JPH10215897A - Detection of mutant cell by chromosomal reciprocal translocation, probe kit for the same detection and detector therefor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To simply and rapidly detect a fused mRNA based on the subject mutant cell participating in hematopoietic tumor for each type by measuring each fluorescent spectrum of specific two kinds of probes as one set and the fluorescent spectrum of a hybridized substance of the probes with the fused mRNA. SOLUTION: When an mRNA in which a 5' splice part derived from an AML1 and a 3' splice part derived from an MTG8 gene is detected, etc., either one of specific two kinds of probes as one set hybridizable continuously to a 5' splice part and a 3' splice part sandwiching a fused point therebetween is labeled with an energy donor fluorescent coloring matter D and the other is labeled with an energy acceptor fluorescent coloring matter A. Each fluorescent spectrum fD of the probes and the fluorescent spectrum fA of a hybridized substance of the probes with the fused mRNA are measured to carry out the wave form analysis.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for detecting a mutant cell by reciprocal translocation of chromosomes, a probe kit for the detection thereof, and an apparatus for detecting the same.

[0002]

2. Description of the Related Art Hematopoietic tumors differ in time until onset,
It is known that there are several types depending on the type of hematopoietic organ in which a tumor develops. Since the symptoms and the timing of onset differ depending on these types, it is considered important in treatment to determine the selection of a therapeutic agent and the timing of administration in accordance with this type. Also,
Since the hematopoietic tumor is a collection of various disease states, it is difficult to determine the type of the disease only from its symptoms, and a determination method using some biochemical index or gene marker is required. It has been. For example, although it is not sufficient for the above purpose, observation of the appearance of an abnormal chromosome called Philadelphia chromosome caused by reciprocal translocation between chromosome 9 and chromosome 22 is often used to determine the type of leukemia. That's the way you are.

[0003] On the other hand, it has been strongly suggested that the onset of hematopoietic tumors is caused by a fusion gene due to reciprocal translocation of chromosomes. Based on this finding, RT-PCR, FISH, etc. The type of organ tumor has been identified. However, these RT-PCR methods and F
The ISH method is an excellent method in terms of sensitivity, but has a problem in that a long detection time is required and the detection operation is complicated. In the RT-PCR method, an appropriate primer is designed to recognize a gene to be fused by chromosomal translocation, and the gene is amplified using the primer. However, once the RNA is reverse-transcribed from mRNA to cDNA. Therefore, there is also a problem that a complicated operation of requiring four types of primers is required. In addition, there is a problem about the possibility of an error due to mismatch in the amplification process. Furthermore, the FISH method requires skill in operation, and there is a problem in simply, quickly and accurately testing a large number of samples.

[0004]

SUMMARY OF THE INVENTION In view of the above-mentioned problems of the prior art, the present inventors have developed a mutant cell having a mutant gene fused by chromosomal translocation in order to detect a mutant cell due to chromosomal translocation. Fusion mRNA based on
For each type, the detection is simple and quick, and the fusion mRN
The present inventors have found a method for detecting the mutant cells based on the determination of the presence of A, and have completed the present invention. Furthermore, they succeeded in developing a probe kit that can be used for the detection method and a detection device therefor.

[0005]

SUMMARY OF THE INVENTION The present invention relates to a method for detecting mutant cells due to chromosomal translocation, a probe kit usable for the detection method, and a detection device.

[0006] In the present invention, a mutant gene is a gene formed by mutual translocation of chromosomes. For example, a part of a gene of type A and a part of a gene of type B, for example, have a certain length. It is obtained by fusing via a DNA having an appropriate base sequence. Further, in the present invention, fusion m
RNA is a mature mRNA formed by splicing or the like based on the mutated gene,
And B-derived portions (for example, 5 ′ or 3 ′ splice portions, respectively) are directly and continuously bonded (the position where the splice portions are bonded is referred to as a fusion point).

Therefore, the presence of the mutant gene is determined by detecting the fusion mRNA and determining the presence thereof, and as a result, the presence of the mutant cell can be detected. Further, in order to detect the fusion mRNA, the mRN
5 ′ and 3 ′ linked in succession to each other in the base sequence of A
This is made possible by detecting the presence of the splice.

[0008] Therefore, the method for detecting a mutant cell based on the chromosomal mutual locus according to the present invention is not particularly limited as long as it uses a probe for selectively determining the presence of the fusion mRNA in a sample. However, in the present invention, as the probe, various oligonucleotides having nuclease resistance such as oligonucleotide probes or phosphorothioate-type oligonucleotides capable of selectively hybridizing to the 5 ′ and 3 ′ splice portions containing the fusion point described above are used. It is preferable to use a probe using a derivative. More preferably, the 5 ′ splice portion and 3 ′
2 that can be separately hybridized continuously to the splice
One type of probe is used. More preferably, to prevent hybridization mismatch,
It is to use a pair of two types of probes that can hybridize continuously to the 5 ′ and 3 ′ splice portions across the fusion point.

Further, the present invention provides the above-mentioned
The means for detecting a hybridized substance hybridized to RNA is not particularly limited. In particular, the pair of two types of probes are labeled with an energy donor fluorescent dye and an energy acceptor fluorescent dye, respectively, and the fluorescence spectra of these dyes are measured. Observation is preferably usable. In particular, as the two kinds of fluorescent dyes, those in which the fluorescence spectrum based on these dyes changes due to the fluorescent energy transfer phenomenon between the fluorescent dyes due to the formation of the hybridized body can be preferably used. In this case, by observing the change in the fluorescence spectrum,
It is possible to determine the formation of a hybridized body between the mRNA and the probe, and therefore, it is possible to determine the presence of the mRNA, that is, to detect a mutant cell by the chromosome mutual translocation.

