ATT TCT AGA TAT GAA ACC AGT TCT ACA TCA 2688 Glu Thr Gln Thr Asp Ser Ile Ser Arg Tyr Glu Thr Ser Ser Thr Ser 885 890 895 GCT GGT GAT CGA TAT GAT TCC TTG CTG GGT CGC TCT GGA TCA TAC AGT 2736 Ala Gly Asp Arg Tyr Asp Ser Leu Leu Gly Arg Ser Gly Ser Tyr Ser 900 905 910 TAC TTA GAA GAA AGA AAA CCT TAC AGC AGC AGG CTA GAA AAG GAT GAC 2784 Tyr Leu Glu Glu Arg Lys Pro Tyr Ser Ser Arg Leu Glu Lys Asp Asp 915 920 925 TCA ACT GAC TTT AAA AAG CTT TAT GAA CAA ATT CTA GCT GAA AAT GAA 2832 Ser Thr Asp Phe Lys Lys Leu Tyr Glu Gln Ile Leu Ala Glu Asn Glu 930 935 940 AAG CTG AAG GCA CAG CTA CAT GATCA AAT ATG GAA CTA ACA GAT CTT 2880 Lys Leu Lys Ala Gln Leu His Asp Thr Asn Met Glu Leu Thr Asp Leu 945 950 955 960 AAA TTA CAG TTG GAA AAG GCC ACC CAG AGA CAA GAA AGA TTT GCT GAT 2928 Lys Leu Gln Leu Glu Lys Ala Thr Gln Arg Gln Glu Arg Phe Ala Asp 965 970 975 AGA TCA CTG TTG GAA ATG GAA AAA AGG GAA CGA AGA GCT CTA GAA AGA 2976 Arg Ser Leu Leu Glu Met Glu Lys Arg Glu Arg Arg Ala Leu Glu Arg 980 985 990 AGA ATA TCT GAA ATG GAA GAA GAG CTC AAA ATG TTA CCA GAC CTA AAA 3024 Arg Ile Ser Glu Met Glu Glu Glu Leu Lys Met Leu Pro Asp Leu Lys 995 1000 1005 GCA GAC AAC CAG AGG CTA AAG GAT GAA AAT GGG GCC TTG ATC AGA GTT 3072 Ala Asp Asn Gln Arg Leu Lys Asp Glu Asn Gly Ala Leu Ile Arg Val 1010 1015 1020 ATA AGC AAA CTT TCC AAA TAAAAAAAAA AA 3102 Ile Ser Lys Leu Ser Lys 1025 1030

[Brief description of the drawings]

FIG. 1 is a view showing the results of purification of a Rho protein-binding protein. Results are representative of three independent experiments. Lane 1: GST, Lane 2: GDP / GS
T-Rho, lane 3: GTPγS · GST-Rho,
Lane 4: GTPγS · GST-Rho ^Ala37 , Lane 5: GDP · GST-H-Ras, Lane 6: GT
PγS-GST-H-Ras.

FIG. 2 shows the results of purification of p164 by Mono Q column chromatography. CHAPS
The eluted fraction was applied to a Mono Q column, and p164 was
Elution was performed with a linear aCl gradient. The results are representative of three independent experiments.

FIG. 3 is a diagram showing the results of immunoblotting of a fraction eluted from affinity column chromatography with an anti-myosin-binding subunit antibody. Results are representative of three independent experiments. Lane 1: GST, Lane 2: GDP / GST-RhoA, Lane 3: GTP
γS · GST-RhoA, lane 4: GTPγS · GS
T-RhoA ^Ala37 , lane 5: GDP · GST-
Rac1, lane 6: GTPγS.GST-Rac1,
Lane 7: GDP · GST-H-Ras, Lane 8: G
TPγS · GST-H-Ras.

FIG. 4 is a diagram showing the results of immunoblotting of a fraction eluted from affinity column chromatography with an anti-catalytic subunit antibody. Results are representative of three independent experiments. Lane 1: GST, Lane 2:
GDP · GST-RhoA, lane 3: GTPγS · G
ST-RhoA, lane 4: GTPγS · GST-Rh
oA ^Ala37 , lane 5: GDP · GST-Rac
1, lane 6: GTPγS · GST-Rac1, lane 7: GDP · GST-H-Ras, lane 8: GTPγ
S · GST-H-Ras.

