JPH10179169A - Expression vector for mammalian cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an expression vector capable of making a high level production of a gene tic recombinant protein by using a mammalian cell as a host. SOLUTION: This expression vector which uses a promoter having low expression inductivity as a promoter in a plasmid and has a gene cistron of wasting neomycinphosphotransferase such as neomycimphosphotransferase cistron, etc., having an insertion sequence containing at least one couple of a sequence capable of coding an amino acid sequence between a sequence of the promoter and sector of a gene translation of the neomycintransferase and a multicloning site for gene integration having strong manifestation inducing promoter. This vector induces the high productivity of the genetic recombinant protein the hose mammalian cell. This vector preferably contains a gene cistron of dihydrofolic acid reducing enzyme using low expression inducing promoter as a promoter.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to an expression vector for mammalian cells that enables high-level production of recombinant proteins using mammalian cells as a host. The expression vector of the present invention is particularly suitable for production of a protein whose activity is hardly obtained by genetic recombination using Escherichia coli or yeast as a host.

[0002]

2. Description of the Related Art Many expression vectors for producing recombinant proteins have been developed, and high yields can be expected especially in expression systems using microorganisms such as Escherichia coli and yeast as hosts.
However, expression systems using these microorganisms as hosts may have problems in protein modification or lose characteristics unique to mammalian proteins. Therefore, for example, in the case of a protein whose biological activity depends on a sugar chain, it is necessary to produce the protein using a mammalian cell as a host. Despite these demands, the productivity of a recombinant protein expression system using mammalian cells as a host is generally low, and there are often problems with the stability of the transgene.

[0003] An example of recombinant protein production using mammalian cells as a host is tissue plasminogen activator.
(JP-A-59-183693; DNA, p. 7,651, 1988), erythropoietin (J. Fermentation Bioengineering, 4,257)
Pt., 1989, Proc. Natl. Acad. Sci. USA, 83, 6465, 1986;
Biotechnology, 6, 67, 1988), IFN-γ (Proc. Natl. Aca
d.Sci. USA, 80.4564, 1983), IFN-β (Cytotechnolog
y, 4, 173, 1990). In addition, there are many reports on recombinant production of monoclonal antibodies (Biotechnology, 10, 169, 1992; J. Immunol.
s, 125, 191, 1989; Biotechnology, 10, 1455, 1992.
Year).

[0004]

It is very important to increase the productivity of recombinant proteins using mammalian cells in the production of protein drugs and diagnostics. It also provides an effective means for their development research. Therefore, there is a need for an expression vector that enables efficient gene transfer and high productivity using mammalian cells, particularly Chinese hamster ovary cells (CHO cells) as a host.

[0005] Efficient gene transfer means that the number of cell clones that effectively produce the target substance in the whole recombinant cells is relatively small, thereby facilitating selection of high-productivity clones. The expected value for the appearance of high-productivity clones is high despite the small population of cells producing the protein of interest.
If the population of the obtained cells is large, the selection requires much time and labor and the efficiency is low.
It is also likely that clones with potentially high productivity will be overlooked.

[0006] Acquiring high productivity means that the production level of the recombinant protein in a cell clone obtained by gene transfer is high, and this is considered to be mainly due to the properties and performance of the expression vector. The level of gene expression has been found to vary significantly with chromosomal location (Ann
u. Rev. Cell Biol., 6, 679, 1990).

[0007]

[Means for Solving the Problems]

[0008] The present inventors did not achieve high expression by increasing the copy number of the gene to be integrated by gene transfer. We have developed an expression vector with a mechanism to be selected as a resistant strain. High productivity of the initial clones as G418-resistant strains after gene introduction neomycin phosphotransferase (hereinafter referred to as NEO ^r) depends on the mechanism of gene expression. In addition, the expression vector has a dihydrofolate reductase (hereinafter referred to as DHFR) gene, and by devising its expression inducibility, an expression vector that enables efficient gene amplification by drug stimulation was developed. As a result, an expression vector capable of producing a stable protein at a high level could be produced, and the present invention was completed.

If the expression of the NEO ^r gene to be introduced does not occur or is too low, the recombinant host cell cannot acquire resistance to neomycin (hereinafter, represented by G418). However, in studies conducted by the present inventors so far, a great number of G418-resistant strains were obtained in all cases using expression vectors having ^NEOR genes, including commercially available vectors. As long as based on such a result, the expression of the NEO ^r gene was provided from the plasmid does not substantially contribute to other role as whether selection marker resulting cell transfection is transformant It was estimated.

The present inventors have further restricted the NEO ^r expression mechanism so that the NEO ^r gene cistron is required for G418 resistance acquisition unless integrated at a high expression position on the host cell chromosome. It was designed so that no level of NEO ^r expression occurred. In other words, by making the expression of the ^NEOr gene extremely deteriorated or attenuated, even if it is a transformant, it can be used in the medium even if the plasmid gene to be integrated is not introduced into a position having extremely high expression on the chromosome. Survival was difficult for the G418 selection. Although reported using a weak promoter to NEO ^r gene cistron of the expression vector are several (Mol.Cel
l Biol., 3: 1246, 1983; Mol. Cell Biol., 6, 2593, 1
986; Mol. Cell Biol., 7, 1296, 1987; DNA, 7, 651,
1988), it is unlikely that high-productivity transformants have been effectively and sufficiently selected in these cases.

The present invention, as a configuration NEO ^r gene cistron, using a promoter with reduced expression inducible,
And a DNA sequence comprising at least one set of sequences capable of encoding an amino acid sequence inserted between the promoter and the NEO ^r gene translation region (insert sequence), or transformed by gene transfer. In host cells
By having the same structure as this in that allowed to decay is significantly depleted expression mechanism of NEO ^r, in which allowed to decay is significantly depleted expression mechanism of NEO ^r in the host cell transformed by gene transfer. NEO ^{r of the} present invention
The gene cistron is different from the one with only a weakened promoter, since it leads to specifically obtain a G418 resistant strain in which a plasmid gene has been introduced into a high expression position,
It is defined as "consumable NEO ^r gene cistron".

Namely, the present invention provides an expression vector having said expendable NEO ^r gene cistron and strong expression inducible promoter in the plasmid. The vector induces high productivity of the recombinant protein in a mammalian host cell.

[0013] The promoter of the "consumable NEO ^r gene cistron", those derived from the promoter normally expressed difficult protein gene in mammalian cells, the promoter having the normal infection difficult viral antigen in a mammal or, Any of the promoters from which the enhancer has been removed can be used, and more specifically, whether the enhancer region has been removed from the viral antigen promoter of SV40 which is normally non-infectious to CHO cells (Mol.
ell Biol., 6, 2593, 1986) or a promoter with sufficiently low expression.
Further, the inserted sequence comprises, for example, at least one set of "sequence capable of encoding an amino acid sequence whose start position as a constituent unit of a triplet corresponds to the start position of the ^NEOr gene translation region". Preferably, the insertion sequence also includes "a sequence capable of encoding an amino acid sequence in which the start position as a constituent unit of a triplet is shifted by one or two bases from that of the NEO ^r gene translation region", and at least two types thereof are included. And more preferably these three
It is desirable to include all types. For the DNA sequence as the inserted sequence, a linker artificially synthesized based on such conditions can be used.If there is a naturally occurring sequence that meets the conditions, it may be derived from it or be derived from it. Modified ones may be used. For example, transposon Tn5 (Cold Spring Harb.Symp.Quant.Biol., 45,
(Pp. 107, 1981) contains all sequences capable of encoding three types of amino acid sequences having different starting positions as triplet constituent units, and use an appropriate region in the sequence. This makes it possible to produce a product satisfying the above conditions. The length of the insertion inlet sequence may be one sufficient to reduce the expression of NEO ^r, although sequences can encode the amino acid sequence is one that varies depending contains several pairs, usually 30 １０００1000 bases, preferably 100-400 bases. In addition, the Kozak consensus sequence (Nucleic Ac) around the NEO ^r gene translation region start position (specifically, (-6), (-3), (+4))
The base at the position corresponding to (ids Res., 15, 8195, 1987) is preferably a pyrimidine base or modified to a pyrimidine base.

[0014] incorporation into strongly expressing the position on the host cell chromosome of the plasmid DNA is is to be eventually achieved by G418 selection from characteristics of the NEO ^r gene cistron, the target protein at the position on the chromosome The expression itself needs to be strongly induced. For this reason,
Multi-cloning site for integration of protein genes
The promoter (hereinafter referred to as MCS) and the polyadenylation signal (hereinafter referred to as polyA) are selected from those having the strongest expression inducibility. As a promoter, human cytomegalovirus Immediate Ea
rly (hCMV MIE: Cell, 41, 521, 1985) promoter, β
Actin promoter (Proc. Natl. Acad. Sci. USA, 84, 4
831, 1987), and polyA signal include bovine growth hormone-derived polyA sequence (DNA 5, 115, 1986).
In the present specification, a cistron having an MCS incorporating the protein gene of interest is referred to as “MCS cistron”.

The present invention also provides a highly productive transformant of a protein that is a G418-resistant cell clone, comprising transforming a host cell by gene transfer using the above-described expression vector into which the protein gene has been incorporated. Provide a way.

The present expression vector preferably also has a DHFR gene cistron. This vector uses dihydrofolate reductase-deficient CHO cells as mammalian host cells,
It allows efficient amplification of the plasmid gene with methotrexate after introduction of the plasmid gene into the host cell.

[0017] In DHFR gene cistron, NEO ^r gene cistron used ones and promoters with reduced expression induced Similarly, for example, CHO cells to the enhancer region from the SV40 virus antigen promoter is usually non-infectious Use what has been removed. More preferably
It is desirable that the base at the position corresponding to the Kozak consensus sequence before and after the start position of the DHFR gene translation region is a pyrimidine base or modified to a pyrimidine base. In order to promote gene amplification, a method for reducing the affinity for methotrexate (hereinafter, referred to as MTX) by introducing a mutation into the DHFR gene to be introduced is known.
(JP-A-59-192089) that the present inventors weakened or suppressed the expression inducibility of the DHFR gene, whereby MTX contained in the medium was integrated into the host cell chromosome. We thought that it would be more effective to guide the amplification of plasmid DNA.

[0018] The present invention also provides a method for obtaining a highly productive transformant of a protein, which comprises transforming a host cell by introducing a gene using an expression vector having the DHFR gene cistron into which the protein gene has been incorporated. provide.

[0019] The present invention further comprises transforming a host cell by gene transfer using the above-described expression vector into which a protein gene has been incorporated, and adapting the resulting transformant to a serum-free medium. Provided is a method for obtaining a high-productivity transformant of a protein capable of stably producing a high-level protein in a medium.

The present invention also provides an expression vector having a multicloning site for gene integration having the DHFR gene cistron and a strong expression inducible promoter. The expression vector can be used for the construction of the expression vector having the debilitating NEO ^r gene cistron.

In the present invention, the term "promoter having low expression inducibility" refers to a promoter generally used for protein expression, for example, SV40 promoter, LTR
It means a promoter whose protein expression is weaker than when induced by a promoter, β-actin promoter or the like. The "sequence capable of encoding an amino acid" is a sequence having a corresponding initiation codon and a termination codon, and having a gene sequence capable of encoding a peptide therebetween,
Preferably, the number of constituent amino acids is about 20 or more. "Cistron" refers to a promoter, structural gene, polyadenylation signal (pol
A unit that expresses a protein by transcription / translation based on yA) means a unit, and may include any DNA sequence related thereto or an arbitrary DNA sequence as an insertion sequence. The term "strong expression inducible promoter" refers to a promoter generally used for protein expression in an ordinary expression vector, and is preferably a human cytomegalovirus Major Immeid having particularly high expression inducibility.
It means a promoter such as an ately-Early antigen promoter and a β-actin promoter.

[0022]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.
The expression vector of the present invention comprises NE backbone vector.
O ^r gene cistron, by incorporating MCS cistron, also be obtained by further incorporating the DHFR gene cistron. There is no particular limitation on the backbone vector, for example, E. coli replication origin
(ColE1 ori) and a plasmid vector having an ampicillin resistance gene (pUC system: Gene, 33: 103, 1985, pBR32
2nd class: Gene, 22, 277, 1983) can be used.

As a method of using the vector of the present invention, after a protein gene is incorporated into the MCS of the vector of the present invention,
The method includes introducing a gene into a host cell by the lipofectin method or electroporation, performing selection using only resistance to G418, and obtaining a transformant with high productivity of the protein. Many of the cells that survived the selection have already achieved relatively high expression levels, but protein expression levels may be assayed to select for cells with higher productivity. The obtained highly productive cells are repeatedly passaged and stabilized after repeated cloning. When it is desired to obtain a strain having a higher productivity, a vector having a DHFR gene cistron is used as a vector of the present invention. Do. In general, MTX is used not only for amplification of the DHFR gene but also for selection of gene-incorporated cells alone or in combination with neomycin (J. Mol. Appl. Gene.
t., 1, 165, 1981; J. Mol. Biol., 159, 601, 1982),
The role of NEO ^r gene and the DHFR gene in the present invention is assumed to share. That, NEO ^r are for selection, DHFR was used to amplify the plasmid vector gene integrated.

Hereinafter, the method for producing the expression vector of the present invention will be described with reference to specific examples. It is easy for those skilled in the art to replace the starting plasmid, promoter and other components used in this specific example with equivalent components.

<1> Preparation of Backbone Vector [pBBV] The backbone vector pBBV was prepared using plasmid pUC18 (Gene, 3
(3, 103, 1985) by completely removing the lacZ region and replacing the cleavage site with a newly synthesized linker with multiple restriction enzyme cleavage sites (BBV linker). FIG. 1 shows a flowchart of pBBV production. pBBV
Has an E. coli replication origin (ColE1 ori) and an ampicillin resistance gene (Amp ^r ).

<2> Preparation of plasmid for gene cloning (a) Plasmid for cloning SV40-related gene [pCV3]
This is prepared by replacing the multiple cloning site of the plasmid pUC119 (Gene, page 33, 103, 1985) with a linker (CV3 linker) having a newly synthesized multiple restriction enzyme cleavage site. FIG. 2 shows a flowchart for preparing pCV3.

(B) Preparation of Plasmid [pCV4] for Gene Cloning Having MCS Cistron The existing multicloning site of plasmid pUC18 was removed and replaced with a newly synthesized linker (CV4 linker) having multiple restriction enzyme cleavage sites. It is produced by doing. This is a construction plasmid used in the process of producing the MCS cistron. FIG. 3 shows a flowchart for preparing pCV4.