[0010] The method for detecting mutant cells by mutual chromosome translocation according to the present invention further relates to the simultaneous detection of mutant cells by two or more different types of mutual chromosome translocation in a sample. Here, the mutant cells due to two or more different chromosome mutual translocations are those having a mutant gene that produces an mRNA having any of the above 5 ′ or 3 ′ splice portions in common. For example, when the 5 ′ splice part is made common, in the sample containing a plurality of mRNAs having different 3 ′ splice parts, each mR
This makes it possible to simultaneously determine the presence of NA. In this case, as the probe, a probe composed of one type of probe that hybridizes to a common 5 ′ splice portion and a plurality of types of probes that can hybridize to different 3 ′ splice portions can be preferably used. In addition, the fluorescence spectrum measured when the probe forms a hybridized form with each mRNA is obtained by superposing the respective fluorescence spectra by selectively using energy acceptor fluorescent dyes having different fluorescent wavelengths. Becomes Therefore, it is possible to simultaneously determine the presence and the abundance ratio of each mRNA by appropriate waveform processing.

The detection probe kit for detecting mutant cells by chromosomal translocation which can be used in the method according to the present invention is basically composed of a pair of oligonucleotides or phosphorothioate of an energy donor probe and an acceptor probe. Comprising various oligonucleotide derivatives having nuclease resistance such as a type oligonucleotide, wherein the donor probe and the acceptor probe hybridize continuously or adjacent to each other and complementarily hybridize with a part of the mRNA. Having a structure in which the donor probe has an energy donor fluorescent dye and the acceptor probe has an energy acceptor fluorescent dye so as to give a fluorescence spectrum different from a fluorescence spectrum based on photoexcitation of the donor probe. Is shall. In addition, multiple mRs
It is also possible to use a plurality of different said probes for the purpose of simultaneous detection of NA.

Further, according to the present invention, a device for detecting a mutant cell based on a specific chromosomal translocation in a multi-sample using the above-mentioned method includes a sample preparing device, a probe kit selecting device, a hybridization reaction device and a fluorescence spectrum measuring device. The apparatus includes an apparatus, a means for capturing fluorescence spectrum measurement data, and a specific mutant cell discriminating means.

More specifically, the present invention relates to a fusion mRNA
A pair of two types of probes capable of hybridizing continuously or adjacent to each other at the 5 ′ splice portion and the 3 ′ splice portion sandwiching the fusion point of the fusion mRNA, wherein each of the probes is an energy donor fluorescent dye, and A fluorescence spectrum of a probe labeled with an energy acceptor fluorescent dye;
It is intended to provide a method for detecting a mutant cell due to mutual translocation of chromosomes by determining by measuring the fluorescence spectrum of a hybridized body formed by hybridizing with A.

[0014] The present invention also provides the method as described above, wherein the fluorescence spectrum of the hybrid body contains fluorescence based on the transfer of fluorescence energy between the fluorescent dyes.

Further, the present invention provides a plurality of mRNAs having a common 5 ′ or 3 ′ splice region.
1 that hybridizes in common with the 5 ′ splice region
A plurality of types of probes and a plurality of types of probes capable of hybridizing to each of the different 3 ′ splice portions, wherein one type of probe that hybridizes in common to the 5 ′ splice portion has energy A fluorescence spectrum of a plurality of probes labeled with a donor fluorescent dye and labeled with a different fluorescent dye at each of the different 3 ′ splice portions, and a hybrid formed by hybridizing the probe with the fusion mRNA. An object of the present invention is to provide a method for selectively discriminating by measuring the fluorescence spectrum of a soybean body and detecting a mutant cell due to chromosome mutual translocation.

The present invention also provides the method as described above, wherein the fluorescence spectrum of the hybrid contains fluorescence based on the transfer of fluorescence energy between the fluorescent dyes.

Further, in the above-mentioned method, mR is obtained by analyzing a waveform of a fluorescence spectrum of the hybridized product.
Another object of the present invention is to provide a method characterized by selectively determining the NA.

The present invention also relates to a probe used for a method for detecting a mutant cell by reciprocal translocation of a chromosome by discriminating a fusion mRNA, comprising a 5 ′ splice portion and a 3 ′ splice portion which sandwich a fusion point of the fusion mRNA. A pair of two types of probes having a base sequence capable of continuously hybridizing to a splice portion, wherein the probes are labeled with an energy donor fluorescent dye and an energy acceptor fluorescent dye, respectively, and hybridized with the fusion mRNA. The fluorescence spectrum of the hybrid body formed as described above includes fluorescence based on the transfer of fluorescence energy between the fluorescent dyes.

Further, the present invention provides a sample preparation device for preparing a sample solution containing a target gene, a probe kit selection device for selecting a probe kit to prepare a probe solution, a sample preparation device and a solution for the probe kit solution. A reaction device that mixes and hybridizes, a fluorescence measurement device that measures the fluorescence spectrum of the mixed solution, a data capturing unit that captures the measured fluorescence spectrum measurement data, and a target gene that is obtained by processing the data. And a determination means for determining whether or not the gene is a translocation fusion gene.

Hereinafter, the present invention will be described in more detail based on embodiments.

[0021]

BEST MODE FOR CARRYING OUT THE INVENTION

(Mutant cell by mutual chromosome translocation) The method according to the present invention,
There is no particular limitation on the type of chromosome mutual translocation of mutant cells that can be detected and distinguished by the probe kit and device. Chromosomal mutual translocation positions and mutant genes (fusion genes) for each type of human leukemia summarized in the table below
Is particularly preferably possible.

