JPH10286086A - Protein kinase gak, dna sequence coding the same, anti-gak antibody and producing cell of the antibody - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new protein kinase GAK as a relating factor or CDK5 and utilizing to elucidate biochemical controlling mechanism and physiological function and useful for curing of cancer, etc., by containing serine/threonine kinase domain, etc. SOLUTION: This protein kinase GAK is a relating factor of cyclin G and contains serine/threonine kinase domain, leucine zipper and a tensin/auxin-like domain and is also a relating factor of CDK5, and contains an amino acid of the formula or an amino acid sequence in which one or more amino acids are inserted, deleted or substituted from the amino acid of the formula. Producing cells producing an anti-GAK antibody and entrusted as FERM P-15843, 15844, 15845, 15846 and 15847 are obtained from a syncytium of an antibody producing cell derived from a mammal immuno-sensitized of the GAK and a mammal myeloma-based cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel protein kinase, GAK, and more particularly to a protein kinase that regulates the physiological function of cyclin G, a candidate for a link between apoptosis and the cell cycle.

[0002]

2. Description of the Related Art In a multicellular organism, cells grow and divide in a complicated pattern, differentiate into cells specialized to perform various functions, and form organs. Communicate with each other via chemical and electrical signals. Despite the complex interdependence of the cells that make up these multicellular organisms, on the other hand, they are autonomous and independent. Thus, these cells can in principle grow and divide independently of neighboring cells.

However, in reality, organisms control the growth and division of cells according to certain rules, and when they deviate from these rules, they lead to canceration and eventually death of the individual organism. Today, exploring the mechanisms of cell growth and division is one of the greatest concerns in the fields of medicine and biology.

[0004] Cells repeatedly proliferate and divide along a certain cycle called the cell cycle. The cell cycle is largely divided into a mitotic phase (M phase) and an interphase.
Phase, S phase, and G2 phase. Many enzymes and structural proteins are involved in the growth and division of eukaryotic cells,
In particular, protein kinases and protein phosphatases, which are enzymes that control protein phosphorylation, play a decisive role in cell cycle control. Protein kinase transfers a phosphate group from ATP to a specific amino acid of a target protein, while protein phosphatase removes the phosphate group from the target protein. By the addition and removal of such a phosphate group, the function of the target protein is significantly changed.

Many of the protein kinases and protein phosphatases exhibit extremely high specificity for the protein with which they act, and act as molecular switches that regulate the activity of their target proteins. As these protein kinases that regulate the cell cycle, those that are called cyclin-dependent kinases (CDKs) and bind to cyclins, which are a series of proteins that are specifically expressed and eliminated in the cell cycle, are known. Cell cycle regulation is regulated by a variety of mechanisms, including phosphorylation and dephosphorylation of serine / threonine or tyrosine residues by CDKs and binding to related factors such as cyclin regulatory subunits and small inhibitory polypeptides. (Elledgeand Harper, Cu
rr. Op. Cell Biol., VOL6: P842-852 (1994)).

[0006] Cyclin regulates the activity of CDK by binding to CDK. When cyclin is degraded by a cell cycle-specific proteolytic enzyme, CDK is activated.
Are inactivated. At present, cyclins have been identified in many eukaryotes, and cyclins that work in the transition from G1 phase to S phase are called G1 cyclins, and cyclins that work in the transition from G2 phase to M phase are called G2 cyclins. , G1 cyclins include cyclin A and cyclin B, and G2 cyclins include cyclin C,
Cyclin D, cyclin E, cyclin F and the like are known.

The present inventors recently cloned rat cyclin G, which is presumed to be G1 cyclin (Tamura, K. Kanaoka, Y. Nojima, H. et al., Oncogen).
e, 8, 2113-2118 (1993)), when compared at the amino acid level, this protein has the highest homology to human cyclin A and fission yeast Cig1 compared to other cyclins (Bueno et al., Cell Connolly, 66, 149-159 (1991);
and Beach, Mol. Cell. Biol., 14, 768-776 (1994)),
On the phylogenetic tree, the budding yeast HCS26 (Ogas et al., Cel
l, 66, 1015-1026 (1991)) and PCL1 (Espinoza et a
l., Science, 266, 1388-1391 (1994)).

[0008] Like cyclin C and cyclin D,
Cyclin G also has a "destruction box" which is a sequence that is degraded by protein kinase or a "PEST" sequence (a region rich in proline, glutamic acid, serine, threonine and aspartic acid) which is a sequence commonly found in unstable proteins. do not have. As can be seen from this structural feature, there is little variation in cyclin G expression throughout the cell cycle. However, cyclin G transcription is induced several hours after stimulation of quiescent cells by growth factors (Tamura, K. Kanaoka, Y. Nojima, H. et al., Oncog.
ene, 8, 2113-2118 (1993)).

Recently, cyclin G was discovered to be a direct transcription target of the p53 tumor suppressor gene product (Okayam
a and Beach, EMBO J., 13, 4816-4822 (1994)), and its importance is increasing as cyclin G is nominated as a candidate for a bridge between apoptosis and the cell cycle.

[0010] On the other hand, the biochemical regulatory mechanism of cyclin G and the regulatory factors considered to regulate the physiological function have not yet been elucidated. An object of the present invention is to provide a novel protein kinase, GAK, which is a related factor that regulates the physiological function of cyclin G.
An object of the present invention is to provide a DNA sequence encoding K, an antibody that specifically binds to GAK, and a cell that produces the antibody.

[0011]

SUMMARY OF THE INVENTION The novel protein kinase GAK of the present invention is a related factor of cyclin G and includes a serine / threonine kinase domain, a leucine zipper and a tensin / auxin-like domain. , CDK5.

[0012] Such GAK is a related factor of cyclin G and is a factor useful for elucidating the biochemical regulation mechanism and physiological function of cyclin G. In addition, cyclin G is considered as a candidate for a link between apoptosis and the cell cycle. From this point, GAK is expected to be useful for cancer treatment and the like.

The amino acid sequence expressing GAK includes, for example, the amino acid sequence of rat GAK consisting of 1305 amino acids shown in SEQ ID NO: 1. Among them, the serine / threonine kinase domain is No. 15 to 331 of the amino acid sequence of SEQ ID NO: 1, and the TAG domain which is a domain for tensin and auxillin is 369 to 1173 of the amino acid sequence of SEQ ID NO: 1,
The leucine zipper is found at amino acid positions 928 to 949, which is the C-terminal part of the TAG domain. This GA
The nucleotide sequence encoding K is 4454 shown in SEQ ID NO: 1.
Nos. 106 to 4020 in the base sequence consisting of

As another amino acid sequence, for example, human GAK consisting of the amino acid 1311 shown in SEQ ID NO: 2
The amino acid sequence of Of these, the serine / threonine kinase domain is amino acids 15 to 331 of the amino acid sequence of SEQ ID NO: 2, the TAG domain which is a domain for tensin and auxilin is amino acids 371 to 1178 of the amino acid sequence of SEQ ID NO: 2, and leucine zipper Is 93 of the amino acid sequence which is the C-terminal part of the TAG domain.
It is found in Nos. 0-944. The base sequence encoding this GAK is Nos. 1 to 3933 of the base sequence consisting of 4331 bases shown in SEQ ID NO: 2.

It should be noted that even if one or more amino acids are inserted, deleted or substituted in the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2,
Any protein that is related to DK5 and contains a serine / threonine kinase domain, a leucine zipper and a tensin / auxin-like domain belongs to the GAK of the present invention.

The antibodies against GAK (anti-GAK antibodies) of the present invention include anti-GAK monoclonal antibodies and anti-GAK antibodies.
There are polyclonal antibodies and the like.
It can be obtained by immunizing an ST-GAK fusion protein, and the latter can be obtained, for example, by immunizing a New Zealand white rabbit with a rat GST-GAK fusion protein by a conventional method. Such an anti-GAK antibody is useful for measuring GAK and the like.

As the cells producing anti-GAK antibodies, it is preferable to use fused cells of antibody-producing cells obtained from mammals immunized with GAK as an antigen and mammalian myeloid cells. An example of obtaining such a fused cell is shown below in (1) to (4). About immunity In addition to mice that are mammals, rats,
Hamsters and the like can also be used. Usually, mice are the most widely used, and BALB / c mice and other strains (str
ain) mice can be used. In this case, the immunization scheme and the concentration of the antigen should be selected so that a sufficient amount of antigen-stimulated lymphocytes is formed. For example, one mouse is immunized three times into the peritoneal cavity at intervals of two weeks with 25 μg of the antigen, and then 25 μg of the antigen is intravenously administered. Several days after the final immunization, spleen cells are removed for fusion.

Cell fusion The spleen is aseptically removed from the mammal immunized as described above, and a single cell suspension is prepared therefrom. The spleen cells (antibody-producing cells) are fused with a suitable myeloma cell by using a suitable fusion promoter. The myeloma cells are preferably derived from mammals of the same species as the immunized animal, but spleen cells of rats, hamsters and the like can be fused with mouse myeloma cells. The preferred ratio of spleen cells to myeloma cells ranges from about 20: 1 to about 2: 1. Is appropriate use of a fusion medium 0.5~1.5ml for about 10 ⁸ splenocytes. As a preferred fusion promoter, for example, polyethylene glycol having an average molecular weight of 1,000 to 4,000 can be advantageously used, but other fusion promoters known in the art (for example, Sendai virus (also known as HVJ)) can also be used. Cell fusion may be performed by a method using electric shock other than the method using these fusion promoters.

About selection of fused cells In a separate container (eg, a microtiter plate), a mixture of unfused splenocytes, unfused myeloma cells and fused fused cells is selected in a selection medium that does not support unfused myeloma cells. Diluted and sufficient time to kill unfused cells (approximately 1
Time) Incubate. As the medium, a medium that is drug-resistant (for example, 8-azaguanine-resistant) and does not support unfused myeloma cells (for example, HAT medium (medium containing hypoxanthine, aminopterin, and thymidine)) is used. Unfused myeloma cells die in this selective medium. Unfused splenocytes are non-neoplastic cells, and die after a certain period of time (eg, one week). In contrast, the fused cells
Since it has the properties of parental spleen cells and the tumor properties of parental cells of myeloma, it can survive in a selective medium.