FIG. 5 is a diagram showing bovine myosin light chain phosphatase activity by fractions eluted from affinity column chromatography. Results are representative of three independent experiments.

FIG. 6. Rat myosin binding subunit produced by in vitro translation and activated Rho.
FIG. 3 is a view showing the result of measuring the binding to a protein.
Lane 1: GST, Lane 2: GDP-GST-Rho
A, Lane 3: ^GTPγS.GST -RhoA, Lane 4: ^GTPγS.GST -RhoA ^Ala37 .

FIG. 7: Recombinant rat myosin binding subunit
It is a figure showing the influence of p122RhoGAP on the RhoGTPase activating ability. Results are representative of three independent experiments. The circles indicate the results in the presence of MBP, the squares indicate the results in the presence of MBP-N, and the triangles indicate the results in the presence of MBP-C. The black mark is p122RhoGA
In the presence of P, open symbols indicate results in the absence of p122RhoGAP.

FIG. 8 shows that GTPγS.GST-RhoA promotes phosphorylation of rat myosin binding subunit by p164. Lane 1: GST, Lane 2: GDP-GST-RhoA, Lane 3: GTPγ
S.GST-RhoA. Arrows indicate the position of myosin binding subunit on SDS-PAGE electrophoresis.

FIG. 9 shows the phosphorylation of S6 peptide by p164. Solid square: GTPγS-RhoA (post-translationally modified), open square: GDP ・ RhoA (post-translationally modified), solid circle: GTPγS-GST-RhoA (non-translationally modified), open circle: GDP ・ GST-RhoA (non-translated) Post-translationally modified).

FIG. 10. Yeast two hybrid system (two hyb)
rid system) and myocin binding subunit and Rho
FIG. 3 is a view showing binding to an A protein.

FIG. 11 shows that GTPγS.GST-RhoA promotes phosphorylation of chicken myosin binding subunit by p164. Lane 1: GST, Lane 2: GDP / GST-RhoA, Lane 3: GTP
γS · GST-RhoA, lane 4: GTPγS · GS
T-RhoA ^Ala37 , lane 5: GDP · GST-
Rac1, lane 6: GTPγS.GST-Rac1.
The numbers above the lanes indicate the degree of phosphorylation as a relative value when GST (lane 1) is 1.0.

FIG. 12 is a diagram showing p164 concentration-dependent thiophosphorylation of chicken myosin binding subunit and inhibition of myosin light chain phosphatase activity. Solid and open circles indicate incorporation of ³⁵ S-thiophosphate into myosin-binding subunit in the presence or absence of GTPγS.GST-RhoA, respectively. Solid squares and open squares indicate p16 phosphorylated in the presence or absence of ATPγS in the presence or absence of GTPγS.GST-RhoA, respectively.
4 shows the enzymatic activity of myosin light chain phosphatase when No. 4 was used. Diamonds indicate the enzymatic activity of myosin light chain phosphatase in the absence of ATPγS (ie, using unphosphorylated p164).

FIG. 13 shows the degree of phosphorylation of the myosin-binding subunit in each NIH / 3T3 cell line overexpressing RhoA or RhoA ^Val14 .

FIG. 14 shows the degree of phosphorylation of myosin light chain in each NIH / 3T3 cell line overexpressing RhoA or RhoA ^Val14 .

FIG. 15 shows changes in the intracellular distribution of myosin binding subunit (MBS) induced by RhoA. Myc-MBS and HA-R in COS7 cells
hoA or HA-RhoA ^Val14 were transfected. Thereafter, a cytosolic fraction and a membrane fraction were prepared from the cell extract, and the amount of MBS was measured by immunoblot. Results are representative of three independent experiments.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁶ Identification number Agency reference number FI Technical indication location C07K 14/78 C12P 21/02 C C12N 1/19 9452-4B C12Q 1/48 A 1/21 A61K 37/02 ABE 5/10 ABR C12P 21/02 ACB C12Q 1/48 C12N 5/00 B (72) Inventor Nobuaki Takahashi 1-1-5 Fukuura, Kanazawa-ku, Yokohama-shi, Kanagawa Prefecture Kirin Brewery Co., Ltd. In the laboratory