<3> Plasmid for constructing cassette [pSVP (D)
S-1, pSVP (D) to produce a plasmid with the plasmid and NEO ^r gene cistron having prepared DHFR gene cistron S-2], previously promoter and polyadenylation signal (p
A plasmid for constructing a cassette having a multiple cloning site between olyA) is prepared. PSVP for the DHFR gene cistron (D) S-1, pS for the NEO ^r gene cistron
Prepare VP (D) S-2. The basic configuration is common, and a modified version of the SV40-derived early promoter (including the SV40 replication origin) is used as the promoter, and SV40 polyA is used as the polyadenylation signal. These were prepared in advance with the plasmid pCV3 for cloning SV40-related genes.
It is produced by incorporating it into The difference between a DHFR and for NEO ^r is only different 5 'ends of the restriction enzyme cleavage sequences of the SV40 promoter portion. FIG. 4 shows a flowchart for preparing pSVP (D) S-1 and FIG. 5 shows a flowchart for preparing pSVP (D) S-2.

(3-1) Preparation of Plasmid pSVP (D) S-1 for Construction of DHFR Gene Cistron (a) Selection of Promoter It is reported that the promoter can be weakened by removing the enhancer from the viral antigen promoter region. (Mol.Cell Biol., 3, 1246, 1983
Mol. Cell Biol., 6, 2593, 1986; Mol. Cell Biol.
I, p. 7.1296, 1987), and a promoter with low expression inducibility is prepared by removing the enhancer portion of the SV40 early promoter. Specifically, the SV40 replication origin (O
The early promoter sequence containing ri) is modified and used.
That is, the SV40 early promoter sequence was excised from the plasmid pSB40 / BR (obtained from Hiroshima University) having the SV40 virus total DNA ligated with BamHI on pBR322 using primers having the nucleotide sequences shown in SEQ ID NOS: 8 and 9. Insert between the SacII-PstI sites of pCV3.
Subsequently, the enhancer portion was removed by self-ligation between SphIs (SphI-SphI) in each of the 72 bp repeat sequences present in this sequence (Mol.Cell Biol., 3,
1246, 1983), weakening the promoter. The weakened promoter is _PSV40DE , and the resulting plasmid is pS
Called VP1a.

(B) Selection and setting of polyA signal sequence From plasmid pSV40pA-A (derived from pSV40 / BR, obtained from Hiroshima University) having a polyA signal derived from SV40 virus genome
Cut out and use 810 bases. S in expression vector
Generally, V40 polyA tends to use a short one on condition that it contains a termination signal, but it is preferable to set a sequence long enough to avoid affecting other cistrons. The restriction enzyme cleavage sequence at the 3 ′ end of this sequence was modified with a newly synthesized linker (SPSV40 linker) (the modified plasmid was pSV40pA-B), and then cut out with BamHI and ClaI and incorporated into pSVP1a to obtain DHFR
A plasmid pSVP (D) S-1 for constructing a gene cistron is prepared.

(3-2) Preparation of plasmid pSVP (D) S-2 for construction of NEO ^r gene cistron (a) Selection of promoter The promoter sequence was the same as that used for the DHFR gene cistron, but the SV40 promoter was weakened. P _SV40DE
Is adopted. This is cut out from pSV40 / DR by the same procedure as for DHFR, but a 5 'sense primer from which a part of the restriction enzyme cleavage sequence (EcoRI) is omitted (SEQ ID NO: 7) is synthesized and used. Removal of the enhancer part from the promoter sequence is also performed in the same manner as in the case of the DHFR gene cistron, and the resulting plasmid is designated as pSVP1b.

(B) Selection and setting of polyA For polyA, pSV40pA-B was prepared in the same manner as for DHFR.
By extracting with BamHI and ClaI and integrating it into pSVP1b, the NEO ^r gene cistron construction vector pSVP
(D) Prepare S-2.

[0033] <4> NEO cassette vector with the ^r gene cistron [pSVP (D) S / NEO ] Preparation of (4-1) Preparation of the insertion sequence to create a "consumable NEO ^r gene cistron" (a) Use of transposon-derived sequences In order to deplete the expression mechanism of the NEO ^r gene, at least one set of sequences that can encode any amino acid sequence between the promoter and the NEOr gene translation region, preferably the starting position as a constituent unit of the triplet is different Although it has an insertion sequence comprising all three types, we have a naturally occurring sequence, the transposon sequence (Tn5: Cold Spring Harb.
Symp.Quant.Biol., 45, 107, 1981; Gene, 18, 327, 19
(1982) was found to have a region that satisfies the conditions for this inserted sequence. In the transposon sequence portion consisting of 354 bases used in the vectors of the examples of the present invention, a gene sequence capable of encoding several amino acid sequences, that is, "ATG" which can be regarded as an initiation codon
(There are a total of 7, of which 6 have corresponding stop codons in the sequence, counting from the most downstream translation region.
The seventh "ATG" starting from the position (-16) is completed with "ATGATTGA (underlined)" immediately after the start codon of the NEO ^r gene translation region as a stop codon.) In addition, in this sequence, three units having different starting positions as constituent units of a triplet are included.
Includes sequences that can encode all types of amino acid sequences. Therefore, the transposon sequence may be about 270 bp to 190 bp counted upstream from the 5 ′ end of the NEO ^r gene translation region, but it is preferably at least about 80 bp even if it is short. The sequence at the 3 'end is "C" at the base three (-3) before the start codon of the ^NEOr gene, and "T" at the base six (-6) before it. It is a base and does not correspond to the Kozak consensus sequence (Nucleic Acids Res., 15, 8195, 1987). Therefore, this transposon sequence is _PS40DE
It was thought that the expression mechanism of the NEO ^r gene could be effectively depleted and attenuated by being located between and the gene encoding the NEO ^r protein.

(B) Preparation of Artificial Linker as Insertion Sequence As an insertion sequence, a linker can be artificially synthesized and used. In this case, the triplet is designed so as to include, as constituent units of the triplet, sequences encoding all three types of amino acid sequences having different starting positions, and to have a length of about 20 amino acids or more. Each amino acid sequence does not necessarily have to be tandem and may have overlapping shared portions. It is thought that by inserting this linker between _PSV40DE and the NEO ^r gene translation region, the expression of the NEO ^r gene can be effectively attenuated (hereinafter, this linker is described as an insertion linker). An embodiment using this synthetic linker insertion sequence is described in <8> below.

(4-2) Construction of pSVP (D) S / NEO (a) When a sequence derived from a transposon is used The cassette vector having the NEO ^r gene cistron is P
_{It is composed of sv40DE} (promoter), insertion sequence (transposon-derived sequence), NEO ^r gene translation region sequence and SV40 polyA. Since the pSVP (D) S-2 is incorporated already P _SV40DE and SV40 polyA, incorporating transposon sequences including the NEO ^r gene from Tn5 during this time. The Tn5 sequence is a commonly used pSV2-neo (J. Mol. Appl. Genet.,
1,327 p., 1982), so cut it out and use it. For pSV2-neo is used in combination with the SV40 promoter with the strong expression inducible transposon sequences including the NEO ^r gene, absolutely no commonality with usage of the present invention. FIG. 7 shows a flowchart of the production of pSVP (D) S / NEO.

(B) When an artificial synthetic linker insertion sequence is used: Since pSVP (D) S-2 has already incorporated _PSV40DE and SV40 _polyA , a synthetic linker as an insertion sequence is incorporated between them. It can be manufactured by the following. Further, as in the examples of the present invention, the expression vector pNOW / CMV finally prepared to have a transposon-derived sequence as an insertion sequence
By using -A and replacing the transposon sequence with a synthetic linker sequence, the expression vector pNOW / CMV-AA
Can also be prepared.

(4-3) Introduction of Mutation into NEO ^r Gene Translation Sequence The translation initiation portion of the NEO ^r gene is preferably a typical Kozak
In order to make a non-consensus sequence, the base immediately after the start codon "ATG" is changed to "C" or "T" which is a pyrimidine base by point mutation (actually changed to "C").
This allows the next amino acid in the Met of NEO ^r gene, from Ile
Changed to Leu or Phe. The NEO ^r gene after the introduction of this change is referred to as Mu-NEO ^r gene. Shows an array of transposon sequences and Mu-NEO ^r gene in SEQ ID NO: 26.

<5> Preparation of cassette vector [pEXP-BL2] having MCS cistron MCS cistron is a multicloning site (MCS-B) for integrating a promoter and a target protein gene.
And polyA. The promoter is hC, one of the strongest inducible promoters
The MV MIE antigen promoter is used as the source (P _CMV ).
Bovine growth hormone polyA signal has been reported to have high productivity and excellent reproducibility in polyA signal.
(bGH polyA). FIG. 8 shows a flowchart for preparing a cistron vector pEXP-BL2 having an MCS cistron.

[0039] (a) P Range P _CMV sequences of the _CMV promoter, plasmids prepared by incorporating an array of approximately 6kb containing the promoter / enhancer region of the hCMV MIE antigen pSV2-Neo pSV2-Neo / EcoH ( From Tokai University). Range of P _CMV is, 2 in the hCMV MIE gene in
A promoter / enhancer region containing all the repeating sequences of 1b, 19b, 18b, and 17b, and a primer having the nucleotide sequence shown in SEQ ID NO: 16 or 17 (restriction enzyme cleavage sequence 5 ′: EcoRV, 3 ′: ClaI was added to the end) Cut out using
EcoRV-C of plasmid pCV4 for MCS-related gene cloning
Incorporate between laI sites. The prepared plasmid was converted into pCV4 /
Called CMV.

(B) Selection of polyA bGH polyA is prepared from genomic DNA derived from bovine hepatocytes. In the literature (Gene, 11, 291 pages, 1987), the polyadenylation signal sequence can be cut out with PvuII and KpnI.
Although highly productive and reproducible results have been obtained using 29 bp, the terminator ("AATAAA") appears once in the sequence during this time. Basically, it is considered that one polyA is sufficient, but bGH poly in plasmid pCV4 / CMV is used to further stabilize the MCS cistron and terminate strongly.
A may be incorporated so that it has a double sequence ((bGH pol
yA) ² : SEQ ID NO: 27).

(C) Plasmid having MCS cistron [EXP-
BL2] In the plasmid (pEXP-BL2) thus prepared,
Between P _CMV of 3 'terminal restriction enzyme site and (bGH polyA) ² 5' ends of the restriction enzyme sites, there are multiple cloning sites for incorporation of protein gene of interest (MCS-B). That is, 5'-ClaI-NotI-KpnI-XbaI-3 'can be used. When the protein gene to be incorporated starts from the start codon, it is desirable to select ClaI or KpnI as the restriction enzyme site directly attached to the 5 ′ side.

<6> Construction of cassette vector [pSVP (D) S / DHFR] having DHFR gene cistron The DHFR region is _{composed of PSV40DE} (promoter), DHFR gene and SV40 _polyA . P _SV40DE and SV40 _polyA are already p
It is incorporated into SVP (D) S-1 and is prepared by incorporating the DHFR gene sequence into it. FIG. 6 shows a flowchart for preparing pSVP (D) S / DHFR.

The DHFR gene is derived from mouse fibroblast 3T3 (J. Bi
ol. Chem., 256, 9501, 1981), the range from 6b upstream of the start codon to about 85b downstream of the stop codon is cut out with PCR primers. The 5 'side is modified from "G" and "A" of 6 bases "GCCATC" immediately before the start codon to pyrimidine bases (for example, "TCCCTC"), and further prepared to have a PstI site on the 5' side I do. 3 'is downstream of the stop codon 85
Up to the BglII site in b. With this PCR primer, the bases on the 5 ′ side of the start codon of the DHFR gene (−6), (−3) and immediately after the start codon (+4) are originally Kozak consensus sequences, but are each a pyrimidine base. Modifications form non-consensus sequences. This changes the amino acid following the start codon of the DHFR protein from Val to Leu or Phe. This mutated DHFR gene is
u-DHFR is shown in SEQ ID NO: 25.

<7> Preparation of Expression Vector [pNOW / CMV-A] Incorporation of NEO ^r region (NEO ^r gene cistron) and target substance in the same transcription direction into a previously prepared backbone vector pBBV for constructing an expression vector. Region (MCS cistron) and DH
It is prepared by integrating in the order of FR region (DHFR gene cistron). The method is as follows. The DHFR gene cistron was cut out from SVP (D) S / DHFR with EcoRI and ApaI, and the plasmid vector pNOW-1 was prepared by ligating between the EcoRI-ApaI site of the multiple cloning site of the backbone vector pBBV to produce pSVP (D) S. From / NEO
The NEO ^r gene cistron was cut out with ClaI and SacII, and p
Ligation between the ClaI-SacII site of the multiple cloning site of NOW-1 and then crushing the ClaI site to produce plasmid pNOW-2, and SplI and EcoRV from pEXP-BL2
The CS cistron is cut out and ligated between the SplI-EcoRV sites of the pNOW-2 multicloning site to prepare the expression vector pNOW / CMV-A. FIG. 9 shows a flowchart of pNOW / CMV-A production, and FIG. 10 shows a map.

[0045] <8> the pNOW / CMV-A that produced finished of the expression vector with the synthetic linker insertion sequence [pNOW / CMV-AA] on the basis of, the sequence portion that follows the Mu-NEO ^r sequence from transposon sequences] [A sequence connecting the synthetic linker insertion sequence and the Mu-NEO ^r sequence].

(A) Preparation of Synthetic Linker In order to prepare a gene sequence containing all sequences capable of encoding three types of amino acid sequences having different starting positions as constituent units of a triplet, two linkers each having about 50 bases (MSR) were prepared. -Linker 1 (+), MSR-Linker 2 (-)) and their complementary sequences (MSR-Linker 1 (-), MSR-Linker 2 (+))
Are synthesized. These linkers were amplified by PCR, and MSR-
MSR-L complementary to "CCAAGC" at the end of Linker 1 (+)
Connect with terminal "GGTTCG" of inker 2 (-). The connected synthetic linker (SEQ ID NO: 29) has a PstI site on the 5 ′ side and an EcoRV site on the 3 ′ side.