Thus, after the fused cells are detected, the anti-G
Enzyme immunoassay for AK antibody (Enzyme Linked Immun
osorbent Assay)
Only those fusion cells that produce a monoclonal antibody that specifically binds to are selected. Such fused cells include, for example, mouse-mouse hybridoma 1A3, 1C
2, 1C11, 1D7, 3H9 (Accession number: FERM
P-15843 to 15847).

Obtaining Anti-GAK Monoclonal Antibodies After cloning a fused cell producing an anti-GAK monoclonal antibody by an appropriate method (eg, limiting dilution method), the antibody can be produced by two different methods. According to the first method, a monoclonal antibody produced by the fusion cell can be obtained from the culture supernatant by culturing the fusion cell for a certain period in an appropriate medium. Second
According to the method, the fused cells can be injected into the peritoneal cavity of an immunized animal having an isogenic or semi-isogenic gene.
An anti-GAK monoclonal antibody produced by the fused cells can be obtained from the blood and ascites of the host animal after a certain period of time.

[0022]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Preferred embodiments of the present invention will be described below. [Example 1] Cloning of GAK molecule cDNA of rat fibroblast (NRK-49F cell)
The library was prepared using a λZapII vector (Stratagene, manufactured by Stratagene) according to a conventional method, and the cells were lysed and transferred to a nitro filter.

After the transfer, the filter was incubated with a GST-cyclin G fusion protein (see Example 2) at 4 ° C. for several hours in a TBS buffer. This filter is a synthetic peptide of rat cyclin G (CTLPFFERR).
NDLNFERL) was screened using an anti-cyclin G polyclonal antibody obtained by immunization.

Subsequently, the filter was an anti-rabbit immunoglobulin labeled with alkaline phosphatase (COSMO (C
osmo), Dako (Dako), etc.) and NTB (nitro blue tetrazolium) and BCIP (5-bromo-4).
-Chloro-3-indoyl phosphate) was used as a substrate for color development to confirm positive clones.

Seven phage clones out of about one million phages were positive. One of the λ phages was returned to the plasmid using the SOLR system (Stratagene) and further analyzed. The base sequence of the double-stranded DNA was determined by the PCR method.

The rat GA thus identified
The amino acid sequence and DNA sequence of K are shown in SEQ ID NO: 1
Shown in FIG. 1 shows rat GAK and auxilin (Au).
xilin) and Tensin (Tensin). FIG. 2 shows the partial amino acid sequence of GAK (amino acids 36 to 409) and Nek1, CDK2, Plk, Tk.
FIG. 3 is an explanatory diagram showing the similarity to sk-1, and FIG.
Partial amino acid sequence (amino acid sequence 369 to 130)
FIG. 5 is an explanatory diagram showing the similarity between No. 5) and auxillin and tensin. In FIGS. 2 and 3, hatched portions indicate the same amino acids.

Rat GAK is composed of 1305 amino acids, and from this amino acid sequence, the kinase domain structure of GAK (amino acids 15 to 331) is Ne.
k1 (Letwin et al., EMBO J., 11, 3521-3531 (199
2)), CDK2 (Ninomiya-Tsuji et al., Proc. Natl.
Acad. Sci. USA, 88, 9006-9010 (1991)), Plk
(Clay et al., Proc. Natl. Acad. Sci. USA, 90,
4882-4886 (1993)) and Tsk-1 kinase (Bielke et al.
al., Gene, 39, 235-239 (1994)). Thus, the kinase domain structure of GAK is a serine / threonine kinase domain.

GAK also lacks the PSTAIR motif, an amino acid sequence found in all CDKs, and therefore does not belong to the CDK family.
In addition, GAK, in the central part of the molecule, is tensin (Daviset al.,
Science, 252, 712-715 (1991)) and auxillin covering a clathrin-coated vessel of the brain (Schroder et al., Eur.
J. Biochem., 228, 297-304 (1995); Ungewickell et a
l., Nature, 378, 632-635 (1995)).

A TAG domain which is a domain for tensin and auxillin (amino acids 369 to 11 of the amino acid sequence)
No. 73) accounts for more than half of all molecules,
Leucine zippers (Landschulz et al., Science, 240,
1759-1764 (1988)) is found in the C-terminal part of the TAG domain (amino acids 928 to 949).

The C-terminal domain of the molecule (11 of the amino acid sequence)
At positions 74-1305), GAK and auxillin are more than 80% identical, and this region is rich in serine and proline residues (14% and 18%, respectively). The phosphorylation recognition site of tyrosine kinase is 40 amino acids in the amino acid sequence.
It is located at position 3 to 410 in KGDLDISY (Patschins
ky et al., Proc. Natl. Acad. Sci. USA, 79, 973-
977 (1982); Cooper, et al., J. Biol. Chem., 259, 78.
35-7841 (1984)), which is located at the left end of the TAG domain. This kinase domain has 13 to
It hides two putative nucleotide binding sequences (GXGXXG) at positions 18 and 337-342 (Moller and Amons, FEBSLett., 186, 1-7 (1985)).

In FIG. 1, a consensus sequence of this amino acid also found in auxillin (KGDLDFTY at positions 58-65 of the amino acid sequence of auxillin)
Is poorly conserved in tensin (SCELD at positions 64-71 of the amino acid sequence of tensin)
LVY).

One site each of which is considered to be phosphorylated by cAMP-dependent protein kinase, protein kinase C and casein kinase II protein kinase (KKLS at positions 90 to 93),
19 and 24 locations have been found.

Hydrophobic plot (Hoop and Wood, Proc. Nat)
l. Acad. Sci. USA, 78, 3824-3828 (1981)) suggests that the overall structure of GAK is hydrophilic. On the other hand, the cloning of human GAK molecule
Using K as a probe, it was hybridized from a human placenta library by a conventional method and caught, and its sequence was analyzed.
The base sequence of the double-stranded DNA was determined by the PCR method.

The human GAK thus identified
Is shown in SEQ ID NO: 2 in the sequence listing. Human GAK consists of 1311 amino acids, of which the serine / threonine kinase domain is the amino acid sequence of SEQ ID NO: 2 from No. 15 to 331, and the TAG domain which is a domain for tensin and auxilin is the amino acid sequence of SEQ ID NO: 2. No. 371 to 117
No. 8 and the leucine zipper was found at amino acid positions 930 to 944 in the C-terminal part of the TAG domain. The base sequence encoding this GAK is No. 1 to 39 out of the base sequence consisting of 4331 bases shown in SEQ ID NO: 2.
It was number 33.

In Examples 2 and later, rat GAK was used as GAK. [Example 2] Preparation of GST fusion protein GST (glutathione-S-transferase) and GST
The fusion protein with AK and the fusion protein with GST and cyclin G can be obtained by the method of Harlow and Lanes ("A Laboratory
Manual ", Cold Spring Harbour, New York: Cold Spri
ng Harbor Laboratori Press, 1988).

That is, 135-1 of the amino acid sequence of GAK
A set of oligonucleotides around the 42nd and initiation codon and a set of oligonucleotides around the initiation codon and termination codon of cyclin G were synthesized, and Taq DNA polymerase (Takara Shuzo) or Pfu DNA polymerase (Stratagene) was synthesized. It was used as a primer for the RT-PCR used.

In order to construct GST-GAK plasmid DNA, 0.5-
The kb fragment was ligated to the GAK cDNA and p-
It was subcloned into the GST3 vector. In addition, pG
The ST3 vector was prepared as follows. That is, pG
EX-2T (Pharmacia) was converted to BamHI and Sma.
After treating with I, inserting the multiple cloning site of BluescriptII KS (+), treating with HindIII and EcoRI, the base sequence of SEQ ID NO: 3 in the sequence listing was inserted.

To prepare a GST-cyclin G plasmid, the above DNA fragment was directly inserted into a pGEX-4T vector (Pharmacia) through appropriate restriction sites (SalI, EcoRI) in the oligonucleotide. E. coli containing these plasmids (PR
745) and cultured with IPTG (isopropyl-β-D-
The lac promoter was induced using thiogalactopyranoside) to produce a GST fusion protein, and affinity purification was performed using a glutathione-Sepharose 4B column (Pharmacia).

GAK or cyclin G excluding the GST portion was eluted by adding 1 mg / ml thrombin. [Example 3] Preparation of anti-GAK monoclonal antibody [3-1] Immunization of mouse The rat GST-GAK fusion protein prepared in Example 2 and complete Freund's adjuvant were mixed well to prepare a suspension, This suspension was administered intraperitoneally to BDF1 mice in an amount of 25 μg as an antigen per animal. Two weeks later, the same amount of antigen was administered again, and three days later, the spleen was removed.
Cell fusion was performed as described below.

[3-2] Selection and Acquisition of Fusion Cells Producing Anti-GAK Monoclonal Antibodies The excised mouse spleen cells and syngeneic mouse myeloma cells (SP2 / 0-Ag14) were in a ratio of about 10: 1. And cell fusion was performed using 50% polyethylene glycol 4000 as a fusion promoter. 1 × 10 ⁶ cells after fusion
The cells were suspended in a HAT medium containing 10% bovine serum to a cell concentration of cells / ml, and dispensed into a 96-well microtiter plate ("Maxi Soap", manufactured by Nunc, the same applies hereinafter) at a rate of 100 µl per well.

The fused cells were in a CO ₂ incubator (5% C
(O ₂ , 37 ° C.), the medium was replaced with a HAT medium, and the cells were grown. The fused cells composed of spleen cells and myeloma cells were screened. Then, it was conditioned in HT medium, and further 10% FCS (fetal calf serum) -RPMI1
Conditioned in 640 medium.

The antibody in the culture supernatant of the fused cells was GST-G.
The AK fusion protein was detected by ELISA using a sensitized microtiter plate. For positive wells, cloning by limiting dilution was repeated twice to select clones having reactivity to the GST-GAK fusion protein, and mouse-mouse hybridomas 1A3, 1C2, 1C11, 1D7, 3H9 ( Accession number: FERM P-15843-15847). The cells of the obtained clones were each 10% DMS.
Suspended in 90% bovine serum containing O and stored in liquid nitrogen.

