JPH1042874A - Dna polymerase composition for nucleic acid amplification - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a heat-stable DNA polymerase composition excellent in amplification efficiency of nucleic acid. SOLUTION: This composition comprises a modified heat-stable DNA polymerase (first DNA polymerase) having 0-5% 3'-5'-exonuclease activity in comparison with a DNA polymerase having 3'5' exonuclease activity before modification and a modified heat-stable DNA polymerase (second DNA polymerase) having 100-6% 3'5' exonuclease activity in comparison with the heat-stable DNA polymerase having 3'-5'-exonuclease activity and the heat-stable DNA polymerase having 3'5'-exonuclease activity before the modification. The first DNA polymerase and the second DNA polymerase have a DNA synthesis rate of at least 30 bases/second and heat stability capable of maintaining >=60% remaining activity at pH8.8 at 95 deg.C for 6 hours treatment. A long-term nucleic acid can be amplified by using the composition.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a DNA polymerase composition for nucleic acid amplification, a nucleic acid amplification reagent containing the composition, and a nucleic acid amplification method using the reagent.

[0002]

2. Description of the Related Art Conventionally, polymerase chain reaction (PC)
Many studies have been made on thermostable DNA polymerases used in techniques for amplifying nucleic acids such as R). The thermostable DNA polymerase used in the PCR reaction is mainly a DNA polymerase derived from Thermus thermophilus (Tth polymerase) or a DNA polymerase derived from Thermus aquaticus (Taq polymerase). Etc. have been used. Also,
DNA polymerases derived from hyperthermophilic archaea, such as thermostable DNA polymerases derived from Pyrococcus furiosus (Pfu polymerase, WO92 / 096
89, JP-A-5-328969), Thermus Litoralis (The
rmococcus litoralis)
(Tli polymerase, JP-A-6-7160) and the like are known.

[0003] The present inventors have proposed Pyrococcus sp. Having excellent thermostability and DNA synthesis rate. KOD1-derived thermostable DNA polymerase (KOD polymerase,
7-298879). In addition, we have found that Pyrococcus sp. Succeeded in creating a modified enzyme having a 3′-5 ′ exonuclease activity reduced to at least 5% or less as compared to the enzyme before modification, while maintaining the DNA synthesis rate and thermal stability of KOD1-derived polymerase. did. The enzyme has a DNA synthesis rate of at least 30 bases / second and a pH of 8.8 (25 ° C).
It is difficult to measure the pH at 95 ° C. ) Is a thermostable DNA polymerase capable of retaining a residual activity of 60% or more after treatment at 95 ° C. for 6 hours, and has a 3′-5 ′ exonuclease activity of at least 5 compared to the enzyme before modification. % Enzyme. It has also been found that the use of this enzyme increases the amplification efficiency as compared with the use of the enzyme before modification.

On the other hand, as one of the methods for amplifying long-chain nucleic acids, Taq polymerase lacking 3'-5 'exonuclease activity (KlenTaq-278) and Pfu polymerase or Tli polymerase having 3'-5' exonuclease activity Alternatively, there has been reported a method of performing PCR using a DNA polymerase composition obtained by mixing these mutant enzymes (Barns, WM (1994) Proc. Natl. Acad. Sci. U.
SA 91, 2216-2220). In addition, Tth polymerase which does not show 3'-5 'exonuclease activity and Pfu polymerase or Tli polymerase which shows 3'-5' exonuclease activity, Thermotoga maritima (Thermotog
a method of performing PCR using a polymerase composition mixed with a heat-resistant DNA polymerase derived from A. maritima) (Japanese Patent Application Laid-Open No. 8-38198).

[0005]

However, these compositions have improved amplification efficiency as compared with the case where one type of DNA polymerase is used, but have a higher thermal stability and DN.
A Since two types of DNA polymerases having different synthesis rates are used, it cannot be said that the amplification efficiency is sufficient, and a method having higher amplification efficiency has been desired.

[0006]

The inventors of the present invention have conducted intensive studies and have found that a DNA polymerase composition for nucleic acid amplification, comprising a first DNA polymerase and a smaller amount than the first DNA polymerase when measured in units of polymerase activity. And a 3′-5 ′ exonuclease activity as compared to a DNA polymerase having substantially the same thermostability and DNA synthesis rate, specifically, the first DNA polymerase, which is a naturally occurring enzyme. 0-5% modified thermostable DNA polymerase, and wherein said second DNA polymerase has a naturally occurring DNA polymerase having 3'-5 'exonuclease activity, or 3′-5 ′ exonuclease activity of 100
The use of a DNA polymerase composition, which is a DNA polymerase selected from the group consisting of modified DNA polymerases that are ~ 6%
The inventors have found that CR can be performed, and have reached the present invention.

That is, the present invention relates to a modified thermostable DNA having a 3'-5 'exonuclease activity of 0 to 5% compared to a thermostable DNA polymerase having a 3'-5' exonuclease activity before modification. It is 100 to 6% as compared to the DNA polymerase (first DNA polymerase) and the thermostable DNA polymerase having 3'-5 'exonuclease activity or the thermostable DNA polymerase having 3'-5' exonuclease activity before modification. A modified DNA polymerase having a 3'-5 'exonuclease activity (a second DNA polymerase) comprising a first DNA polymerase and a second DNA polymerase
DNA whose polymerase is at least 30 bases / second
95 at synthesis rate, pH 8.8 (measured at 25 ° C.)
It is a DNA polymerase composition for nucleic acid amplification characterized by having heat stability capable of maintaining a residual activity of 60% or more after treatment at 6 ° C. for 6 hours.

The present invention is also a nucleic acid amplification method comprising reacting a primer, dNTP and the above DNA polymerase composition with DNA as a template to extend the primer and synthesize a DNA primer extension. .

In addition, the present invention provides two primers wherein one primer is complementary to the DNA extension product of the other primer, dNTPs and the above DNA polymerase composition, divalent ions, monovalent ions and buffer. Nucleic acid amplification reagent.

[0010]

DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The first DNA polymerase of the present invention is 0 to 5%, preferably 1 to 5%, of the thermostable DNA polymerase having 3'-5 'exonuclease activity before modification.
% 3% -5% exonuclease activity.

[0012] Such a first DNA polymerase includes an amino acid sequence in which at least one of amino acids 141, 142, 143, 210 and 311 of the amino acid sequence of SEQ ID NO: 2 is substituted with another amino acid. There is an enzyme having Examples thereof include an enzyme in which the 141st aspartic acid in SEQ ID NO: 2 is substituted with alanine, an enzyme in which the 143rd glutamic acid in SEQ ID NO: 2 is substituted with alanine, 141st aspartic acid and 143rd glutamic acid in SEQ ID NO: 2 An enzyme in which is substituted with alanine, an enzyme in which the asparagine at position 210 in SEQ ID NO: 2 is replaced with aspartic acid, 311 in SEQ ID NO: 2
And an enzyme in which the tyrosine is substituted with phenylalanine. Further, an enzyme in which isoleucine at SEQ ID NO: 142 is substituted with arginine is also included.

The first DNA polymerase of the present invention includes a modified heat-resistant DNA having the following physicochemical properties:
There is a polymerase. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 0-5%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours.

The first DNA polymerase of the present invention includes a modified heat-resistant DNA having the following physicochemical properties:
There is a polymerase. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 0-5%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C. Molecular weight: 88 to 90 KDa Amino acid sequence: The first amino acid sequence of SEQ ID NO: 2
Amino acid sequence in which at least one of amino acids at positions 41, 142, 143, 210 and 311 is substituted with another amino acid

The first DNA polymerase of the present invention includes a modified heat-resistant DNA having the following physicochemical properties:
There is a polymerase. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 0-5%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88 to 90 KDa Amino acid sequence: 141st aspartic acid to alanine, 142nd isoleucine to arginine, 143rd glutamic acid to alanine,
Amino acid sequence obtained by substituting 141st aspartic acid and 143rd glutamic acid with alanine, 210th asparagine with aspartic acid, and 311th tyrosine with phenylalanine

The second DNA polymerase of the present invention has a 3 ′
Compared to a thermostable DNA polymerase having -5 'exonuclease activity or a thermostable DNA polymerase having 3'-5' exonuclease activity before modification,
3'-5 'which is 00 to 6%, preferably 90 to 30%
Modified thermostable DN having exonuclease activity
A polymerase. Examples of such a second DNA polymerase include an enzyme having an amino acid sequence represented by SEQ ID NO: 2 or an amino acid obtained by substituting amino acids at positions 140, 142 and 144 of the amino acid sequence represented by SEQ ID NO: 2 with another amino acid. Some enzymes have a sequence. Examples thereof include an amino acid sequence in which isoleucine at position 142 of SEQ ID NO: 2 is substituted with aspartic acid, glutamic acid, asparagine, glutamine or lysine, or an enzyme in which the threonine at position 144 is substituted with valine.

The second DNA polymerase of the present invention includes a modified heat-resistant DNA having the following physicochemical properties:
There is a polymerase. Action: It has DNA synthesis activity and has 3'-5 'exonuclease activity. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88 to 90 KDa Amino acid sequence: amino acid sequence described in SEQ ID NO: 2

The second DNA polymerase of the present invention includes a modified heat-resistant DNA having the following physicochemical properties:
There is a polymerase. Action: has DNA synthesis activity, compared to the enzyme before modification
3'- which is 100 to 6%, preferably 90 to 30%
It has 5 'exonuclease activity. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Amino acid sequence: an amino acid sequence present in the exo1 (EXO1) region of the amino acid sequence described in SEQ ID NO: 2, X ₁ D
Amino acid sequence in which at least one amino acid of X ₁ , X ₂ and X _{3 in} the X ₂ EX ₃ motif has been replaced with another amino acid DNA having 3′-5 ′ exonuclease activity
In the amino acid sequence of the polymerase, amino acid regions highly conserved for this exonuclease are known (EXO I, EXO II, EXO III, FIG. 4). Exo I
The (EXO1) region has an X ₁ DX ₂ EX ₃ motif, and it is known that these amino acids, D (aspartic acid) and E (glutamic acid), are essential for exonuclease activity.

The second DNA polymerase of the present invention includes a modified heat-resistant DNA having the following physicochemical properties:
There is a polymerase. Action: has DNA synthesis activity, compared to the enzyme before modification
3'- which is 100 to 6%, preferably 90 to 30%
It has 5 'exonuclease activity. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Amino acid sequence: Nos. 140, 142 and 1 of SEQ ID NO: 2
Amino acid sequence in which amino acid at position 44 has been substituted with another amino acid

The second DNA polymerase of the present invention includes a modified heat-resistant DNA having the following physicochemical properties:
There is a polymerase. Action: has DNA synthesis activity, compared to the enzyme before modification
3'- which is 100 to 6%, preferably 90 to 30%
It has 5 'exonuclease activity. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88 to 90 KDa Amino acid sequence: Amino acid sequence obtained by substituting isoleucine at position 142 of SEQ ID NO: 2 with aspartic acid, glutamic acid, asparagine, glutamine, or lysine, or threonine at position 144 Amino acid sequence substituted with valine

First DNA polymerase and second DNA
The polymerase has a DNA synthesis rate of at least 30 bases /
Seconds, preferably 100-120 bases / second, pH
It is a heat-resistant DNA polymerase that can maintain 60% or more of activity by treating at 8.8 (measured at 25 ° C) at 95 ° C for 6 hours. The first DNA polymerase and the second DNA polymerase of the present invention are preferably KOD polymerase or a mutant of the enzyme.

In the present invention, the activity of the second DNA polymerase is preferably smaller than the activity of the first DNA polymerase. For every 2.5 units of the first DNA polymerase, the amount of the second DNA polymerase is 0.02 to 0.1 units. Is preferred.

As a method for producing these modified enzymes, for example, a mutation is introduced into a gene encoding a natural KOD polymerase, and 3′-5 ′ as compared with the natural KOD polymerase by a protein engineering technique. There is a method for producing a novel enzyme having reduced exonuclease activity.

[0024] The gene encoding KOD polymerase for introducing a mutation is not particularly limited, but one embodiment of the present invention relates to Pyrococcous sp. KO
The gene described in SEQ ID No. 3 in the Sequence Listing derived from D was used.

In another embodiment of the present invention, a mutation is introduced into the gene encoding the amino acid sequence shown in SEQ ID NO: 1 so that the 3'-5 'exonuclease activity is reduced as compared with the native KOD polymerase. Produce new enzymes.

Any known method can be used to introduce a mutation into the natural KOD polymerase gene. For example, natural type KOD polymerase gene DNA
From the method of contacting the drug with a mutagenic agent and the method of ultraviolet irradiation, protein engineering techniques such as PCR and site-specific mutagenesis can be used. In addition, since the gene repair mechanism has been deleted, it is also possible to introduce mutations in vivo using Escherichia coli in which mutations frequently occur in genes. Chameleon site-dire used in the present invention
What is cted mutagenesis kit (Stratagene)
(1) The plasmid into which the gene of interest is inserted is denatured, and the plasmid is annealed with a mutant primer and a selection primer. (2) Next, D
After synthesizing NA, a ligation reaction is performed with Ligation. (3) The plasmid is cleaved with a restriction enzyme that is not present in the selection primer but is present in the plasmid serving as a template, and the DNA into which no mutation has been inserted is cleaved. (Four)
Next, E. coli is transformed with the remaining plasmid. (Five)
In this method, a mutant plasmid is prepared from a transformant, and steps (3) and (4) are repeated to obtain a plasmid into which the desired mutation has been inserted.