The substitution of (b) a transposon sequences into synthetic linker insertion sequence was then used to pNOW / CMV-A, separately synthesized primer using Mu-NEO 7 bases upstream counted from the 5 'side of the ^r From the beginning to the end codon. The 5 'end of the terminal and Mu-NEO ^r' 3 in the connected synthetic linker is assigned a EcoRV,
Preparing an array of connecting the synthetic linker and Mu-NEO ^r as insertion sequence by connecting them. Since there is no suitable restriction enzyme cleavage site to cut out and substitute only the transposon sequence from pNOW / CMV-A, use the prepared [sequence connecting the synthetic linker insertion sequence and the Mu-NEO ^r sequence] pNOW / CMV-A [Mu-
Replace the sequence following the NEO ^r array]. PstI on 5 'side
Since the site has EcoRV on the 3 'side, pNOW / CMV-A must be PstI, E
coRV in cleavage, ligated the synthetic linker insertion sequence and Mu-NEO ^r sequences were connected sequence] with the same restriction enzymes. Newly produced, the insertion sequence debilitating NEO ^r gene cistron and pNOW / CMV-AA expression vector, which is a synthetic linker. For pNOW / CMV-AA production
FIG. 11 shows a flowchart for preparing pSVP (D) S / NEO-A.
Hereinafter, in the manufacturing method shown in the flowchart in FIG.
pNOW / CMV-AA is made by using pSVP (D) S / NEO-A instead of pSVP (D) S / NEO. FIG. 12 shows a map of pNOW / CMV-AA.

Next, the method of using the expression vectors of the present invention (pNOW / CMV-A and pNOW / CMV-AA) will be described. This expression vector can be used according to the following procedure.

(1) After cloning the gene of the target substance (protein), (2) integrate it into the MCS of the expression vector of the present invention (plasmid vector pNOW / CMV-A or pNOW / CMV-AA). (3) After growing the integrated expression vector,
(4) CHO cells (DHFR negative) were transfected by the ribofectin method or electroporation, and (5) G
G418-resistant cells are selected by adding and culturing 418. (6) Cloning is repeated while culturing the obtained cells, (7) A clone with a high yield of the target substance is selected, and (8) Culture is continued until the growth rate is further increased and stabilized. (9) The medium of the stabilized clone is gradually reduced from the FCS-supplemented medium to the FCS amount, and is adapted to a serum-free medium.
(10) For clones with high productivity, MTX (10 nM-1
(μM) is added stepwise to amplify the introduced plasmid gene, (11) a high-productivity clone is selected again, and (12) the culture is continued until the growth rate is further increased and stabilized. (13) The medium of the stabilized clone is gradually reduced from the FCS-supplemented medium to the FCS amount, and is adapted to a serum-free medium. The serum-free medium may be used in any of the steps (9) and (13).

Hereinafter, examples of use of the expression vector of the present invention will be described. <1> Conglutinin production test using expression vector pNOW / CMV-AA (a) Introduction of conglutinin gene and establishment of G418-resistant early clone As a target substance, bovine conglutinin which is a kind of serum lectin was selected. This protein requires a sugar chain for its activity, and is not suitable for production using Escherichia coli or yeast as a host. Cloning the bovine conglutinin gene and pNOW
/ CMV-AA
The HFR-deficient CHO cell line (transferred from Dr. Gail Urlaub) was transfected by the lipofectin method. When G418 was added to the medium and cultured, cells survived only in 33 of the 960 wells (G418 resistant strain). Most of the surviving cells produced significantly higher levels of conglutinin, but among them, 5 clones were selected as highly productive cells and subcultured, and all showed 7.0 μg / ml (4 days), The highest production level was 11.8 μg / ml. This was the highest level compared with the data of the initial clone before gene amplification by a typical expression vector reported in the literature (DNA, 7,651 pages, 1988; Biotechnology, 1).
0.1455, 1992; Biotechnology, 8,662, 1990; Gen
e, 76, 19, 1989; Biotechnology, 9, 64, 1991). Screening of recombinant cells by gene amplification usually requires 6 months to 1 year, and the differences in culture conditions and amplification stimulant concentration are large. It seems appropriate to do so. This revealed that the performance of the expression vector of the present invention was extremely high. As a result, "consumable NE
The expression vector with the O ^r gene cistron "is obtained
It was confirmed that while the number of G418 resistant strains was extremely low, it was possible to establish a highly productive cell line of the target substance protein with very high efficiency. The present inventors have carried out a number of tests using commercially available expression vectors for mammalian cells and independently developed expression vectors, but the conglutinin expression level is up to 50 ng / ml (4 days). Yes, it was not practical. This proved that the expression vector of the present invention enables a very high protein expression level.

<2> Conglutinin production test using expression vector pNOW / CMV-A (a) Introduction of conglutinin gene and establishment of G418-resistant early clone In the same manner as in <1>, a bovine conglutinin gene was transformed.
After integration into the multicloning site of pNOW / CMV-A, the gene was introduced into a DHFR-deficient CHO cell line by the lipofectin method. When G418 was added to the medium supplemented with 10% FCS and cultured, cells survived in 48 wells out of 960 wells.
(G418 resistant strains), most of these surviving cells produced significantly higher levels of conglutinin. When culturing was continued while repeating cloning, a number of high-level conglutinin-producing clones exceeding 1 μg / ml (4 days) were obtained, of which 6.8 showed the highest production level.
μg / ml. Therefore, it was proved that a G418-resistant strain with high productivity could be obtained even if a natural sequence derived from a transposon sequence satisfies the conditions as an insertion sequence. In this experiment, after stabilizing the cell line, the FCS level in the medium was reduced and the serum-free CHO-S-SFM II medium was used.
(GIBCO, hypoxanthine and thymidine were not included), it was found that adaptation was sufficient, and no significant decrease in conglutinin productivity was observed.

(B) Gene Amplification of G418-Resistant Cell Lines Among the G418-resistant cell lines, clones having the highest conglutinin production were subcultured and stabilized, and then MTX-based gene amplification was performed. Start with a medium containing 10 nM MTX.
After weekly cultivation, the cells were further amplified in a medium containing 50 nM MTX for another 2 weeks.
It increased to 18.6 μg / ml (4 days). MTX used for gene amplification
The concentration is generally set in multiple steps between 10 nM and 10 μM, and a final concentration of 1 μM is often used. However, exposure to high concentrations has a problem in establishing a stable recombinant cell line due to the problem of toxicity to cells. For this reason, the ability to achieve high productivity with low concentration MTX is also an important evaluation criterion, and was set to 50 nM in this experiment. MTX exposure period including normal selection is 6-12
The experiment was performed in about 4 weeks, whereas the experiment was performed in months. Despite these experimental conditions, an effective increase in the amount of conglutinin was observed, and the high performance of this expression vector was also confirmed in a gene amplification system. As many papers suggest, toxicity is of little concern (<1
Higher productivity can be expected by increasing the concentration level of MTX at (μM) or increasing the exposure time of MTX.

[0053]

Embodiments of the present invention will be described below.

[0054]

Example 1 (1) Preparation of Backbone Vector pBBV As a linker (BBV linker) for a multiple cloning site to be newly incorporated into plasmid pUC18, a sense DNA having the nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide sequence shown in SEQ ID NO: 2 Was synthesized. The restriction enzyme cleavage sequence of this linker is 3'-NdeI-SacII-ClaI-E
coRV-SplI-EcoRI-ApaI-5 ', 5' end is blunt
(Blunt End). Plasmid pUC18 (Takara Shuzo Co., Ltd., 1 ng (0.1 μl) was treated with restriction enzymes NdeI and PvuII to completely remove the region encoding lacZ. To this solution, the sense DNA and antisense DNA of the BBV linker were added. Add 100 pmole of each, then add 2.0 μl of Solution I of DNA Ligation Kit Ver.2 (Takara Shuzo Co., Ltd.), and add
The reaction was carried out at 30 ° C for 30 minutes. The reaction mixture was added to 0.1 ml of E. coli competent cell XL1-BLUE (STRATAGENE), reacted on ice for 30 minutes, and then subjected to heat shock at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, 0.9 ml of SOC medium (Toyobo Co., Ltd.) was added, and the cells were cultured with shaking at 37 ° C. for 1 hour on a shaker. 5,000rpm
And the supernatant was discarded. The precipitated competent cells were suspended in the solution remaining in the tube, and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C overnight, a new BBV linker D
Those into which NA was inserted were selected and designated as pBBV.

(2) Preparation of Plasmid pCV3 for Cloning SV40-Related Gene A sense having the nucleotide sequence shown in SEQ ID NO: 3 as a linker (CV3 linker) for the multicloning site of plasmid pUC119 to be removed and newly incorporated. An antisense DNA having the DNA and the base sequence shown in SEQ ID NO: 4 was synthesized. The restriction enzyme cleavage sequence of this linker is 5'-HindIII-SacII-PstI-BamHI-ClaI.
3 ′, and the 3 ′ end was Blunt End. Plasmid pUC119
(1 ng (0.1 μl) of Takara Shuzo Co., Ltd.) was treated with restriction enzymes HindIII and EcoRI. To the solution containing the obtained plasmid, 100 pmole of each of the sense DNA and antisense DNA of the CV3 linker was added, and 2.0 μl of Solution I of DNA Ligation Kit Ver. 2 was added, followed by reaction at 16 ° C. for 30 minutes.
The reaction solution was added to 0.1 ml of E. coli competent cell XL1-BLUE, reacted on ice for 30 minutes, and then heat-shocked at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, 0.9 ml of SOC medium was added, and the cells were cultured with shaking at 37 ° C. for 1 hour. 5,000rpm
And the supernatant was discarded. The precipitated competent cells were suspended in the solution remaining in the tube, and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C overnight, a new CV3 linker D
Those into which NA was inserted were selected and designated as pCV3.

(3) Preparation of a weakened SV40 promoter ( _PSV40DE ) (a) Preparation of a weakened SV40 promoter (for DHFR cistron) In order to cut out the SV40 early promoter containing SV40 Ori from plasmid pSV40 / BR, the base shown in SEQ ID NO: 5 A 5 ′ sense primer (PS1) having a sequence and a 3 ′ antisense primer (PS2) having a base sequence shown in SEQ ID NO: 6 were synthesized. At the 5 'end of the PS1 primer, PvuII of the original sequence
The site was changed to provide a SacII-EcoRI restriction enzyme site. In addition, the original HindI was added to the 3 ′ end of the PS2 primer.
Changed II site and added PstI site. To 1 ng (0.1 μl) of pSV40 / BR genome (derived from pSV40 / BR, obtained from Hiroshima University), add 100 pmole of each of these PS1 and PS2 primers, and add Taq polymerase (Takara Shuzo Co., Ltd.)
2.5 U (0.5 μl) and PCR buffer solution (250 mM Tris-HCl (25 ° C
PH 8.3), 375 mM KCl, 15 mM MgCl ₂ ) 20 μl, 100 mM DTT 1.
0 μl, 10 mM dNTP 0.5 μl (10 mM dATP, dCTP, dGTP, dTT
P), 0.25 μl of BSA acetate (4 mg / ml), and the final volume is 100 μl
Sterile water was added. One drop of mineral oil (Sigma Chemical Co.) was added to these mixed solutions under the following conditions.
PCR was performed. That is, after heating at 95 ° C for 4 minutes, 95 ° C
Three steps of 1 minute, 55 ° C. for 1 minute and 72 ° C. for 2 minutes were repeated 30 times, followed by treatment at 72 ° C. for 10 minutes to terminate the reaction. Take out the aqueous phase from this PCR reaction solution and 10 μl of it
Was added with 2 μl of a 10 × H solution, and then the restriction enzyme SacII 20U (1
μl) and 20 U (1 μl) of PstI, 7 μl of sterile water was added, and the mixture was reacted at 37 ° C. for 1 hour. The reaction solution was subjected to electrophoresis at 50 mA for 30 minutes using a 0.8% agarose gel. Approximately 0.35 kb detected by irradiating the gel with 360 nm UV light
Cut out the band. This agarose fragment was placed in a 1.5 ml tube and centrifuged at 15,000 rpm for 10 minutes in a centrifuge,
The obtained aqueous solution was separated with a pipette to obtain a DNA solution.

To the solution obtained by treating the plasmid pCV3 with SacII and PstI, 5 μl of the above DNA solution was added, and then 2.0 μl of solution I of DNA Ligation Kit Ver.
The reaction was performed at 6 ° C. for 30 minutes. The reaction mixture was added to 0.1 ml of E. coli competent cell XL1-BLUE (STRATAGENE), reacted on ice for 30 minutes, and then subjected to heat shock at 42 ° C. for 60 seconds. Two
After placing on ice for 0.9 minutes, 0.9 ml of SOC medium was added, and the cells were cultured with shaking at 37 ° C. for 1 hour. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. Suspend the precipitated competent cells with the solution remaining in the tube and prepare two 100
Plated on ampicillin plates containing μg / ml ampicillin. After culturing at 37 ° C. overnight, a plasmid newly inserted with the SV40 promoter DNA was selected from plasmids obtained from the resulting colonies and designated as pSV0a. Further self-ligation of this plasmid with the restriction enzyme SphI
(Self-ligation) to remove the enhancer portion, _{resulting in} a P _SV40DE with a SacII-EcoRI site at the 5 'end.
A plasmid pSVP1a having the following sequence was prepared.

[0058] (b) 5 'sense primer having the nucleotide sequence of manufacturing SEQ ID NO: 5 of the weakened SV40 promoter (for NEO ^r gene cistron)
In place of (PS1), another 5 ′ sense primer (PS3) having the nucleotide sequence shown in SEQ ID NO: 7 was synthesized and used, except that the weakened SV40 promoter (DHFR gene cistron in Preparation and similar methods use), to produce plasmid pSVP1b having weakened SV40 promoter P _SV40DE for NEO ^r gene cistron. This PS3 primer is 5 '
Only the SacII site is added at the end (EcoRI site is not added). 3 'antisense primer is the same
(PS2: SEQ ID NO: 6) was used.

(4) Preparation of SV40 polyA The EcoRI site was crushed by ligating the SPSV40 linker to the 3 ′ terminal EcoRI site of the SV40 polyA signal sequence of the plasmid pSV40pA-A, and the site was changed to an ApaI-ClaI site. First, as an SPSV40 linker, a sense DNA having the nucleotide sequence shown in SEQ ID NO: 8 and an antisense DNA having the nucleotide sequence shown in SEQ ID NO: 9 were synthesized. Plasmid pSV40pA
-A 1 ng (0.1 μl) was digested with the restriction enzyme EcoRI, and the resulting solution was subjected to SPSV40 linker sense DNA.
And antisense DNA, 100 pmole each, then DNA
Add 2.0 μl of solution I of Ligation Kit Ver.
The reaction was performed for 30 minutes. E. coli competent cell XL
1-BLUE 0.1 ml, after reacting on ice for 30 minutes, 42 ℃
For 60 seconds. After 2 minutes on ice,
0.9 ml of SOC medium was added, and the cells were shake-cultured at 37 ° C. for 1 hour with a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded.
The competent cells precipitated with the solution remaining in the tube were suspended and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C overnight, select a plasmid newly obtained with SPSV40 linker DNA inserted from the resulting colonies and p
SV40pA-B.