Claims (43)

[Claims] 1. A protein or a modified protein thereof having an active Rho protein binding ability and having a phosphorylation site in its structure. 2. A protein or a modified protein thereof having an active Rho protein binding ability or having a phosphorylation site in its structure. 3. The protein according to claim 1, wherein the Rho protein is a RhoA protein, a RhoB protein, a RhoC protein, or a RhoG protein, or a modified protein thereof. 4. A protein having an active Rho protein binding ability and having a protein kinase activity, wherein a phosphorylated site is specifically phosphorylated by a protein.
The protein according to claim 1 or 2, or a modified protein thereof. 5. A peptide or protein having a modified amino acid sequence of a myosin binding subunit or an equivalent sequence thereof, wherein the sequence has an activity of binding to an active Rho protein. 6. A peptide or protein having a modified amino acid sequence of a myosin binding subunit or an equivalent sequence thereof, wherein the site of phosphorylation is present in the structure of the sequence. 7. A peptide or protein having a modified amino acid sequence of a myosin-binding subunit or an equivalent sequence thereof, wherein the sequence has an activity of binding to an active Rho protein, and a phosphorylation site in the structure of the sequence. A peptide or protein in which is present. 8. The peptide or protein according to claim 5, wherein the Rho protein is a RhoA protein, a RhoB protein, a RhoC protein, or a RhoG protein. 9. A protein having an active Rho protein binding ability and a protein having protein kinase activity, wherein a phosphorylated site is specifically phosphorylated.
A peptide or protein according to claim 6 or 7. 10. The peptide or protein according to any one of claims 5 to 9, which does not have myosin light chain phosphatase catalytic subunit and / or myosin binding ability. 11. The peptide or protein according to claim 5, wherein the myosin binding subunit is derived from an animal. 12. The method according to claim 1, wherein the myosin binding subunit is derived from bovine, rat, chicken, or human.
2. The peptide or protein according to 1. 13. The amino acid sequence represented by SEQ ID NO: 1 comprises the sequence of positions 1 to 707 or the sequence of positions 699 to 976, or a modified amino acid sequence thereof, or an equivalent sequence thereof. 12. The peptide or protein according to any one of 12 above. 14. The amino acid sequence according to claim 5, which comprises the sequence of amino acids 1 to 707 or the sequence of amino acids 699 to 976 of the amino acid sequence shown in SEQ ID NO: 1 or a modified amino acid sequence thereof, or an equivalent sequence thereof. The peptide or protein according to any one of claims 12 to 12. 15. The amino acid sequence according to any one of claims 5 to 12, which comprises the entire amino acid sequence of SEQ ID NO: 3 or the sequence of positions 754 to 1030, or their modified amino acid sequences or their equivalent sequences. Item 14. The peptide or protein according to Item. 16. The amino acid sequence according to any one of claims 5 to 12, which comprises the entire amino acid sequence of SEQ ID NO: 3 or the sequence of positions 754 to 1030, or their modified amino acid sequences or their equivalent sequences. Item 14. The peptide or protein according to Item. 17. A peptide or protein comprising an amino acid sequence represented by SEQ ID NO: 1 consisting of the sequence of positions 1 to 707 or 699 to 976, or a modified amino acid sequence thereof, or an equivalent sequence thereof. 18. A peptide or a sequence comprising the sequence of positions 1 to 707 or the sequences of positions 699 to 976 of the amino acid sequence shown in SEQ ID NO: 1 or a modified amino acid sequence thereof, or an equivalent sequence thereof. protein. 19. A peptide or protein comprising the entire amino acid sequence of SEQ ID NO: 3 or the sequence of positions 754 to 1030, or a modified amino acid sequence thereof or an equivalent sequence thereof. 20. A peptide or protein comprising the entire amino acid sequence of SEQ ID NO: 3 or the sequence of positions 754 to 1030, or a modified amino acid sequence thereof or an equivalent sequence thereof. A base sequence encoding the peptide or protein according to any one of claims 5 to 20. 22. A vector comprising the nucleotide sequence according to claim 21. 23. The vector according to claim 22, which is selected from the group consisting of a plasmid vector, a virus vector, and a liposome vector. [24] a host cell transformed with the vector according to [22] or [23] (however, a human cell is limited to a cell isolated from a human); 25. Escherichia coli, yeast, insect cells, COS cells,