The modified polymerase gene obtained as described above is used, for example, in pLED-M1, pBluescr.
After being inserted into a vector such as ipt and transformed into, for example, Escherichia coli, it is applied to an agar medium containing a drug such as ampicillin to form a colony. The colonies are inoculated on a nutrient medium, for example, LB medium or 2 × YT medium, and incubated at 37 ° C. for 12 to 2 hours.
After culturing for 0 hours, the cells are crushed to extract a crude enzyme solution. Any known method may be used to disrupt the cells, for example, a physical disruption method such as ultrasonic treatment or glass beer disruption, or a lytic enzyme such as lysozyme can be used. This crude enzyme is subjected to heat treatment, for example, 80 ° C., 3
0 min to inactivate the polymerase from the host,
Measure NA polymerase activity. Next, the 3′-5 ′ exonuclease activity was measured, and the activity ratio of the two was compared with that of the native KOD polymerase to determine the 3′-5 ′ exonuclease activity.
Enzymes with reduced exonuclease activity can be screened.

Purified D from the strain selected by the above method
As a method for obtaining NA polymerase, any known method may be used, for example, the following method. After recovering the cells obtained by culturing in a nutrient medium, the cells are crushed and extracted by enzymatic or physical crushing to obtain a crude enzyme solution. The obtained crude enzyme extract is heat-treated, for example, treated at 80 ° C. for 30 minutes, and then the KOD polymerase fraction is recovered by ammonium sulfate precipitation. The crude enzyme solution can be desalted by a method such as Sephadex G-25 (Pharmacia Biotech) gel filtration. After this operation, Q Sepharose,
Separation and purification can be performed by column chromatography such as heparin sepharose to obtain a purified enzyme preparation. This purified enzyme preparation is purified by SDS-PAGE to such an extent that it shows almost a single band.

In the present invention, the DNA synthesizing activity refers to deoxyribonucleic acid by covalently bonding α-phosphate of deoxyribonucleoside 5′-triphosphate to the 3′-hydroxyl group of an oligonucleotide or a polynucleotide annealed to a template DNA. Refers to an activity of catalyzing a reaction for introducing a deoxyribonucleoside 5′-monophosphate into a template in a template-dependent manner.

In the method for measuring the activity, when the enzyme activity is high, the measurement is performed by diluting the sample with a storage buffer. In the present invention, 25 μl of the following solution A, 5 μl of each of the solutions B and C and 10 μl of sterilized water are added to an Eppendorf tube and mixed by stirring.
React for 0 minutes. Thereafter, the mixture is cooled with ice, 50 μl of Solution E and 100 μl of Solution D are added, and after stirring, the mixture is further cooled with ice for 10 minutes. This solution was filtered through a glass filter (Whatman GF / C filter), washed sufficiently with solution D and ethanol, and the radioactivity of the filter was measured with a liquid scintillation counter (manufactured by Packard) to determine the incorporation of nucleotides into the template DNA. Measure. One unit of the enzymatic activity is defined as the amount of the enzyme that takes in 10 nmol of the nucleotide into the acid-insoluble fraction per 30 minutes under these conditions. A: 40 mM Tris-HCl (pH 7.5) 16 mM magnesium chloride 15 mM dithiothreitol 100 μg / ml BSA B: 2 μg / μl Activated calf thymus DNA C: 1.5 mM dNTP (250 cpm / pmol [ ³ H] dTTP) D: 20% trichloroacetic acid (2 mM sodium pyrophosphate) E: 1 μg / μl carrier DNA

In the present invention, the 3′-5 ′ exonuclease activity is defined as excision of the 3 ′ terminal region of DNA to remove 5 ′
-Refers to the activity of releasing mononucleotides. The activity was measured using a 50 μl reaction solution (120 mM Tris-HCl (pH 8.8 at
25 ° C), 10 mM KCl, 6 mM ammonium sulfate, 1 mM MgCl ₂ ,
Dispense 0.1% Triton X-100, 0.001% BSA, 5 μg tritium-labeled E. coli DNA) into a 1.5 ml Eppendorf tube, and add DNA polymerase. 75 ℃
After reaction for 10 minutes, the reaction was stopped by ice cooling,
Next, 50 μl of 0.1% BSA is added as a carrier, and 100 μl of 10% trichloroacetic acid, 2% sodium pyrophosphate solution is further added and mixed. After standing on ice for 15 minutes, the precipitate is separated by centrifugation at 12,000 rpm for 10 minutes. The radioactivity of 100 μl of the supernatant is measured with a liquid scintillation counter (manufactured by Packard), and the amount of nucleotide released in the acid-soluble fraction is measured.

In the present invention, the DNA synthesis rate refers to the number of synthesized DNAs per unit time. The measuring method is D
NA polymerase reaction solution (20 mM Tris-HCl (pH 7.5), 8 mM
Magnesium chloride, 7.5 mM dithiothreitol, 100 μ
g / ml BSA, 0.1 mM dNTP, 0.2 μCi [α- ³² P] dCTP) and M13mp181 single-stranded D with primer annealing.
React with NA at 75 ° C. The reaction is stopped by adding an equal volume of a reaction stopping solution (50 mM sodium hydroxide, 10 mM EDTA, 5% ficoll, 0.05% bromophenol blue). After fractionating the DNA synthesized by the above reaction by alkaline agarose gel electrophoresis, the gel is dried and subjected to autoradiography. Labeled λ / HindIII is used as a DNA size marker. The DNA synthesis rate is determined by measuring the size of the synthesized DNA using the marker band as an index.

In the present invention, the term “thermal stability” refers to a pH of 8.
8 (measured at 25 ° C.) means the residual activity after treatment at 95 ° C. for 6 hours.

The thermostable DNA polymerase of the present invention before modification is obtained from Pyrococcus sp., A kind of hyperthermophilic bacterium isolated from Kotakarajima, Kagoshima Prefecture. It is an enzyme derived from KOD. The bacteriological properties of KOD producing the enzyme are described in JP-A-7-298879. The enzyme is produced by culturing the above strain. The enzyme has the following physicochemical properties. Action: It has DNA synthesis activity and has 3'-5 'exonuclease activity. DNA synthesis rate: at least 120 bases / sec Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88 to 90 KDa Amino acid sequence: amino acid sequence described in SEQ ID NO: 2

In the nucleic acid amplification method of the present invention, the above DNA polymerase composition is used as a template with DNA as a primer and four kinds of deoxyribonucleotide triphosphates (dN
TP) to extend the primer to synthesize a DNA primer extension.

In the PCR method, which is a kind of the nucleic acid amplification method of the present invention, first, when a nucleic acid in a sample, especially a long-chain nucleic acid is double-stranded, the nucleic acid is denatured by heat to make it single-stranded. Incomplete strand separation of long nucleic acids will interfere with primer annealing and extension reactions. Then, using the single strand as a template, a primer complementary to the template, preferably a primer complementary to one of the other DNA extension products and dNTPs are used in a PCR reaction solution using the DNA polymerase composition of the present invention. To react.

The reaction temperature alternates between a high temperature at which the nucleic acid to be amplified is denatured and a low temperature at which the primer anneals to the denatured nucleic acid to cause primer extension, using a two-stage temperature cycle. Normally, repeating at 94 ° C for 0.5 to 1 minute → 68 ° C for 0.5 to 10 minutes 25 to 40 times. The two primers anneal to opposite ends of the template nucleic acid sequence, and hybridize to the other primer when the extension product of each primer is a complementary copy of the template nucleic acid sequence and is separated from its complement. Anneal the template nucleic acid in a direction that allows it to do so. The reaction time is preferably a time sufficient for the extension reaction to complete the chain synthesis. For amplification of nucleic acids longer than 20 kb,
Annealing and extension times of at least 10 to 20 minutes are preferred.

The long-chain nucleic acid is preferably protected from degradation during amplification, for example, glycerol, dimethylsulfoxide (DMSO) or the like is used.

The presence of misincorporated nucleotides terminates strand synthesis prematurely, reducing the number of template strands for the next round of amplification and reducing the efficiency of amplification of long nucleic acids. However, in the present invention, in addition to DNA polymerase activity, the presence of small amounts of 3'-5 'exonuclease activity in the reaction removes erroneously incorporated nucleotides during the synthesis of primer extension products. However, the predominant polymerase activity allows for complete strand synthesis.

The pH and composition of the reaction buffer, salts (divalent ions and monovalent ions), and the design of primers are important for the amplification efficiency of long-chain nucleic acids. Since the preparation of PCR reagents is usually performed at room temperature before the denaturation step, it may cause the binding of the primer to another primer or some homologous nucleic acid sequences. If an extension product is also formed from the binding of this non-specific primer, the amplification efficiency of the long chain product will be reduced. In order to prevent such specific binding, a so-called hot start method in which an enzyme is added after a high temperature is preferred.

In order to maintain the activity of the DNA polymerase of the present invention, it is preferable that a divalent ion such as a magnesium ion and a monovalent ion such as an ammonium ion and / or a potassium ion coexist. Further, the nucleic acid amplification reaction solution contains a buffer solution and these ions, as well as BSA, a nonionic surfactant,
For example, Triton X-100 and a buffer may be present.

The nucleic acid amplification reagent of the present invention comprises two primers, one of which is complementary to the DNA extension product of the other primer, dNTP and the above DNA polymerase composition, magnesium ion and ammonium ion and / or Or potassium ions, BSA and non-ionic surfactants and buffers. In the present invention,
The activity of the second DNA polymerase is preferably smaller than the activity of the first DNA polymerase, and the ratio of the second DNA polymerase is preferably 0.02 to 0.1 units per 2.5 units of the first DNA polymerase. If necessary, the reagent of the present invention may contain an auxiliary solubilizer, for example, glycerin, DMSO, polyethylene glycol and the like.

As the buffer, Tris buffer, tris (hydroxymethyl) methylglycine (tricine buffer), N-bis (hydroxyethyl) glycine (bicin buffer) and the like are used. Optimal buffer and pH
Depends on the DNA polymerase used. In the present invention, when KOD polymerase and a mutant of the enzyme are used, pH 7.5 to 9.2 (10 mM at 25 ° C.)
５０50 mM, preferably 20-120 mM. The divalent cation is preferably a magnesium ion, and magnesium chloride or the like is used. The concentration is preferably 1-2 mM. The monovalent cation is preferably an ammonium ion or a potassium ion, and ammonium sulfate, potassium glutamate, potassium acetate and the like are used.
Preferably, their concentration is between 2 and 50 mM. The primers are two oligonucleotides, one preferably being a primer that is complementary to the other DNA extension product. The concentration is preferably from 0.2 to 1 μM.

Next, the present invention will be described in detail with reference to examples. Reference Example 1 DNA polymerase gene derived from KOD
Cloning The hyperthermophilic archaeon KOD1 strain isolated at Kohojima, Kagoshima was cultured at 95 ° C., and the cells were collected. The chromosomal DNA of the hyperthermophilic archaeon KOD strain was prepared from the obtained cells according to a conventional method. Pyrococcus furiosas
osus) based on the amino acid sequence of the conserved region of DNA polymerase (Pfu polymerase).
GGATTAGTATAGTGCCAATGGSSGGCGA-3 'and 5'-GAGGGCAGA
AGTTTATTCCGAGCTT-3 ') was synthesized. Using these two primers, a PCR reaction was performed using the prepared DNA as a template.

After determining the nucleotide sequence of the PCR-amplified DNA fragment and determining the amino acid sequence, Southern hybridization was performed on the KOD1 strain chromosomal DNA restriction enzyme-treated product using the amplified DNA fragment as a probe,
The size of the fragment encoding NA polymerase was determined (approximately 4-7 Kbp). Further, a DNA fragment of this size was recovered from an agarose gel, inserted into a plasmid pBS (Stratagene), and Escherichia coli was isolated from these mixtures.
(E. coli JM109) was transformed to generate a library. Colony hybridization was carried out using the probe used for Southern hybridization, and a clonal strain (E. coli) thought to contain a DNA polymerase gene derived from the KOD1 strain was obtained from the above library.
JM109 / pSBKOD1) was obtained.

The obtained clone strain, (E. coli JM109 / pSBK
OD1), the plasmid pSBKOD1 was recovered, and its nucleotide sequence was determined according to a conventional method. Further, the amino acid sequence was deduced from the obtained base sequence. DNA from KOD1 strain
The polymerase gene consists of 5010 bases and 1670
Amino acids were encoded (SEQ ID NO: 1).