Table =============================================== ========================= Chromosome translocation Mutant gene 5 'and 3' splice part of translation product type ------ −−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−−− t (8; 21) (q22; q22) AML1-MTG8 Transcription factor / DNA binding protein AML t ( 3; 21) (q26; q22) AML1-EVI-1 transcription factor / DNA binding protein AML t (3; 21) (q26; q22) AML1-MDS1 CML-BC t (12; 21) (q13; q22) TEL -AML1 T cell ALL t (4; 11) (q21; q23) MLL-AF4 pro B ALL t (9; 11) (q21; q23) MLL-AF9 / MLLT3 ALL t (11; 19) (q23; q13) MLL-ENL ALL t (X; 11) (q13; q23) MLL-AFX1 T cell ALL t (1; 11) (q32; q23) MLL-AF6 ALL t (11; 17) (q23; q21) MLL-AFL17 DNA binding protein AML t (1; 19) (q23; q13.3) E2A-PBX1 MDS t (17; 19) (q22; q13) E2A-HLF pro B ALL t (15; 17) (q21; q21) PML -RARα transcription factor / DNA binding protein APL t (11; 17) (q23; q21.1) PLZF-RARα transcription factor / DNA binding protein APL t (9; 22) (q34; q11) bcr-abl Tyrosine kinase CML / ALL t (6; 9 ) (q23; q34) DEK-CAN AML t (5; 12) (q33; q13) PDGF-b-TELL tyrosine kinase II / DNA binding protein CMMol t (16; 21) (q11; q22) FUS-ERG AML / MDS ================================================== ===================== At this time, the base sequence of each splice portion needs to be known, but they are determined by a conventionally known base sequence determination method. It can be determined.

(Probe Kit for Detecting Mutant Cells by Mutual Translocation of Chromosomes) The probe kit according to the present invention comprises various oligonucleotide derivatives having nuclease resistance such as oligonucleotides or phosphorothioate-type oligonucleotides, and is basically composed of Comprises (1) a donor probe having an energy donor fluorescent dye, and (2)
It consists of an acceptor probe having an energy acceptor fluorescent dye. Further, the donor probe has a base sequence capable of hybridizing complementarily with a specific base sequence including a 5 ′ splice portion of the fusion mRNA, and the acceptor probe has a 3 ′ splice portion of the mRNA. And (3) the two types of probes, when hybridized to the fusion mRNA to form a hybridized form, the energy This is to measure the fluorescence spectrum including the fluorescence from the energy acceptor dye generated by the fluorescence energy transfer by exciting the donor dye.

Therefore, when the fluorescence is observed,
It indicates the presence of the hybridization and can determine the presence of the fusion mRNA. Here, for the purpose of explanation, the donor probe has a base sequence capable of hybridizing complementarily with a specific region including the 5 ′ splice portion of the fusion mRNA, and the acceptor probe has a 3 ′ sequence of the fusion mRNA. It is assumed to have a base sequence capable of hybridizing complementarily with a specific region including a splice portion, but is not limited thereto.
The sides may be interchanged.

Specifically, as shown in FIG. 1, when the fusion mRNA to be detected is a 5 ′ splice portion derived from AML1 and an mRNA obtained by fusing a 3 ′ splice portion derived from the MTG8 gene, A donor probe labeled with an energy donor fluorescent dye at the 5 ′ end and having a complementary base sequence capable of hybridizing with the 5 ′ splice portion, and a 3 ′ splice labeled with an energy acceptor fluorescent dye near the 3 ′ end Part and an acceptor probe having a complementary base sequence capable of hybridizing with the mRNA, when a hybridized form is formed by hybridizing with the mRNA, when the energy donor fluorescent dye is excited, resonance energy transfer causes resonance energy transfer. Not only the fluorescence from the donor fluorescent dye, but also the energy acceptor fluorescent dye Fluorescence is also observed. That is, what is observed is not only a fluorescence spectrum due to the energy donor fluorescent dye alone, but also a spectrum in which the fluorescence spectrum due to the energy acceptor fluorescent dye overlaps. Here, when the acceptor fluorescent dye does not hybridize (that is, when the mRNA is not present),
Only by the energy donor fluorescent dye.

Further, according to the above table, many examples of fusion genes involving AML1 are found. In chronic myelogenous leukemia and myelodysplastic syndromes, translocation between chromosome 3 and chromosome 21 occurs, and AML1 (5 'side) and EV
It can be seen that fusion with I1 (3 'side) has occurred. In acute lymphocytic leukemia, chromosome 12 and chromosome 21 reciprocally translocate, and TEL (5 'side) and AML1
It can be seen that fusion with (3 'side) has occurred. Similarly, in acute myeloid leukemia, the translocation between chromosome 3 and chromosome 21 shows that fusion between AML1 (5 'side) and MTG8 (3' side) has occurred. The AML1 gene product is known to show high homology to the runt that controls segmentation in Drosophila and the nucleotide sequence of the mouse polyoma virus enhancer binding factor. These factors are thought to be genes that regulate cell differentiation. Have been. AML of translocation between chromosomes 3 and 21
Since MTG8, which is a fusion partner gene of one gene, also has a DNA binding motif called Zn finger, it is considered that it encodes a factor that regulates gene transcription by binding to DNA. That is, A
It has been suggested that the ML1 gene product is deeply involved in the development of hematopoietic tissue tumors, and that the ML1 gene product changes its physiological activity by fusing with various genes by chromosomal translocation. Similarly, it is shown that there are many cases where the gene is fused to the 5 ′ side as a common MLL gene. Furthermore, the case where the RARα gene is fused to the 3 ′ side as a common gene is also seen.

The method according to the present invention can be used even when a plurality of mRNAs having a common 5 ′ or 3 ′ splice part are mixed, and the mRNAs can be simultaneously and simply used. This can be determined.