[3-3] Collection of Monoclonal Antibody An anti-GAK monoclonal antibody produced by a clone is obtained by growing mouse-mouse hybridoma 1C2 in the abdominal cavity of a nude mouse and using a protein-A Sepharose 4B column from the ascites of the mouse. To purify each. still,
The reactivity of the obtained antibody to GAK was confirmed by ELISA.

Example 4 Relationship between GAK and Cyclin G The relationship between GAK and cyclin G in vitro was determined by an immunoprecipitation method using an extract of normal rat fibroblasts (NRK) and an antibody against cyclin G. Proven by Western blotting using anti-GAK monoclonal antibody as a probe.

Incidentally, rat fibroblasts were NRK-49F
Cells were obtained from the ATCC and 5 ° C., 5% CO ₂ , 5
The cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 100% fetal calf serum and penicillin (100 U / ml). An anti-GAK monoclonal antibody was obtained by immunizing a rat GST-GAK fusion protein as described in detail in Example 3 above, and an anti-GAK polyclonal antibody (p-GAK) was obtained by immunizing a rat GST-GAK fusion protein. It was obtained by immunizing a New Zealand white rabbit by a conventional method.

The immunoprecipitation method and the Western blot were
This was performed as follows. In the immunoprecipitation method, NRK cells grown in a subconfluent state were treated with a protease inhibitor (100 mM PMSF, 1 μg / ml Leu).
peptine and 1 μg / ml Pepstatin
A) and a phosphatase inhibitor (10 mM Na
Lysis buffer (50 mM Tris-HCl [pH 7.5], 250 mM, supplemented with ₄ P ₂ O ₇ , 10 mM NaF, 2 mM sodium vanadate and 1 mM EGTA)
mM NaCl, 0.1% NP40).

The cell extract was centrifuged at 10,000 × g for 5 minutes to remove the residue, and the supernatant was immunoprecipitated using only protein A-Sepharose. The lysate before centrifugation was subsequently immunoprecipitated with the corresponding antibody. Optionally, immunoprecipitated SDS polyacrylamide gels were stained by silver staining.

For analysis by Western blot, an equal volume of fresh, immunoprecipitated cell extract was adsorbed to protein A-Sepharose and 10% SDS-PA
Separation by GE, Immobilon membrane (Millipore (Milpore)
iST) and transfer to TBST buffer (20 mM T
ris-HCl [pH 7.5], 150 mM NaC
1, 0.05% tween 20). Immunologically reactive protein bands were confirmed by ECL chemiluminescence (Amersham). Size markers were purchased from Bio-Rad.

FIG. 4 shows that 500 μg of NRK cell extract was immunoprecipitated using serum before immunization (lane 1) or immunoprecipitated using anti-cyclin G polyclonal antibody (lanes 2 and 3). 4 is a photograph as a substitute for a drawing, showing the result of Western blotting of a precipitate using an anti-GAK monoclonal antibody as a probe. still,
In Lane 3, the anti-cyclin G antibody used for immunoprecipitation was
What absorbed 10 ng of GST-cyclin G fusion protein which had been affinity-purified beforehand was used. Lane 4
The results obtained when 10 μg of NRK cell extract was electrophoresed without immunoprecipitation and subjected to Western blotting using an anti-GAK monoclonal antibody are shown.

Here, a GAK band appears in lane 4, indicating that GAK is contained in the extract of NRK cells. Lane 1 shows no GAK band, indicating that GAK was not contained in the immunoprecipitate using pre-immune serum.

Lane 2 shows a GAK band, which indicates that the immunoprecipitate with the anti-cyclin G antibody contains GAK in addition to the antigen, cyclin G. Lane 3 shows no GAK band. This is because the anti-cyclin G antibody does not contain cyclin G in the immunoprecipitate because the GST-cyclin G fusion protein has been preabsorbed. This shows that the immunoprecipitate containing no cyclin G does not contain GAK.

The above results demonstrate the relationship between cyclin G and GAK. FIG. 5 shows an extract 50 of NRK cells.
0 ng was subjected to immunoprecipitation using an anti-GAK monoclonal antibody (lane 1), an anti-GAK polyclonal antibody (lanes 2, 3, 4) or serum before immunization (lane 5), and the immunoprecipitate was subjected to anti-cyclin G polyclonal antibody. 7 is a photograph as a substitute of a drawing, showing the result of Western blotting using as a probe. In lanes 3 and 4, the anti-GAK body used for the immunoprecipitation was 10 μg of the affinity-purified GST-GAK fusion protein, 3.5 μg.
What absorbed μg was used.

In lanes 1 to 4, the cyclin G band appeared, but in lane 5, no cyclin G band appeared. This indicates that the immunoprecipitate using the serum before immunization showed the cyclin G band. Indicates that it is not included. Also, the band of cyclin G in lanes 3 and 4 is weaker than that in lane 2, indicating that the content of cyclin G decreases as the content of GAK in the immunoprecipitate decreases. And proves the relationship between GAK and cyclin G.

[Example 5] GAK / cyclin G / CDK5 complex in vivo In order to confirm whether GAK is merely a cyclin G-related kinase, immunization of the association between cyclin G and other known CDKs was performed. Investigations were made using sedimentation and Western blotting. In vivo for Western blotting
Showed a relationship between cyclin G and CDK5.

FIG. 6 is a photograph as a drawing showing the relationship between CDK5 and cyclin G and GAK in vivo. FIG.
Lane 6 of (A) shows the relationship between CDK5 and GAK, and lane 8 shows the relationship between CDK5 and cyclin G. These were subjected to immunoprecipitation with an anti-GAK polyclonal antibody (pGAK) or anti-cyclin G antibody using an extract of NRK cells, and Western blotting of the precipitate. An anti-CDK5 monoclonal antibody (Santa Crutz Biotechnology) was used as a Western blot probe.

Lane 6 in FIG. 6A suggests that CDK5 is present in the immunoprecipitate of anti-GAK polyclonal antibody and GAK, and lane 8 shows immunoprecipitation of anti-cyclin G antibody and cyclin G. Suggests the presence of CDK5 in the product. On the other hand, lane 6 in FIG.
Lane 12 shows the relationship between AK and CDK5, and lane 12 shows the relationship between GAK and cyclin G. Using an extract of NRK cells, immunoprecipitation reaction was performed with an anti-CDK5 monoclonal antibody or anti-cyclin G antibody, and the precipitate was subjected to Western blot. An anti-GAK monoclonal antibody was used as a Western blot probe.

Lane 6 of FIG. 6 (B) suggests the presence of GAK in the immunoprecipitate of anti-CDK5 antibody and CDK5, and lane 12 shows the immunoprecipitate of anti-cyclin G antibody and cyclin G. Suggests the presence of GAK in it. Example 6 Analysis of GAK Kinase Activity GAK kinase activity (serine / threonine kinase activity) was measured by incorporation of ³² P into histone H1. FIG. 7 shows the result.

[About Lanes 1 to 6] Lane 1 in FIG.
Nos. 6 to 6 show that the extract of NRK cells was extracted from normal rabbit serum or anti-G
Immunoprecipitation was performed using an AK polyclonal antibody, and the immunoprecipitate was used for histone H1 (5 μg, manufactured by Boehringer Mannheim) and [γ- ³² P] ATP.
(5 μCi) in a 25 μl reaction mixture (50 mM T
ris-HCl [pH 7.4], 10 mM MgCl
2,1 mM dithiothreitol) and the specific activity of the histone H1 band on 10% SDS-PAGE was determined from the autoradiogram to quantitatively demonstrate the incorporation of ³² P phosphate into histone H1. The analysis was performed using a densitograph (manufactured by Atto).

The extract of NRK cells was dissolved in a lysis buffer containing a protease inhibitor and a phosphatase inhibitor, centrifuged, and a part of the supernatant was pretreated with protein A sepharose as in Example 4. Rabbit serum or anti-GAK polyclonal antibody (α-
Immunoprecipitation was performed with (pGAK).

Here, lane 1 is a negative control, and the uptake of ³² P phosphate into histone H1 was measured for the precipitate obtained by immunoprecipitating the extract of NRK cells with normal rabbit serum. In lanes 2 and 3, the incorporation of ³² P phosphate into histone H1 was measured for the precipitate obtained by immunoprecipitating the extract of NRK cells with an anti-GAK polyclonal antibody (* mark in α-pGAK column in FIG. 7). (This indicates that immunoprecipitation was performed with an anti-GAK polyclonal antibody). still,
Lane 3 shows 10 μg of GST-GA before immunoprecipitation.
The anti-GAK polyclonal antibody pre-absorbed with the K fusion protein was used (the ** mark in the GST-GAK column in FIG. 7 indicates that the pre-absorbed anti-GAK polyclonal antibody was used).

Lane 4 is a negative control, and was measured in the same manner as in Lane 1 except that 1.0 μg of the GST-cyclin G fusion protein was added (GST-FIG. 7).
The asterisks in the cyclinG column indicate that GST-cyclin G is 1.
0 μg was added). Lanes 5 and 6 are GST
The measurement was performed in the same manner as in lanes 2 and 3 except that 1.0 μg of the cyclin G fusion protein was added.

The measurement results of the above lanes 1 to 6 will be described with reference to FIG. FIG. 7 shows one of the reaction products at the bottom.
FIG. 4 shows an autoradiogram on 0% SDS-PAGE,
Histone H1 measured from autoradiogram above
Shows a bar graph indicating the relative intensities of the bands.

The immunoprecipitated GAK was replaced with [γ- ³² P] ATP.
And incubated - When was collected, ³² P phosphate histone H1
(Lane 2), while native control
Was not substantially incorporated into histone H1 (lanes 1, 4). GST-cyclin G in reaction buffer
The addition of the fusion protein did not enhance the kinase activity of GAK (lane 5).

With α-pGAK preabsorbed by the GST-GAK fusion protein, the kinase activity of the anti-GAK immunoprecipitate was greatly reduced (lanes 3, 6). This competition experiment indicates that the kinase activity of the immunoprecipitate is specific for GAK. [About lanes 7 to 11] Lanes 7 to 10 in FIG. 7 show affinity-purified G
1.5 μg of ST-GAK fusion protein (GST-G in FIG. 7)
+ In the AK column indicates that 1.5 μg of GST-GAK was used) was dissolved in the above reaction mixture containing histone H1 and [γ- ³² P] ATP, and the histone H1 band on 10% SDS-PAGE. Was measured from an autoradiogram and analyzed using a densitograph (manufactured by Atto).