In order to create a complete polymerase gene, two intervening sequences (1374-2453 bp: 27
08-4316 bp) was removed by PCR fusion. In the PCR fusion method, PCR was carried out using a plasmid recovered from a clone strain as a template and three sets of primers in combination to amplify three fragments excluding the intervening sequence. At this time, the primers used for PCR were designed such that the same sequence as the binding partner was located on the side that binds to other fragments. Separate restriction enzyme sites (N-terminal: Eco
RV, C-terminal side: BamHI). Next, in the PCR-amplified fragment, the fragment located in the center of the structure and the fragment located on the N-terminal side were mixed, and PCR was performed using each fragment as a primer. Similarly, the fragment located at the center and the fragment located at the C-terminal side were mixed in structure, and PCR was performed using each fragment as a primer. Using the two fragments thus obtained, P
A CR is performed to remove the intervening sequence and EcoR at the N-terminus.
A complete gene fragment encoding a DNA polymerase derived from the KOD1 strain having a BamHI site at the V and C terminals was obtained. Furthermore, an expression vector capable of inducing the same gene with a T7 promoter, NcoI / Ba of pET-8c
Using the mHI site and the restriction enzyme site created earlier,
After subcloning, the recombinant expression vector (pET-
pol). In addition, E. coli BL21 (DE
3) / pET-pol has been deposited with the Biotechnology Research Institute (FERM BP-5513).

Reference Example 2 Subcloning of KOD Polymerase Gene To modify the heat-resistant DNA polymerase, the KOD polymerase gene was cut out from the plasmid pET-pol and subcloned into pBluescript. That is, pET-pol is replaced with restriction enzymes XbaI and B
cut with amHI (manufactured by Toyobo), and KOD of about 2.3 kb
The polymerase gene was cut out. Next, this DNA fragment was digested with XbaI and BamHI using a ligation kit (Ligation high, manufactured by Toyobo).
Ligated with Bluescript SK (-). next,
Commercially available competent cells (Toyobo competent high JM
109). LB agar medium (1% bactotryptone, 0.5% yeast extract, 0.5% sodium chloride, 1.5% agar, Gibco) containing 100 μg / ml ampicillin at 35 ° C.
After culturing for a time, a plasmid was prepared from the obtained colonies. Further, the partial nucleotide sequence was confirmed, and a plasmid pKOD1 containing the KOD polymerase gene was obtained.

Reference Example 3 Preparation of Modified Gene (DA) and Modified Thermostable DNA
Purification of Limerase (DA) Using the plasmid pKOD1 obtained in Reference Example 2, a plasmid having a modified thermostable DNA polymerase gene in which the 141st aspartic acid of the KOD polymerase described in Sequence Listing 2 was substituted with alanine was prepared. (PKO
DDA). Made by chameleon site-directed mutagenes
An is kit (Stratagene) was used. The method was performed according to the instruction manual. The primer described in SEQ ID NO: 4 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 7. The confirmation of the mutant was performed by decoding the nucleotide sequence. Escherichia coli JM109 was transformed with the obtained plasmid, and JM109 (pKO
DDA) was obtained.

A sterilized TB medium containing 100 μg / ml ampicillin (Molecular Cloning, p.A.2)
6L) was dispensed into a 10L jar fermenter. In this medium, 50 ml of an LB medium (1% bactotryptone,
Escherichia coli JM109 (pKODDA) (using a 500 ml Sakaguchi flask) cultured at 30 ° C. for 16 hours with 0.5% yeast extract, 0.5% sodium chloride (manufactured by Gibco) is inoculated, and cultured with aeration and stirring at 35 ° C. for 12 hours. did.
The cells were collected from the culture by centrifugation, and 400 ml of a disruption buffer (10 mM Tris-HCl (pH 8.0), 80 mM KCl, 5 mM 2-
After suspending in mercaptoethanol, 1 mM EDTA, the cells were disrupted by sonication to obtain a cell lysate. Next, the cell lysate was treated at 85 ° C. for 30 minutes, and the insoluble fraction was removed by centrifugation. Further, nucleic acid removal treatment using polyethyleneimine, ammonium sulfate fractionation, and heparin sepharose chromatography were performed. Finally, a storage buffer (50 mM Tris-
HCl (pH 8.0), 50 mM potassium chloride, 1 mM dithiothreitol, 0.1% Tween 20, 0.1% nonidet P40, 50% glycerin), and the modified heat-resistant DNA polymerase (D
A) was obtained. The measurement of the DNA polymerase activity in the above purification step was performed by the following operation. When the enzyme activity was high, the sample was diluted with a storage buffer and measured.

(Reagents) A: 40 mM Tris-HCl (pH 7.5) 16 mM magnesium chloride 15 mM dithiothreitol 100 μg / ml BSA B: 2 μg / μl Activated calf thymus DNA C: 1.5 mM dNTP (250 cpm / pmol [ ³ H] dTTP) D: 20% trichloroacetic acid (2 mM sodium pyrophosphate) E: 1 μg / μl Carrier DNA

(Method) 25 μl of solution A, 5 μl of each of solution B and C and 10 μl of sterile water were added to an Eppendorf tube and mixed by stirring, and 5 μl of the above enzyme solution was added.
Incubate at 5 ° C for 10 minutes. Thereafter, the mixture was cooled on ice, and the solution E (50 μm) was added.
1 and 100 μl of solution D, and after stirring, the mixture is cooled on ice for 10 minutes. This solution is passed through a glass filter (Whatman GF
/ C filter), washed sufficiently with solution D and ethanol, and measuring the radioactivity of the filter with a liquid scintillation counter (manufactured by Packard) to measure the incorporation of nucleotides into the template DNA. One unit of the enzymatic activity was the amount of the enzyme that incorporated 10 nmol of nucleotides into the acid-insoluble fraction per 30 minutes under these conditions.

Reference Example 4 Preparation of mutant (EA) gene and modified heat-resistant DNA
Purification of Limerase In the same manner as in Reference Example 3, a plasmid having a modified thermostable DNA polymerase gene in which 143rd glutamic acid of KOD polymerase shown in Sequence Listing 2 was substituted with alanine was prepared (pKODEA). The primer described in SEQ ID NO: 5 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 8. Further, modified heat-resistant DN was obtained by the same purification method as in Reference Example 3.
A polymerase (EA) was obtained.

Reference Example 5 Preparation of mutant (DEA) gene and modified heat-resistant DNA
Purification of Polymerase In the same manner as in Reference Example 3, a modified thermostable DN in which 141st aspartic acid and 143rd glutamic acid of KOD polymerase described in Sequence Listing 2 were substituted with alanine.
A plasmid having the A polymerase gene was prepared (p
KODDEA). The primer described in SEQ ID NO: 4 was used as a selection primer. The primer described in SEQ ID NO: 6 was used as the mutation primer. Further, a modified thermostable DNA polymerase (DE) was purified by the same purification method as in Reference Example 3.
A) was obtained.

Reference Example 6 Preparation of mutant (ND) gene and modified heat-resistant DNA
Purification of limerase In the same manner as in Reference Example 3, a plasmid having a modified thermostable DNA polymerase gene in which the asparagine at position 210 of KOD polymerase described in Sequence Listing 2 was substituted with aspartic acid was prepared (pKODND). The primer described in SEQ ID NO: 4 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 9. Further, a modified thermostable DNA polymerase (ND) was obtained by the same purification method as in Reference Example 3.

Reference Example 7 Preparation of mutant (YF) gene and modified heat-resistant DNA
Purification of Limerase In the same manner as in Reference Example 3, a plasmid having a modified thermostable DNA polymerase gene in which the tyrosine at position 311 of KOD polymerase described in Sequence Listing 2 was substituted with phenylalanine was prepared (pKODYF). The primer described in SEQ ID NO: 4 was used as a selection primer.
The primer described in SEQ ID NO: 10 was used as the mutation primer. Further, a modified thermostable DNA polymerase (YF) was obtained by the same purification method as in Reference Example 3.

Reference Example 8 Exonuclease of modified thermostable DNA polymerase
Confirmation of activity The exonuclease activity of the modified thermostable DNA polymerases (DA, EA, DEA, ND and YF) obtained in the above Reference Examples 3 to 7 was measured by the following method. As a control, natural KOD polymerase (manufactured by Toyobo) was used. 50 μl of the reaction solution (120 mM Tris-HCl (pH 8.8 at 25
℃), 10 mM KCl, 6 mM ammonium sulfate, 1 mM MgCl ₂ ,
0.1% Triton X-100, 0.001% BSA, 5 μg tritium-labeled E. coli DNA) was dispensed into 1.5 ml Eppendorf tubes, and 25 units, 50 units, and 100 units of DNA polymerase were added, respectively. In addition, natural type KO
0.25 units, 0.5 units, and 1 unit of D polymerase were used. After reacting at 75 ° C. for 10 minutes, the reaction was stopped by ice cooling, and then 0.1% BSA was used as a carrier.
Was added, and 10% of trichloroacetic acid, 2%
100 μl of sodium pyrophosphate solution was added and mixed.
After standing on ice for 15 minutes, the precipitate was separated by centrifugation at 12,000 rpm for 10 minutes. The radioactivity of 100 μl of the supernatant was measured with a liquid scintillation counter (manufactured by Packard), and the amount of nucleotide released into the acid-soluble fraction was measured. FIG. 1 shows the polymerase activity of each DNA polymerase and the DNA degradation rate. The results show that the modified heat resistance D
Exonuclease activity could not be detected for three types of polymerases, NA polymerases (DEA, DA, and EA). The modified thermostable DNA polymerase (ND) exhibited about 0.1% exonuclease activity of the natural KOD polymerase, and the modified thermostable DNA polymerase (YF) exhibited about 0.01% exonuclease activity.

Reference Example 9 Confirmation of Thermal Stability The thermal stability of the modified thermostable DNA polymerases (DA, EA, DEA, ND and YF) obtained in Reference Examples 3 to 7 was measured by the following method. 5 units of the purified modified DNA polymerase was added to 100 μl of a buffer solution (20 mM Tris-HCl).
pH 8.8 at 25 ° C, 10 mM potassium chloride, 10 mM ammonium sulfate, 2 mM magnesium sulfate, 0.1% Triton X-100,
0.1 mg / ml BSA, 5 mM 2-mercaptoethanol) and pre-incubated at 95 ° C. Samples were collected over time from this mixture and the polymerase activity was measured by the method described in Reference Example 3. For comparison, the same operation was performed for Taq polymerase (manufactured by Toyobo) and natural KOD polymerase (manufactured by Toyobo). As shown in FIG. 2, all the modified thermostable DNA polymerases showed a residual activity of 60% or more after treatment at 95 ° C. for 6 hours, similarly to the natural type KOD polymerase. In contrast, Taq polymerase had a residual activity of 15% or less.

Reference Example 10 Measurement of DNA Synthesis Rate The DNA synthesis rate of the modified thermostable DNA polymerases (DA, EA, DEA, ND and YF) obtained in Reference Examples 3 to 7 was measured by the following method. Purified modified DNA
One unit of polymerase is added to 10 μl of a reaction solution (20 mM Tris-HCl
(pH7.5), 8 mM magnesium chloride, 7.5 mM dithiothreitol, 100 μg / ml BSA, 0.1 mM dNTP, 0.2 μCi (α-
³² P] dCTP) M13mp181 stranded DNA is annealed primers of SEQ ID NO: 15 of 0.2μg at 75
The reaction was carried out at a temperature of 20 ° C., 40 seconds and 60 seconds. Stop the reaction using an equal volume of stop solution (50 mM sodium hydroxide, 10 mM EDT
A, 5% ficoll, 0.05% bromophenol blue). For comparison, the same operation was performed for Taq polymerase (manufactured by Toyobo) and natural KOD polymerase (manufactured by Toyobo).

After DNA synthesized by the above reaction was fractionated by alkaline agarose gel electrophoresis, the gel was dried and subjected to autoradiography. Labeled λ / HindIII was used as a DNA size marker. The DNA synthesis rate was determined by measuring the size of the synthesized DNA using the marker band as an index. As a result, all of the modified polymerases had a synthesis rate of about 120 bases / sec, similarly to the natural KOD polymerase. In contrast, Taq polymerase had a synthesis rate of about 60 bases / second.

Reference Example 11 Preparation of Modified Gene (IN) and Modified Thermostable DNA
Purification of polymerase Using plasmid pKOD1 obtained in Reference Example 2, K
X ₁ DX ₂ existing in the EXO1 region of OD polymerase
Of EX ₃ motif, to produce plasmid with a modified thermostable DNA polymerase gene was replaced with isoleucine X ₂ asparagine (pKODIN). For the preparation, a chameleon site-directed mutagenesis kit (manufactured by Stratagene) was used. The method was performed according to the instruction manual. The primer described in SEQ ID NO: 14 was used as a selection primer. The primer described in SEQ ID NO: 15 was used as the mutation primer. The confirmation of the mutant was performed by decoding the nucleotide sequence. Escherichia coli JM10
9 was transformed to obtain JM109 (pKODIN).