The probe kit used for this purpose is
(1) a common donor probe having an energy donor fluorescent dye, and (2) a plurality of acceptor probes,
It consists of an acceptor probe having a fluorescent dye in which the fluorescence wavelength of each energy acceptor dye is different. Further, the donor probe has a sequence capable of hybridizing complementarily with a specific region of a common splice portion (for example, 5 ′ splice portion) among the plurality of mRNAs, and the plurality of acceptor probes are Having a sequence capable of hybridizing complementarily with a specific region of a different splice portion (for example, a 3 ′ splice). (3) The donor probe and the acceptor probe are MR
Each hybridized to the NA mixture to form a hybrid, and when the energy donor dye was excited,
The fluorescence spectrum is obtained by superimposing not only the fluorescence spectrum of the energy donor dye alone but also the fluorescence spectrum of each energy acceptor dye by fluorescence energy transfer. Therefore, when fluorescence at a wavelength from the energy acceptor dye is observed, it indicates the presence of the specific hybridization, and it can be determined that a specific fusion mRNA is present.
The fluorescence spectrum obtained at this time is a spectrum in which each spectrum is superimposed, but by ordinary waveform analysis,
Each can be separated.

In the above, the energy donor probe is mR
Although described as the 5 'splice part of NA, the same result can be obtained even in the 3' splice part of the energy donor probe mRNA.

Specifically, as shown in FIG. 2, three different target genes have the AML1 gene in common on the 5 ′ side, and MTG as a 3 ′ side fusion gene.
A donor probe labeled with an energy donor fluorescent dye at the 3 ′ end and having a complementary base sequence capable of hybridizing with the AML1 gene, assuming that the gene, the EVI1 gene and the MDS1 gene are fused;
Labeled with an energy acceptor fluorescent dye near the 5 'end, MTG8 gene, EVI1 gene, and MD
When three kinds of acceptor probes having complementary base sequences capable of hybridizing with the S1 gene are hybridized with the target gene, when the energy donor fluorescent dye is excited, the energy donor fluorescent dye is excited by resonance energy transfer. In addition to the fluorescence from the dye, the fluorescence from each of the three types of energy acceptor fluorescent dyes is observed. That is, what is observed is not the fluorescence spectrum of the energy donor fluorescent dye, but the fluorescence spectrum of the three types of energy acceptor fluorescent dyes (or an overlap thereof). When the fluorescence spectra overlap, it is possible to determine the presence of each of the three types of mRNA by appropriate waveform analysis means (FIG. 3).

(Confirmed diagnosis of chronic myeloid leukemia and acute lymphocytic leukemia and molecular monitor for induction of remission)
Using the kit according to the present invention comprising various kinds of energy acceptor probes, it becomes possible to make a definitive diagnosis of chronic myeloid leukemia and acute lymphocytic leukemia and to perform molecular monitoring of induction of remission. Conventionally, the definitive diagnosis in chronic myeloid leukemia (abbreviated as CML) is based on a method for detecting the Philadelphia chromosome (Ph1) resulting from the t (9; 22) chromosomal translocation. However, 5-10% of Ph1 negative
, A detection method at the molecular level for detecting gene rearrangement associated with translocation (BCR-a
bl) is required. 4 shows a flowchart of diagnosis and treatment in CML. Chronic phase-> IFN-α, chemotherapy->
Remission-> Bone Marrow Transplant-> Acute Transition-> IFN-α, Chemotherapy As shown here, CML enters the acute phase after several years (underlined in the table), so acute myeloid leukemia and acute Discrimination from lymphocytic leukemia (ALL) is important. Furthermore, it is necessary to test the treatment strategy after identification, and in this case, a method of simply detecting gene rearrangement is considered to be useful. BC at CML and ALL
As shown in the figure, the R-abl rearrangement differs in the fusion site on the BCR gene side. In CML, EX2 and EX3 and abl EX2 are M-BCRs that cause fusion, whereas in ALL, BCR EX1 and abl E1
There is an m-BCR to which X2 fuses. So, abl
Is labeled with a donor fluorescent dye that recognizes EX2 in common, while EX2, 3 and EX1 constituting Bm-BCR are separately labeled with a dye that emits fluorescence in a wavelength range from M-BCR on the BCR side. , MR collected from the patient
NA or its mRNA is mixed with a DNA sample amplified by the RT-PCR method, and M-BCR and m-BC
The fusion site can be determined by comparing the fluorescence intensity in the fluorescence wavelength region of the probe that identifies each of EX2, EX3, and EX1 constituting R.

Further, it is possible not only to identify the disease type but also to quantify the number of residual disease cells (MRD) in the remission period after the treatment. That is, a probe recognizing a normal BCR is prepared, added to a sample, and the abundance ratio of residual diseased cells can be estimated from the fluorescence recognizing the normal BCR and the fluorescence intensity ratio recognizing the fusion gene. . This makes it possible to easily evaluate the prognosis after induction of remission.

Table Genes related to chromosomal abnormalities observed in hematopoietic tumors. ---------------------------------------- − Disease type FAB subtype Chromosome aberration gene ----------------------------------------- ----------------------------- AML M1 t (9; 22) abl, bcr M2 t (8; 21), t ( 7, 11) AML1, MTG8 (ETO) M3 t (15; 17) PML, RARα M4 inv (16), del (16) M5 t (9; 11) est-1 ALL t (9; 22) abl, bcr L1, L2 t (4; 11) est-1 L3 t (8; 14) myc, IgHT-ALL t (11; 14) Tcl-2, TCR CML t (9; 22) abl, bcr Acute conversion t ( 3; 21) AML1, Evi1 CLL inv (1 ) Tcl-1, TCR NHL lymphocytic t (11; 14) bcl-1, follicular t (11; 18) bcl-2, IgH Burkitt t (8; 14) myc, IgH ----- -------------------------------------------------- ------------- A; acute, M; myeloid, L; lymphocytic, t; translocation, inv; inversion, del; deletion Probe suitable for the above purposes The following is an example.