Here, lanes 7 to 10 show the affinity-purified GST-cyclin G fusion proteins at 0, 0.1, 0.5, 2... For examining the effect of GST-cyclin G on the kinase activity. 5 μg was added (G in FIG. 7).
In the column of ST-cyclinG,-represents 0, + represents 0.1, ++ represents 0.5, and +++ represents 2.5 µg). In addition, lane 11
Is a negative control.

With respect to the above measurement results of lanes 7 to 11,
A description will be given based on FIG. When the GST-cyclin G fusion protein was added to the GST-GAK fusion protein (lanes 7 to 11), a larger amount (2.5 or 15 μg) or a smaller amount (0.5 μg) of the GST-GAK fusion protein was used. Neither inhibition nor activation was seen.

GAK itself incorporated ³² P-phosphate and this autophosphorylation was not affected by the addition of GST-cyclin G. These results suggest that the action of cyclin G on GAK is distinctly different from that of cyclin / CDK complex.

Although the GST-GAK fusion protein itself has kinase activity (lane 7), almost no activity remains in the immunoprecipitate (lanes 3, 6). Binding of anti-GAK antibody to the GST-GAK fusion protein appears to inhibit kinase activity (La
3, 6).

FIG. 8 schematically shows the state of GAK in a living body from the results of the above embodiments.

[0070]

As described above, GAK of the present invention is a related factor of cyclin G, and is useful for elucidating the biochemical regulation mechanism and physiological function of cyclin G. Is considered as a candidate for a link between apoptosis and the cell cycle. In this regard, GAK is a useful substance expected to be useful for cancer treatment and the like.

The anti-GAK antibody is useful for the measurement of GAK and the like, and can support the usefulness of the above-described GAK together with the cells producing the anti-GAK antibody.