A sterilized TB medium containing 100 μg / ml ampicillin (Molecular Cloning, p.A.2)
6L) was dispensed into a 10L jar fermenter. In this medium, 50 ml of an LB medium (1% bactotryptone,
Escherichia coli JM109 (pKODIN) (using a 500 ml Sakaguchi flask) cultured at 30 ° C. for 16 hours with 0.5% yeast extract, 0.5% sodium chloride (manufactured by Gibco) is inoculated, and cultured with aeration and stirring at 35 ° C. for 12 hours. did.
The cells were collected from the culture by centrifugation, and 400 ml of a disruption buffer (10 mM Tris-HCl (pH 8.0), 80 mM KCl, 5 mM 2-
After suspending in mercaptoethanol, 1 mM EDTA, the cells were disrupted by sonication to obtain a cell lysate. Next, the cell lysate was treated at 85 ° C. for 30 minutes, and the insoluble fraction was removed by centrifugation. Further, nucleic acid removal treatment using polyethyleneimine, ammonium sulfate fractionation, and heparin Sepharose chromatography were performed, and finally a storage buffer (50 mM Tris-H
Cl (pH 8.0), 50 mM potassium chloride, 1 mM dithiothreitol, 0.1% Tween 20, 0.1% nonidet P40, 50% glycerin), and modified heat-resistant DNA polymerase (I
N) was obtained. The measurement of the DNA polymerase activity in the above purification step was performed by the following operation. When the enzyme activity was high, the sample was diluted with a storage buffer and measured.

(Reagents) A: 40 mM Tris-HCl (pH 7.5) 16 mM magnesium chloride 15 mM dithiothreitol 100 μg / ml BSA B: 2 μg / μl Activated calf thymus DNA C: 1.5 mM dNTP (250 cpm / pmol [ ³ H] dTTP D: 20% trichloroacetic acid (2 mM sodium pyrophosphate) E: 1 μg / μl Carrier DNA

(Method) 25 μl of solution A, 5 μl of each of solution B and solution C and 10 μl of sterilized water were added to an Eppendorf tube, and mixed by stirring.
React at 10 ° C for 10 minutes. Thereafter, the mixture was cooled on ice, and the solution E (50 μm) was added.
l, 100 μl of solution D, and after cooling, ice-cooling for 10 minutes. This solution is passed through a glass filter (Whatman GF /
C), washed thoroughly with solution D and ethanol, measured the radioactivity of the filter with a liquid scintillation counter (manufactured by Packard), and measured the incorporation of nucleotides into the template DNA. Under the conditions, the amount of the enzyme that incorporated 10 nmol of nucleotides per 30 minutes into the acid-insoluble fraction was determined.

Reference Example 12 Preparation of mutant (IE) gene and modified heat-resistant DNA
Purification of polymerase In the same manner as in Reference Example 11,
XO1 of X ₁ DX ₂ EX ₃ motif present in the region, to produce a thermostable DNA polymerase gene was replaced isoleucine of X ₂ to glutamic acid (PKODI
E). The primer described in SEQ ID NO: 14 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 16. Further, a modified thermostable DNA polymerase (IE) was obtained by the same purification method as in Reference Example 11.

Reference Example 13 Preparation of mutant (IQ) gene and modified heat-resistant DNA
Purification of Limerase In the same manner as in Reference Example 11,
XO1 of X ₁ DX ₂ EX ₃ motif present in the region, to produce a thermostable DNA polymerase gene was replaced isoleucine of X ₂ to glutamine (PKODI
Q). The primer described in SEQ ID NO: 14 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 17. Furthermore, a modified thermostable DNA polymerase (IQ) was obtained by the same purification method as in Reference Example 11.

Reference Example 14 Preparation of mutant (ID) gene and modified heat-resistant DNA
Purification of Limerase In the same manner as in Reference Example 11,
XO1 of X ₁ DX ₂ EX ₃ motif present in the region, to produce a thermostable DNA polymerase gene was replaced isoleucine of X ₂ to aspartic acid (PKODI
D). The primer described in SEQ ID NO: 14 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 18. Further, a modified thermostable DNA polymerase (ID) was obtained by the same purification method as in Reference Example 11.

Reference Example 15 Preparation of mutant (TV) gene and modified heat-resistant DNA
X present in the EX01 region in the same manner as in Reference Example 11 for purification of limerase
Of ₁ DX ₂ EX ₃ motif, it was produced thermostable DNA polymerase gene was substituted tyrosine X ₃ valine (pKODTV)). The primer described in SEQ ID NO: 14 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 19. Further, a modified thermostable DNA polymerase (TV) was obtained by the same purification method as in Reference Example 11.

Reference Example 16 Preparation of mutant (IK) gene and modified heat-resistant DNA
X existing in the EXO1 region in the same manner as purification Reference Example 11 of polymerase
₁ DX ₂ EX ₃ of motif X, to produce a thermostable DNA polymerase gene was replaced isoleucine of X ₂ to lysine (pKODIK). The primer described in SEQ ID NO: 14 was used as a selection primer. The mutation primer used was the primer described in SEQ ID NO: 21. Furthermore,
A modified thermostable DNA polymerase (IK) was obtained by the same purification method as in Reference Example 11.

Reference Example 17 Preparation of mutant (IR) gene and modified heat-resistant DNA
X existing in the EXO1 region in the same manner as purification Reference Example 11 of polymerase
₁ DX ₂ EX ₃ of motif X, to produce a thermostable DNA polymerase gene was replaced isoleucine of X ₂ in arginine (pKODIR). The primer described in SEQ ID NO: 14 was used as a selection primer. The primer described in SEQ ID NO: 20 was used as the mutation primer. Further, the modified heat-resistant DN was purified by the same purification method as in Reference Example 11.
A polymerase (IR) was obtained.

Reference Example 18 Exonuclease of modified thermostable DNA polymerase
Confirmation of activity The exonuclease activity of the modified thermostable DNA polymerases (IN, IE, IQ, ID, YV, IK and IR) obtained in Reference Examples 11 to 17 was measured by the following method. As a control, natural KOD polymerase (manufactured by Toyobo) was used. 50 μl of the reaction solution (120 mM Tris-HCl
(pH8.8 at 25 ℃), 10mM KCl, 6mM ammonium sulfate,
1 mM MgCl ₂ , 0.1% Triton X-100, 0.001% BSA, 5 μg tritium-labeled E. coli DNA) were dispensed into 1.5 ml eppen tubes, and 0.5 units, 1 unit, and 1 unit of the above DNA polymerase were added. After adding 0.5 units, the reaction was carried out at 75 ° C. for 10 minutes. The reaction was stopped by cooling with ice, then 50 ml of 0.1% BSA was added as a carrier, and 100 μl of 10% trichloroacetic acid and 2% sodium pyrophosphate solution were further added and mixed. After standing on ice for 15 minutes, the precipitate was separated by centrifugation at 12,000 rpm for 10 minutes. The radioactivity of 100 μl of the supernatant was measured with a liquid scintillation counter (manufactured by Packard), and the amount of nucleotide released into the acid-soluble fraction was measured.

FIG. 5 shows the polymerase activity of each DNA polymerase and the rate of DNA degradation. More natural KOD
The ratio of exonuclease activity to polymerase is shown in FIG. Thus, according to the present invention, 3'-
It was shown that a thermostable DNA polymerase having 5 'exonuclease activity could be obtained. For the 3′-5 ′ exonuclease activity of native KOD polymerase, IN is about 95%, IE is about 76%, and IQ is about 64%.
%, ID is about 52%, TV is about 48%, IK is about 30%
% And IR had about the same activity of 0%.

Reference Example 11 Correction of DNA Synthesis by PCR with Modified DNA Polymerase
Measurement of Accuracy The accuracy of DNA synthesis by PCR was measured by the following method for natural KOD polymerase and modified thermostable DNA polymerases IE, ID, IK, IR and Taq polymerase. Plasmid pUR288 (Current
Protocols in Molecular Biology 1.5.6) was cut with the restriction enzyme ScaI. PCR was performed using 1 ng of this plasmid. After completion of the reaction, agarose gel electrophoresis was performed on 5 μl of the reaction solution, and amplification of a target of about 5.3 kb was confirmed. The remaining reaction solution was treated with phenol / chloroform, followed by ethanol precipitation. After drying the precipitate, 50 μl of High buffer (50 mM Tris-HCl
(pH 7.5), 100 mM NaCl, 10 mM MgCl ₂ , 1 mM DTT). Further, 10 units of a restriction enzyme ScaI (manufactured by Toyobo) was added and reacted at 37 ° C. for 16 hours. The target amplification product was separated by agarose gel electrophoresis, and agarose in that portion was cut out. DNA was purified from the agarose using Geneclean 2 (manufactured by BIO101). 10 ng of the purified DNA is diluted with TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA) to 10 μl, and a ligation kit (Ligation kit manufactured by Toyobo) is used.
10 μl of the reaction solution (i) was added and reacted at 16 ° C. for 30 minutes. Next, commercially available competent cells (toyobo co.
Transformation was performed using mpetent high JM109).

100 μg / ml ampicillin, 1 mM
Isopropylthio-β-galactoside (IPTG, manufactured by Nacalai Tesque, Inc.), 0.7% of 5-bromo-4-chloro-
3-indolyl-β-D-galactoside (X-gal
(Manufactured by Nacalai Tesque)) containing LB agar medium (1%
Bactotripton, 0.5% yeast extract,
(0.5% sodium chloride, 1.5% agar, manufactured by Gibco)
At 35 ° C. for 16 hours, and colonies were counted.
The lacZ gene (β-galactosidase) is present in pUR288. Therefore, when DNA synthesis during PCR is performed correctly, blue colonies are formed on the agar medium. Conversely, when an error occurs during DNA synthesis and β-galactosidase activity encoded by the lacZ gene is reduced or deleted, a pale blue or white colony is formed. The pale blue colonies and white colonies were used as mutant colonies, and the mutation rates (%) when each enzyme was used are shown in Table 1.

[0075]

[Table 1]

As is clear from Table 1, the modified thermostable DNA polymerases IE, ID, IK,
IR is inferior to native KOD polymerase,
The mutation rate is lower than that of Taq polymerase, that is, DNA
The accuracy of the synthesis was high.

Example 1 PCR Using DNA Polymerase Composition (Human Geno
Modified ) thermostable DNA polymerase (DA, EA, DE
A, ND, YF) and natural KOD polymerase were used for PCR. 50 ml of reaction solution (120 mM Tr
is-HCl (pH8.8 at 25 ° C), 10 mM KCl, 6 mM ammonium sulfate, 1 mM MgCl _2, 0.2 mM dNTP, 0.1% Triton X-100, 0.00
1% BSA, 30 ng of human placenta-derived genomic DNA (manufactured by Clonetech), 10 pmol of primers described in Sequence Listings 11 and 12), 2.5 units of ND and 0.05 unit of KOD polymerase were added to perform a PCR reaction. Was done. Thermal cycler is model PJ2000 manufactured by PerkinElmer
Was used. The reaction conditions were 94 ° C, 30 seconds → 68 ° C, 3
The cycle was performed for 30 minutes. Modified heat-resistant DN for comparison
A polymerase (ND), Taq polymerase (manufactured by Toyobo), a commercially available DNA polymerase mixture (ExTaq
The PCR reaction was performed in the same manner for Takara Shuzo Co., Ltd. and Advantage Tth (Clontech). However, the composition of the reaction solution used was a buffer attached to a commercial product, and the same amounts of genomic DNA and primers were used as described above. After completion of the reaction, 5 μl of the reaction solution was subjected to agarose gel electrophoresis, and amplification of a target of about 4 kb was confirmed. FIG. 3 shows the results of agarose gel electrophoresis.
As a result, when PCR was performed using a mixture of modified thermostable DNA polymerase (ND) and natural KOD polymerase, amplification was better than that of a commercially available polymerase mixture.

[0078]

According to the present invention, by using both the 3'-5 'exonuclease activity and the polymerase activity, the length of an amplifiable template nucleic acid can be greatly increased. In addition, by using a mixture of two or more DNA polymerases having substantially the same thermal stability and DNA synthesis rate but different in 3′-5 ′ exonuclease activity, nucleic acid amplification with excellent amplification efficiency can be performed. Can be.