================================= CML mBCR-abl Detection Probe BCREX2-abl (donor fluorescence Formula is Bodypy, acceptor fluorescent dye is Cy3.5) Donor probe: 5'-GCCGCTGAAGGGCTT-3 'Acceptor probe: 5'-TTGAACTCTGCTTAA-3' BCREX3-abl (donor fluorescent formula is Bodypy, acceptor fluorescent dye is Cy3 ) Donor probe: 5′-GCCGCTGAAGGGCTT-3 ′ Acceptor probe: 5′-CTTCCTTTATTGATGG-3 ′ −−−−−−−−−−−−−−−−−−−−−−−−−−−−− -------- All-mBCR-abl detection probe BCRX1-abl (donor fluorescence Element is Bodypy, acceptor fluorescent dye is Cy5) Donor probe: 5'-GCCGCTGAAGGGCTT-3 'Acceptor probe: 5'-CTGCGTCTCCCATGGA-3' --------------- Probe for detecting wild type BCR (donor fluorescent formula is Bodypy, acceptor fluorescent dye is Cy5.5) Donor probe: 5'-TTCCGAACGAGCCAT-3 'acceptor Probe: 5'-CTGCGTCTCCCATGGA-3 '======================================= Here, the fusion genotype BCR-abl and wild type BCR
The gene sequence is as follows.

=================================== CML MBCR-abl BCR EX2-abl TTAAGCAGAGTTCAAAAGCCCTCCAGCGGC BCR EX3 -Abl CCATCAATAAGGAAG AAGCCCTTCAGCGGCALL mBCR-abl BCR EX1-abl TCCATGGAGAGCGAG AAGCCCTTCAGCGGC BCR cDNA TCCATGGAGCGAG ============================================================================= === In addition, RT-PCR primers for detecting CML MBCR-abl are shown below.

=================================== CML MBCR-abl BCR EX2-abl forward reverse CACTCAGCCCACTGAA AAAGTCAGCCTGCTAC BCR EX3-abl forward reverse CACGCATCCCCTGAAAGTCAGCTGCTAC ALL mBCR-abl BCR EX1-abl forward reverse GATGGCGAGGGCCC AAAGTCAGCTGCTC = GCR = GATGGCC = GATGGCC = GATGCCC ============ (Preparation Method of Probe Kit) As described above, the number of bases of each probe of the probe kit according to the present invention or the number thereof Group sequences can be determined based on the known nucleotide sequence of the mRNA. In this case, if the number of bases is too small, there is a possibility that a mismatch may occur in hybridization. Therefore, the number is preferably at least 10 and more preferably 15 or more. If the amount is too large, handling of the probe, storage stability, and the like become difficult. In the present invention, it is sufficient that the number is 30 or less.

The nucleotide sequence is determined by the mRN to be hybridized.
It is preferably completely complementary to the base sequence of A,
Hybridization may be performed substantially without mismatch, and may not be completely complementary. Specifically, at least 8
It is preferable to have 0% or more homology.

The type and position of the fluorescent dye contained in the probe kit of the present invention are not particularly limited, but can be optimized from the viewpoint of ease of preparation, efficiency of fluorescent energy transfer phenomenon, detection sensitivity, and the like. is there. For this purpose, it is possible to refer to some already known combinations of fluorescent dyes (Kay M. et al., Biochemistry 34, 293-30.
0 (1995)).

In the present invention, particularly preferred energy donor fluorescent dyes, energy acceptor fluorescent dyes and combinations of the number of bases between the dyes are shown in the following table.

Table Dye type Excitation wavelength Fluorescence wavelength =================================== Energy donor dye Bodipy493 / 503 493 503 FITC 492 519 Rhodamine 568 590-630 Energy acceptor dye Cy3 552 565 Cy3.5 581 596 Cy5 650 667 CY5.5 678 703 Rhodamine 568 590 ================ ==================== Furthermore, in the above described oligonucleotide sequence portion of the probe kit according to the present invention, and particularly in the preparation method for binding a fluorescent dye, No restrictions. Known nucleic acid synthesis methods can be preferably used. In particular, automatic synthesis methods based on various solid-phase synthesis methods are preferable. For example, synthesis methods of amidite, triester, etc. are preferably used (Mineo Niwa, Chemistry and Biological Experiment Line, Chemical Synthesis Method of DNA, Hirokawa Shoten, Heisei 4) Year). Furthermore, a method for introducing a preferable linker portion for binding a fluorescent molecule into a probe can be achieved by using various polypeptide modifying reagents.

In the present invention, in particular, 6- (trifluoroacetylamino) hexyl- (2-cyanoethyl)-(N, N-diisopropyl) -phosphoramidite, which is a reagent for amination at the 5′-terminal, is synthesized by the above chemical synthesis. Can be used at the same time. This makes it possible to introduce a hexylamino group (after removing the trifluoroacetyl group) at any position in the oligonucleotide chain.

In addition, by selecting the position of the linker portion and the length of the linker portion, in order to prepare a probe in which the two kinds of fluorescent molecules can have a preferable relative spatial configuration, various probes for estimating the spatial configuration are used. A molecular model, a molecular model computer program, or the like can be used.

A method for bonding a linker moiety to a necessary fluorescent molecule,
Alternatively, there is no particular limitation on the method of bonding the linker moiety to a base at an appropriate position of the oligonucleotide probe, and a chemical synthesis method, an enzyme method, or the like can be used.