[0072]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 4454 Sequence type: Nucleic acid Number of strands: Double-stranded Topology: Linear sequence GCGTCACGGC GCGGGCGGAA GATGGCCGGG TTGGTTGCCC GCAGCTGCTA ACCCGGCAGT 60 GCGGAGCTGG AGCCTGGCTC CCGCTGCCGC GAAGCGGCCG TCGCCTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CTG CCG CTG TTC CTG GCG GGC CCT GGT 150 Met Ser Leu Leu Gln Ser Ala Leu Asp Phe Leu Ala Gly Pro Gly 1 5 10 15 TCT CTT GGC GGA GCT GCC GGC CGT GAC CAG AGT GAC TTC GTG GGG 195 Ser Leu Gly Gly Ala Ala Gly Arg Asp Gln Ser Asp Phe Val Gly 20 25 30 CAG ACT GTG GAG CTG GGC GAG CTG CGT CTG CGG GTG CGG CGG GTC 240 Gln Thr Val Glu Leu Gly Glu Leu Arg Leu Arg Val Arg Arg Val 35 40 45 CTG GCC GAG GGA GGG TTT GCA TTT GTT TAT GAA GCT CAA GAT CTG 285 Leu Ala Glu Gly Gly Phe Ala Phe Val Tyr Glu Ala Gln Asp Leu 50 55 60 GGA AGT GGC AGA GAG TAT GCA TTA AAG AGA TTA CTA TCC AAT GAA 330 Gly Ser Gly Arg Glu Tyr Ala Leu Lys Arg Leu Leu Ser Asn Glu 65 70 75 GAG GAA AAG AAC AGA GCC ATC ATT CAG GAA GTA TGT TTC TTG AAA 375 Glu Glu Lys Asn A rg Ala Ile Ile Gln Glu Val Cys Phe Leu Lys 80 85 90 AAA CTT TCT GGC CAC CCC AAT ATT GTC CAG TTC TGC TCT GCA GCA 420 Lys Leu Ser Gly His Pro Asn Ile Val Gln Phe Cys Ser Ala Ala 95 100 105 TCC ATA GGA AAA GAG GAA TCG GAC ACT GGG CAG GCT GAG TTC CTC 465 Ser Ile Gly Lys Glu Glu Ser Asp Thr Gly Gln Ala Glu Phe Leu 110 115 120 CTG CTT ACG GAG CTC TGT AAA GGA CAG CTG GTG GAG TTT CTC AGG 510 Leu Leu Thr Glu Leu Cys Lys Gly Gln Leu Val Glu Phe Leu Arg 125 130 135 AGA GTT GAA TGT AAA GGC CCT CTA TCC TGC GAC AGC ATT CTG AAG 555 Arg Val Glu Cys Lys Gly Pro Leu Ser Cys Asp Ser Ile Leu Lys 140 145 150 ATC TTC TAC CAG ACA TGC AGA GCA GTG CAG CAC ATG CAC AGG CAG 600 Ile Phe Tyr Gln Thr Cys Arg Ala Val Gln His Met His Arg Gln 155 160 165 AAA CCA CCC ATC ATC CAC AGG GAT CTC AAG GTT GAA AAC TTA CTG 645 Lys Pro Pro Ile Ile His Arg Asp Leu Lys Val Glu Asn Leu Leu 170 175 180 CTT AGT AAC CAG GGG ACC ATT AAG CTG TGT GAC TTT GGC AGT GCC 690 Leu Ser Asn Gln Gly Thr Ile Lys Leu Cys Asp Phe Gly Ser Ala 185 190 1 95 ACA ACC ATC TCC CAT TAT CCT GAC TAC AGC TGG AGC GCC CAG AAG 735 Thr Thr Ile Ser His Tyr Pro Asp Tyr Ser Trp Ser Ala Gln Lys 200 205 210 CGA GCA ATG GTG GAG GAA GAG ATC ACG AGG AAC ACC ACA CCC ATG 780 Arg Ala Met Val Glu Glu Glu Ile Thr Arg Asn Thr Thr Pro Met 215 220 225 TAC AGA ACG CCA GAA ATT GTA GAC CTG TAT TCT AAC TTC CCT ATT 825 Tyr Arg Thr Pro Glu Ile Val Asp Leu Tyr Ser Asn Phe Pro Ile 230 235 240 GGC GAA AAG CAG GAT ATC TGG GCA CTG GGC TGT ATC TTA TAC CTG 870 Gly Glu Lys Gln Asp Ile Trp Ala Leu Gly Cys Ile Leu Tyr Leu 245 250 255 CTG TGT TTC CGG CAG CAT CCT TTT GAA GAT GGA GCA AAA CTT CGG 915 Leu Cys Phe Arg Gln His Pro Phe Glu Asp Gly Ala Lys Leu Arg 260 265 270 ATA GTC AAT GGG AAG TAT TCC ATT CCT GTG AAT GAC ACT CGT TAC 960 Ile Val Asn Gly Lys Tyr Ser Ile Pro Val Asn Asp Thr Arg Tyr 275 280 285 ACA GTC TTC CAT GAC CTT ATT CGT GGC ATG CTA AAG GTC AAT CCA 1005 Thr Val Phe His Asp Leu Ile Arg Gly Met Leu Lys Val Asn Pro 290 295 300 GAA GAG AGG CTA TCC ATT GCT GAA GTT GTC CGACAA CTG CAG GAA 1050 Glu Glu Arg Leu Ser Ile Ala Glu Val Val Arg Gln Leu Gln Glu 305 310 315 ATT GCA GCA GCC CGG AAT GTG AAC CCC AAA GCC CCC ATC ACA GAA 1095 Ile Ala Ala Ala Arg Asn Val Asn Pro Lys Ala Pro Ile Thr Glu 320 325 330 CTT CTG GAG CAG AAT GGT GGC TAT GGG AAC TCA GGG CCT TCC CGA 1140 Leu Leu Glu Gln Asn Gly Gly Tyr Gly Asn Ser Gly Pro Ser Arg 335 340 345 345 GCA CAA CCA CCT TCT GGG GGC CCT GTG AAC AGC AGT GGA GTT TTG 1185 Ala Gln Pro Pro Ser Gly Gly Pro Val Asn Ser Ser Gly Val Leu 350 355 360 GCT CTG GCA GAG TAT GAC CAG CCC TAT GGT GGG TTT CTC GAT ATC 1230 Ala Leu Ala Glu Tyr Asp Gln Pro Tyr Gly Gly Phe Leu Asp Ile 365 370 375 CTA CGG GGT GGG ACA GAA CGG CTC TTC ACC AAC CTC AAG GAT ACT 1275 Leu Arg Gly Gly Thr Glu Arg Leu Phe Thr Asn Leu Lys Asp Thr 380 385 390 TCC TCC AAG GTC ATC CAG TCT GTG GCT AAC TAT GCA AAG GGC GAT 1320 Ser Ser Lys Val Ile Gln Ser Val Ala Asn Tyr Ala Lys Gly Asp 395 400 405 CTT GAC ATA TCT TAC ATC ACA TCC AGG ATT GCA GTG ATG TCG TTC 1365 Leu Asp Ile Ser Tyr Ile Thr Ser Arg Ile Ala Val Met Ser Phe 410 415 420 CCA GCA GAA GGT GTG GAG TCA GCA ATC AAA AAC AAT ATA GAG GAT 1410 Pro Ala Glu Gly Val Glu Ser Ala Ile Lys Asn Asn Ile Glu Asp 425 430 435 435 GTA CGA TTG TTT CTG GAT GCC AAG CAT CCA GGA CAT TAT GCT GTC 1455 Val Arg Leu Phe Leu Asp Ala Lys His Pro Gly His Tyr Ala Val 440 445 450 TAC AAC CTT TCT CCA AGA ATA TAC CGG GCT TCC AAG TTC CAC AAT 1500 Tyr Asn Leu Ser Pro Arg Ile Tyr Arg Ala Ser Lys Phe His Asn 455 460 465 CGG GTC ACT GAG TGT GGC TGG GCA GTC AGG CGG GCA CCA CAT CTC 1545 Arg Val Thr Glu Cys Gly Trp Ala Val Arg Arg Ala Pro His Leu 470 475 480 CAC AGT TTG TAT ACT CTA TGC AGG AGC ATG CAT GCC TGG CTC CGG 1590 His Ser Leu Tyr Thr Leu Cys Arg Ser Met His Ala Trp Leu Arg 485 490 495 GAA GAC CAC AGG AAC GTC TGT GTT GTA CAT TGC ATG GAT GGG AGA 1635 Glu Asp His Arg Asn Val Cys Val Val His Cys Met Asp Gly Arg 500 505 510 GCT GCG TCT GCT GTG GCA GTC TGT GCA TTC CTG TGC TTC TGC CGT 1680 Ala Ala Ser Ala Val Ala Val Cys Ala Phe Leu Cys Phe Cys Arg 5 15 520 525 CTC TTC AGC ACT GCA GAG GCT GCT GTG TAC ATG TTC AGC ATG AAG 1725 Leu Phe Ser Thr Ala Glu Ala Ala Val Tyr Met Phe Ser Met Lys 530 535 540 CGC TGC CCA CCA GGC ATT TGG CCA TCC CAC AAA AGG TAC ATT GAA 1770 Arg Cys Pro Pro Gly Ile Trp Pro Ser His Lys Arg Tyr Ile Glu 545 550 555 TAC GTG TGT GAC ATG GTG GCA GAG GAA CCC ATC ACG CCC CAC AGC 1815 Tyr Val Cys Asp Met Val Ala Glu Glu Pro Ile Thr Pro His Ser 560 565 570 AAG CCA ATG CTG GTG AAA TCT GTT GTC ATG ACC CCT GTG CCA CTG 1860 Lys Pro Met Leu Val Lys Ser Val Val Met Thr Pro Val Pro Leu 575 580 585 TTC AGC AAG CAG AGG AAT GGC TGC CGA CCA TTC TGT GAG GTC TAT 1905 Phe Ser Lys Gln Arg Asn Gly Cys Arg Pro Phe Cys Glu Val Tyr 590 595 600 GTT GGG GAG GAG CGT GTA ACC ACC ACA TCC CAG GAG TAT GAC AGG 1950 Val Gly Glu Glu Arg Val Thr Thr Thr Ser Gln Glu Tyr Asp Arg 605 610 615 ATG AAG GAA TTT AAA ATT GAG GAT GGC AAG GCT GTC ATC CCC CTG 1995 Met Lys Glu Phe Lys Ile Glu Asp Gly Lys Ala Val Ile Pro Leu 620 625 630 GGC ATA ACA GTT CAA GGC GAT GT C CTC ACC ATC ATT TAC CAT GCC 2040 Gly Ile Thr Val Gln Gly Asp Val Leu Thr Ile Ile Tyr His Ala 635 640 645 AGA TCC ACT TTA GGA GGG AGA CTG CAG GCC AAG ATG GCG TCC ATG 2085 Arg Ser Thr Leu Gly Gly Arg Leu Gln Ala Lys Met Ala Ser Met 650 655 660 aaa AAA ATG TTC CAG ATT CAG TTC CAC ACT GGG TTC GTG CCT CGA AAC 2130 Lys Met Phe Gln Ile Gln Phe His