[0079]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 5342 Sequence type: nucleic acid (DNA) Number of strands: double-stranded Topology: linear Sequence type: genomic DNA Origin: Hyperthermophilic primordial Strain name: KOD1 Sequence characteristics 156-5165 P CDS 1374-2453 Intervening sequence 2708-4316 Intervening sequence Sequence GCTTGAGGGC CTGCGGTTAT GGGACGTTGC AGTTTGCGCC TACTCAAAGA TGCCGGTTTT 60 ATAACGGAGA AAAATGGGGA GCTATTACGA TCTCTCCTTGATGTGTAGTCAGTCATGAGT ATC GTCATGATCAGTCAGTCATGTAGTCAGTCATGTAGTCAGTCATGATGTCAGTACGTAGCTAGCATGATCTAGGTGATCAGCTAGATGAGTTCAGT ATA ACC GAG GAT GGA AAG CCT GTC ATA AGA ATT TTC AAG AAG GAA 221 Tyr Ile Thr Glu Asp Gly Lys Pro Val Ile Arg Ile Phe Lys Lys Glu 10 15 20 AAC GGC GAG TTT AAG ATT GAG TAC GAC CGG ACT TTT GAA CCC TAC TTC 269 Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg Thr Phe Glu Pro Tyr Phe 25 30 35 TAC GCC CTC CTG AAG GAC GAT TCT GCC ATT GAG GAA GTC AAG AAG ATA 317 Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile Glu Glu Val Lys Lys Ile 40 45 50 ACC GCC GAG AGG CAC GGG ACG GTT GTA ACG GTT AAG CGG GTT GAA AAG 365 Thr Ala Glu Arg His Gly Thr Val Val Thr Val Lys Arg Val Glu Lys 55 60 65 70 GTT CAG AAG AAG TTC CTC GGG AGA CCA GTT GAG GTC TGG AAA CTC TAC 413 Val Gln Lys Lys Phe Leu Gly Arg Pro Val Glu Val Trp Lys Leu Tyr 75 80 85 TTT ACT CAT CCG CAG GAC GTC CCA GCG ATA AGG GAC AAG ATA CGA GAG 461 Phe Thr His Pro Gln Asp Val Pro Ala Ile Arg Asp Lys Ile Arg Glu 90 95 100 CAT GGA GCA GTT ATT GAC ATC TAC GAG TAC GAC ATA CCC TTC GCC AAG 509 His Gly Ala Val Ile Asp Ile Tyr Glu Tyr Asp Ile Pro Phe Ala Lys 105 110 115 CGC TAC CTC ATA GAC AAG GGA TTA GTG CCA ATG GAA GGC GAC GAG GAG 557 Arg Tyr Leu Ile Asp Lys Gly Leu Val Pro Met Glu Gly Asp Glu Glu 120 125 130 CTG AAA ATG CTC GCC TTC GAC ATT GAA ACT CTC TAC CAT GAG GGC GAG 605 Leu Lys Met Leu Ala Phe Asp Ile Glu Thr Leu Tyr His Glu Gly Glu 135 140 145 150 GAG TTC GCC GAG GGG CCA ATC CTT ATG ATA AGC TAC GCC GAC GAG GAA 653 Glu Phe Ala Glu Gly Pro Ile Leu Met Ile Ser Tyr Ala Asp Glu Glu 155 160 165 GGG GCC AGG GTG ATA ACT TGG AAG AAC GTG GAT CTC CCC TAC GTT GAC 701 Gly Ala Arg Val Ile Thr Trp Lys Asn Val Asp Leu Pro Tyr Val Asp 170 175 180 GTC GTC TCG ACG GAG AGG GAG ATG ATA AAG CGC TTC CTC CGT GTT GTG 749 Val Val Ser Thr Glu Arg Glu Met Ile Lys Arg Phe Leu Arg Val Val 185 190 195 AAG GAG AAA GAC CCG GAC GTT CTC ATA ACC TAC AAC GGC GAC AAC TTC 797 Lys Glu Lys Asp Pro Asp Val Leu Ile Thr Tyr Asn Gly Asp Asn Phe 200 205 210 GAC TTC GCC TAT CTG AAA AAG CGC TGT GAA AAG CTC GGA ATA AAC TTC 845 Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu Lys Leu Gly Ile Asn Phe 215 220 225 230 GCC CTC GGA AGG GAT GGA AGC GAG CCG AAG ATT CAG AGG ATG GGC GAC 893 Ala Leu Gly Arg Asp Gly Ser Glu Pro Lys Ile Gln Arg Met Gly Asp 235 240 245 AGG TTT GCC GTC GAA GTG AAG GGA CGG ATA CAC TTC GATTC TAT CCT 941 Arg Phe Ala Val Glu Val Lys Gly Arg Ile His Phe Asp Leu Tyr Pro 250 255 260 GTG ATA AGA CGG ACG ATA AAC CTG CCC ACA TAC ACG CTT GAG GCC GTT 989 Val Ile Arg Arg Thr Ile Asn Leu Pro Thr Tyr Thr Leu Glu Ala Val 265 270 275 TAT GAA GCC GTC TTC GGT CAG CCG AAG GAG AAG GTT TAC GCT GAG GAA 1037 Tyr Glu Ala Val Phe Gly Gln Pro Lys Glu Lys Val Tyr Ala Glu Glu 280 285 290 ATA ACA CCA GCC TGG GAA ACC GGC GAG AAC CTT GAG AGA GTC GCC CGC 1085 Ile Thr Pro Ala Trp Glu Thr Gly Glu Asn Leu Glu Arg Val Ala Arg 295 300 305 310 TAC TCG ATG GAA GAT GCG AAG GTC ACA TAC GAG CTT GGG AAG GAG TTC 1133 Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr Glu Leu Gly Lys Glu Phe 315 320 325 CTT CCG ATG GAG GCC CAG CTT TCT CGC TTA ATC GGC CAG TCC CTC TGG 1181 Leu Pro Met Glu Ala Gln Leu Ser Arg Leu Ile Gly Gln Ser Leu Trp 330 335 340 GAC GTC TCC CGC TCC AGC ACT GGC AAC CTC GTT GAG TGG TTC CTC CTC 1229 Asp Val Ser Arg Ser Ser Thr Gly Asn Leu Val Glu Trp Phe Leu Leu 345 350 355 AGG AAG GCC TAT GAG AGG AAT GAG CTG GCC CCG AAC AAG CCC GAT GAA 1277 Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala Pro Asn Lys Pro Asp Glu 360 365 370 AAG GAG CTG GCC AGA AGA CGG CAG AGC TAT GAA GGA GGC TAT GTA AAA 1325 Lys Glu Leu Ala Arg Arg Arg Gln Ser Tyr Glu Gly Gly Tly Val Lys 375 380 385 390 GAG CCC GAG AGA GGG TTG TGG GAG AAC ATA GTG TAC CTA GAT TTT AGA 1373 Glu Pro Glu Arg Gly Leu Trp Glu Asn Ile Val Tyr Leu Asp Phe Arg 395 400 405 TGC CAT CCA GCC GAT ACG AAG GTT GTC GTC AAG GGG AAG GGG ATT ATA 1421 Cys His Pro Ala Asp Thr Lys Val Val Val Lys Gly Lys Gly Ile Ile 410 415 420 AAC ATC AGC GAG GTT CAG GAA GGT GAC TAT GTC CTT GGG ATT GAC GGC 1469 Asn Ile Ser Glu Val Gln Glu Gly Asp Tyr Val Leu Gly Ile Asp Gly 425 430 435 TGG CAG AGA GTT AGA AAA GTA TGG GAA TAC GAC TAC AAA GGG GAG CTT 1517 Trp Gln Arg Val Arg Lys Val Trp Glu Tyr Asp Tyr Lys Gly Glu Leu 440 445 450 GTA AAC ATA AAC GGG TTA AAG TGT ACG CCC AAT CAT AAG CTT CCC GTT 1565 Val Asn Ile Asn Gly Leu Lys Cys Thr Pro Asn His Lys Leu Pro Val 455 460 465 470 GTT ACA AAG AAC GAA CGA CAA ACG AGA ATA AGA GAC AGT CTT GCT AAG 1613 Val Thr Lys Asn Glu Arg Gln Thr Arg Ile Arg Asp Ser Leu Ala Lys 475 480 485 TCT TTC CTC ACT AAA AAA GTT AAG GGC AAG ATA ATA ACC ACT CCC CTT 1661 S er Phe Leu Thr Lys Lys Val Lys Gly Lys Ile Ile Thr Thr Pro Leu 490 495 500 TTC TAT GAA ATA GGC AGA GCG ACA AGT GAG AAT ATT CCA GAA GAA GAG 1709 Phe Tyr Glu Ile Gly Arg Ala Thr Ser Glu Asn Ile Pro Glu Glu Glu 505 510 515 GTT CTC AAG GGA GAG CTC GCT GGC ATA CTA TTG GCT GAA GGA ACG CTC 1757 Val Leu Lys Gly Glu Leu Ala Gly Ile Leu Leu Ala Glu Gly Thr Leu 520 525 530 TTG AGG AAA GAC GTT GAA TAC TTT GAT TCA TCC CGC AAA AAA CGG AGG 1805 Leu Arg Lys Asp Val Glu Tyr Phe Asp Ser Ser Arg Lys Lys Arg Arg 535 540 545 550 ATT TCA CAC CAG TAT CGT GTT GAG ATA ACC ATT GGG AAA GAC GAG GAG 1853 Ile Ser His Gln Tyr Arg Val Glu Ile Thr Ile Gly Lys Asp Glu Glu 555 560 565 GAG TTT AGG GAT CGT ATC ACA TAC ATT TTT GAG CGT TTG TTT GGG ATT 1901 Glu Phe Arg Asp Arg Ile Thr Tyr Ile Phe Glu Arg Leu Phe Gly Ile 570 575 580 ACT CCA AGC ATC TCG GAG AAG AAA GGA ACT AAC GCA GTA ACA CTC AAA 1949 Thr Pro Ser Ile Ser Glu Lys Lys Gly Thr Asn Ala Val Thr Leu Lys 585 590 595 GTT GCG AAG AAG AAT GTT TAT CTT AAA GTC AAG GAA ATT ATG GAC AAC 1997 Val Ala Lys Lys Asn Val Tyr Leu Lys Val Lys Glu Ile Met Asp Asn 600 605 610 ATA GAG TCC CTA CAT GCC CCC TCG GTT CTC AGG GGA TTC TTC GAA GGC 2045 Ile Glu Ser Leu His Ala Pro Ser Val Leu Arg Gly Phe Phe Glu Gly 615 620 625 630 GAC GGT TCA GTA AAC AGG GTT AGG AGG AGT ATT GTT GCA ACC CAG GGT 2093 Asp Gly Ser Val Asn Arg Val Arg Arg Ser Ile Val Ala Thr Gln Gly 635 640 645 645 ACA AAG AAC GAG TGG AAG ATT AAA CTG GTG TCA AAA CTG CTC TCC CAG 2141 Thr Lys Asn Glu Trp Lys Ile Lys Leu Val Ser Lys Leu Leu Ser Gln 650 655 660 CTT GGT ATC CCT CAT CAA ACG TAC ACG TAT CAG TAT CAG GAA AAT GGG 2189 Leu Gly Ile Pro His Gln Thr Tyr Thr Tyr Gln Tyr Gln Glu Asn Gly 665 670 675 AAA GAT CGG AGC AGG TAT ATA CTG GAG ATA ACT GGA AAG GAC GGA TTG 2237 Lys Asp Arg Ser Arg Tyr Ile Leu Glu Ile Thr Gly Lys Asp Gly Leu 680 685 690 ATA CTG TTC CAA ACA CTC ATT GGA TTC ATC AGT GAA AGA AAG AAC GCT 2285 Ile Leu Phe Gln Thr Leu Ile Gly Phe Ile Ser Glu Arg Lys Asn Ala 695 700 705 710 CTG CTT AAT AAG GCA ATA TCT CAG AGG GAA ATG AAC AAC TTG GAA AAC 2333 Leu Leu Asn Lys Ala Ile Ser Gln Arg Glu Met Asn Asn Leu Glu Asn 715 720 725 AAT GGA TTT TAC AGG CTC AGT GAA TTC AAT GTC AGC ACG GAA TAC TAT 2381 Asn Gly Pyr Arg Leu Ser Glu Phe Asn Val Ser Thr Glu Tyr Tyr 730 735 740 GAG GGC AAG GTC TAT GAC TTA ACT CTT GAA GGA ACT CCC TAC TAC TTT 2429 Glu Gly Lys Val Tyr Asp Leu Thr Leu Glu Gly Thr Pro Tyr Tyr Phe 745 750 755 GCC AAT GGC ATA TTG ACC CAT AAC TCC CTG TAC CCC TCA ATC ATC ATC 2477 Ala Asn Gly Ile Leu Thr His Asn Ser Leu Tyr Pro Ser Ile Ile Ile 760 765 770 ACC CAC AAC GTC TCG CCG GAT ACG CTC AAC AGA GAA GGA TGC AAG GAA 2525 Thr His Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu 775 780 785 790 TAT GAC GTT GCC CCA CAG GTC GGC CAC CGC TTC TGC AAG GAC TTC CCA 2573 Tyr Asp Val Ala Pro Gln Val Gly His Arg Phe Cys Lys Asp Phe Pro 795 800 805 GGA TTT ATC CCG AGC CTG CTT GGA GAC CTC CTA GAG GAG AGG CAG AAG 2621 Gly Phe Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys 810 815 820 ATA ATA AAG A AG AAG ATG AAG GCC ACG ATT GAC CCG ATC GAG AGG AAG CTC 2669 Ile Lys Lys Lys Met Lys Ala Thr Ile Asp Pro Ile Glu Arg Lys Leu 825 830 835 CTC GAT TAC AGG CAG AGG GCC ATC AAG ATC CTG GCA AAC AGC ATC CTA 2717 Leu Asp Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Ile Leu 840 845 850 CCC GAG GAA TGG CTT CCA GTC CTC GAG GAA GGG GAG GTT CAC TTC GTC 2765 Pro Glu Glu Trp Leu Pro Val Leu Glu Glu Gly Glu Val His Phe Val 855 860 865 870 AGG ATT GGA GAG CTC ATA GAC CGG ATG ATG GAG GAA AAT GCT GGG AAA 2813 Arg Ile Gly Glu Leu Ile Asp Arg Met Met Glu Glu Asn Ala Gly Lys 875 880 885 GTA AAG AGA GAG GGC GAG ACG GAA GTG CTT GAG GTC AGT GGG CTT GAA 2861 Val Lys Arg Glu Gly Glu Thr Glu Val Leu Glu Val Ser Gly Leu Glu 890 895 900 GTC CCG TCC TTT AAC AGG AGA ACT AAC AAG GCC GAG CTC AAG AGA GTA 2909 Val Pro Ser Phe Asn Arg Arg Thr Asn Lys Ala Glu Leu Lys Arg Val 905 910 915 AAG GCC CTG ATT AGG CAC GAT TAT TCT GGC AAG GTC TAC ACC ATC AGA 2957 Lys Ala Leu Ile Arg His Asp Tyr Ser Gly Lys Val Tyr Thr Ile Arg 92 0 925 930 CTG AAG TCG GGG AGG AGA ATA AAG ATA ACC TCT GGC CAC AGC CTC TTC 3005 Leu Lys Ser Gly Arg Arg Ile Lys Ile Thr Ser Gly His Ser Leu Phe 935 940 945 950 950 TCT GTG AGA AAC GGG GAG CTC GTT GAA GTT ACG GGC GAT GAA CTA AAG 3053 Ser Val Arg Asn Gly Glu Leu Val Glu Val Thr Gly Asp Glu Leu Lys 955 960 965 CCA GGT GAC CTC GTT GCA GTC CCG CGG AGA TTG GAG CTT CCT GAG AGA 3101 Pro Gly Asp Leu Val Ala Val Pro Arg Arg Leu Glu Leu Pro Glu Arg 970 975 980 AAC CAC GTG CTG AAC CTC GTT GAA CTG CTC CTT GGA ACG CCA GAA GAA 3149 Asn His Val Leu Asn Leu Val Glu Leu Leu Leu Gly Thr Pro Glu Glu 985 990 995 GAA ACT TTG GAC ATC GTC ATG ACG ATC CCA GTC AAG GGT AAG AAG AAC 3197 Glu Thr Leu Asp Ile Val Met Thr Ile Pro Val Lys Gly Lys Lys Asn 1000 1005 1010 TTC TTT AAA GGG ATG CTC AGG ACT TTG CGC TGG ATT TTC GGA GAG GAA 3245 Phe Phe Lys Gly Met Leu Arg Thr Leu Arg Trp Ile Phe Gly Glu Glu 1015 1020 1025 1030 AAG AGG CCC AGA ACC GCG AGA CGC TAT CTC AGG CAC CTT GAG GAT CTG 3293 Lys Arg Pro Arg Thr Ala Arg Arg Tyr Leu Arg His Leu Glu Asp Leu 1035 1040 1045 GGC TAT GTC CGG CTT AAG AAG ATC GGC TAC GAA GTC CTC GAC TGG GAC 3341 Gly Tyr Val Arg Leu Lys Lys Ile Gly Tyr Glu Val Leu Asp Trp Asp 1050 1055 1060 TCA CTT AAG AAC TAC AGA AGG CTC TAC GAG GCG CTT GTC GAG AAC GTC 3389 Ser Leu Lys Asn Tyr Arg Arg Leu Tyr Glu Ala Leu Val Glu Asn Val 1065 1070 1075 AGA TAC AAC GGC AAC AAG AGG GAG TAC CTC GTT GAA TTC AAT TCC ATC 3437 Arg Tyr Asn Gly Asn Lys Arg Glu Tyr Leu Val Glu Phe Asn Ser Ile 1080 1085 1090 CGG GAT GCA GTT GGC ATA ATG CCC CTA AAA GAG CTG AAG GAG TGG AAG 3485 Arg Asp Ala Val Gly Ile Met Pro Leu Lys Glu Leu Lys Glu Trp Lys 1095 1100 1105 1110 ATC GGC ACG CTG AAC GGC TTC AGA ATG AGA AAG CTC ATT GAA GTG GAC 3533 Ile Gly Thr Leu Asn Gly Phe Arg Met Arg Lys Leu Ile Glu Val Asp 1115 1120 1125 GAG TCG TTA GCA AAG CTC CTC GGC TAC TAC GTG AGC GAG GGC TAT GCA 3581 Glu Ser Leu Ala Lys Leu Leu Gly Tyr Tyr Val Ser Glu Gly Tyr Ala 1130 1135 1140 AGA AAG CAG AGG AAT CCC AAA AAC GGC TGG AGC TAC AGC GTG AAG CTC 3629 Arg Lys Gln Arg Asn Pro Lys Asn Gly Trp Ser Tyr Ser Val Lys Leu 1145 1150 1155 TAC AAC GAA GAC CCT GAA GTG CTG GAC GAT ATG GAG AGA CTC GCC AGC 3677 Tyr Asn Glu Asp Pro Glu Val Leu Asp Asp Met Glu Arg Leu Ala Ser 1160 1165 1170 AGG TTT TTC GGG AAG GTG AGG CGG GGC AGG AAC TAC GTT GAG ATA CCG 3725 Arg Phe Phe Gly Lys Val Arg Arg Gly Arg Asn Tyr Val Glu Ile Pro 1175 1180 1185 1190 AAG AAG ATC GGC TAC CTG CTC TTT GAG AAC ATG TGC GGT GTC CTA GCG 3773 Lys Lys Ile Gly Tyr Leu Leu Phe Glu Asn Met Cys Gly Val Leu Ala 1195 1200 1205 GAG AAC AAG AGG AGG ATT CCC GAG TTC GTC TTC ACG TCC CCG AAA GGG GTT 3821 Glu Asn Lys Arg Ile Pro Glu Phe Val Phe Thr Ser Pro Lys Gly Val 1210 1215 1220 CGG CTG GCC TTC CTT GAG GGG TAC TCA TCG GCG ATG GCG ACG TCC ACC 3869 Arg Leu Ala Phe Leu Glu Gly Tyr Ser Ser Ala Met Ala Thr Ser Thr 1225 1230 1235 GAA CAA GAG ACT CAG GCT CTC AAC GAA AAG CGA GCT TTA GCG AAC CAG 3917 Glu Gln Glu Thr Gln Ala Leu Asn Glu Lys Arg Ala Leu Ala Asn Gln 1240 1245 1250 CTC GTC CTC CTC TTG AAC TCG GTG GGG GTC TCT GCT GTA AAA CTT GGG 3965 Leu Val Leu Leu Leu Asn Ser Val Gly Val Ser Ala Val Lys Leu Gly 1255 1260 1265 1270 CAC GAC AGC GGC GTT TAC AGG GTC TAT ATA AAC GAG GAG CTC CCG TTC 4013 His Asp Ser Gly Val Tyr Arg Val Tyr Ile Asn Glu Glu Leu Pro Phe 1275 1280 1285 GTA AAG CTG GAC AAG AAA AAG AAC GCC TAC TAC TCA CAC GTG ATC CCC 4061 Val Lys Leu Asp Lys Lys Lys Asn Ala Tyr Tyr Ser His Val Ile Pro 1290 1295 1300 AAG GAA GTC CTG AGC GAG GTC TTT GGG AAG GTT TTC CAG AAA AAC GTC 4109 Lys Glu Val Leu Ser Glu Val Phe Gly Lys Val Phe Gln Lys Asn Val 1305 1310 1315 AGT CCT CAG ACC TTC AGG AAG ATG GTC GAG GAC GGA AGA CTC GAT CCC 4157 Ser Pro Gln Thr Phe Arg Lys Met Val Glu Asp Gly Arg Leu Asp Pro 1320 1325 1330 GAA AAG GCC CAG AGG CTC TCC TGG CTC ATT GAG GGG GAC GTA GTG CTC 4205 Glu Lys Ala Gln Arg Leu Ser Trp Leu Ile Glu Gly Asp Val Val Leu 1335 1340 1345 1350 GAC CGC GTT GAG TCC GTT GAT GTG GAA GAC TAC GAT GGT TAT GTC TAT 4253 Asp Arg Val Glu Ser Val Asp Val Glu Asp Tyr Asp Gly Tyr Val Tyr 1355 1360 1365 GAC CTG AGC GTC GAG GAC AAC GAG AAC TTC CTC GTT GGC TTT GGG TTG 4301 Asp Leu Ser Val Glu Asp Asn Glu Asn Phe Leu Val Gly Phe Gly Leu 1370 1375 1380 GTC TAT GCT CAC AAC AGC TAC TAC GGT TAC TAC GGC TAT GCA AGG GCG 4349 Val Tyr Ala His Asn Ser Tyr Tyr Gly Tyr Tyr Gly Tyr Ala Arg Ala 1385 1390 1395 CGC TGG TAC TGC AAG GAG TGT GCA GAG AGC GTA ACG GCC TGG GGA AGG 4397 Arg Trp Tyr Cys Glu Cys Ala Glu Ser Val Thr Ala Trp Gly Arg 1400 1405 1410 GAG TAC ATA ACG ATG ACC ATC AAG GAG ATA GAG GAA AAG TAC GGC TTT 4445 Glu Tyr Ile Thr Met Thr Ile Lys Glu Ile Glu Glu Lys Tyr Gly Phe 1415 1420 1425 1430 AAG GTA ATC TAC AGC GAC ACC GAC GGA TTT TTT GCC ACA ATA CCT GGA 4493 Lys Val Ile Tyr Ser Asp Thr Asp Gly Phe Phe Ala Thr Ile Pro Gly 1435 1440 1445 GCC GAT GCT GAA ACC GTC AAA AAG AAG GCT ATG GAG TTC CTC AAC TAT 4541 Ala Asp Ala Glu Thr Val Lys Lys Lys Ala Met Glu Phe Leu Asn Tyr 1450 1455 1460 ATC AAC GCC AAA CTT CCG GGC GCG CTT GAG CTC GAG TAC GAG GGC TTC 4589 Ile Asn Ala Lys Leu Pro Gly Ala Leu Glu Leu Glu Tyr Glu Gly Phe 1465 1470 1475 TAC AAA CGC GGC TTC TTC GTC ACG AAG AAG AAG TAT GCG GTG ATA GAC 4637 Tyr Lys Arg Gly Phe Phe Val Thr Lys Lys Lys Tyr Ala Val Ile Asp 1480 1485 1490 GAG GAA GGC AAG ATA ACA ACG CGC GGA CTT GAG ATT GTG AGG CGT GAC 4685 Glu Glu Gly Lys Ile Thr Thr Arg Gly Leu Glu Ile Val Arg Arg Asp 1495 1500 1505 1510 TGG AGC GAG ATA GCG AAA GAG ACG CAG GCG AGG GTT CTT GAA GCT TTG 4733 Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala Arg Val Leu Glu Ala Leu 1515 1520 1525 CTA AAG GAC GGT GAC GTC GAG AAG GCC GTG AGG ATA GTC AAA GAA GTT 4781 Leu Lys Asp Gly Asp Val Glu Lys Ala Val Arg Ile Val Lys Glu Val 1530 1535 1540 ACC GAA AAG CTG AGC AAG TAC GAG GTT CCG CCG GAG AAG CTG GTG ATC 4829 Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro Pro Glu Lys Leu Val Ile 1545 1550 1555 CAC GAG CAG ATA ACG AGG GAT TTA AAG GAC TAC AAG GCA ACC GGT CCC 4877 His Glu Gln Ile Thr Arg Asp Leu Lys Asp Tyr Lys Ala Thr Gly Pro 1560 1565 1570 CAC GTT GCC GTT GCC AAG AGG TTG GCC GCG AGA GGA GTC AAA ATA CGC 4925 His Val Ala Val Ala Lys Arg Leu Ala Ala Arg Gly Val Lys Ile Arg 1575 1580 1585 1590 CCT GGA ACG GTG ATA AGC TAC ATC GTG CTC AAG GGC TCT GGG AGG ATA 4973 Pro Gly Thr Val Ile Ser Tyr Ile Val Leu Lys Gly Ser Gly Arg Ile 1595 1600 1605 GGC GAC AGG GCG ATA CCG TTC GAC GAG TTC GAC CCG ACG AAG CAC AAG 5021 Gly Asp Arg Ala Ile Pro Phe Asp Glu Phe Asp Pro Thr Lys His Lys 1610 1615 1620 TAC GAC GCC GAG TAC TAC ATT GAG AAC CAG GTT CTC CCA GCC GTT GAG 5069 Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln Val Leu Pro Ala Val Glu 1625 1630 1635 AGA ATT CTG AGA GCC TTC GGT TAC CGC AAG GAA GAC CTG CGC TAC CAG 5117 Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys Glu Asp Leu Arg Tyr Gln 1640 1645 1650 AAG ACG AGA CAG GTT GGT TTG AGT GCT TGG CTG AAG CCG AAG GGA ACT 5165 Lys Thr Arg Gln Val Gly Leu Ser Ala Trp Leu Lys Pro Lys Gly Thr 1655 1660 1665 1670 TGACCTTTCC ATTTGTTTTC CAGCGGATAA CCCTTTAACT TCCCTTTCAA AAACTCCCTT 5225 TAGGGAAAGA CCATGAAGAT AGAAATCCGG CGGCGCCCGG TTAAATACGC TAGGATAGAA 5285 GTG AAGCCAG ACGGCAGGGT AGTCGTCACT GCCCCGAGGG TTCAACGTTG AGAAGTT 5342