(Hybridization Conditions) In the hybridization according to the present invention, the mRNA and the probe D
It occurs between NA. Therefore, RNA-DN
Usually used hybridization conditions between A can be preferably used.

(Method of Detecting Mutant Cells by Mutual Translocation of Chromosomes) In the method of detecting mutant cells by mutual translocation of chromosomes according to the present invention, the probe using the probe kit continuously hybridizes with a part of the mRNA in a complementary manner. This is based on a phenomenon in which when the hybrid body is irradiated with light from the donor probe and light-excited, the acceptor probe emits fluorescence based on fluorescence energy transfer.
Further, if the acceptor fluorescent dyes are different, fluorescence of different wavelengths will be generated.

Accordingly, a method of irradiating light having the excitation wavelength of the energy donor fluorescent dye and measuring the fluorescence wavelength of the energy acceptor fluorescent dye based on a generally known fluorescence spectrum measuring method can be preferably used.

When using an acceptor probe having a plurality of different energy acceptor fluorescent dyes, the measured fluorescence spectrum is a superposition of the fluorescence spectra according to the wavelengths of the respective energy acceptor fluorescent dyes. Therefore, it is possible to separate the fluorescence spectra by ordinary waveform analysis means.

[0048] The above analysis means makes it possible to simultaneously determine the presence of a plurality of target genes.

FIG. 4 shows a processing flow of an example of a method for automatically discriminating the presence of a mutant cell due to a specific translocation of a specific chromosome in multiple samples using the method according to the present invention. First, in step S1, information on each subject and a predetermined initial value based on the information are read. At this time, the initial value includes information (such as a base sequence) on a specific chromosome mutual translocation to be discriminated and a fusion mRNA based thereon, a type of a probe necessary to hybridize to each mRNA, and a fluorescence spectrum. Measurement conditions, data processing conditions, and the like. In step S2, it is determined whether or not the subject should be pre-processed. If necessary, pre-processing such as protein removal and removal of coloring substances is performed (step S3). Further, in step S4, an mRNA extraction process is performed from the subject to perform mRN
Prepare a sample containing A. In step S5, a probe kit as required for each of the obtained samples is selected and mixed. After forming a hybridized body under appropriate hybridization conditions in Step S6, Step S7
Then, the fluorescence of the obtained hybrid body is measured to acquire data (step S8), the fluorescence measurement data is processed (step S9), it is determined whether or not the target gene is present, and if necessary, Quantify the amount.

In the data processing in step S9, as shown in FIG. 3, the fluorescence spectrum of each acceptor probe is an overlapping spectrum. Methods can be used (eg, by Taiji Nishikawa, Keizo Hiraki,
Instrumental Analysis Practical Series, "Fluorescence and Phosphorescence Analysis", Kyoritsu Shuppan Co., Ltd., pp. 170-171).

(Mutational Cell Detecting Apparatus by Mutual Chromosome Translocation) FIG. 5 shows an embodiment of the mutant cell detecting apparatus by chromosome mutual translocation according to the present invention. Each subject 1
Are held in a sample tube 2 containing a subject and arranged on a sample tube holding rack 3. Each sample tube 2 is numbered. The sample tube number is read by the sample tube number reader 4 and stored in the controller 5. The subject in the sample tube is sampled by the sampling device 6,
It is sent to the pre-processing device 7. The solution containing the mRNA isolated by the pretreatment device is further sent to the mixing device 8. Further, a solution containing an appropriate probe selected by the control device 5 is prepared by the probe kit preparing device 9,
It is sent to the mixing device 8. The control device 5 allows the mRNA and the probe to hybridize in the mixing device 8 set to the hybridization condition. The resulting hybridized solution is sent to the fluorescence measurement device 10. The measurement conditions and the like are set by the control device 5. The measurement data obtained by the measurement device 10 is sent to the control device 5 and stored in the storage device 11. Further, the data is processed by the control device 5 and output to the input / output device 12.

The controller 5 reads out the sample information stored in advance or input from the input / output device 12 based on the sample tube number read by the sample tube number reader, and adjusts the necessary sample concentration. Settings for reagent addition, etc. The selection of the probe kit and the preparation of the solution are performed by the probe kit preparation device 9.

Further, the controller 5 sets conditions for hybridization between the sample solution in the mixing device 8 and the probe solution.

The control device 5 also performs a waveform analysis based on the fluorescence spectrum data measured by the measuring device 10 in advance in the control device or based on a processing program input from the input / output device 12, and performs a predetermined analysis. The fluorescence intensity at the fluorescence wavelength is calculated, compared with the background fluorescence, tested for a significant difference, determined, and the result is output to an output device.

Although the example of the apparatus described above has been described as being automated by the control device, a part of the operation may be performed manually. The sample tube may be a single tube or a plurality of the same type. Although an example in which the reading device automatically reads each sample information in the sampling device is shown, it is also possible to input information to the control device from an input device (for example, a key input device) provided in the control device. The sample information according to the sample includes the type and concentration of the target gene to be determined, the type of probe kit required, the fluorescence measurement conditions, and the like. The sample information reading device can also read the label of the sample tube itself, or read the sample number from the rack number, and refer to the sample information previously input to the storage device by the control device.

The control device enables the control of the optimum conditions of the mixing device (temperature, time, etc.) in addition to the control of the sampling device, the control of the probe kit preparation device, and the like. Alternatively, each condition may be set manually. The storage device stores in advance necessary fluorescence measurement conditions, background data, the fluorescence characteristics of the probe kit, and the like. However, the storage device is not necessarily required, and can be input to the control device by an input device. is there. The sample preparation device collects a required amount of a sample solution in a sample tube, dilutes the sample solution to an appropriate concentration, and optionally performs a filtration process using a filter. These processes need not be automated. The probe kit preparation device selects a probe kit by a control device and prepares a solution to a required concentration. It is not always necessary to automate all of these processes, and it is also possible to perform them manually.