(5) Preparation of cassette incorporating weakened SV40 promoter and SV40 polyA (a) Plasmid pSVP (D) S-1 for cistron construction of DHFR gene
Preparation of plasmid pSV40pA-B 1 ng (0.1 μl) with restriction enzyme BamHI 20U
(1 μl) and Cla I 20 U (1 μl) were added, and 7 μl of sterilized water was added, followed by a reaction at 37 ° C. for 1 hour. The reaction solution was subjected to electrophoresis at 50 mA for 30 minutes using a 0.8% agarose gel.
Approximately 0.8 kb detected by irradiating the gel with ultraviolet light of 360 nm wavelength
Cut out the band. This agarose fragment was placed in a 1.5 ml tube and centrifuged at 15,000 rpm for 10 minutes in a centrifuge,
The obtained aqueous solution was separated with a pipette to obtain a DNA solution.
On the other hand, after treating the plasmid pSV1a with the restriction enzymes BamHI and ClaI, the above DNA was added to 1 ng / 0.1 μl of the obtained solution.
Add 0.5 μl of the solution, and add DNA ligation kit Ver.2 I
2.0 μl of the solution was added and reacted at 16 ° C. for 30 minutes. Add the reaction solution to 0.1 ml of E. coli competent cell XL1-BLUE and place on ice for 30 minutes.
After reacting for 2 minutes, heat shock was applied at 42 ° C. for 60 seconds.
After placing on ice for 2 minutes, add 0.9 ml of SOC medium, and add 1 ml at 37 ° C.
The cells were cultured with shaking for an hour on a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. The precipitated competent cells are suspended in the solution remaining in the tube, and two cells are suspended at a ratio of 1:10.
Plated on ampicillin plates containing 100 μg / ml ampicillin. After culturing at 37 ° C. overnight, a newly inserted plasmid into which SV40 poly A DNA had been inserted was selected from plasmids obtained from the resulting colonies and designated as pSVP (D) S-1.

(B) Preparation of plasmid pSVP (D) S-2 for constructing the NEO ^r gene cistron pSV (D) S-1
SV40 polyA DNA obtained from 40pA-B and plasmid pSVP1
The b Based to produce plasmid pSVP (D) S-2 with the weakened SV40 promoter and SV40 polyA for NEO ^r gene cistron.

(6) Preparation of cassette vector having DHFR gene cistron (6-1) Cloning of DHFR gene (a) Isolation of DHFR mRNA After culturing mouse fibroblast cell line 3T3 to obtain 10 ⁷ cells, guanidine was obtained. Isothiocyanate method (Meth.Enzymol., 152, 219)
MRNA, p. 1987). First, cells were suspended in a flask, and the obtained cells were suspended again in sterilized PBS and transferred to a centrifuge tube. Temperature condition 0 ° C
Centrifugation was performed at 450 × G for 10 minutes under the supernatant and the supernatant was discarded. 6 M GTG-CsCl, 10 mM sodium citrate, 0.1 ml β-
The cells obtained were added to a mixed solution of mercaptoethanol and 0.5% sarkosyl, suspended and lysed, and RNA was fragmented through an 18-gauge injection needle. 2.5 ml of the thus obtained 5.7 M CsCl, 0.1 M EDTA solution in an ultracentrifuge tube
Layered over 2.5 ml. 35,000r using an ultracentrifuge
After centrifugation at pm for 8 hours, the supernatant was carefully discarded, and the RNA fraction precipitated on the bottom was dissolved in sterilized water saturated with phenol extracted and saturated. Ethanol was added thereto, and RNA was precipitated by centrifugation at 12,000 rpm. The precipitate is then
After washing twice, it was air-dried. The obtained RNA was resuspended in 3 ml of RNase-free water. The concentration of the mRNA sample thus obtained was about 0.3 μg / μl according to the absorbance at 260 nm.

(B) Preparation of DHFR cDNA In order to amplify the DHFR gene by PCR, a 5 ′ sense primer (PD1) having the nucleotide sequence shown in SEQ ID NO: 10 and a 3 ′ antisense having the nucleotide sequence shown in SEQ ID NO: 11 A primer (PD2) was synthesized. The 5 'end is a sequence in which a nonsense pyrimidine sequence "TCCCTC" is artificially linked to the PstI site, and the 3' end is BglII, which is about 85b downstream from the stop codon.
Included up to the site. To synthesize cDNA,
A 10 μl solution containing 2 μg of total RNA was used. Sterilized R
In a Nase-free tube, add PCR buffer (250 mM Tris-H
Cl (pH 8.3 at 25 ° C), 375 mM KCl, 15 mM MgCl ₂ ) 20 μl, 100 m
M DTT 1.0 μl, 10 mM dNTP 0.5 μl (10 mM dATP, dCTP, dGT
P, dTTP), 0.25 μl of BSA acetate (4 mg / ml), 2.0 μg of oligo dT primer, 0.5 μl of PCR reverse transcriptase (200 units / μl) 0.5 μl
μl of RNase-free DEPC water was added. These at 37 ° C for 60
After incubation for 70 minutes, the reaction was stopped by heating at 70 ° C. for 15 minutes. The obtained cDNA was directly added to the prepared reaction solution for PCR. To this solution were added 100 pmole of each of the PD1 primer and the PD2 primer, and then 2.5 U (0.5 μl) of Taq polymerase (Takara Shuzo Co., Ltd.) and a PCR buffer solution (250 mM T
ris-HCl (pH 8.3 at 25 ° C), 375 mM KCl, 15 mM MgCl ₂ ) 20 μl,
100 mM DTT 1.0 μl, 10 mM dNTP 0.5 μl (10 mM dATP, dC
TP, dGTP, dTTP) and 0.25 μl of BSA acetate (4 mg / ml) were added, and sterile water was added to a final volume of 100 μl. One drop of mineral oil (Sigma Chemical Co.) was added to these mixed solutions, and PCR was performed under the following conditions. That is, after the heat treatment at 95 ° C. for 4 minutes, three steps of 95 ° C. for 1 minute, 55 ° C. for 1 minute and 72 ° C. for 2 minutes were repeated 30 times, followed by treatment at 72 ° C. for 10 minutes to terminate the reaction. Take out the aqueous phase from this PCR reaction solution, add 2 μl of 10 × H solution to 10 μl of it, and then
20 μL (1 μl) of PstI and 20 μL (1 μl) of BglII were added, and 7 μl of sterilized water was added, followed by a reaction at 37 ° C. for 1 hour. The reaction solution is
The sample was subjected to electrophoresis at 50 mA for 30 minutes using 0.8% agarose gel. The gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 0.65 kb detected. This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution.

(6-2) Construction of cassette vector pSVP (D) S / DHFR having DHFR gene cistron Plasmid pSVP (D) S-1 was partially digested with restriction enzymes PstI and BamHI (this was SV40 polyA
One PstI site is included in it.)
0.5 μl of DHFR DNA solution to 0.1 μl (1 ng DNA) of this solution
Was added at the 5 ′ end with PstI and at the 3 ′ end with a protruding end of BamHI and BglII. At this time, 2.0 μl of solution I of DNA ligation kit Ver. 2 was added and reacted at 16 ° C. for 30 minutes. The reaction solution was added to 0.1 ml of E. coli competent cell XL1-BLUE, reacted on ice for 30 minutes, and then heat-shocked at 42 ° C. for 60 seconds. After 2 minutes on ice, 0.9 ml of SOC medium
In addition, the cells were cultured with shaking at 37 ° C. for 1 hour. 5,000rp
After centrifugation at 1 m for 1 minute, the supernatant was discarded. The precipitated competent cells were suspended in the solution remaining in the tube, and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing overnight at 37 ° C., a plasmid obtained from the resulting colony, in which DHFR DNA was newly inserted, and which had an ApaI restriction enzyme site, was selected. The DHFR gene was excised from this plasmid and sequenced so that the base at position (+4) from the entire DHFR gene sequence and start codon "ATG" was "A".
Was changed to "C" (Mu-DHFR, SEQ ID NO: 25).

[0065] (7) NEO ^r Preparation of cassette vector with gene cistron (a) Preparation NEO ^r gene region of NEO ^r gene containing a transposon sequence consists 354 bases 5 'upstream of the transposon sequences and NEO ^r gene translation Those with connected areas were used. Since this sequence was derived from Tn5 and contained in pSV2-neo, it was cut out and used. First, a 5 ′ sense primer (PN1) having the nucleotide sequence shown in SEQ ID NO: 12 and a 3 ′ antisense primer (PN2) having the nucleotide sequence shown in SEQ ID NO: 13 were synthesized. The PstI site was added to the 5 ′ end of the PN1 primer by changing the HindIII site of the original sequence. In addition, a BamHI site was added to the 3 ′ end of the PN2 primer by changing the original SmaI site. 1 ng (0.1 μl) of pSV2-neo genome, these PN1 primers and PN2
100 pmole of each primer was added, then 2.5 U (0.5 μl) of Taq polymerase and PCR buffer solution (250 mM Tris-HCl
(PH 8.3 at 25 ° C), 375 mM KCl, 15 mM MgCl ₂ ) 20 μl, 100 mM DTT
1.0 μl, 10 mM dNTP 0.5 μl (10 mM dATP, dCTP, dGTP, dTT
P), 0.25 μl of BSA acetate (4 mg / ml), and the final volume is 100 μl
Sterile water was added. One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, after a heat treatment at 95 ° C for 4 minutes, three steps of 95 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 2 minutes were repeated 30 times,
The reaction was completed by treating at 10 ° C. for 10 minutes. Take out the aqueous phase from this PCR reaction solution and add 10 μl of 2 × 10 × H solution
l followed by the restriction enzymes PstI 20U (1 μl) and BamHI
After adding 20 U (1 μl) and adding 7 μl of sterilized water, the reaction was carried out at 37 ° C. for 1 hour. The reaction solution used 0.8% agarose gel
The sample was subjected to electrophoresis at 50 mA for 30 minutes. The gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 1.3 kb detected. This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution.

(B) Construction of cassette vector pSVP (D) S / NEO having NEO ^r gene cistron Plasmid pSVP (D) S-2 was subjected to partial digestion treatment with PstI and BamHI (this was also carried out in SV40 polyA.
I site is included in one place). This solution
0.5 μl of NEO ^r gene DNA solution per 0.1 μl (1 ng DNA)
Was added and ligated between the PstI-BamHI site. For this reaction, 2.0 μl of Solution I of DNA Ligation Kit Ver. 2 was used.
Was added and reacted at 16 ° C. for 30 minutes. The reaction solution was added to 0.1 ml of E. coli competent cell XL1-BLUE, reacted on ice for 30 minutes, and then heat-shocked at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, 0.9 ml of SOC medium was added, and the cells were cultured with shaking at 37 ° C. for 1 hour on a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. The competent cells precipitated with the solution remaining in the tube were suspended and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. 37
℃ and cultured overnight at were chosen resulting in new rata among the obtained plasmids from colonies which are inserted a transposon sequence DNA comprising NEO ^r gene was confirmed by G418 resistance.

[0067] (c) NEO partially directed mutagenesis to ^r gene NEO ^r gene translation region initiation codon "ATG" of the immediately following base "A"
Was changed to "C", an antisense primer for mutagenesis having the nucleotide sequence shown in SEQ ID NO: 24 was synthesized.
100 pmole of this antisense primer was added to 1 ng (1 μl) of pSVP (D) / NEO genome, and PCR in vitro Mutagenes
Site-specific mutation using is Kit (Takara Shuzo Co., Ltd.)
(site-directed mutagensis). Taq polymerase 2.5 U (0.5 μl) and PCR buffer solution (250 mM Tris-HCl (2
PH 8.3 at 5 ° C), 375 mM KCl, 15 mM MgCl ₂ ) 20 μl, 100 mM DTT
1.0 μl, 10 mM dNTP 0.5 μl (10 mM dATP, dCTP, dGTP, dTT
P), 0.25 μl of BSA acetate (4 mg / ml), and the final volume is 100 μl
Sterile water was added. One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, after a heat treatment at 95 ° C for 4 minutes, three steps of 95 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 2 minutes were repeated 30 times,
The reaction was completed by treating at 10 ° C. for 10 minutes. The prepared plasmid vector was designated as pSVP (D) S / NEO. From the transposon sequence, a sequence consisting of the NEO ^r gene was cut out and resequenced, whereby the entire base sequence and the base at position (+4) immediately after the NEO ^r gene start codon “ATG” were “A” From "C" to "C" (Mu-NE
^Or gene). This sequence is shown in SEQ ID NO: 26.

(8) Preparation of cassette vector having MCS cistron Preparation of plasmid pCV4 for cloning of MCS-related gene
As a linker (CV4 linker) for a multicloning site into which a related gene was incorporated, a sense DNA having the nucleotide sequence shown in SEQ ID NO: 14 and an antisense DNA having the nucleotide sequence shown in SEQ ID NO: 15 were synthesized. The restriction enzyme cleavage sequence of this linker is 3'-HindIII-EcoRV-ClaI-Not
I-KpnI-XbaI-BglII-SplI-EcoRI-5 '. Plasmid pUC18 (1 ng (0.1 μl)) with restriction enzymes HindIII and Eco
After treatment with RI, to the solution containing the obtained plasmid, 100 pmole of each of sense DNA and antisense DNA of the CV4 linker was added, and then DNA ligation kit Ve
2.0 μl of solution I of r.2 was added, and reacted at 16 ° C. for 30 minutes. The reaction solution was added to 0.1 ml of E. coli competent cell XL1-BLUE, reacted on ice for 30 minutes, and then heat-shocked at 42 ° C. for 60 seconds. After 2 minutes on ice, add 0.9 ml of SOC medium and add
The cells were cultured with shaking at 1 ° C. for 1 hour on a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. Suspend the precipitated competent cells with the solution remaining in the tube and add 1:10
Plates were plated on ampicillin plates containing 100 μg / ml ampicillin. After culturing at 37 ° C. overnight, a plasmid having a newly inserted CV4 linker DNA was selected from plasmids obtained from the resulting colonies and designated as pCV4.