SEQ ID NO: 2 Sequence length: 774 Sequence type: amino acid Topology: linear Sequence type: protein sequence Met Ile Leu Asp Thr Asp Tyr Ile Thr Glu Asp Gly Lys Pro Val Ile 1 5 10 15 Arg Ile Phe Lys Lys Glu Asn Gly Glu Phe Lys Ile Glu Tyr Asp Arg 20 25 30 Thr Phe Glu Pro Tyr Phe Tyr Ala Leu Leu Lys Asp Asp Ser Ala Ile 35 40 45 Glu Glu Val Lys Lys Ile Thr Ala Glu Arg His Gly Thr Val Val Thr 50 55 60 Val Lys Arg Val Glu Lys Val Gln Lys Lys Phe Leu Gly Arg Pro Val 65 70 75 80 Glu Val Trp Lys Leu Tyr Phe Thr His Pro Gln Asp Val Pro Ala Ile 85 90 95 Arg Asp Lys Ile Arg Glu His Gly Ala Val Ile Asp Ile Tyr Glu Tyr 100 105 110 Asp Ile Pro Phe Ala Lys Arg Tyr Leu Ile Asp Lys Gly Leu Val Pro 115 120 125 Met Glu Gly Asp Glu Glu Leu Lys Met Leu Ala Phe Asp Ile Glu Thr 130 135 140 Leu Tyr His Glu Gly Glu Glu Phe Ala Glu Gly Pro Ile Leu Met Ile 145 150 155 160 Ser Tyr Ala Asp Glu Glu Gly Ala Arg Val Ile Thr Trp Lys Asn Val 165 170 175 Asp Leu Pro Tyr Val Asp Va l Val Ser Thr Glu Arg Glu Met Ile Lys 180 185 190 Arg Phe Leu Arg Val Val Lys Glu Lys Asp Pro Asp Val Leu Ile Thr 195 200 205 Tyr Asn Gly Asp Asn Phe Asp Phe Ala Tyr Leu Lys Lys Arg Cys Glu 210 215 220 Lys Leu Gly Ile Asn Phe Ala Leu Gly Arg Asp Gly Ser Glu Pro Lys 225 230 235 240 Ile Gln Arg Met Gly Asp Arg Phe Ala Val Glu Val Lys Gly Arg Ile 245 250 255 His Phe Asp Leu Tyr Pro Val Ile Arg Arg Thr Ile Asn Leu Pro Thr 260 265 270 Tyr Thr Leu Glu Ala Val Tyr Glu Ala Val Phe Gly Gln Pro Lys Glu 275 280 285 Lys Val Tyr Ala Glu Glu Ile Thr Pro Ala Trp Glu Thr Gly Glu Asn 290 295 300 Leu Glu Arg Val Ala Arg Tyr Ser Met Glu Asp Ala Lys Val Thr Tyr 305 310 315 320 Glu Leu Gly Lys Glu Phe Leu Pro Met Glu Ala Gln Leu Ser Arg Leu 325 330 335 Ile Gly Gln Ser Leu Trp Asp Val Ser Arg Ser Ser Thr Gly Asn Leu 340 345 350 Val Glu Trp Phe Leu Leu Arg Lys Ala Tyr Glu Arg Asn Glu Leu Ala 355 360 365 Pro Asn Lys Pro Asp Glu Lys Glu Leu Ala Arg Arg Arg Gln Ser Tyr 370 375 380 Glu Gly Gly Tyr Val Lys Glu Pr o Glu Arg Gly Leu Trp Glu Asn Ile 385 390 395 400 Val Tyr Leu Asp Phe Arg Ser Leu Tyr Pro Ser Ile Ile Ile Thr His 405 410 415 Asn Val Ser Pro Asp Thr Leu Asn Arg Glu Gly Cys Lys Glu Tyr Asp 420 425 430 Val Ala Pro Gln Val Gly His Arg Phe Cys Lys Asp Phe Pro Gly Phe 435 440 445 Ile Pro Ser Leu Leu Gly Asp Leu Leu Glu Glu Arg Gln Lys Ile Lys 450 455 460 Lys Lys Met Lys Ala Thr Ile Asp Pro Ile Glu Arg Lys Leu Leu Asp 465 470 475 480 480 Tyr Arg Gln Arg Ala Ile Lys Ile Leu Ala Asn Ser Tyr Tyr Gly Tyr 485 490 495 495 Tyr Gly Tyr Ala Arg Ala Arg Trp Tyr Cys Lys Glu Cys Ala Glu Ser 500 505 510 Val Thr Ala Trp Gly Arg Glu Tyr Ile Thr Met Thr Ile Lys Glu Ile 515 520 525 Glu Glu Lys Tyr Gly Phe Lys Val Ile Tyr Ser Asp Thr Asp Gly Phe 530 535 540 540 Phe Ala Thr Ile Pro Gly Ala Asp Ala Glu Thr Val Lys Lys Lys Ala 545 550 555 560 Met Glu Phe Leu Asn Tyr Ile Asn Ala Lys Leu Pro Gly Ala Leu Glu 565 570 575 Leu Glu Tyr Glu Gly Phe Tyr Lys Arg Gly Phe Phe Val Thr Lys Lys 580 585 590 Lys Tyr Ala Val Ile Asp Glu Gl u Gly Lys Ile Thr Thr Arg Gly Leu 595 600 605 Glu Ile Val Arg Arg Asp Trp Ser Glu Ile Ala Lys Glu Thr Gln Ala 610 615 620 Arg Val Leu Glu Ala Leu Leu Lys Asp Gly Asp Val Glu Lys Ala Val 625 630 635 640 Arg Ile Val Lys Glu Val Thr Glu Lys Leu Ser Lys Tyr Glu Val Pro 645 650 655 Pro Glu Lys Leu Val Ile His Glu Gln Ile Thr Arg Asp Leu Lys Asp 660 665 670 Tyr Lys Ala Thr Gly Pro His Val Ala Val Ala Lys Arg Leu Ala Ala 675 680 685 Arg Gly Val Lys Ile Arg Pro Gly Thr Val Ile Ser Tyr Ile Val Leu 690 695 700 Lys Gly Ser Gly Arg Ile Gly Asp Arg Ala Ile Pro Phe Asp Glu Phe 705 710 715 715 720 Asp Pro Thr Lys His Lys Tyr Asp Ala Glu Tyr Tyr Ile Glu Asn Gln 725 730 735 Val Leu Pro Ala Val Glu Arg Ile Leu Arg Ala Phe Gly Tyr Arg Lys 740 745 750 Glu Asp Leu Arg Tyr Gln Lys Thr Arg Gln Val Gly Leu Ser Ala Trp 755 760 765 Leu Lys Pro Lys Gly Thr 770