Thr Gly Phe Val Pro Arg Asn 665 670 675 675 GCA ACC ACT GTG AAA TTT GCA AAG TAT GAC CTG GAT GCT TGT GAC 2175 Ala Thr Thr Val Lys Phe Ala Lys Tyr Asp Leu Asp Ala Cys Asp 680 685 690 ATT CAA GAG AAG TAC CCA GAT CTG TTC CAG GTG AAC CTG GAA GTG 2220 Ile Gln Glu Lys Tyr Pro Asp Leu Phe Gln Val Asn Leu Glu Val 695 700 705 GAG GTG GAG CCT AGA GAC AGG CCC AGC CGA GAC GTT CCA CCT TGG 2265 Glu Val Glu Pro Arg Asp Arg Pro Ser Arg Asp Val Pro Pro Trp 710 715 715 720 GAG AAT ACC AGC CTA AGG GGG TTA AAC CCC AAG ATC CTC TTT TCC 2310 Glu Asn Thr Ser Leu Arg Gly Leu Asn Pro Lys Ile Leu Phe Ser 725 730 735 AAC AGG GAA GAG CAA CAG GAC ATT CTG TCT AAG TTT GGG AAA CCA 2355 Asn Ar g Glu Glu Gln Gln Asp Ile Leu Ser Lys Phe Gly Lys Pro 740 745 750 GAG CTA CCC CGG CAG CCG GGC TCC ACA GCT CAG TAT GAT GCT GAG 2400 Glu Leu Pro Arg Gln Pro Gly Ser Thr Ala Gln Tyr Asp Ala Glu 755 760 765 GCA GGG TCT CCA GAG GCT GAG ATC ACA GAG TCG GAC TCA CCA CAG 2445 Ala Gly Ser Pro Glu Ala Glu Ile Thr Glu Ser Asp Ser Pro Gln 770 775 780 780 AGC AGC AGC ACG GAC ACC AAC CAC TTT CTT CAC ACA CTG GAT TGG 2490 Ser Ser Ser Thr Asp Thr Asn His Phe Leu His Thr Leu Asp Trp 785 790 795 CAG GAG GAA AAA GAC CCA GAG ACT GGT GTA GAC AAT ACC TCT CCT 2535 Gln Glu Glu Lys Asp Pro Glu Thr Gly Val Asp Asn Thr Ser Pro 800 805 810 AAG GAG AGT CAG TCT AAC CTG ATT GCA GAT GGA GAT GGA AGT GAA 2580 Lys Glu Ser Gln Ser Asn Leu Ile Ala Asp Gly Asp Gly Ser Glu 815 820 825 GTA TCA GAT GAA GAA GAG GCT TCA TGC CCT AGT GAA GAG AGA AAG 2625 Val Ser Asp Glu Glu Glu Ala Ser Cys Pro Ser Glu Glu Arg Lys 830 835 840 CCT GGG GCT GGA GAA GAT ACA CCA AGG CTG GCA GCT GGG ACC AGA 2670 Pro Gly Ala Gly Glu Asp Thr Pro Arg Leu Ala Al a Gly Thr Arg 845 850 855 CAG CAA GAC TTA ATA TTT GAT GTG GGC ATG CTG GCT GCC CCA CAG 2715 Gln Gln Asp Leu Ile Phe Asp Val Gly Met Leu Ala Ala Pro Gln 860 865 870 870 GAG CCT GTA CAG CCT GAA GAA GGT GTC GAT CTC CTG GGG CTG CAC 2760 Glu Pro Val Gln Pro Glu Glu Gly Val Asp Leu Leu Gly Leu His 875 880 885 TCT GAA GGG GAC TTA AGG CCT GCT GCT CCC TTG CAG GCT AGC GGG 2805 Ser Glu Gly Asp Leu Arg Pro Ala Ala Pro Leu Gln Ala Ser Gly 890 895 900 GTC CAG TCT AGC AAC ACT GAC CTG TTG AGC TCC CTT CTT GAA CCA 2850 Val Gln Ser Ser Asn Thr Asp Leu Leu Ser Ser Leu Leu Glu Pro 905 910 915 TCT GAT GCT TCT CAA GTG GGA CCT CCT GGT GAC CTG CTT GGT GGT 2895 Ser Asp Ala Ser Gln Val Gly Pro Pro Gly Asp Leu Leu Gly Gly 920 925 930 GAG ACT CCT CTG CTG TTA GCA AGC CCA GTT TCT CTT CTT GGG GTG 2940 Glu Thr Pro Leu Leu Leu Ala Ser Pro Val Ser Leu Leu Gly Val 935 940 945 CAG AGC AAC CTG CAA GGA AAA GTC CCT GAC ACT GTG GAC CCA TTT 2985 Gln Ser Asn Leu Gln Gly Lys Val Pro Asp Thr Val Val Asp Pro Phe 950 955 960 GAC CAG TTC CTG CTG CCA TCC AGC TCG GAC ACC CAG CCC TGC TCC 3030 Asp Gln Phe Leu Leu Pro Ser Ser Ser Asp Thr Gln Pro Cys Ser 965 970 975 AAG CCT GAT CTC TTT GGA GAG TTT CTC AAC TCT GAC TCT GTA GCT 3075 Lys Pro Asp Leu Phe Gly Glu Phe Leu Asn Ser Asp Ser Val Ala 980 985 990 TCC TCA ACT GCC TTC CCA TCG ACC CAC AGC GCC CCA CCC CCA TCC 3120 Ser Ser Thr Ala Phe Pro Ser Thr His Ser Ala Pro Pro Pro Ser 995 1000 1005 TGC AGC ACT GCC TTC CTG CAC CTG GGA GAT CTG CCA GCA GAG CCC 3165 Cys Ser Thr Ala Phe Leu His Leu Gly Asp Leu Pro Ala Glu Pro 1010 1015 1020 AAC AAG GTG ATT GCT TCA TCC AGC CAC CCA GAT CTG CTA GGA GGA 3210 Asn Lys Val Ile Ala Ser Ser Ser His Pro Asp Leu Leu Gly Gly 1025 1030 1035 TGG GAT ACG TGG GCT GAG ACT GCT CTA CCT GGG CCG GCC TCC ATG 3255 Trp Asp Thr Trp Ala Glu Thr Ala Leu Pro Gly Pro Ala Ser Met 1040 1045 1050 CCA GTA CCA GAA GGT ACT CTC TTC TCT TCT GCA GGT CAC CCA GCC 3300 Pro Val Pro Glu Gly Thr Leu Phe Ser Ser Ala Gly His Pro Ala 1055 1060 1065 CCT CCA GGC CCC AAC CCC AGC CAA ACC AAG TC T CAG AAC CCA GAC 3345 Pro Pro Gly Pro Asn Pro Ser Gln Thr Lys Ser Gln Asn Pro Asp 1070 1075 1080 CCA TTT GCT GAC CTC AGT GAT CTC AGC TCT AGC CTC CAA GGC TTG 3390 Pro Phe Ala Asp Leu Ser Asp Leu Ser Ser Ser Leu Gln Gly Leu 1085 1090 1095 CCT GCT GGA CTT CCT GCA GGG AGC TTC GTT GGC ACA TCA GCC ACC 3435 Pro Ala Gly Leu Pro Ala Gly Ser Phe Val Gly Thr Ser Ala Thr 1100 1105 1110 ACT CAC AAA AGC AAC AGC TCC TGG CAG ACA ACT CGT CCC ACA GCC 3480 Thr His Lys Ser Asn Ser Ser Trp Gln Thr Thr Arg Pro Thr Ala 1115 1120 1125 CCT GGA ACC TCA TGG CCC CCG CAG GCC AAG CCA GCC CCC AGA GCC 3525 Pro Gly Thr Ser Trp Pro Pro Gln Ala Lys Pro Ala Pro Arg Ala 1130 1135 1140 TCT GAA CAA CTA AGG TCT CAC TTT AGT GTG ATT GGG GCC CGA GAA 3570 Ser Glu Gln Leu Arg Ser His Phe Ser Val Ile Gly Ala Arg Glu 1145 1150 1155 GAG AGA GGT GTC CGT GCG CCC AGC TTT GCC CAA AAG CCA AAG GTC 3615 Glu Arg Gly Val Arg Ala Pro Ser Phe Ala Gln Lys Pro Lys Val 1160 1165 1170 TCA GAA AAT GAT TTT GAA GAT CTG CTG CCT AAT CAA GGC TTC TCT 36 60 Ser Glu Asn Asp Phe Glu Asp Leu Leu Pro Asn Gln Gly Phe Ser 1175 1180 1185 AAG TCT GAC AAG AAG GGG CCA AAG ACC ATG GCA GAG ATG CGG AAA 3705 Lys Ser Asp Lys Lys Gly Pro Lys Thr Met Ala Glu Met Arg Lys 1190 1195 1200 CAG GAA CTT GCC AGA GAT ACA GAC CCA TTC AAA TTG AAG CTT TTG 3750 Gln Glu Leu Ala Arg Asp Thr Asp Pro Phe Lys Leu Lys Leu Leu 1205 1210 1215 GAC TGG ATT GAA GGC AAA GAG AGG AAT ATT CGT GCA CTG CTG TCC 3795 Asp Trp Ile Glu Gly Lys Glu Arg Asn Ile Arg Ala Leu Leu Ser 1220 1225 1230 ACT CTG CAC ACA GTA TTG TGG GAT GGG GAG AGC CGC TGG ACA CCT 3840 Thr Leu His Thr Val Leu Trp Asp Gly Glu Ser Arg Trp Thr Pro 1235 1240 1245 GTG AGT ATG GCT GAC CTG GTG ACT CCA GAG CAG GTG AAG AAG CAG 3885 Val Ser Met Ala Asp Leu Val Thr Pro Glu Gln Val Lys Lys Gln 1250 1255 1260 TAC CGC CGT GCA GTG CTG GTA GTG CAT CCT GAT AAG GCC ACA GGG 3930 Tyr Arg Arg Ala Val Leu Val Val His Pro Asp Lys Ala Thr Gly 1265 1270 1275 CAG CCA TAT GAA CAG TCT GCC AAG ATG ATC TTC ATG GAG CTG AAT 3975 Gln Pro Tyr Glu G ln Ser Ala Lys Met Ile Phe Met Glu Leu Asn 1280 1285 1290 GAT GCA TGG TCT GAG TTT GAA AAC CAG GGC TCA AGG CCC CTC TTC 4020 Asp Ala Trp Ser Glu Phe Glu Asn Gln Gly Ser Arg Pro Leu Phe 1295 1300 1305 TGA 4023 * GGCCTGTGAT GACTATGGCT GCAGGAGCTG CTCATGAATC CTGAATGCTG CTGGCCTGAC 4083 TGAGGCACAA ATGGGACCAT AACAGGTGTG GCAGGTGATA TCGCCCCAGG GGCCTGGACC 4143 ATCTACTCCC AATCATCCCT GCATTCATCA TGGACAAATA CCATTCCATG GCTGGGAGAG 4203 AAAGCATTCC TCAGATCTGA TATTTGTTGT TTTGTTTTTC TTTTTCTTGT CCCAGAGGAA 4263 AAGTGTTGAT TTATATTCCT TCCACAGCTG TCACAATTTG TGATTTACTT GGTGTCTGGT 4323 GGCTGTCACC TCTTGAATGG CACATGTCGC TGGCACTTCT CTCCTGTAAT TTCTTCAAAT 4383 ATGGGGTGCA TCCACACCCC ACTCTGATAA GTTTGCCAAT CATCTGTACA TAATTAAACT 4443 ATTTTCCGAT G 4454