NIH / 3T3 cells, lymph cells, fibroblasts, CHO
The host cell according to claim 24, wherein the host cell is selected from the group consisting of cells, blood cells, and tumor cells. 26. The method according to claim 5, comprising culturing the host cell according to claim 24 or 25, and collecting the peptide or protein according to any one of claims 5 to 20 from the culture. 21. The method for producing a peptide or protein according to any one of claims to 20. 27. A therapeutic agent for a disease associated with a Rho protein, comprising a myosin-binding subunit or the peptide or protein according to any one of claims 1 to 20. 28. A gene therapy agent for treating a disease associated with a Rho protein, comprising a myosin-binding subunit or a nucleotide sequence encoding the peptide or protein according to any one of claims 1 to 20. (1) A substance to be screened is present in a screening system containing an active Rho protein and a myosin-binding subunit or the peptide or protein according to any one of claims 1 to 20, And (2) measuring the degree of inhibition of binding between the active Rho protein and the myosin-binding subunit or the peptide or protein according to any one of claims 1 to 20. A method for screening a substance that inhibits binding to a myosin binding subunit or a protein or peptide according to any one of claims 1 to 20. (30) The screening system further comprises an activated Rh
30. The screening system according to claim 29, wherein a GTPase activating protein of o-protein is present. 31. The screening method according to claim 29, wherein the screening system is a cell line or a cell-free system. 32. The screening method according to claim 28, wherein the screening system is a yeast two-hybrid system. 33. The method according to claim 29, wherein the myosin-binding subunit or the peptide or protein according to any one of claims 1 to 20 is expressed by in vitro translation. Screening method. 34. The screening method according to claim 29, which is a method for screening a substance that suppresses tumor formation or metastasis, cell aggregation, or smooth muscle contraction. 35. (1) A substance to be screened is a protein having an active Rho protein binding ability and having a protein kinase activity, a myosin light chain, a myosin binding subunit, a myosin light chain phosphatase or Item 21. A screening system comprising the peptide or protein according to any one of Items 1 to 20, and (2) myosin light chain, myosin binding subunit, myosin light chain phosphatase or any one of Items 1 to 20. Measuring the degree of inhibition of phosphorylation of the peptide or protein according to claim 2, comprising a myosin light chain, a myosin binding subunit, a light chain phosphatase or the peptide or protein according to any one of claims 1 to 20. , A substance that inhibits the phosphorylation of Grayed method. 36. (1) A substance to be screened is a protein having an active Rho protein binding ability and having a protein kinase activity, a myosin light chain phosphatase, a phosphate donor, and a phosphorylated phosphorylation. (2) a method for screening a substance that inhibits the inhibition of myosin light chain phosphatase activity, the method comprising: (2) measuring the degree of inhibition of myosin light chain phosphatase activity. (37) the phosphate donor is ATP or ATPγ;
37. The screening method according to claim 36, which is S. 38. The screening method according to claim 36, wherein the phosphorylated substance is a phosphorylated-myosin light chain. 39. The screening method according to any one of claims 35 to 38, wherein a Rho protein is further present in the screening system. 40. The screening method according to claim 39, wherein the Rho protein is post-translationally modified. 41. The screening method according to claim 33, wherein the screening system is a cell line or a cell-free system. (42) A substance to be screened is present in a cell screening system containing a Rho protein and a myosin light chain, and (2) the degree of inhibition of phosphorylation of a myosin light chain is determined. A method for screening for a substance that inhibits phosphorylation of myosin light chain, which comprises measuring. 43. The screening method according to any one of claims 33 to 42, which is a method for screening a substance that suppresses tumor formation or metastasis, cell aggregation, or smooth muscle contraction.