B. Since the preparation plasmid pSV2-neo / EcoH Preparation of P _CMV and embedded (a) P _CMV cut out P _CMV, 5 'sense primer having the nucleotide sequence shown in SEQ ID NO: 16
(PC1) and a 3 ′ antisense primer (PC2) having the nucleotide sequence shown in SEQ ID NO: 17 were synthesized. 5 'of PC1 primer
An EcoRV site was added to the side end, and a ClaI site was added to the 3 ′ end of the PS2 primer. Plasmid pSV2-neo / EcoH
To 1 ng (0.1 μl) of the genome, 100 pmole of each of these PC1 and PC2 primers was added, and then 2.5 U (0.5 μl) of Taq polymerase and PCR buffer solution (250 mM Tris
-HCl (pH 8.3 at 25 ° C), 375 mM KCl, 15 mM MgCl ₂ ) 20 μl, 100 mM
DTT 1.0 μl, 10 mM dNTP 0.5 μl (10 mM dATP, dCTP, dGTP, dTTP
TP), 0.25 μl of BSA acetate (4 mg / ml) to a final volume of 100 μl
l of sterile water was added. One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, after the heat treatment at 95 ° C for 4 minutes, three steps of 95 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 2 minutes were repeated 30 times,
The reaction was completed by treating at 72 ° C. for 10 minutes. Take out the aqueous phase from this PCR reaction solution and add 2 μl of 10 × H solution to 10 μl of this.
, Followed by the restriction enzymes EcoRV 20U (1 μl) and ClaI 2
After adding 0 U (1 μl) and adding 7 μl of sterilized water, the mixture was reacted at 37 ° C. for 1 hour. The reaction solution used 0.8% agarose gel
The sample was subjected to electrophoresis at 50 mA for 30 minutes. The gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 0.6 kb detected. This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution.

[0070] (b) incorporation into MCS cistron related gene cloning plasmid of P _CMV Meanwhile, treated with restriction enzymes EcoRV and ClaI plasmid pCV4 1ng (1μl) of the side to be incorporated, a solution containing the resulting plasmid in contrast, addition of P _CMV DNA solution 0.5 [mu] l,
We ligated between EcoRV-ClaI sites. In this reaction,
Add 2.0 μl of Solution I of DNA Ligation Kit Ver.2, add 16
The reaction was carried out at 30 ° C for 30 minutes. After adding the reaction solution to 0.1 ml of E. coli competent cell XL1-BLUE and reacting on ice for 30 minutes,
Heat shock was applied at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, 0.9 ml of SOC medium was added, and the cells were cultured with shaking at 37 ° C. for 1 hour on a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. The precipitated competent cells were suspended in the solution remaining in the tube, and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C overnight, plasmids obtained from the resulting colonies
DNA of P _CMV was the PCV4 / CMV picks what is inserted.

C. Preparation and Incorporation of bGH polyA 10mM Tris-HCl (pH
8.0), 10 mM DETA, 0.1% SDS) and mixed gently. After incubating at 55 ° C for 1 hour, the cells were further incubated at 37 ° C overnight. An equal volume of neutral phenol equilibrated with Tris was added and gently mixed at room temperature for 20 minutes. After centrifugation at 2,000 × G for 10 minutes at room temperature, the resulting upper layer (5
ml) was collected, transferred to a new tube, and centrifuged again under the same conditions. After the upper layer was collected again and transferred to a new tube, a double volume of 100% ethanol was overlaid, and the buffer and ethanol were mixed with gentle stirring. The obtained DNA was collected by winding it up with a glass rod, then air-dried, put in 5 ml of a TE solution, and dissolved at 4 ° C. overnight. The concentration of the obtained DNA sample was about 0.5 μg /
μl.

(B) Incorporation of bGH polyA gene into MCS cistron-related gene cloning plasmid (1) To connect the bGH polyA sequence doubly, two types of bGHpolyA sequences having different restriction enzyme sites were prepared. Therefore, in advance, two pairs of 5 ′ sense primer and 3 ′ antisense primer, that is, a 5 ′ sense primer (PB11) having the base sequence shown in SEQ ID NO: 18 of the first combination
And a 3 ′ antisense primer (PB12) having the nucleotide sequence shown in SEQ ID NO: 19, and a 5 ′ sense primer (PB2
3) An antisense primer (PB22) having the nucleotide sequence shown in 1) and SEQ ID NO: 21 was synthesized.

100 ng of the obtained DNA sample was taken out,
Using a PCR template, a bGH polyA sequence having a desired restriction enzyme cleavage sequence at each end was prepared. First, DNA sample 100ng
(1 μl) to the first combination of sense primers
100 pmole each of PB11 and antisense primer PB12
In addition, Taq polymerase 2.5U (0.5μl) and PCR buffer solution
(250 mM Tris-HCl (pH 8.3 at 25 ° C), 375 mM KCl, 15 mM MgCl
₂ ) 20 μl, 100 mM DTT 1.0 μl, 10 mM dNTP 0.5 μl (10 mM
dATP, dCTP, dGTP, dTTP) and 0.25 μl of BSA acetate (4 mg / ml) were added, and sterilized water was added to a final volume of 100 μl.
One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, after heat treatment at 95 ° C for 4 minutes,
3 steps of 95 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 2 minutes
After repeating 0 times, the reaction was terminated by treating at 72 ° C. for 10 minutes. The aqueous phase was taken out from the PCR reaction solution, 2 μl of a 10 × H solution was added to 10 μl of the aqueous phase, and then the restriction enzyme XbaI
20 U (1 μl) and BglII 20 U (1 μl) were added, and sterile water was added
After adding μl, the mixture was reacted at 37 ° C. for 1 hour. The reaction solution is 0.8%
The cells were subjected to electrophoresis at 50 mA for 30 minutes using an agarose gel. The gel was irradiated with 360nm ultraviolet light and detected.
A 0.23 kb band was cut out. Add this agarose fragment to 1.
The mixture was placed in a 5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution.

The above DNA solution was added to 0.1 μl (1 ng DNA) of the solution obtained by treating the plasmid pCV4 with XbaI and BglII.
Add 0.5 μl, then add DNA Ligation Kit Ver.2
2.0 μl of Solution I was added and reacted at 16 ° C. for 30 minutes. Add the reaction solution to 0.1 ml of E. coli competent cell XL1-BLUE, and place on ice
After reacting for 0 minutes, heat shock was applied at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, add 0.9 ml of SOC medium and add
For 1 hour with a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. The precipitated competent cells are suspended in the solution remaining in the tube, and two 1: 1 ratios are prepared.
Plated on ampicillin plates containing 00 μg / ml ampicillin. After culturing at 37 ° C. overnight, a plasmid obtained from the resulting colony, into which bGH polyA DNA had been newly inserted, was selected and designated as pCV4 / CMV-bGH1.

(C) Incorporation of bGH polyA gene into plasmid for cloning MCS cistron-related gene (2) Subsequently, 1 ng (1 μl) of the DNA sample obtained by PCR amplification with the combination of the first primer was taken out. Then, 100 pmole of each of the sense primer PB21 and the antisense primer PB22 of the second combination was added, and then 2.5 U (0.5 μl) of Taq polymerase and a PCR buffer solution (250 mM Tris-HCl
(PH 8.3 at 25 ° C), 375 mM KCl, 15 mM MgCl ₂ ) 20 μl, 100 mM DTT
1.0 μl, 10 mM dNTP 0.5 μl (10 mM dATP, dCTP, dGTP, dTT
P), 0.25 μl of BSA acetate (4 mg / ml), and the final volume is 100 μl
Sterile water was added. One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, after the heat treatment at 95 ° C for 4 minutes, three steps of 95 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 2 minutes were repeated 30 times,
The reaction was completed by treating at 2 ° C. for 10 minutes. Take out the aqueous phase from this PCR reaction solution and add 10 μl of 2 × 10 × H solution
Followed by the restriction enzymes XbaI 20U (1 μl) and BglII 20
U (1 μl) was added, and 7 μl of sterile water was added, followed by a reaction at 37 ° C. for 1 hour. The reaction solution was 50% using 0.8% agarose gel.
mA was subjected to electrophoresis for 30 minutes. The gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 0.47 kb detected. This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution.

The plasmid pCV4 / CMV-bGH1 was replaced with BamHI and Sp
To 0.1 μl (1 ng DNA) of the solution after treatment with lI, 0.5 μl of the above DNA solution was added, followed by 2.0 μl of Solution I of DNA Ligation Kit Ver. 2 and reacted at 16 ° C. for 30 minutes.
The reaction solution was added to 0.1 ml of E. coli competent cell XL1-BLUE, reacted on ice for 30 minutes, and then heat-shocked at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, 0.9 ml of SOC medium was added, and the cells were cultured with shaking at 37 ° C. for 1 hour on a shaker. 5,000rpm
And the supernatant was discarded. The competent cells precipitated with the solution remaining in the tube were suspended and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C. overnight, a new second bGH polyA
A DNA inserted, that is, a DNA (bGH polyA) ² into which bGH polyA was double-bonded was selected, and this was designated as a cassette vector pEXP-BL2 having an MCS cistron. The produced pEXP-BL2 was excised with XbaI and SplI, sequenced again, and the sequence was confirmed (SEQ ID NO: 27).

(9) Construction of expression vector pNOW / CMV-A (a) Incorporation of DNA sequence constituting DHFR cistron (preparation of plasmid pNOW-1) H solution 1μl
Was added, and the restriction enzyme EcoRI20U (1 μl) was added, followed by reaction at 37 ° C. for 1 hour. The reaction solution was 50% using 0.8% agarose gel.
The gel was subjected to electrophoresis for 30 minutes, and the gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 1.75 kb detected.
This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution. This DNA sequence constitutes the DHFR gene cistron, and consists of _PSV40DE , Mu-DHFR gene and SV40 _polyA .

On the other hand, the DN constituting the DHFR gene cistron
1 ng (1 μl) of the plasmid pBBV into which the A sequence was integrated was treated with restriction enzymes EcoRV and ApaI. To the solution containing the obtained plasmid, 0.5 μl of a DNA solution of a sequence constituting the DHFR gene cistron was added, and ligated between EcoRV-ApaI sites. To this reaction, 2.0 μl of Solution I of DNA Ligation Kit Ver. 2 was added and reacted at 16 ° C. for 30 minutes. The reaction solution was added to 0.1 ml of E. coli competent cell XL1-BLUE, reacted on ice for 30 minutes, and then heat-shocked at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, add 0.9 ml SOC medium
In addition, the cells were cultured with shaking at 37 ° C for 1 hour using a shaker. 5,000r
After centrifugation at pm for 1 minute, the supernatant was discarded. The precipitated competent cells were suspended in the solution remaining in the tube, and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C overnight, a plasmid obtained from the resulting colony was selected out of the plasmids into which the DNA sequence constituting the DHFR gene cistron had been inserted.
NOW-1.

(B) DNA Constituting NEO ^r Gene Cistron
Incorporation of sequence (preparation of plasmid pNOW-2) 1 μl of 10 × H solution in 100 ng (1 μl) of plasmid pSVP (D) S / NEO
And the restriction enzymes SacI 20U (1 μl) and ClaI 20U (1 μl)
Was added and reacted for 1 hour. The reaction solution was subjected to electrophoresis at 50 mA for 30 minutes using a 0.8% agarose gel, and the gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 2.4 kb detected. This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution. This sequence is the DNA sequence that makes up the NEO ^r cistron, _PSV40DE ,
Transposon sequence, Mu-NEO ^r gene and SV40 polyA
Consists of

[0080] On the other hand, DN that make up the NEO ^r gene cistron
Plasmid pNOW-1 1 ng (1 μl) into which the A sequence is incorporated
Was treated with restriction enzymes SacII and ClaI. To a solution 1 ng (0.1 [mu] l) containing the resulting plasmid, the DNA solution 0.5μl of sequence constituting NEO ^r gene cistron was added, SacI-
Ligated between ClaI sites. To this reaction, 2.0 μl of Solution I of DNA Ligation Kit Ver.
Allowed to react for minutes. The reaction solution was used for E. coli competent cell XL1-
Add 0.1 ml of BLUE and react for 30 minutes on ice.
Heat shock was applied for 0 seconds. After placing on ice for 2 minutes, SOC
0.9 ml of the medium was added, and cultured with shaking at 37 ° C. for 1 hour using a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. The competent cells precipitated with the solution remaining in the tube were suspended and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. Incubate at 37 ° C overnight,
DNA sequences constituting the NEO ^r gene cistron of plasmid obtained from the resulting colonies chose what is inserted (pNOW-2P).

To remove the ClaI site from the multiple cloning site of the obtained plasmid pNOW-2P, ApaI-Cl
The ClaI site was removed by replacing the aI-EcoRV portion with a newly synthesized ApaI-EcoRV linker. First, as this linker, a sense DN having a base sequence of 5′-CGAT-3 ′
Antisense DNA having A and 3'-CGGGCTA-5 'base sequence
Was synthesized. After digesting 1 ng (0.1 μl) of plasmid pNOW-2P with restriction enzymes ApaI and EcoRV, 100 pmole of ApaI-EcoRV linker sense DNA and antisense DNA were added to the resulting solution, and then DNA ligation kit Ver. 2 2.0 μl of Solution I was added and reacted at 16 ° C. for 30 minutes. The reaction solution is E. coli competent cell XL1-BLUE0.1m
After reacting on ice for 30 minutes, heat shock was applied at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, the SOC medium was brought to 0.
9 ml was added, and the cells were cultured with shaking at 37 ° C. for 1 hour using a shaker. 5,00
After centrifugation at 0 rpm for 1 minute, the supernatant was discarded. Suspend the precipitated competent cells with the solution remaining in the tube and add 1:10
And spread on two ampicillin plates containing 100 μg / ml ampicillin. After culturing at 37 ° C. overnight, a new plasmid which could not be digested with ClaI was selected from plasmids obtained from the resulting colonies and designated as pNOW-2.

(C) Incorporation of DNA sequence constituting MCS cistron (Preparation of plasmid pNOW / CMV-A) 1 μl of a 10 × H solution was added to 100 ng (1 μl) of plasmid pEXP-BL2, and the restriction enzymes EcoRV 20U (1 μl) and 20 U (1 μl) of SplI was added and reacted for 1 hour. The reaction solution was subjected to electrophoresis at 50 mA for 30 minutes using a 0.8% agarose gel. The gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 1.1 kb detected. This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution. This sequence is a DNA sequence that constitutes the MCS cistron, P _CMV, MCS-
B, and (bGH polyA) ² .