SEQ ID NO: 2 Sequence length: 4331 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear sequence ATG TCG CTG CTG CAG TCT GCG CTC GAC TTC TTG GCG GGT CCA GGC 45 Met Ser Leu Leu Gln Ser Ala Leu Asp Phe Leu Ala Gly Phe Gly 1 5 10 15 TCC CTG GGC GGT GCT TCC GGC CGC GAC CAG AGT GAC TTC GTG GGG 90 Ser Leu Gly Gly Ala Ser Gly Arg Asp Gln Ser Asp Phe Val Gly 20 25 30 CAG ACG GTG GAA CTG GGC GAG CTG CGG CTG CGG GTG CGG CGG GTC 135 Gln Thr Val Glu Leu Gly Glu Leu Arg Leu Arg Val Arg Arg Val 35 40 45 CTG GCC GAA GGA GGG TTT GCA TTT GTG TAT GAA GCT CAA GAT GTG 180 Leu Ala Glu Gly Gly Phe Ala Phe Val Tyr Glu Ala Gln Asp Val 50 55 60 GGG AGT GGC AGA GAG TAT GCA TTA AAG AGG CTA TTA TCC AAT GAA 225 Gly Ser Gly Arg Glu Tyr Ala Leu Lys Arg Leu Leu Ser Asn Glu 65 70 75 GAG GAA AAG AAC AGA GCC ATC ATT CAA GAA GTT TGC TTC ATG AAA 270 Glu Glu Lys Asn Arg Ala Ile Ile Gln Glu Val Cys Phe Met Lys 80 85 90 AAG CTT TCC GGC CAC CCG AAC ATT GTC CAG TTT TGT TCT GCAGCG 315 Lys Leu Ser Gly His Phe Asn Ile Val Gln Phe Cys Ser Ala Ala 95 100 105 TCT ATA GGA AAA GAG GAG TCA GAC ACG GGG CAG GCT GAG TTC CTC 360 Ser Ile Gly Lys Glu Glu Ser Asp Thr Gly Gln Ala Glu Phe Leu 110 115 120 TTG CTC ACA GAG CTC TGT AAA GGG CAG CTG GTG GAA TTT TTG AAG 405 Leu Leu Thr Glu Leu Cys Lys Gly Gln Leu Val Glu Phe Leu Lys 125 130 135 AAA ATG GAA TCT CGA GGC CCC CTT TCG TGC GAC ACG GTT CTG AAG 450 Lys Met Glu Ser Arg Gly Phe Leu Ser Cys Asp Thr Val Leu Lys 140 145 150 ATC TTC TAC CAG ACG TGC CGC GCC GTG CAG CAC ATG CAC CGG CAG 495 Ile Phe Tyr Gln Thr Cys Arg Ala Val Gln His Met His Arg Gln 155 160 165 AAG CCG CCC ATC ATC CAC AGG GAC CTC AAG GTT GAG AAC TTG TTG 540 Lys Phe Phe Ile Ile His Arg Asp Leu Lys Val Glu Asn Leu Leu 170 175 180 CTT AGT AAC CAA GGG ACC ATT AAG CTG TGT GAC TTT GGC AGT GCC 585 Leu Ser Asn Gln Gly Thr Ile Lys Leu Cys Asp Phe Gly Ser Ala 185 190 195 ACG ACC ATC TCG CAC TAC CCT GAC TAC AGC TGG AGC GCC CAG AGG 630 Thr Thr Ile Ser His Tyr Phe Asp Tyr Ser T rp Ser Ala Gln Arg 200 205 210 CGA GCC CTG GTG GAG GAA GAG ATC ACG AGG AAT ACA ACA CCA ATG 675 Arg Ala Leu Val Glu Glu Glu Glu Ile Thr Arg Asn Thr Thr Phe Met 215 220 225 TAT AGA ACA CCA GAA ATC ATA GAC TTG TAT TCC AAC TTC CCG ATC 720 Tyr Arg Thr Phe Glu Ile Ile Asp Leu Tyr Ser Asn Phe Phe Ile 230 235 240 GGC GAG AAG CAG GAT ATC TGG GCC CTG GGC TGC ATC TTG TAC CTG 765 Gly Glu Lys Gln Asp Ile Trp Ala Leu Gly Cys Ile Leu Tyr Leu 245 250 255 CTG TGC TTC CGG CAG CAC CCT TTT GAG GAT GGA GCG AAA CTT CGA 810 Leu Cys Phe Arg Gln His Phe Phe Glu Asp Gly Ala Lys Leu Arg 260 265 270 ATA GTC AAT GGG AAG TAC TCG ATC CCC CCG CAC GAC ACG CAG TAC 855 Ile Val Asn Gly Lys Tyr Ser Ile Phe Phe His Asp Thr Gln Tyr 275 280 285 ACG GTC TTC CAC AGC CTC ATC CGC GCC ATG CTG CAG GTG AAC CCG 900 Thr Val Phe His Ser Leu Ile Arg Ala Met Leu Gln Val Asn Phe 290 295 300 GAG GAG CGG CTG TCC ATC GCC GAG GTG GTG CAC CAG CTG CAG GAG 945 Glu Glu Arg Leu Ser Ile Ala Glu Val Val His Gln Leu Gln Glu 305 310 315 ATC GCG GCC GCC C GC AAC GTG AAC CCC AAG TCT CCC ATC ACA GAG 990 Ile Ala Ala Ala Arg Asn Val Asn Phe Lys Ser Phe Ile Thr Glu 320 325 330 CTC CTG GAG CAG AAT GGA GGC TAC GGG AGC GCC ACA CTG TCC CGA 1035 Leu Leu Glu Gln Asn Gly Gly Tyr Gly Ser Ala Thr Leu Ser Arg 335 340 345 GGG CCA CCC CCT CCC GTG GGC CCC GCT GGC AGT GGC TAC AGT GGA 1080 Gly Phe Phe Phe Phe Phe Val Gly Phe Ala Gly Ser Gly Tyr Ser Gly 350 355 360 GGC CTG GCG CTG GCG GAG TAC GAC CAG CCG TAT GGC GGC TTC CTG 1125 Gly Leu Ala Leu Ala Glu Tyr Asp Gln Phe Tyr Gly Gly Phe Leu 365 370 375 GAC ATT CTG CGG GGT GGG ACA GAG CGG CTC TTC ACC AAC CTC AAG 1170 Asp Leu Arg Gly Gly Thr Glu Arg Leu Phe Thr Asn Leu Lys 380 385 390 GAC ACC TCC TCC AAG GTC ATC CAG TCC GTC GCT AAT TAT GCA AAG 1215 Asp Thr Ser Ser Lys Val Ile Gln Ser Val Ala Asn Tyr Ala Lys 395 400 405 GGT GAC CTG GAC ATA TCT TAC ATC ACA TCC AGA ATT GCA GTG ATG 1260 Gly Asp Leu Asp Ile Ser Tyr Ile Thr Ser Arg Ile Ala Val Met 410 415 420 TCA TTC CCA GCA GAA GGT GTG GAG TCA GCG CTC AAA AAC AAC AT C 1305 Ser Phe Phe Ala Glu Gly Val Glu Ser Ala Leu Lys Asn Asn Ile 425 430 435 GAA GAT GTG CGG TTG TTC CTG GAC TCC AAG CAC CCA GGG CAC TAT 1350 Glu Asp Val Arg Leu Phe Leu Asp Ser Lys His Phe Gly His Tyr 440 445 450 GCC GTC TAC AAC CTG TCC CCG AGG ACC TAC CGG CCC TCC AGG TTC 1395 Ala Val Tyr Asn Leu Ser Phe Arg Thr Tyr Arg Phe Ser Arg Phe 455 460 465 CAC AAC CGG GTC TCC GAG TGT GGC TGG GCA GCA CGG CGG GCC CCA 1440 His Asn Arg Val Ser Glu Cys Gly Trp Ala Ala Arg Arg Ala Phe 470 475 480 CAC CTG CAC ACC CTG TAC AAC ATC TGC AGG AAC ATG CAC GCC TGG 1485 His Leu His Thr Leu Tyr Asn Ile Cys Arg Asn Met His Ala Trp 485 490 495 CTG CGG CAG GAC CAC AAG AAC GTC TGC GTC GTG CAC TGC ATG GAC 1530 Leu Arg Gln Asp His Lys Asn Val Cys Val Val His Cys Met Asp 500 505 510 GGG AGA GCC GCG TCT GCT GTG GCC GTC TGC TCC TTC CTG TGC TTC 1575 Gly Arg Ala Ala Ser Ala Val Ala Val Cys Ser Phe Leu Cys Phe 515 520 525 TGC CGT CTC TTC AGC ACC GCG GAG GCC GCC GTG TAC ATG TTC AGC 1620 Cys Arg Leu Phe Ser Thr Ala Glu Al a Ala Val Tyr Met Phe Ser 530 535 540 ATG AAG CGC TGC CCA CCA GGC ATC TGG CCA TCC CAC AAA AGG TAC 1665 Met Lys Arg Cys Phe Phe Gly Ile Trp Phe Ser His Lys Arg Tyr 545 550 555 ATC GAG TAC ATG TGT GAC ATG GTG GCG GAG GAG CCC ATC ACA CCC 1710 Ile Glu Tyr Met Cys Asp Met Val Ala Glu Glu Phe Ile Thr Phe 560 565 570 CAC AGC AAG CCC ATC CTG GTG AGG GCC GTG GTC ATG ACA CCC GTG 1755 His Ser Lys Phe Ile Leu Val Arg Ala Val Val Met Thr Phe Val 575 580 585 CCG CTG TTC AGC AAG CAG AGG AGC GGC TGC AGG CCC TTC TGC GAG 1800 Phe Leu Phe Ser Lys Gln Arg Ser Gly Cys Arg Phe Phe Cys Glu 590 595 600 GTC TAC GTG GGG GAC GAG CGT GTG GCC AGC ACC TCC CAG GAG TAC 1845 Val Tyr Val Gly Asp Glu Arg Val Ala Ser Thr Ser Gln Glu Tyr 605 610 615 615 GAC AAG ATG CGG GAC TTT AAG ATT GAA GAT GGC AAA GCG GTG ATT 1890 Asp Lys Met Arg Asp Phe Lys Ile Glu Asp Gly Lys Ala Val Ile 620 625 630 CCC CTG GGC GTC ACG GTG CAA GGA GAC GTG CTC ATC GTC ATC TAT 1935 Phe Leu Gly Val Thr Val Gln Gly Asp Val Leu Ile Val Ile Tyr 635 640 645 CAC GCC CGG TCC ACT CTG GGC GGC CGG CTG CAG GCC AAG ATG GCA 1980 His Ala Arg Ser Thr Leu Gly Gly Arg Leu Gln Ala Lys Met Ala 650 655 655 660 TCC ATG AAG ATG TTC CAG ATT CAG TTC CAC ACG GGG TTT GTG CCT 2025 Ser Met Lys Met Phe Gln Ile Gln Phe His Thr Gly Phe Val Phe 665 670 675 CGG AAC GCC ACC ACT GTG AAA TTT GCC AAG TAT GAC CTG GAC GCG 2070 Arg Asn Ala Thr Thr Val Lys Phe Ala Lys Tyr Asp Leu Asp Ala 680 685 690 TGT GAC ATT CAA GAA AAA TAC CCG GAT TTA TTT CAA GTG AAC CTG 2115 Cys Asp Ile Gln Glu Lys Tyr Phe Asp Leu Phe Gln Val Asn Leu 695 700 705 GAA GTG GAG GTG GAG CCC AGG GAC AGG CCG AGC CGG GAA GCCCA 2160 Glu Val Glu Val Glu Phe Arg Asp Arg Phe Ser Arg Glu Ala Phe 710 715 720 CCA TGG GAG AAC TCG AGC ATG AGG GGG CTG AAC CCC AAA ATC CTG 2205 Phe Trp Glu Asn Ser Ser Met Arg Gly Leu Asn Phe Lys Ile Leu 725 730 735 TTT TCC AGC CGG GAG GAG CAG CAA GAC ATT CTG TCT AAG TTT GGG 2250 Phe Ser Ser Arg Glu Glu Gln Gln Asp Ile Leu Ser Lys Phe Gly 740 745 750 AAG CCG GAG CTT CCC CGG CAG CCT GGC TCC ACG GCT CAG TAT GAT 2295 Lys Phe Glu Leu Phe Arg Gln Phe Gly Ser Thr Ala Gln Tyr Asp 755 760 765 GCT GGG GCA GGG TCC CCG GAA GCC GAA CCC ACA GAC TCT GAC TCA 2340 Ala Gly Ala Gly Ser Phe Glu Ala Glu Phe Thr Asp Ser Asp Ser 770 775 780 CCG CCA AGC AGC AGC GCG GAC GCC AGT CGC TTC CTG CAC ACG CTG 2385 Phe Phe Ser Ser Ser Ala Asp Ala Ser Arg Phe Leu His Thr Leu 785 790 795 GAC TGG CAG GAA GAG AAG GAG GCA GAG ACT GGT GCA GAA AAT GCC 2430 Asp Trp Gln Glu Glu Lys Glu Ala Glu Thr Gly Ala Glu Asn Ala 800 805 810 TCT TCC AAG GAG AGC GAG TCT GCC CTG ATG GAG GAC AGA GAC GAG 2475 Ser Ser Lys Glu Ser Glu Ser Ala Leu Met Glu Asp Arg Asp Glu 815 820 825 AGT GAG GTG TCA GAT GAA GGG GGA TCC CCG ATC TCC AGC GAG GGC 2520 Ser Glu Val Ser Asp Glu Gly Gly Ser Phe Ile Ser Ser Glu Gly 830 835 840 CAG GAA CCC AGG GCC GAC CCA GAG CCC CCC GGC CTG GCA GCA GGG 2565 Gln Glu Phe Arg Ala Asp Phe Glu Phe Phe Gly Leu Ala Ala Gly 845 850 855 CTG GTG CAG CAG GAC TTG GTT TTT GAG GTG GAG ACA CCG GCT GTG 2610 Leu Val Gln Gln Asp Leu Val Phe Glu Val Glu Thr Phe Ala Val 860 865 870 CTG CCA GAG CCT GTG CCA CAG GAA GAC GGG GTC GAC CTC CTG GGC 2655 Leu Phe Glu Phe Val Phe Gln Glu Asp Gly Val Asp Leu Leu Gly 875 880 885 885 CTG CAC TCC GAG GTG GGC GCA GGG CCA GCT GTA CCC CCG CAG GCC 2700 Leu His Ser Glu Val Gly Ala Gly Phe Ala Val Phe Phe Gln Ala 890 895 900 TGC AAG GCC CCC TCC AGC AAC ACC GAC CTG CTC AGC TGC CTC CTT 2745 Cys Lys Ala Phe Ser Ser Asn Thr Asp Leu Leu Ser Cys Leu Leu 905 910 915 GGG CCC CCT GAG GCC GCC TCC CAG GGG CCC CCG GAG GAT CTG CTC 2790 Gly Phe Phe Glu Ala Ala Ser Gln Gly Phe Phe Glu Asp Leu Leu 920 925 930 AGC GAG GAC CCG CTG CTC CTG GCA AGC CCG GCC CCT CCC CTG AGC 2835 Ser Glu Asp Phe Leu Leu Leu Ala Ser Phe Ala Phe Phe Leu Ser 935 940 945 GTG CAG AGC ACC CCA AGA GGA GGG CCC CCT GCC GCT GCT GAC CCC 2880 Val Gln Ser Thr Phe Arg Gly Gly Phe Phe Ala Ala Ala Asp Phe 950 955 960 TTT GGC CCG CTT CTG CCG TCT TCA GGC AAC AAC TCC CAG CCC TGC 2925 Phe Gly Phe Leu Leu Phe Ser Ser Gly Asn Asn Ser Gln Phe Cys 9 65 970 975 TCC AAT CCT GAT CTC TTC GGC GAA TTT CTC AAT TCG GAC TCT GTG 2970 Ser Asn Phe Asp Leu Phe Gly Glu Phe Leu Asn Ser Asp Ser Val 980 985 990 ACC GTC CCA CCA TCC TTC CCG TCT GCC CAC AGC GCT CCG CCC CCA 3015 Thr Val Phe Phe Ser Phe Phe Ser Ala His Ser Ala Phe Phe Phe 995 1000 1005 TCC TGC AGC GCC GAC TTC CTG CAC CTG GGG GAT CTG CCA GGA GAG 3060 Ser Cys Ser Ala Asp Phe Leu His Leu Gly Asp Leu Phe Gly Glu 1010 1015 1020 CCC AGC AAG ATG ACA GCC TCG TCC AGC AAC CCA GAC CTG CTG GGA 3105 Phe Ser Lys Met Thr Ala Ser Ser Ser Asn Phe Asp Leu Leu Gly 1025 1030 1035 GGA TGG GCT GCC TGG ACC GAG ACT GCA GCG TCG GCA GTG GCC CCC 3150 Gly Trp Ala Ala Trp Thr Glu Thr Ala Ala Ser Ala Val Ala Phe 1040 1045 1050 ACG CCA GCC ACA GAA GGC CCC CTC TTC TCT CCT GGA GGT CAG CCG 3195 Thr Phe Ala Thr Glu Gly Phe Leu Phe Ser Phe Gly Gly Gln Phe 1055 1060 1065 GCC CCT TGT GGC TCT CAG GCC AGC TGG ACC AAG TCT CAG AAC CCG 3240 Ala Phe Cys Gly Ser Gln Ala Ser Trp Thr Lys Ser Gln Asn Phe 1070 1075 1080 GAC CCA TTT G CT GAC CTT GGC GAC CTC AGC TCC GGC CTC CAA GGC 3285 Asp Phe Phe Ala Asp Leu Gly Asp Leu Ser Ser Gly Leu Gln Gly 1085 1090 1095 TCA CCA GCT GGA TTT CCT CCT GGG GGC TTC ATT CCC AAA ACG GCC 3330 Ser Phe Ala Gly Phe Phe Phe Gly Gly Phe Ile Phe Lys Thr Ala 1100 1105 1110 ACC ACG GCC AAA GGC AGC AGC TCC TGG CAG ACA AGT CGG CCG CCA 3375 Thr Thr Ala Lys Gly Ser Ser Ser Trp Gln Thr Ser Arg Phe Phe 1115 1120 1125 GCC CAG GGC GCC TCA TGG CCC CCT CAG GCC AAG CCG CCC CCC AAA 3420 Ala Gln Gly Ala Ser Trp Phe Phe Gln Ala Lys Phe Phe Phe Lys 1130 1135 1140 GCC TGC ACA CAG CCA AGG CCT AAC TAT GCC TCG AAC TTC AGT GTG 3465 A Cys Thr Gln Phe Arg Phe Asn Tyr Ala Ser Asn Phe Ser Val 1145 1150 1155 ATC GGG GCG CGG GAG GAG CGG GGG GTC CGC GCA CCC AGC TTT GCT 3510 Ile Gly Ala Arg Glu Glu Arg Gly Val Arg Ala Phe Ser Phe Ala 1160 1165 1170 CAA AAG CCA AAA GTC TCT GAG AAC GAC TTT GAA GAT CTG TTG TCC 3555 Gln Lys Phe Lys Val Ser Glu Asn Asp Phe Glu Asp Leu Leu Ser 1175 1180 1185 AAT CAA GGC TTC TCC TCC AGG TCT GAC AAG AAA GGG CCA AAG ACC 3600 Asn Gln Gly Phe Ser Ser Arg Ser Asp Lys Lys Gly Phe Lys Thr 1190 1195 1200 ATT GCA GAG ATG AGG AAG CAG GAC CTG GCT AAA GAC ACG GAC CCA 3645 Ile Ala Glu Met Arg Lys Gln Asp Leu Ala Lys Asp Thr Asp Phe 1205 1210 1215 CTC AAG CTG AAG CTC CTG GAC TGG ATT GAG GGC AAG GAG CGG AAC 3690 Leu Lys Leu Lys Leu Leu Asp Trp Ile Glu Gly Lys Glu Arg Asn 1220 1225 1230 ATC CGG GCC CTG CTG CTG ACG CTG CAC ACA GTG CTG TGG GAC GGG 3735 Ile Arg Ala Leu Leu Ser Thr Leu His Thr Val Leu Trp Asp Gly 1235 1240 1245 GAG AGC CGC TGG ACG CCC GTG GGC ATG GCC GAC CTG GTG GCT CCG 3780 Glu Ser Arg Trp Thr Phe Val Gly Met Ala Asp Leu Val Ala Phe 1250 1255 1260 GAG CAA GTG AAG AAG CAC TAT CGC CGC GCG GTG CTG GCC GTG CAC 3825 Glu Gln Val Lys Lys His Tyr Arg Arg Ala Val Leu Ala Val His 1265 1270 1275 CCC GAC AAG GCT GCG GGG CAG CCG TAC GAG CAG CAC GCC AAG ATG 3870 Phe Asp Lys Ala Ala Gly Gln Phe Tyr Glu Gln His Ala Lys Met 1280 1285 1290 ATC TTC ATG GAG CTG AAT GAC GCC TGG TCG GAG TTT GAG AAC CAG 3915 Ile Phe Met Glu Leu Asn Asp Ala Trp Ser Glu Phe Glu Asn Gln 1295 1300 1305 GGC TCC CGG CCC CTC TTC TGA 3936 Gly Ser Arg Phe Leu Phe * 1310 GGCCGCAG TGCACACAGC TCGCGGCGCCGCGCGTGCGGTCGGCGCC 4056 CCCGGGTCAC CGCCCGCCCA GCGTTCCAGG CACATGAAGA GAAAGCATTC CAAAGCCTCT 4116 GATTGTTGTT TCCTTTTTCT CCTCCCGAAG GAACAGCTGA TTCATGCTCC TCCCGCAATT 4176 GTCACGTCTG TGATTTATTT GGTGTTTCGG GCGTGGCCTC TGGAGCCCCG GCACGTGGTG 4236 GGCCACGCTG CTGGCGCTCA TGGGCCCTGG TGTTTGCACC GCACTTTGTA ATCAGTCCCG 4296 TGGTTGTCTG TACAGAATTA AACTATTTTC CGATG 4331