SEQ ID NO: 3 Sequence length: 2325 Sequence type: Nucleic acid (DNA) Number of chains: double-stranded Topology: linear Sequence type: genomic DNA sequence ATGATCCTCG ACACTGACTA CATAACCGAG GATGGAAAGC CTGTCATAAG AATTTTCAAG 60 AAGGAAAACG GCGAGTTTAA GATTGAGTAC GACCGGACTT TTGAACCCTA CTTCTACGCC 120 CTCCTGAAGG ACGATTCTGC CATTGAGGAA GTCAAGAAGA TAACCGCCGA GAGGCACGGG 180 ACGGTTGTAA CGGTTAAGCG GGTTGAAAAG GTTCAGAAGA AGTTCCTCGG GAGACCAGTT 240 GAGGTCTGGA AACTCTACTT TACTCATCCG CAGGACGTCC CAGCGATAAG GGACAAGATA 300 CGAGAGCATG GAGCAGTTAT TGACATCTAC GAGTACGACA TACCCTTCGC CAAGCGCTAC 360 CTCATAGACA AGGGATTAGT GCCAATGGAA GGCGACGAGG AGCTGAAAAT GCTCGCCTTC 420 GACATTCAAA CTCTCTACCA TGAGGGCGAG GAGTTCGCCG AGGGGCCAAT CCTTATGATA 480 AGCTACGCCG ACGAGGAAGG GGCCAGGGTG ATAACTTGGA AGAACGTGGA TCTCCCCTAC 540 GTTGACGTCG TCTCGACGGA GAGGGAGATG ATAAAGCGCT TCCTCCGTGT TGTGAAGGAG 600 AAAGACCCGG ACGTTCTCAT AACCTACAAC GGCGACAACT TCGACTTCGC CTATCTGAAA 660 AAGCGCTGTG AAAAGCTCGG AATAAACTTC GCCCGG GGGATGGAAG CGAGCCGAAG 720 ATTCAGAGGA TGGGCGACAG GTTTGCCGTC GAAGTGAAGG GACGGATACA CTTCGATCTC 780 TATCCTGTGA TAAGACGGAC GATAAACCTG CCCACATACA CGCTTGAGGC CGTTTATGAA 840 GCCGTCTTCG GTCAGCCGAA GGAGAAGGTT TACGCTGAGG AAATAACACC AGCCTGGGAA 900 ACCGGCGAGA ACCTTGAGAG AGTCGCCCGC TACTCGATGG AAGATGCGAA GGTCACATAC 960 GAGCTTGGGA AGGAGTTCCT TCCGATGGAG GCCCAGCTTT CTCGCTTAAT CGGCCAGTCC 1020 CTCTGGGACG TCTCCCGCTC CAGCACTGGC AACCTCGTTG AGTGGTTCCT CCTCAGGAAG 1080 GCCTATGAGA GGAATGAGCT GGCCCCGAAC AAGCCCGATG AAAAGGAGCT GGCCAGAAGA 1140 CGGCAGAGCT ATGAAGGAGG CTATGTAAAA GAGCCCGAGA GAGGGTTGTG GGAGAACATA 1200 GTGTACCTAG ATTTTAGATC CCTGTACCCC TCAATCATCA TCACCCACAA CGTCTCGCCG 1260 GATACGCTCA ACAGAGAAGG ATGCAAGGAA TATGACGTTG CCCCACAGGT CGGCCACCGC 1320 TTCTGCAAGG ACTTCCCAGG ATTTATCCCG AGCCTGCTTG GAGACCTCCT AGAGGAGAGG 1380 CAGAAGATAA AGAAGAAGAT GAAGGCCACG ATTGACCCGA TCGAGAGGAA GCTCCTCGAT 1440 TACAGGCAGA GGGCCATCAA GATCCTGGCA AACAGCTACT ACGGTTACTA CGGCTATGCA 1500 AGGGCGCGCT GGTACTGCAA GGAGTGTGCA GAGAGCGTAA CGGCCTGGGG AAGGGAGTAC 1560 ATAACGATGA CCATCAAGGA GATAGAGGAA AAGTACGGCT TTAAGGTAAT CTACAGCGAC 1620 ACCGACGGAT TTTTTGCCAC AATACCTGGA GCCGATGCTG AAACCGTCAA AAAGAAGGCT 1680 ATGGAGTTCC TCAACTATAT CAACGCCAAA CTTCCGGGCG CGCTTGAGCT CGAGTACGAG 1740 GGCTTCTACA AACGCGGCTT CTTCGTCACG AAGAAGAAGT ATGCGGTGAT AGACGAGGAA 1800 GGCAAGATAA CAACGCGCGG ACTTGAGATT GTGAGGCGTG ACTGGAGCGA GATAGCGAAA 1860 GAGACGCAGG CGAGGGTTCT TGAAGCTTTG CTAAAGGACG GTGACGTCGA GAAGGCCGTG 1920 AGGATAGTCA AAGAAGTTAC CGAAAAGCTG AGCAAGTACG AGGTTCCGCC GGAGAAGCTG 1980 GTGATCCACG AGCAGATAAC GAGGGATTTA AAGGACTACA AGGCAACCGG TCCCCACGTT 2040 GCCGTTGCCA AGAGGTTGGC CGCGAGAGGA GTCAAAATAC GCCCTGGAAC GGTGATAAGC 2100 TACATCGTGC TCAAGGGCTC TGGGAGGATA GGCGACAGGG CGATACCGTT CGACGAGTTC 2160 GACCCGACGA AGCACAAGTA CGACGCCGAG TACTACATTG AGAACCAGGT TCTCCCAGCC 2220 GTTGAGAGAA TTCTGAGAGC CTTCGGTTAC CGCAAGGAAG ACCTGCGCTA CCAGAAGACG 2280 AGACAGGTTG GTTTGAGTGC TTGGCTGAAG CCGAAGGGAA CTTGA 2325

SEQ ID NO: 4 Sequence length: 24 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CTTTTGCTCA GATCTTCTTT CCTG 24

SEQ ID NO: 5 Sequence length: 36 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CAGGAAAGAA GATCTGAGCA AAAG 24

SEQ ID NO: 6 Sequence length: 36 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CTGAAAATGC TCGCCTTCGC GATTGCAACT CTCTAC 36

SEQ ID NO: 7 Sequence length: 33 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CTGAAAATGC TCGCCTTCGC GATTGAAACT CTCT 34

SEQ ID NO: 8 Sequence length: 30 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence GCCCTCGTGG TAGAGAGTTG CAATGTCGAA 30