On the other hand, the plasmid pNOW-21ng (0.1 μl) into which the DNA sequence constituting the MCS cistron was integrated was treated with the restriction enzymes EcoRV and SplI. To 1 ng (0.1 μl) of the solution containing the obtained plasmid, 0.5 μl of a DNA solution of a sequence constituting the MSC cistron was added, and ligated between EcoRV-SplI sites. To this reaction, 2.0 μl of Solution I of DNA Ligation Kit Ver. 2 was added and reacted at 16 ° C. for 30 minutes. The reaction solution was added to 0.1 ml of E. coli competent cell XL1-BLUE, reacted on ice for 30 minutes, and then heat-shocked at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, add 0.9 ml SOC medium
In addition, the cells were cultured with shaking at 37 ° C. for 1 hour. 5,000rp
After centrifugation at 1 m for 1 minute, the supernatant was discarded. The competent cells precipitated with the solution remaining in the tube were suspended and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C. overnight, plasmids obtained by inserting a DNA sequence constituting MSC cistron were selected from plasmids obtained from the resulting colonies. The expression vector thus produced was designated as pNOW / CMV-A. With respect to this expression vector pNOW / CMV-A, each constituent part was fragmented with a restriction enzyme, and each was sequenced and joined to confirm that each gene sequence was correctly inserted.

[0084]

Example 2 (1) Expression Vector pNOW / CMV Having Synthetic Linker Insertion Sequence
Construction of -AA (a) Preparation of a synthetic linker In order to prepare a gene sequence comprising all the sequences that can encode three types of amino acid sequences having different starting positions as constituent units of a triplet, as a first sequence,
A linker having the nucleotide sequence shown in SEQ ID NO: 30 (MSR-lin
ker 1 (+)) and its complementary sequence shown in SEQ ID NO: 31 (MSR-link
er 1 (-)) was synthesized. Next, as a second sequence, SEQ ID NO: 3
Linker having the nucleotide sequence shown in 3 (MSR-linker 2 (-))
And its complementary sequence shown in SEQ ID NO: 32 (MSR-linker 2 (+))
Was synthesized. MSR-linker 1 (+) has a PstI site at the 5 ′ end and a sequence “CCAAGC” at the 3 ′ end for annealing and connection with MSR-linler 2. Also, MSR-li
The 3 ′ end of nker 2 (−) has an EcoRV site, and the 5 ′ end has a sequence “GGTTCG” for annealing and connecting to the first sequence.

(B) Connection of two linkers Using a PCR template, an MSR linker sequence having a desired restriction enzyme cleavage sequence at both ends was prepared. First combination of sense MSR-linker 1 (+) and antisense MSR-linker
Prepare 1 (-) of 100 pmole for each, and add Taq polymerase 2.5
U (0.5 μl) and PCR buffer solution (250 mM Tris-HCl (p
H8.3), 375mM KCl, 15mM MgCl ₂ ) 20μl, 100mM DTT 1.0μ
l, 10mM dNTP 0.5μl (10mM dATP, dCTP, dGTP, dTT
P), 0.25 μl of BSA acetate (4 mg / ml), and the final volume is 100 μl
Sterile water was added. One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, after a heat treatment at 95 ° C for 4 minutes, three steps of 95 ° C for 1 minute, 55 ° C for 1 minute and 72 ° C for 2 minutes were repeated 30 times,
The reaction was completed by treating at 10 ° C. for 10 minutes. Take out the aqueous phase from this PCR reaction solution and add 10 μl of 2 × 10 × H solution
, Followed by restriction enzymes PstI 20U (1 μl) and EcoRVI
After adding 20 U (1 μl) and adding 7 μl of sterilized water, the reaction was carried out at 37 ° C. for 1 hour. The reaction solution used 0.8% agarose gel
The sample was subjected to electrophoresis at 50 mA for 30 minutes. The gel was irradiated with ultraviolet light having a wavelength of 360 nm, and a band of about 0.1 kb detected was cut out. This agarose fragment was placed in a 1.5 ml tube, centrifuged at 15,000 rpm for 10 minutes with a centrifuge, and the obtained aqueous solution was separated with a pipette to obtain a DNA solution.

The above DNA solution was added to 0.1 μl (1 ng DNA) of the solution obtained by treating the plasmid pUC18 with PstI and SmaI.
Add 0.5 μl, then add DNA Ligation Kit Ver.2
2.0 μl of Solution I was added and reacted at 16 ° C. for 30 minutes. Add the reaction solution to 0.1 ml of E. coli competent cell XL1-BLUE, and place on ice
After reacting for 0 minutes, heat shock was applied at 42 ° C. for 60 seconds. After placing on ice for 2 minutes, add 0.9 ml of SOC medium and add
For 1 hour with a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. The precipitated competent cells were suspended in the solution remaining in the tube, and two cells were suspended at a ratio of 1:10.
Plated on ampicillin plates containing 100 μg / ml ampicillin. After culturing overnight at 37 ° C., a plasmid obtained by inserting a new MSR linker DNA from the resulting colonies was selected as pUC18 / MSR.

[0087] (c) Mu-NEO ^r gene translation for cropping Mu-NEO ^r gene coding region from the cut pSVP (D) S / NEO region, 5 'sense primer having the nucleotide sequence shown in SEQ ID NO: 34 (neo- N′1) and a 3 ′ antisense primer (NEO-N′2) shown in SEQ ID NO: 35 were synthesized. NEO-N'1 primer
EcoRV site at 5 'end, BamHI at 3' end of NEO-N'2
Granted site. To 1 ng (0.1 μl) of the pNOW / CMV-A genome, 100 pmole of each of these NEO-N′1 and NEO-N′2 primers was added, and Taq polymerase 2.5 U (0.5 μl) was added.
μl) and PCR buffer solution (250 mM Tris-HCl (pH 8.3 at 25 ° C),
375mM KCl, 15mM MgCl ₂ ) 20μl, 100mM DTT 1.0μl, 10mM d
NTP 0.5 μl (10 mM dATP, dCTP, dGTP, dTTP), acetate BSA (4 mg /
ml) and sterile water was added to a final volume of 100 μl. One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, after the heat treatment at 95 ° C for 4 minutes, 3 hours at 95 ° C for 1 minute, 55 ° C for 1 minute and
After repeating the step 30 times, the reaction was completed by treating at 72 ° C. for 10 minutes. The aqueous phase was taken out of the PCR reaction solution, 2 μl of a 10 × H solution was added to 10 μl of the aqueous phase, then 20 U (1 μl) of restriction enzymes EcoRV and 20 μl (1 μl) of BamHI were added, and 7 μl of sterile water was added. Allowed to react for hours. The reaction solution was subjected to electrophoresis at 50 mA for 30 minutes using a 0.8% agarose gel. The gel was irradiated with ultraviolet light having a wavelength of 360 nm to cut out a band of about 0.8 kb detected. This agarose fragment was placed in a 1.5 ml tube and centrifuged at 15,000 rpm for 10 minutes.
Centrifuge for 5 minutes and separate the resulting aqueous solution with a pipette to remove DNA
The solution was used.

[0088] (d) connecting the MSR linker sequence and Mu-NEO ^r sequences using the connection PCR template of MSR Linker and NEO ^r. Of each sequence prepared in (b) and (c) above
Prepare 100 pmole of each DNA and use Taq polymerase 2.5 U
(0.5 μl) and PCR buffer solution (250 mM Tris-HCl (pH at 25 ° C)
8.3), 375mM KCl, 15mM MgCl 2) 20μl, 100mM DTT 1.0μl, 1
0 mM dNTP 0.5 μl (10 mM dATP, dCTP, dGTP, dTTP), BSA acetate
(4 mg / ml) 0.25 μl was added, and sterile water was added to a final volume of 100 μl. One drop of mineral oil was added to these mixed solutions, and PCR was performed under the following conditions. That is, 95 ° C4
1 minute at 95 ° C, 1 minute at 55 ° C and 72 ° C2
After repeating the three steps of 30 minutes for 30 minutes, the reaction was terminated by treating at 72 ° C. for 10 minutes. The aqueous phase was taken out from the PCR reaction solution, 2 μl of a 10 × H solution was added to 10 μl of the aqueous phase, 20 U (1 μl) of restriction enzymes PstI and 20 μl (1 μl) of BamHI were added, and 7 μl of sterile water was added. Allowed to react for hours. The reaction solution was subjected to electrophoresis at 50 mA for 30 minutes using a 0.8% agarose gel. The gel was irradiated with ultraviolet light having a wavelength of 360 nm, and a band of about 0.9 kb detected was cut out. Put this agarose fragment in a 1.5 ml tube and centrifuge for 15,
After centrifugation at 000 rpm for 10 minutes, the resulting aqueous solution was separated with a pipette to obtain a DNA solution.

(E) Incorporation into cassette vector pSVP (D) S / NEO having NEO ^r gene cistron The obtained DNA (connecting sequence between MSR linker and NEO ^r ) was used in Example 1.
Was integrated into the plasmid pSVP (D) S / NEO obtained in the above. pSVP
(D) S / NEO was partially digested with PstI and BamHI (this is due to the inclusion of one PstI site in SV40 polyA). 0.1 μl of this solution (1 ng DN
The DNA solution 0.5μl of NEO ^r gene added to A), PstI-B
We lit between amHI sites. To this reaction, 2.0 μl of Solution I of DNA Ligation Kit Ver.
Allowed to react for minutes. The reaction solution was used for E. coli competent cell XL1-
Add 0.1 ml of BLUE and react for 30 minutes on ice.
Heat shock was applied for 60 seconds. After placing on ice for 2 minutes, SOC
0.9 ml of the medium was added, and cultured with shaking at 37 ° C. for 1 hour using a shaker. After centrifugation at 5,000 rpm for 1 minute, the supernatant was discarded. The precipitated competent cells were suspended in the solution remaining in the tube, and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. Incubate at 37 ° C overnight,
New plasmids obtained from the resulting colonies
DNA containing Mu-NEO ^r gene connected to MSR linker sequence
Was selected by checking with G418 resistance (pSV
P (D) S / NEO-A).

(F) Construction of Expression Vector pNOW / CMV-AA Hereinafter, pSVP (D) S / NEO-A was converted to NEO in the same manner as in Example 1.
^The DNA sequence constituting the ^r gene cistron was cut out and integrated into plasmid pNOW-1 to produce pNOW-2PA. Further, pN corresponding to pNOW-2 was obtained in the same manner as in Example 1.
OW-2A was prepared, and subsequently, a DNA sequence constituting the MCS cistron cut out from the plasmid pEXP-BL2 was incorporated into pNOW-2A. An expression vector in NEO ^r gene cistron The thus produced with synthetic linker insertion sequence pNOW / CMV-AA
And With respect to this expression vector, each constituent part was fragmented with a restriction enzyme, and each was sequenced and joined, thereby confirming that each gene sequence was correctly inserted.

[0091]

Example 3 (1) Conglutinin Production Test Using pNOW / CMV-AA (a) Preparation of Conglutinin cDNA and Incorporation into pNOW / CMV-AA Gene was inserted into MCS-B of plasmid vector pNOW / CMV-AA For incorporation, the 5 'sense primer having the nucleotide sequence shown in SEQ ID NO: 22 and the 3' nucleotide having the nucleotide sequence shown in SEQ ID NO: 23 were obtained by cutting the restriction enzyme cleavage sequences at both ends of bovine conglutinin cDNA.
Modified using antisense primer. pNOW / CMV-A
A After treating 1 ng / 0.1 μl with restriction enzymes XbaI and NotI,
To 1 ng / 0.1 μl of the solution containing the obtained plasmid, 100 pmole of a sense primer and 100 pmole of an antisense primer for modifying the end of conglutinin cDNA were added.
Add 2.0 μl of solution I of Ligation Kit Ver.2 and at 16 ° C
The reaction was performed for 30 minutes. E. coli competent cell XL
After adding to 1 ml of 1-BLUE and reacting on ice for 30 minutes, a heat shock was applied at 42 ° C for 60 seconds. After placing on ice for 2 minutes, the SOC medium is
0.9 ml was added, and the cells were cultured with shaking at 37 ° C. for 1 hour. Five,
After centrifugation at 000 rpm for 1 minute, the supernatant was discarded. The competent cells precipitated with the solution remaining in the tube were suspended and spread on two ampicillin plates containing 100 μg / ml ampicillin at a ratio of 1:10. After culturing at 37 ° C. overnight, plasmids obtained from the resulting colonies and having newly inserted conglutinin DNA were selected. The integrated conglutinin gene was cut out and sequenced again to confirm the nucleotide sequence (SEQ ID NO: 28).

(B) Gene transfer into host CHO cells (DHFR-deficient strain) F12 medium (GIB) supplemented with 10% fetal calf serum (FCS, GIBCO)
DHFR gene-deficient CHO cell line was mixed at 1 × 10 ⁵ cells / ml, seeded in a dish with a diameter of 60 mm, and incubated at 37 ° C. and 5% CO ₂ for 24 hours. Cultured for hours. The culture supernatant was discarded, and 5 ml of 10% FCS-containing F12 medium containing 5 μg of DNA (pNOW / CMV-AA incorporating the conglutinin gene) previously mixed with a lipofectin solution (BRL) was added and cultured for 16 hours. . The cultured cells are collected from the dish by trypsin treatment, and after counting the number of cells, 1
Suspend cells in 10% FCS-supplemented F12 medium containing G418 at a concentration of 400 μg / ml at × 10 ⁵ cells / ml, and inoculate two 96-well microplates at 0.1 ml / well. did. Cultured for 2 weeks at 37 ° C and 5% CO ₂ 192
Surviving cells were observed only in 33 of the wells, and proliferation of cells that acquired G418 resistance was observed.

(2) Conglutinin production test (a) Proliferation of G418-resistant cells and conglutinin production level measurement test The conglutinin production level was confirmed.
Although the level was high in the 18 resistant strains, five representative clones were selected from them and cloning was repeated twice. Subsequently, G418-resistant cells were mixed with F12 medium supplemented with 10% FCS (2 × 10 ⁵ cells / ml concentration), and 5 ml of each cell clone was
Planted in 5 cm ² culture flasks. 2 × 10 ⁶ ce When cells were counted cells were cultured to confluency
lls. The culture supernatant of each dish was discarded, and 2 ml of 10% FCS-supplemented F12 medium having the same composition was added and cultured for 4 days, and the culture supernatant was collected. When the amount of conglutinin produced was measured, it was found that the amount exceeded 14 μg / 2 ml in all dishes. Table 1 shows the production amount. Clone 7-3, which produced the highest levels, reached 11.8 μg / ml.