SEQ ID NO: 3 Sequence length: 204 Sequence type: Nucleic acid Topology: Linear sequence AGCTTGAGCT CGGACCTAGG CCCAATTGGC CGACGTCATG AGATCTTAAG GCGCGCCAAG 60 GGGACTCGAG CCTGGATCCG GGTTAACCGG CTGCAGTACT CTAGAATTCC GCGCGGCCATTGCCCCTCGATCCGCCTCGATCCGCCTCGATCCGCCTCGATCCGCCTCGATCCGCCTCGATCCGCCTCGATCCGCCTCGATCCC

[Brief description of the drawings]

Fig. 1. Rat GAK and auxilin (Auxili
n) is a schematic diagram showing the structure of Tensin.

FIG. 2 shows the partial amino acid sequence of GAK (amino acid sequence Nos. 36 to 409) and Nek1, CDK2, Plk, and T
It is explanatory drawing showing the similarity with sk-1.

FIG. 3 is an explanatory diagram showing the similarity between the partial amino acid sequence of GAK (amino acid sequence Nos. 369 to 1305) and auxillin and tensin.

FIG. 4 is a photograph substituted for a drawing, showing the results of immunoprecipitation-Western blot in an in vitro association test between GAK and cyclin G.

FIG. 5 is a photograph substituted for a drawing, showing the result of immunoprecipitation-Western blot in the in vitro test for the association between GAK and cyclin G.

FIG. 6: CDK5 in vivo and cyclin G, G
It is a drawing substitute photograph which shows the relationship of AK.

FIG. 7 is a drawing-substitute photograph showing the measurement results of kinase activity.

FIG. 8 is a schematic view of GAK in a living body.

──────────────────────────────────────────────────続 き Continuing on the front page (51) Int.Cl. ⁶ Identification symbol FI (C12P 21/08 C12R 1:91) (72) Inventor Shinya Kimura 3-1 Yamadaoka, Suita-shi, Osaka Pref. Inside the research institute (72) Inventor Masako Ikeda Ina City, Nagano Pref.

Claims (11)

[Claims] 1. A novel protein kinase GAK that is a related factor of cyclin G, which contains a serine / threonine kinase domain, a leucine zipper and a tensin / auxin-like domain, and is also a related factor of CDK5. 2. The protein kinase GAK according to claim 1, comprising the amino acid sequence of SEQ ID NO: 1 in the sequence listing, or an amino acid sequence in which one or more amino acids have been inserted, deleted or substituted in the amino acid sequence. . 3. The protein kinase GA according to claim 2,
D comprising a base sequence encoding the amino acid sequence of K
NA sequence. 4. The DNA sequence according to claim 3, which comprises the nucleotide sequence of base numbers 106 to 4020 of SEQ ID NO: 1 in the sequence listing. 5. The protein kinase GAK according to claim 1, comprising the amino acid sequence of SEQ ID NO: 2 in the sequence listing, or the amino acid sequence in which one or more amino acids are inserted, deleted or substituted in the amino acid sequence. . 6. The protein kinase GA according to claim 5,
D comprising a base sequence encoding the amino acid sequence of K
NA sequence. 7. The DNA sequence according to claim 6, which comprises the nucleotide sequence of nucleotide numbers 1 to 3933 of SEQ ID NO: 2 in the sequence listing. 8. An anti-GAK antibody which specifically reacts with GAK according to claim 1. 9. A production cell that produces the anti-GAK antibody according to claim 8. 10. A production cell according to claim 9, which is a fusion cell of an antibody-producing cell obtained from a mammal immunized with GAK according to claim 1 and a mammalian myeloid cell. cell. 11. The production cell according to claim 9 or 10, wherein the accession number is FERM P-15843, FERM.
P-15844, FERM P-15845, FERM
P-15846, a producer cell that is FERM P-15847.