In the mixing device, the temperature, time, stirring process, and the like are controlled by the control device. These conditions may be those that execute predetermined settings, or that are input by an input device. It may be executed according to the set conditions.

As a means for analyzing the waveform of the measured fluorescence spectrum data, an ordinary waveform analysis program can be used. Specifically, it is possible to calculate the fluorescence intensity at a predetermined fluorescence wavelength, compare the calculated fluorescence intensity with the background fluorescence, and perform a test for a preset significant difference to make a determination.

Hereinafter, the present invention will be described specifically with reference to Examples, but the present invention is not limited to the following Examples as long as the gist of the present invention is not exceeded.

Example 1 As a target gene, (A
ML1-MTG8, 5'-CCCGGAGAACCUCG
A donor probe (5 ′ (Bodipy493 / 503) -TTCGAGGGTT) obtained by labeling an oligo DNA having a sequence complementary to the 15 bases on the 5 ′ side of the fusion site of AAAUCGUACUGAGAAGC-3 ′) with the fluorescent dye BODIPY.
CTCGGG-3 ′) and an oligo DNA having a sequence complementary to the 15 bases on the 3 ′ side of the fusion site.
Is labeled with an acceptor probe (5′-GCTTCTCAGTA (Cy5) CGAT-
3 ′) was synthesized.

The obtained two probes were mixed with the target gene and allowed to stand at about 10 ° C. for several minutes, and then analyzed by HPLC equipped with an ion exchange column chromatograph under the following conditions.

Solution: 1 × SSC Column: DEAE-NPR (No. 1) Flow rate: 1 ml / min, Column temperature: 25 ° C. Mobile phase: A; 20 mM Tris-HCl (pH 9.
5) 1 mM EDTA B; 20 mM Tris-HCl (pH 9.5), 1 m
M EDTA / 1M NaCl Elution conditions: increase the mixing ratio linearly from 20% to 100% of solution B in 10 minutes Detection: UV absorption: 260 nm, excitation wavelength for fluorescence detection: 4
Emission from the acceptor probe based on fluorescence energy transfer due to photoexcitation of the donor probe due to hybridization of the two types of probes adjacent to each other at an elution position of 5.9 minutes at 75 nm and a fluorescence wavelength of 675 nm was detected. Therefore, it is clear that the above-mentioned hybrid exists stably under the above-mentioned chromatographic conditions.

(Example 2) Hybridization was carried out using a common donor probe and an acceptor probe labeled with three different fluorescent dyes, and the fluorescence spectrum was measured.

As a target, a fusion RNA of AML1 and EV1 was used. The entire base sequence is as follows.

5'-AGAACCUCGAAAUTTU
GAGUGUGUAUAUGG-3 ′ Further, one common type of donor probe has the following nucleotide sequence.

5'-TTATTTCGAGGTTCT-
3 ′, and is labeled with BODIPY at the T at the 5 ′ end.

The different acceptor probes are as follows.

5'-CCATATACACTACTA-
3 ′, and the eleventh A has Cy3, Ct3.5, C
Each is labeled with y5.

Under the same conditions as in (Example 1), target RNA, a common donor probe and an acceptor probe were mixed, hybridized, and the fluorescence spectrum was measured. As shown in FIG. 6A, it can be seen that the fluorescence spectra from each acceptor probe show a fluorescence maximum at clearly different wavelengths. That is,
Cy3 at 565 nm, Cy3.5 at 596 nm
The fluorescence maximum is observed at 667 nm in Cy5.

Further, as shown in FIG. 6 (B), the fluorescence spectrum under the condition where the equivalent mixture of the target RNA, the common donor probe and the three types of acceptor probes was hybridized was obtained from each acceptor probe. And the fluorescence spectrum from each acceptor probe can be separated by means of waveform analysis or the like.

[0071]

The present invention is a set of two types of probes capable of continuously hybridizing to a 5 'splice portion and a 3' splice portion sandwiching a fusion point of a fusion mRNA, wherein the probes are an energy donor fluorescent dye and an energy By using a probe labeled with a sceptor fluorescent dye, the presence of the fusion mRNA is determined by measuring the fluorescence spectrum of the probe itself and the fluorescence spectrum of the hybrid formed by hybridization of the probe with the fusion mRNA. And it is possible to detect mutant cells due to mutual translocation of chromosomes. Further, a sample preparation device for preparing a sample solution containing the target gene,
A probe kit selection device for selecting a probe kit to prepare a probe solution, a reaction device for mixing and hybridizing the prepared sample and the probe kit solution, and a fluorescence measurement device for measuring a fluorescence spectrum of the mixed solution And a data capturing means for capturing the measured fluorescence spectrum measurement data, and a determining means for processing the data to determine whether or not a target gene is present. By doing so, translocation fusion genes in multiple samples can be automatically determined and detected.