[0094]

[Table 1]

[0095]

Example 4 (1) Conglutinin production test using pNOW / CMV-A (a) Incorporation of conglutinin cDNA into pNOW / CMV-A and gene transfer into host CHO cells (DHFR-deficient strain) Example 3 The bovine conglutinin gene was inserted into MCS-B of the plasmid vector pNOW / CMV-A in the same manner as described above.
F12 medium (GIB) supplemented with 10% calf fetal serum (FCS, GIBCO)
DHFR gene-deficient CHO cell line was mixed at 1 × 10 ⁵ cells / ml, seeded in a dish with a diameter of 60 mm, and incubated at 37 ° C. and 5% CO ₂ for 24 hours. Cultured for hours. Discard the culture supernatant and replace it with 10% FCS-containing F12 medium containing 5 μg DNA (pNOW / CMV-A incorporating the conglutinin gene) previously mixed with a lipofectin solution (BRL)
5 ml was added and the cells were cultured for 16 hours. The cultured cells are recovered from the dish by trypsin treatment, and after counting the number of cells, 1 × 1
Include G418 at a concentration of 400 μg / ml to obtain 0 ⁵ cells / ml1
The cells were suspended in an F12 medium supplemented with 0% FCS, and the cells were seeded on 10 96-well microplates at 0.1 ml / well. When the cells were cultured for 2 weeks at 37 ° C. and 5% CO ₂ , viable cells were observed only in 48 of the 960 wells, and the proliferation of cells that had acquired G418 resistance was observed.

(2) Conglutinin production test (a) Proliferation of G418-resistant cells and conglutinin production level measurement test The conglutinin production level was confirmed.
Although the level was high in the 18 resistant strains, a representative 5 well was selected from these and cloning was repeated twice. Subsequently, G418-resistant cells were mixed with F12 medium supplemented with 10% FCS (2 × 10 ⁵ cells / ml concentration), and 5 ml of each cell clone was
Planted in 5 cm ² culture flasks. 2 × 10 ⁶ ce When cells were counted cells were cultured to confluency
lls. The culture supernatant of each dish was discarded, and 2 ml of 10% FCS-supplemented F12 medium having the same composition was added and cultured for 4 days, and the culture supernatant was collected. When the amount of conglutinin produced was measured, it was found that the amount exceeded 4 μg / 2 ml in all dishes. Table 2 shows the production amount. Clone 11A, which produced the highest levels, reached 6.8 μg / ml.

[0097]

[Table 2]

(B) Amplification of plasmid gene by MTX After conglutinin-producing clones were further subcultured and stabilized, low concentration MTX was added to the medium to perform gene amplification. As a first step, the selected cell clone 11A was mixed with 10% FCS-added I-MEM medium (GIBCO, not containing hypoxanthine and thymidine) containing MTX 10 nM and G418 200 μg / ml, and 25 cm ² of Planted in a culture flask and cultured until it became confluent (2 weeks). Discard the culture supernatant, and add the same composition of FCS-added I-MEM medium (10 nM MTX, 200 μl /
After addition of 2 ml of the mixture, the culture supernatant was collected and the production level of conglutinin was measured.
Then, add 10% FCS with MTX 50nM and G418 200μg / ml
The cells were cultured again in I-MEM medium until they became confluent (2
weekly). Discard the culture supernatant, add 2 ml of FCS-supplemented I-MEM medium of the same composition (50 nM MTX, 200 μl / ml G418 added) and add 4 ml.
After culturing for one day, the culture supernatant was collected and the production level of conglutinin was measured. The results were as shown in Table 3. The resulting cells had a very slow growth rate, and it was expected that higher levels of productivity would be achieved if the adaptation proceeded and the growth was accelerated.

[0099]

[Table 3]

[0100]

Example 5 (1) Human IFN-β Production Test In the same procedure as in Example 4, human IFN-β (Gene, p.
Cloned from fibroblasts after pNOW /
It was incorporated into CMV-A and further transfected into a DHFR-deficient CHO cell line. Table 4 shows the production levels of human IFN-β after G418 selection. Here, IU is a value determined based on the antiviral activity.

[0101]

[Table 4]

(2) Amplification of plasmid gene by MTX In the same procedure as in Example 4, human IFN-β producing clone 72 was added to a low-concentration MTX medium, and gene amplification was performed. First MTX 5
After amplification at 0 nM, the production level of human IFN-β was measured and the results are as shown in Table 5.

[0103]

[Table 5]

(3) Adaptation of Human IFN-β Producing Clone to Serum-Free Medium A clone 7222 obtained by amplifying human IFN-β producing clone 72 with 50 nM MTX was used in a serum-free medium (CHO-S-SFM II, GIBCO
Inc., not containing hypoxanthine and thymidine)
Conditioning was performed in a medium supplemented with 0 μg / ml G418 and 50 nM MTX.

As a result of measuring the amount of human IFN-β produced after the adaptation, the amount was 473,900 IU / ml, which was almost the same as that obtained when 10% FCS was added.

(4) Human IFN-β production test using serum-free medium pNOW incorporating human IFN-β cDNA obtained in Example 5 (1)
/ CMV-A, DHFR conditioned in serum-free medium (CHO-S-SFM II, GIBCO, not containing hypoxanthine and thymidine)
The gene was introduced into a defective CHO cell line, and 200 μg / ml G41 was added to the same medium.
After selection in a medium to which 8 was added, the amount of human IFN-β produced was measured.

[0107]

[Table 6]

According to the present invention, it is possible to provide an expression vector capable of producing a high-level recombinant protein using a mammalian cell as a host.

[0108]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 41 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbol: Cleavage- site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 8 ^ 9 Symbol indicating feature: Cleavage-site Location: 13 ^ 14 Symbol indicating feature: Cleavage-site Location: 20 ^ 21 Feature Symbol indicating: Cleavage-site Location: 24 ^ 25 Symbol indicating feature: Cleavage-site Location: 30 ^ 31 Symbol indicating feature: Cleavage-site Location: 40 ^ 41 Sequence TATGCCGCGG AATCGATGAT TACCGTACGG AATTCGGGCC C 41

SEQ ID NO: 2 Sequence length: 39 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 4 ^ 5 Symbol indicating feature: Cleavage-site Location: 13 ^ 14 Symbol indicating feature: Cleavage-site Location: 18 ^ 19 Symbol indicating feature: Cleavage-site Location: 26 ^ 27 Symbol indicating feature: Cleavage-site Location: 32 ^ 33 Symbol indicating feature: Cleavage-site Location: 34 ^ 35 Sequence ACGGCGCCTT AGCTACTAAT GGCATGCCTT AAGCCCGGG 39

SEQ ID NO: 3 Sequence length: 29 Sequence type: number of nucleic acid strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 9 ^ 10 Symbol indicating feature: Cleavage-site Location: 16 ^ 17 Symbol indicating feature: Cleavage-site Location: 18 ^ 19 Characteristic symbol: Cleavage-site Location: 25 ^ 26 Sequence AGCTTCCGCG GCTGCAGGGA TCCATCGAT 29

SEQ ID NO: 4 Sequence length: 29 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 3 ^ 4 Symbol indicating feature: Cleavage-site Location: 8 ^ 9 Symbol indicating feature: Cleavage-site Location: 18 ^ 19 Characteristic symbol: Cleavage-site Location: 23 ^ 24 Sequence AGGCGCCGAC GTCCCTAGGT AGCTATTAA 29

SEQ ID NO: 5 Sequence length: 37 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 6 ^ 7 Characteristic symbol: Cleavage-site Location: 9 ^ 10 Sequence CCCCGCGGGA ATTCTGTGGA ATGTGTGTCA GTTAGGG 37

SEQ ID NO: 6 Sequence length: 32 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 7 ^ 8 sequence CCCTGCAGCT TTTTGCAAAA GCCTAGGCCT CC 32

SEQ ID NO: 7 Sequence length: 31 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 6 ^ 7 sequence CCCCGCGGTG TGGAATGTGT GTCAGTTAGG G 31

SEQ ID NO: 8 Sequence length: 16 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 9 ^ 10 Characteristic symbol: Cleavage-site Location: 12 ^ 13 Sequence AATTGGGCCC ATCGAT 16

SEQ ID NO: 9 Sequence length: 16 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 1 ^ 2 Symbol indicating characteristics: Cleavage-site Location: 8 ^ 9 Sequence CCCGGGTAGC TATTAA 16

SEQ ID NO: 10 Sequence length: 41 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 7 ^ 8 sequence GGCTGCAGTC CCTCATGCTT CGACCATTGA ACTGCATCGT C 41

SEQ ID NO: 11 Sequence length: 32 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 3 ^ 4 sequence ATAGATCTAA AGCCAGCAAA AGTCCCATGG TC 32

SEQ ID NO: 12 Sequence length: 28 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 7 ^ 8 sequence GGCTGCAGCT TCACGCTGCC GCAAGCAC 28

SEQ ID NO: 13 Sequence length: 29 Sequence type: number of nucleic acid strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 1 ^ 2 Characteristic symbol: Cleavage-site Location: 3 ^ 4 Sequence GGGGATCCGG GGTGGGCGAA GAACTCCAG 29

SEQ ID NO: 14 Sequence length: 50 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 8 ^ 9 Symbol indicating feature: Cleavage-site Location: 13 ^ 14 Symbol indicating feature: Cleavage-site Location: 19 ^ 20 Symbol indicating feature: Cleavage-site Location: 30 ^ 31 Symbol indicating feature: Cleavage-site Location: 32 ^ 33 Symbol indicating feature: Cleavage-site Location: 38 ^ 39 Symbol indicating feature: Cleavage -site Location: 44 ^ 45 Characteristic symbol: Cleavage-site Location: 50 ^ 51 Sequence AGCTTGATAT CATCGATGCG GCCGCGGTAC CAGATCTCGT ACGTCTAGAG 50

SEQ ID NO: 15 Sequence length: 50 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 4 ^ 5 Symbol indicating feature: Cleavage-site Location: 11 ^ 12 Symbol indicating feature: Cleavage-site Location: 19 ^ 20 Symbol indicating feature: Cleavage-site Location: 22 ^ 23 Symbol indicating feature: Cleavage-site Location: 32 ^ 33 Symbol indicating feature: Cleavage-site Location: 38 ^ 39 Symbol indicating feature: Cleavage -site Location: 44 ^ 45 Characteristic symbol: Cleavage-site Location: 50 ^ 51 Sequence ACTATAGTAG CTACGCCGGC GCCATGGTCT AGAGCATGCA GATCTCTTAA 50

SEQ ID NO: 16 Sequence length: 47 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 5 ^ 6 sequence CCGATTACTT ACCGCCATGT TGACATTGAT TATTGACTAG TTATTAA 47

SEQ ID NO: 17 Sequence length: 45 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 4 ^ 5 sequence CCATCGATCG GTTCACTAAA CGAGCTCTGC TTATATAGAC CTCCC 45

SEQ ID NO: 18 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single stranded Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 2 ^ 3 sequence CCTCTAGACTGT GCCTTCTAGT TGCCAGCCAT 30

SEQ ID NO: 19 Sequence length: 30 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 3 ^ 4 sequence CCAGATCTGTAC CCATAGAGCC CACCGCATCC 30

SEQ ID NO: 20 Sequence length: 32 Sequence type: number of nucleic acid strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 3 ^ 4 sequence TTGGATCCCT GTGCCTTCTA GTTGCCAGCC AT 32

SEQ ID NO: 21 Sequence length: 32 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 3 ^ 4 sequence TTCGTACGGA TCCCATAGAG CCCACCGCAT CC 32

SEQ ID NO: 22 Sequence length: 30 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 4 ^ 5 sequence AAGCGGCCGC TCTCAACTTG CTTTCCTGTG 30

SEQ ID NO: 23 Sequence length: 28 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 3 ^ 4 sequence CCTCTAGAGC CAGTTTCAAA CTTTATTC 28

SEQ ID NO: 24 Sequence length: 28 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Antisense: YES sequence ATCTTGTTCA AGCATGCGAA ACGATCCT 28

SEQ ID NO: 25 Sequence length: 651 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Antisense: NO Sequence characteristics Characteristic symbol: Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 651 ^ 652 Symbol indicating feature: CDS Location: 8..568 Symbol indicating feature: mutation Location: 2 Symbol indicating feature: mutation position: symbols 5, wherein: mutation present position: 11 SEQ GTCCCTCATG CTTCGACCAT TGAACTGCAT CGTCGCCGTG TCCCAAAATA TGGGGATTGG 60 CAAGAACGGA GACCTACCCT GGCCTCCGCT CAGGAACGAG TTCAAGTACT TCCAAAGAAT 120 GACCACAACC TCTTCAGTGG AAGGTAAACA GAATCTGGTG ATTATGGGTA GGAAAACCTG 180 GTTCTCCATT CCTGAGAAGA ATCGACCTTT AAAGGACAGA ATTAATATAG TTCTCAGTAG 240 AGAACTCAAA GAACCACCAC GAGGAGCTCA TTTTCTTGCC AAAAGTTTGG ATGATGCCTT 300 AAGACTTATT GAACAACCGG AATTGTCAAG TAAAGTAGAC ATGGTTTGGA TAGTCGGAGG 360 CAGTTCTGTT TACCAGGAAG CCATGAATCA ACCAGGCCAC CTCAGACTCT TTGTGAC AAG 420 GATCATGCAG GAATTTGAAA GTGACACGTT TTTCCCAGAA ATTGATTTGG GGAAATATAA 480 ACTTCTCCCA GAATACCCAG GCGTCCTCTC TGAGGTCCAG GAGGAAAAAG GCATCAAGTA 540 TAAGTTTGAA GTCTACGAGA AGAAAGACTA ACAGGAAGAT GCTTTCAAGT TCTCTGCTCC 600 CCTCCTAAAG CTATGCATTT TTATAAGACC ATGGGACTTT TGCTGGCTTT A 651