SEQ ID NO: 9 Sequence length: 32 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CGGACGTACT GATAACGTAC GACGGTGACA AC 32

SEQ ID NO: 10 Sequence length: 33 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CCTTGAGAGA GTCGCGCGCT TCTCGATGGA AGA 33

SEQ ID NO: 11 Sequence length: 35 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence TGGCTAGCCA AGGAACCACC AGTTGATTAG CAGAG 35

SEQ ID NO: 12 Sequence length: 35 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence ATAAGAGGTC CCAAGACTTA GTACCTGAAG GGTGA 36

SEQ ID NO: 13 Sequence length: 24 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA sequence CGCCAGGGTT TTCCCAGTCA CGAC 24

SEQ ID NO: 14 Sequence length: 24 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA CTTTTGCTCA GATCTTCTTT CCTG 24

SEQ ID NO: 15 Sequence length: 36 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA AGCTGAAAAT GCTAGCCTTC GACAATGAAA CTCTCT 36

SEQ ID NO: 16 Sequence length: 36 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA AGCTGAAAAT GCTAGCCTTC GACGAAGAAA CTCTCT 36

SEQ ID NO: 17 Sequence length: 33 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA GAAAATGCTC GCCTTTGATC AAGAAACTCT CTA 33

SEQ ID NO: 18 Sequence length: 36 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA AGCTGAAAAT GCTAGCCTTC GACGATGAAA CTCTCT 36

SEQ ID NO: 19 Sequence length: 30 Sequence type: Nucleic acid (DNA) Number of strands: Single strand Topology: Linear Sequence type: Synthetic DNA CGCCTTCGAC ATTGAAGTAC TCTACCATGA 30

SEQ ID NO: 20 Sequence length: 36 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA AGCTGAAAAT GCTAGCCTTC GACAGAGAAA CTCTCT 36

SEQ ID NO: 21 Sequence length: 36 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA AGCTGAAAAT GCTAGCCTTC GACAAAGAAA CTCTCT 36

SEQ ID NO: 22 Sequence length: 35 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA AAAAAGTACT CACCAGTCAC AGAAAAGCAT CTTAC 35

SEQ ID NO: 23 Sequence length: 34 Sequence type: nucleic acid (DNA) Number of strands: single strand Topology: linear Sequence type: synthetic DNA AAAAAGTACT CAACCAAGTC ATTCVTGAGA ATAGT 34

[Brief description of the drawings]

FIG. 1 is a diagram showing the polymerase activity and DNA degradation rate of a modified DNA polymerase.

FIG. 2 is a diagram showing the thermal stability of a modified DNA polymerase.

FIG. 3 shows the results of PCR (human genome) using a DNA polymerase composition.

FIG. 4: Exo of heat-resistant DNA polymerase (EXO)
It is a figure which shows the amino acid sequence of a region.

FIG. 5 is a diagram showing the polymerase activity and DNA degradation rate of a modified DNA polymerase.

FIG. 6 is a diagram showing the ratio of exonuclease activity to native KOD polymerase.

[Procedure amendment]

[Submission date] September 2, 1996

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Figure 3

[Correction method] Change

[Correction contents]

FIG. 3 PCR using a DNA polymerase composition
4 is a photograph of electrophoresis showing a result of (human genome).

 ──────────────────────────────────────────────────続 き Continuing on the front page (72) Inventor Fumiyoshi Kawakami 10-24, Toyocho, Tsuruga-shi, Fukui Toyobo Co., Ltd. Inside Tsuruga Bio-Research Laboratory (72) Inventor Yoshihisa Kawamura 10-24, Toyocho, Tsuruga-shi, Fukui (72) Inventor Masahiro Takagi 1-38 Aoyamadai, Suita-shi, Osaka C-58-207 (72) Inventor Tadayuki Imana 2-28-11, Fujishirodai, Suita-shi, Osaka

Claims (30)

[Claims] Claims: 1. A thermostable DNA polymerase having a 3'-5 'exonuclease activity before modification,
5% modified thermostable DNA polymerase having 3'-5 'exonuclease activity (first DNA polymerase) and thermostable DNA polymerase having 3'-5' exonuclease activity or 3'-
A modified thermostable DNA polymerase having a 3'-5 'exonuclease activity (a second DNA polymerase) which is 100-6% higher than a thermostable DNA polymerase having a 5' exonuclease activity;
The DNA synthesis rate at which the NA polymerase and the second DNA polymerase are at least 30 bases / second, pH 8.
8 (measured at 25 ° C) at 95 ° C for 6 hours
A DNA polymerase composition for nucleic acid amplification, having thermal stability capable of maintaining 0% or more of the remaining activity. 2. The method according to claim 2, wherein the activity of the second DNA polymerase is the first DNA polymerase.
The DNA polymerase composition for nucleic acid amplification according to claim 1, wherein the composition is smaller than the activity of the DNA polymerase. 3. The DNA polymerase composition for nucleic acid amplification according to claim 1, wherein the amount of the second DNA polymerase is 0.02 to 0.1 units per 2.5 units of the first DNA polymerase. 4. The 3′-5 ′ exonuclease activity of the first DNA polymerase is higher than the 3′-5 ′ exonuclease activity of the thermostable DNA polymerase before modification.
2. The DN of claim 1 wherein said DN is reduced to about 1% or less.
A polymerase composition. 5. The DNA polymerase composition according to claim 1, wherein the first DNA polymerase is a modified thermostable DNA polymerase having the following physicochemical properties. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 0-5%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. 6. The DNA polymerase composition according to claim 1, wherein the first DNA polymerase is a modified thermostable DNA polymerase having the following physicochemical properties. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 0-5%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C. Molecular weight: 88 to 90 KDa Amino acid sequence: The first amino acid sequence of SEQ ID NO: 2
Amino acid sequence in which at least one of amino acids at positions 41, 142, 143, 210 and 311 is substituted with another amino acid 7. The DNA polymerase composition according to claim 1, wherein the first DNA polymerase is a modified thermostable DNA polymerase having the following physicochemical properties. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 0-5%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88 to 90 KDa Amino acid sequence: 141st aspartic acid to alanine, 142nd isoleucine to arginine, 143rd glutamic acid to alanine,
Amino acid sequence obtained by substituting 141st aspartic acid and 143rd glutamic acid with alanine, 210th asparagine with aspartic acid, and 311th tyrosine with phenylalanine 8. The method according to claim 8, wherein the first DNA polymerase is SEQ ID NO: 2.
2. The DNA according to claim 1, which is a thermostable DNA polymerase obtained by substituting the 141st aspartic acid with alanine.
Polymerase composition. 9. The method according to claim 9, wherein the first DNA polymerase is SEQ ID NO: 2.
The DNA according to claim 1, which is a thermostable DNA polymerase obtained by substituting the 142nd isoleucine with arginine.
Polymerase composition. 10. The DNA according to claim 1, wherein the first DNA polymerase is a heat-resistant DNA polymerase obtained by substituting 143rd glutamic acid of SEQ ID NO: 2 with alanine.
Polymerase composition. 11. The DNA polymerase composition according to claim 1, wherein the first DNA polymerase is a thermostable DNA polymerase obtained by substituting the 141st aspartic acid and the 143rd glutamic acid of SEQ ID NO: 2 with alanine. 12. The DNA polymerase composition according to claim 1, wherein the first DNA polymerase is a heat-resistant DNA polymerase in which the asparagine at position 210 in SEQ ID NO: 2 has been substituted with aspartic acid. 13. The heat-resistant DNA polymerase according to claim 1, wherein the first DNA polymerase is a thermostable DNA polymerase obtained by substituting the 311st tyrosine of SEQ ID NO: 2 with phenylalanine.
NA polymerase composition. 14. The DNA polymerase composition according to claim 1, wherein the second DNA polymerase is a modified thermostable DNA polymerase having the following physicochemical properties. Action: It has DNA synthesis activity and has 3'-5 'exonuclease activity. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88 to 90 KDa Amino acid sequence: amino acid sequence described in SEQ ID NO: 2 15. The DNA polymerase composition according to claim 1, wherein the second DNA polymerase is a modified thermostable DNA polymerase having the following physicochemical properties. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 100-6%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Amino acid sequence: an amino acid sequence present in the exo1 (EXO1) region of the amino acid sequence described in SEQ ID NO: 2, X ₁ D
Amino acid sequence in which at least one amino acid of X ₁ , X ₂ and X _{3 in} the X ₂ EX ₃ motif has been substituted with another amino acid 16. The DNA polymerase composition according to claim 1, wherein the second DNA polymerase is a modified thermostable DNA polymerase having the following physicochemical properties. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 100-6%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Amino acid sequence: Nos. 140, 142 and 1 of SEQ ID NO: 2
Amino acid sequence in which amino acid at position 44 has been substituted with another amino acid 17. The DNA polymerase composition according to claim 1, wherein the second DNA polymerase is a modified thermostable DNA polymerase having the following physicochemical properties. Action: has DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 100-6%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88-90 KDa Amino acid sequence: Amino acid sequence in which isoleucine at position 142 of SEQ ID NO: 2 is substituted with aspartic acid, glutamic acid, asparagine, glutamine or lysine, or threonine at position 144 is replaced with valine Substituted amino acid sequence 18. The DNA polymerase composition according to claim 1, wherein the second DNA polymerase is a thermostable DNA polymerase obtained by substituting isoleucine at position 142 of SEQ ID NO: 2 with aspartic acid. 19. The D according to claim 1, wherein the second DNA polymerase is a thermostable DNA polymerase obtained by replacing isoleucine at position 142 of SEQ ID NO: 2 with glutamic acid.
NA polymerase composition. 20. The DNA according to claim 1, wherein the second DNA polymerase is a thermostable DNA polymerase obtained by substituting isoleucine at position 142 of SEQ ID NO: 2 with asparagine.
NA polymerase composition. 21. The DN according to claim 1, wherein the second DNA polymerase is a heat-resistant DNA polymerase obtained by substituting glutamine for the isoleucine at position 142 of SEQ ID NO: 2.
A polymerase composition. 22. The DNA polymerase composition according to claim 1, wherein the second DNA polymerase is a heat-resistant DNA polymerase in which isoleucine at position 142 of SEQ ID NO: 2 has been substituted with lysine. 23. The DN according to claim 1, wherein the second DNA polymerase is a thermostable DNA polymerase obtained by substituting arginine for the isoleucine at position 142 of SEQ ID NO: 2.
A polymerase composition. 24. The DNA polymerase composition according to claim 1, wherein the second DNA polymerase is a thermostable DNA polymerase obtained by substituting the 144th threonine of SEQ ID NO: 2 with valine. 25. A DNA polymerase composition for nucleic acid amplification, comprising the following first DNA polymerase and the following second DNA polymerase. First DNA polymerase: action: has a DNA synthesis activity, compared to the enzyme before modification
It has a 3'-5 'exonuclease activity of 0-5%. DNA synthesis rate: at least 30 bases / second Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88-90 KDa Amino acid sequence: 141st aspartic acid to alanine, 142nd isoleucine to arginine, 143rd glutamic acid to alanine,
Amino acid sequence obtained by substituting 141st aspartic acid and 143rd glutamic acid with alanine, 210th asparagine with aspartic acid, and 311th tyrosine with phenylalanine 2nd DNA polymerase: action: having DNA synthesis activity Has 3′-5 ′ exonuclease activity. DNA synthesis rate: at least 120 bases / sec Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C. Molecular weight: 88 to 90 KDa Amino acid sequence: amino acid sequence described in SEQ ID NO: 2 or Action: having DNA synthesis activity,
It has a 3'-5 'exonuclease activity that is 100-30%. DNA synthesis rate: at least 120 bases / sec Thermal stability: 95 at pH 8.8 (measured at 25 ° C.)
The residual activity of 60% or more can be maintained by treatment at 6 ° C. for 6 hours. Optimum temperature: about 75 ° C Molecular weight: 88-90 KDa Amino acid sequence: Amino acid sequence in which isoleucine at position 142 of SEQ ID NO: 2 is substituted with aspartic acid, glutamic acid, asparagine, glutamine or lysine, or threonine at position 144 is substituted with valine Amino acid sequence 26. A DNA comprising: a template;
A nucleic acid amplification method comprising reacting TP with a reagent comprising the DNA polymerase composition for nucleic acid amplification according to any one of claims 1 to 25 to extend the primer and synthesize a DNA primer extension. . 27. The nucleic acid amplification method according to claim 26, wherein the primers are two kinds of oligonucleotides, one of which is complementary to the DNA extension product of the other primer. 28. The method according to claim 26, wherein heating and cooling are repeated.
The nucleic acid amplification method according to the above. 29. The DNA polymerase composition for nucleic acid amplification according to any one of claims 1 to 25, a divalent ion,
A nucleic acid amplification reagent comprising monovalent ions, primers, dNTPs and a buffer. 30. The DNA polymerase composition for nucleic acid amplification according to any one of claims 1 to 25, magnesium ion and ammonium ion and / or potassium ion, wherein one primer is DN of the other primer.
Two primers complementary to the A extension product, dNT
A nucleic acid amplification reagent comprising P, BSA, a nonionic surfactant and a buffer.