[0072]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: DNA sequence CCCGAGAACC UCGAAAUCGU ACUGAGAAGC 30 SEQ ID NO: 2 Sequence length: 30 Sequence type : Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence AGAACCUCGA AAUTTUGAGU GUGUAUAUGG 30 SEQ ID NO: 3 Sequence length: Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence TTCGAGGTTC TCGGG 15 SEQ ID NO: 4 Sequence length: Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence GCTTCTCAGT ACGAT 15 SEQ ID NO: 5 Length: 15 Sequence type: number of nucleic acid strands: 1 strand Topology: linear Sequence type: DNA sequence GCCGCTGAAG GGCTT 15 SEQ ID NO: 6 Sequence length: 15 Sequence type: nucleic acid number of strands: 1 Main strand Topology: Linear Sequence type: DNA sequence TT GAACTCTG CTTAA 15 SEQ ID NO: 7 Sequence length: 15 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: DNA sequence CTTCCTTATT GATGG 15 SEQ ID NO: 8 Sequence length: 15 sequences Type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence CTGCGTCTCC ATGGA 15 SEQ ID NO: 9 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Topology: Straight Type of chain sequence: DNA sequence TTCCGAACGA GCCAT 15 Sequence number: 10 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence TTAAGCAGAG TTCAA 15 Sequence number: 11 Sequence length: 15 Sequence type: Nucleic acid Number of strands: 1 strand Topology: Linear Sequence type: DNA sequence AAGCCCTTCA GCGGC 15 SEQ ID NO: 12 Sequence length: 15 Sequence type: Nucleic acid Number: single-stranded Topology: linear Sequence type: DNA sequence CCATCAATA A GGAAG 15 SEQ ID NO: 13 Sequence length: 15 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: DNA sequence TCCATGGAGA CGCAG 15 SEQ ID NO: 14 Sequence length: 15 sequences Type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence ATGGCTCGTT CGGAA 15 SEQ ID NO: 15 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Topology: Straight Type of linear sequence: DNA sequence CACTCAGCCA CTGAA 15 Sequence number: 16 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence AAAGTCAGCT GCTAC 15 Sequence number: 17 Sequence length: 15 Sequence type: Nucleic acid Number of strands: 1 strand Topology: Linear Sequence type: DNA sequence CACAGCATTC CGCTG 15 SEQ ID NO: 18 Sequence length: 15 Sequence type: Nucleic acid Number: Single-stranded Topology: Linear Sequence type: DNA sequence GATGGCGAGG GC GCC 15 SEQ ID NO: 19 Sequence length: 15 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: DNA sequence GCCGTATCCA GGTGG 15

[Brief description of the drawings]

FIG. 1 is a diagram showing an outline of a probe of the present invention.

FIG. 2 is a diagram showing a detection method using a common donor probe and a plurality of acceptor probes according to the present invention.

FIG. 3 is a diagram showing a detection method using a common donor probe and a plurality of acceptor probes according to the present invention.

FIG. 4 is a diagram showing a processing flow of an automated translocation fusion gene detection device using the detection method according to the present invention.

FIG. 5 is a diagram schematically showing an automated translocation fusion gene detection device according to the present invention.

FIG. 6 is a diagram showing a fluorescence spectrum of a hybrid when a common donor probe according to the present invention and a plurality of acceptor probes having three kinds of different fluorescent dyes are used.

[Explanation of symbols]

DESCRIPTION OF SYMBOLS 1 ... Subject, 2 ... Sample tube, 3 ... Sample tube holding rack, 4 ...
Sample tube number reading device, 5: control device, 6: sampling device, 7: pretreatment device, 8: mixing device, 9: probe kit preparation device, 10: fluorescence measurement device, 11: storage device, 12: input / output device

Claims (7)

[Claims] 1. A set of two types of probes capable of continuously hybridizing a fusion mRNA to a 5 ′ splice portion and a 3 ′ splice portion sandwiching a fusion point of the fusion mRNA, wherein each of the probes is an energy donor. Fluorescent dye, and the fluorescence spectrum of a probe labeled with an energy acceptor fluorescent dye, and discriminating by measuring the fluorescence spectrum of a hybrid body formed by the probe hybridizing with the fusion mRNA, A method for detecting a mutant cell by mutual chromosome translocation. 2. The method according to claim 1, wherein the fluorescence spectrum of the hybrid body includes fluorescence based on the transfer of fluorescence energy between the fluorescent dyes. 3. A plurality of mRNAs having a common 5 ′ or 3 ′ splice portion, and one type of probe that hybridizes in common with the 5 ′ splice portion, and a different 3 ′ splice portion. A plurality of types of probes capable of hybridizing to each of the 5 ′ splice portions, wherein one type of probe that hybridizes in common to the 5 ′ splice portion is labeled with an energy donor fluorescent dye. A fluorescence spectrum of a plurality of probes labeled with different fluorescent dyes in each of the 3 ′ splice portions;
A method for selectively discriminating by measuring the fluorescence spectrum of a hybrid body formed by hybridizing with A to detect a mutant cell due to chromosome mutual translocation. 4. The method according to claim 3, wherein the fluorescence spectrum of the hybrid body includes fluorescence based on the transfer of fluorescence energy between the fluorescent dyes. 5. The method according to claim 4, further comprising selectively discriminating the mRNA by analyzing a waveform of a fluorescence spectrum of the hybridized product. 6. A probe used for a method for detecting a mutant cell by reciprocal chromosome translocation by discriminating a fusion mRNA, wherein the probe is connected to a 5 ′ splice portion and a 3 ′ splice portion sandwiching the fusion point of the fusion mRNA. A pair of probes having a hybridizable base sequence,
The probes are each labeled with an energy donor fluorescent dye, and an energy acceptor fluorescent dye,
A probe, wherein a fluorescence spectrum of a hybrid body formed by hybridizing with the fusion mRNA contains fluorescence based on transfer of fluorescence energy between the fluorescent dyes. 7. A sample preparation device for preparing a sample solution containing a target gene, a probe kit selection device for selecting a probe kit to prepare a probe solution, and mixing the prepared sample with the probe kit solution. A reaction device that hybridizes, a fluorescence measurement device that measures the fluorescence spectrum of the mixed solution, a data capturing unit that captures the measured fluorescence spectrum measurement data, and whether the target gene exists by processing the data or not. A translocation fusion gene detecting device, comprising: a discriminating means for discriminating.