SEQ ID NO: 26 Sequence length: 1321 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Antisense: NO Sequence characteristics Characteristic symbol: Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 1321 ^ 1322 Symbol indicating feature: transposon Location: 1..354 Symbol indicating feature: CDS Location: 355..1146 Symbol indicating feature : mutation existing position: 358 SEQ GCTTCACGCT GCCGCAAGCA CTCAGGGCGC AAGGGCTGCT AAAGGAAGCG GAACACGTAG 60 AAAGCCAGTC CGCAGAAACG GTGCTGACCC CGGATGAATG TCAGCTACTG GGCTATCTGG 120 ACAAGGGAAA ACGCAAGCGC AAAGAGAAAG CAGGTAGCTT GCAGTGGGCT TACATGGCGA 180 TAGCTAGACT GGGCGGTTTT ATGGACAGCA AGCGAACCGG AATTGCCAGC TGGGGCGCCC 240 TCTGGTAAGG TTGGGAAGCC CTGCAAAGTA AACTGGATGG CTTTCTTGCC GCCAAGGATC 300 TGATGGCGCA GGGGATCAAG ATCTGATCAA GAGACAGGAT GAGGATCGTT TCGCATGCTT 360 GAACAAGATG GATTGCACGC AGGTTCTCCG GCCGCTTGGG TGGAGAGGCT ATTCGGCTAT 420 GACTGGGCAC AACAGACAAT CGGCTG CTCT GATGCCGCCG TGTTCCGGCT GTCAGCGCAG 480 GGGCGCCCGG TTCTTTTTGT CAAGACCGAC CTGTCCGGTG CCCTGAATGA ACTGCAGGAC 540 GAGGCAGCGC GGCTATCGTG GCTGGCCACG ACGGGCGTTC CTTGCGCAGC TGTGCTCGAC 600 GTTGTCACTG AAGCGGGAAG GGACTGGCTG CTATTGGGCG AAGTGCCGGG GCAGGATCTC 660 CTGTCATCTC ACCTTGCTCC TGCCGAGAAA GTATCCATCA TGGCTGATGC AATGCGGCGG 720 CTGCATACGC TTGATCCGGC TACCTGCCCA TTCGACCACC AAGCGAAACA TCGCATCGAG 780 CGAGCACGTA CTCGGATGGA AGCCGGTCTT GTCGATCAGG ATGATCTGGA CGAAGAGCAT 840 CAGGGGCTCG CGCCAGCCGA ACTGTTCGCC AGGCTCAAGG CGCGCATGCC CGACGGCGAG 900 GATCTCGTCG TGACCCATGG CGATGCCTGC TTGCCGAATA TCATGGTGGA AAATGGCCGC 960 TTTTCTGGAT TCATCGACTG TGGCCGGCTG GGTGTGGCGG ACCGCTATCA GGACATAGCG 1020 TTGGCTACCC GTGATATTGC TGAAGAGCTT GGCGGCGAAT GGGCTGACCG CTTCCTCGTG 1080 CTTTACGGTA TCGCCGCTCC CGATTCGCAG CGCATCGCCT TCTATCGCCT TCTTGACGAG 1140 TTCTTCTGAG CGGGACTCTG GGGTTCGAAA TGACCGACCA AGCGACGCCC AACCTGCCAT 1200 CACGAGATTT CGATTCCACC GCCGCCTTCT ATGAAAGGTT GGGCTTCGGA ATCGTTTTCC 1260 GGGACGCCGG CTGGATGATC CTCCAGCGCG GGATCACATG CTGGATTCTT CGCCCACCCC 1320 G 1321

SEQ ID NO: 27 Sequence length: 470 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA Antisense: NO Sequence characteristics Characteristic symbol: Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 470 ^ 471 Symbol indicating feature: bGH polyA signal (1) Location: 6..234 Symbol indicating feature: terminator Location: 20 .. 25 Characteristic symbol: terminator Location: 96..101 Characteristic symbol: bGH polyA signal (2) Location: 241..469 Characteristic signature: terminator Location: 331..336 Sequence CTAGACTGTG CCTTCTAGTT GCCAGCCATC TGTTGTTTGC CCCTCCCCCG TGCCTTCCTT 60 GACCCTGGAA GGTGCCACTC CCACTGTCCT TTCCTAATAA AATGAGGAAA TTGCATCGCA 120 TTGTCTGAGT AGGTGTCATT CTATTCTGGG GGGTGGGGTG GGGCAGGACA GCAAGGGGGA 180 GGATTGGGAA GACAATAGCA GGCATGCTGG GGATGCGGTG GGCTCTATGG GTACAGATCC 240 CTGTGCCTTC TAGTTGCCAG CCATCTGTTG TTTGCCCCTC CCCCGTGCCT TCCTTGACCC 300 TGGAAGGTGC CACTCCCACT GTC CTTTCCT AATAAAATGA GGAAATTGCA TCGCATTGTC 360 TGAGTAGGTG TCATTCTATT CTGGGGGGTG GGGTGGGGCA GGACAGCAAG GGGGAGGATT 420 GGGAAGACAA TAGCAGGCAT GCTGGGGATG CGGTGGGCTC TATGGGTACC 470

SEQ ID NO: 28 Sequence length: 1392 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA antisense: NO Sequence characteristics Characteristic symbol: Cleavage-site Location: 0 ^ 1 Symbol indicating feature: Cleavage-site Location: 1392 ^ 1393 Symbol indicating feature: CDS Location: 106..1263 Sequence GGCCGCTCAC AACTTGCTTT CCTGTGTCCA ATAGCACTGC AGACTCCAGT ACTAGCCTGT 60 CCAGAGCAGC AAGTGATCCTAGCTAGCATGCT CACACAGCCC TGGAGATCCC TGGGAGCAGA AATGACAACC 180 TTTTCTCAGA AAATACTGGC CAATGCCTGT ACCCTGGTTA TGTGTAGCCC CCTGGAGAGT 240 GGCTTGCCTG GTCATGATGG ACAAGATGGG AGAGAATGTC CCCATGGAGA GAAGGGGGAT 300 CCAGGTTCAC CAGGACCTGC AGGACGAGCA GGAAGGCCTG GATGGGTTGG CCCTATTGGG 360 CCGAAAGGAG ACAATGGCTT TGTTGGAGAA CCTGGACCAA AGGGAGACAC TGGGCCACGT 420 GGGCCTCCAG GTATGCCTGG ACCAGCTGGA AGAGAAGGCC CCTCAGGGAA GCAGGGGAGC 480 ATGGGACCTC CAGGCACACC AGGCCCCAAA GGAGAGACTG GGCCCAAAGG AGGAGTGGGT 5 40 GCCCCAGGCA TACAGGGCTT CCCAGGCCCC TCGGGTCTCA AAGGAGAGAA AGGTGCCCCC 600 GGGGAGACTG GAGCCCCTGG ACGTGCTGGG GTGACAGGGC CTTCTGGAGC AATAGGTCCA 660 CAGGGCCCTT CAGGTGCCAG GGGCCCCCCA GGACTGAAGG GGGACAGAGG TGATCCTGGA 720 GAAACAGGAG CAAAGGGGGA GAGTGGGCTT GCAGAGGTCA ATGCTCTCAA GCAGCGGGTA 780 ACCATCTTAG ATGGACATCT ACGCCGGTTC CAAAATGCCT TCAGTCAGTA TAAGAAGGCG 840 GTGCTCTTCC CTGATGGCCA GGCTGTCGGG GAGAAGATCT TCAAGACAGC AGGTGCTGTA 900 AAGTCATATT CAGATGCAGA GCAGCTCTGC AGAGAGGCTA AGGGACAGCT GGCCTCCCCA 960 CGCTCTTCAG CCGAGAACGA GGCCGTGACA CAGATGGTCA GAGCCCAGGA AAAGAATGCT 1020 TACCTGAGCA TGAATGACAT CTCCACGGAG GGGAGGTTCA CTTACCCCAC TGGGGAAATA 1080 CTGGTCTATT CCAACTGGGC CGATGGGGAG CCCAACAACA GTGATGAGGG ACAACCAGAG 1140 AACTGTGTGG AAATCTTTCC TGATGGCAAG TGGAATGACG TACCCTGCAG TAAGCAACTC 1200 CTTGTGATCT GCGAGTTTTG AGCTCTCCCA CCCACCCCAG GGAAGGGGCA GTGCCCAGAG 1260 CTGTGAGCTG CCAACATCCC AATAAAAAGG TGACCCTCTG CTGCTCAGGG CTTCCCCACT 1320 GAGCCACGGG ATGAGGCCAC CAGGCAGGCC TCCTATGGAA CTCCTCCCTC AGAATAAAGT 1380 TTGAAACTGG CT 1392

SEQ ID NO: 29 Sequence length: 94 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Sequence characteristics Characteristic symbol: Cleavage-site Location: 0 ^ 1 Symbol indicating characteristics: Cleavage-site Location: 91 ^ 92 Sequence GATGAATGTA TGTCAGCTAC TGGGCTATCA GGGAAAACGA AATACCAAGC GCAATGTTGA 60 ATGGGGGATG TGACTAGTAG TTAAGTTAGA TATC 94

SEQ ID NO: 30 Sequence length: 50 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 1 ^ 2 sequence GATGAATGTA TGTCAGCTAC TGGGCTATCA GGGAAAACGA AATACCAAGC 50

SEQ ID NO: 31 Sequence length: 48 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES sequence TATTTCGTTT TCCCTGATAG CCCAGTAGCT GACATACATT CATCTGCA 48

SEQ ID NO: 32 Sequence length: 44 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: NO sequence GCAATGTTGA ATGGGGGATG TGACTAGTAG TTAAGTTAGA TATC 44

SEQ ID NO: 33 Sequence length: 50 Sequence type: Number of nucleic acid strands: Single stranded Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 3 ^ 4 sequence GATATCTAAC TTAACTACTA GTCACATCCC CCATTCAACA TTGCGCTTGG 50

SEQ ID NO: 34 Sequence length: 23 Sequence type: Nucleic acid Number of strands: Single-stranded Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Antisense: NO Sequence characteristics Characteristic symbols : Cleavage-site Location: 3 ^ 4 sequence GATATCGTTT CGCATGCTTG AAC 23

SEQ ID NO: 35 Sequence length: 23 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Antisense: YES Sequence characteristics Characteristic symbols : Cleavage-site Location: 1 ^ 2 sequence GGATCCTCAG AAGAACTGGT CAA 23

[Brief description of the drawings]

FIG. 1 shows a flow chart for preparing a backbone vector pBBV linker.

FIG. 2 shows pCV3 (for cloning SV40-related genes)
2 shows a flowchart of the fabrication.

FIG. 3 shows pCV4 (for cloning MCS-related genes)
2 shows a flowchart of the fabrication.

FIG. 4 shows a plasmid pSVP for constructing a DHFR cassette.
(D) The flowchart for producing S-1 is shown.

FIG. 5 shows a plasmid pSVP (D) for constructing a NEO cassette.
3 shows a flowchart of the fabrication of S-2.

FIG. 6 shows the DHFR cassette vector pSVP (D) S / DHFR
2 shows a flowchart of the fabrication.

FIG. 7 shows a flowchart of the preparation of the NEO cassette vector pSVP (D) S / NEO.

FIG. 8 shows a flowchart of preparation of an MCS cassette vector pEXP-BL2.

FIG. 9 shows a flowchart of construction of the expression vector pNOW / CMV-A of the present invention.

FIG. 10 shows the expression vector pNOW / CMV-A of the present invention.
The map of is shown.

FIG. 11 shows the expression vector pNOW / CMV-A of the present invention.
3 shows a flowchart of pSVP (D) S / NEO-A construction for A construction.

FIG. 12 shows the expression vector pNOW / CMV-A of the present invention.
The map of A is shown.

Claims (13)

[Claims] Claims: 1. A plasmid having a consumable neomycin phosphotransferase gene cistron and a multicloning site for gene integration having a strong expression inducible promoter in a plasmid, and having high productivity of a recombinant protein in a mammalian host cell. An expression vector for inducing. 2. The consumable neomycin phosphotransferase gene cistron uses a promoter with low expression inducibility as a promoter, and a sequence capable of encoding an amino acid sequence between the sequence of the promoter and the neomycin transferase gene translation region. The expression vector according to claim 1, having an insertion sequence comprising at least one set. 3. The consumable neomycin phosphotransferase gene cistron contains at least one set of sequences capable of encoding an amino acid sequence whose start position as a constitutional unit of a triplet corresponds to the start position of a translation region of a neomycin phosphotransferase gene. The expression vector according to claim 2, which has an insertion sequence consisting of: 4. The cistron of the consumable neomycin phosphotransferase gene has a triplet in which the start position as a constituent unit corresponds to the start position of the neomycin phosphotransferase gene translation region or is shifted by one or two bases. The expression vector according to claim 2, wherein the expression vector has an insertion sequence comprising at least two types of sequences that can encode an amino acid sequence. 5. The expression vector according to any one of claims 2 to 4, wherein the insertion sequence is an artificially synthesized linker. 6. The expression vector according to any one of claims 2 to 4, wherein the insertion sequence is derived from a naturally occurring sequence or is a modification thereof. . 7. The expression vector according to claim 6, wherein at least a part of the insertion sequence is derived from a transposon sequence. 8. A promoter having low expression inducibility,
Use a promoter derived from a protein gene promoter that is usually difficult to express in mammalian cells. The expression vector according to any one of claims 2 to 7, which is characterized in that: 9. The method according to claim 1, wherein the protein gene is incorporated.
G4 comprising transforming a host cell by gene transfer using the expression vector according to any one of claims 1 to 8.
A method for obtaining a highly productive transformant of a protein which is an 18-resistant cell clone. 10. The plasmid has a dihydrofolate reductase gene cistron using a promoter with low expression inducibility as a promoter, and a dihydrofolate reductase-deficient CHO cell is used as a mammalian host cell. The expression vector according to any one of claims 1 to 8, which enables efficient amplification of the gene of the plasmid with methotrexate after introduction of the gene into the host cell. 11. A promoter having a low inducibility of expression of the dihydrofolate reductase gene cistron, which is derived from a promoter of a protein gene which is hardly expressed in mammalian cells, and has a viral antigen which is hardly infected in mammals. The expression vector according to claim 10, wherein a promoter or a promoter obtained by removing an enhancer portion from any of the promoters is used. 12. A method for obtaining a highly productive transformant of a protein, comprising transforming a host cell by gene transfer using the expression vector according to claim 10 or 11, into which the protein gene has been incorporated. 13. A host cell is transformed by gene transfer using the expression vector according to any one of claims 1 to 8, 10 and 11, into which a protein gene has been incorporated. A method for obtaining a high-productivity transformant of a protein capable of stably producing a high-level protein in a serum-free medium, which comprises acclimating to a serum medium.