JPH09322755A - Incubator for trace specimen - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an incubator using microtiter plates with capability of accurately controlling temperature of the specimen. SOLUTION: This incubator has a reactor vessel 13 comprising a substrate having a plurality of holes 11 for receiving a reaction mixture, and at least one controller 21 or 22 for changing the temperature in the reactor vessel so that the reaction mixture 10 retained in the holes 11 is changed with the lapse of time to advance the reaction of the reaction mixture 10. In this case, a means, e.g. heat-conductive resin sheet, for accelerating thermal conduction between the reactor vessel 13 and the temperature controller 21 or 22, is laid between the reactor vessel 13 and the temperature controller 21 or 22.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an incubator for controlling the temperature of a reaction vessel (incubator) more easily and accurately in a programmable incubator such as a PCR method widely used in the field of DNA.

[0002]

2. Description of the Related Art In performing a chemical reaction such as an enzymatic reaction, accurate control of the temperature is required to maintain optimum reaction conditions and achieve optimum reaction yield and reaction efficiency. It is very important. Therefore, when the optimum temperature condition is changed over time, the temperature condition and the time to achieve it are often set in advance from the beginning of the reaction using an incubator whose temperature is controlled by a computer. Particularly recently, amplification of DNA by PCR has been actively performed, and the demand for the amplification has been increasing. In addition, there is a growing need to significantly increase the number of reactions in genetic diagnostics and genomic projects without increasing cost, space or labor. Therefore, there is a need for a method capable of simultaneously processing a larger number of samples by reducing the volume of the reaction mixture (analyte).

There are the following problems in controlling the temperature of a large number of trace samples in parallel. (1) When the reaction temperature needs to be relatively high, since the amount of the sample is very small, the solvent (usually water) in the sample may evaporate and the reaction may not proceed further. This is because water vapor evaporated on the upper wall surface of the test tube is liquefied because the temperature of the upper part of the test tube containing the specimen is lower than the temperature of the specimen. (2) Therefore, in order to prevent evaporation of water from the specimen, a mineral oil or the like is overlaid on the specimen. However, when the amount of the sample becomes smaller, it becomes difficult to sample the sample under the mineral oil.

As a means for solving such a problem, the temperature of the upper portion of the test tube containing the specimen is maintained at a temperature higher than the boiling point of water to prevent liquefaction on the upper wall surface of the test tube. Has been proposed. As shown in FIG. 2, an incubator 33 having a heater 32 (hot bonnet) for heating the upper part of the test tube in addition to the heater 32 for heating the sample in the test tube 30 is known (DNA engine, MJ). research). Specifically, the heater 32 for heating the upper part of the test tube is maintained at about 105 ° C. This incubator 33 normally uses a test tube of 500 μl and is well used for about 50 μl of a sample. However, as described above, when a larger number of samples are to be processed at a time with a smaller sample amount, the sample amount is reduced to an amount smaller than the above 50 μl, for example, 0.5 to 25 μl.
It is desired to be on the order. Further, when a large number of samples are processed in parallel at the same time, the use of a test tube is complicated, and it is desired to use a reaction vessel capable of processing a large number of samples other than the test tube in parallel at a time.

Therefore, the present inventors have attempted to create an incubator using a microtiter plate having a plate having a constant thickness and a large number of holes (wells) having a constant depth. As a result, when using the above test tube,
It is possible to control the temperature of individual test tubes independently, but for the entire microtiter plate,
Moreover, it has been found that it is necessary to control the temperature of the specimen in each hole uniformly and accurately. That is, it has been found that if the temperature of the sample in each hole in the microtiter plate is not accurately controlled, there is a problem that a desired reaction does not proceed by the hole.

[0006]

SUMMARY OF THE INVENTION Accordingly, an object of the present invention is to provide an incubator using a microtiter plate and capable of accurately controlling the temperature of a specimen.

[0007]

The incubator of the present invention has a reaction vessel comprising a substrate having a plurality of holes for accommodating a reaction mixture, and at least one temperature controller for changing the temperature of the reaction vessel. An incubator for changing the temperature of the reaction mixture contained in the hole over time to progress the reaction of the reaction mixture, wherein the reaction container and the temperature controller are between the reaction container and the temperature controller. The present invention relates to an incubator characterized by interposing means for promoting heat transfer to and from a temperature controller.

In one embodiment of the incubator of the present invention, the temperature controller comprises a pair of a temperature controller (1) and a temperature controller (2), wherein the temperature controller (1) is a reaction mixture contained in a hole of a reaction vessel. The temperature controller (2) controls the temperature (1) of the reaction vessel, and the temperature controller (2) faces the liquid surface of the reaction mixture contained in the reaction vessel on the inner wall of the hole of the member for closing the opening of the hole of the reaction vessel. The surface temperature (2) is controlled, and the heat conduction promoting means is provided between the temperature controller (1) and the reaction vessel, between the temperature controller (2) and the reaction vessel, or between the temperature controller (1) and the temperature. An incubator provided between each of the controller (2) and the reaction vessel can be mentioned.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION In the incubator of the present invention, "heat conduction promoting means" for promoting heat conduction between the reaction vessel and the temperature controller may be interposed between the reaction vessel and the temperature controller. It is a feature. It is usually difficult to bring the reaction vessel and the temperature controller into close contact with each other. If the two are not in close contact with each other, the temperature of the specimen in the reaction vessel is not properly controlled, and as a result, a desired reaction product cannot be obtained. In the present invention, the above problem is solved by interposing "heat conduction promoting means" between the two.

As the "heat conduction promoting means", for example, a flexible and heat conductive sheet can be mentioned. By having flexibility, the close contact between the reaction vessel and the temperature controller can be maintained. In addition, the thermal conductivity facilitates the transfer of heat between the reaction vessel and the temperature controller, and thus enables more accurate temperature control of the sample (reaction mixture).

As the "flexible and thermally conductive sheet", for example, a thermally conductive resin sheet can be mentioned, and as the thermally conductive resin sheet, for example, a thermally conductive silicone sheet can be mentioned. be able to. The heat conductive silicon sheet is, for example, commercially available from Shin-Etsu Silicone as a heat radiation rubber sheet, and has flexibility and high heat conductivity used as a heat radiation material for electronic components. In addition, a flexible graphite sheet can also be cited as the "flexible and thermally conductive sheet".
The flexible graphite sheet is commercially available from Matsushita Electric Industrial as a Panasonic graphite sheet, and has flexibility and high thermal conductivity.

Hereinafter, the incubator of the present invention will be described with reference to FIG. The incubator shown in FIG. 1 is an embodiment having a pair of temperature controllers and having a means for promoting heat conduction between one of the temperature controllers and the reaction vessel. The incubator 1 of the present invention has a reaction vessel 13 composed of a substrate 12 having a plurality of holes 11 for accommodating a reaction mixture (sample) 10 and at least one temperature controller for changing the temperature of the reaction vessel 13. . In FIG. 1, a pair of temperature controllers (1) and (2) 21 and 22 are provided.

When the substrate 12 having a plurality of holes is made of metal, the temperature of the controller is controlled by the reaction mixture (specimen) 1.
It is preferable from the viewpoint that it can be easily reflected to 0 and the reaction can be controlled more accurately. However, the inner wall of the pore may be surface-coated with a polymer or the like for the purpose of preventing the inhibitory effect of the metal on the reaction mixture, particularly the enzyme activity, or modifying the wetting characteristics of the inner wall.

The holes formed in the substrate 12 may be closed at the bottom to form a reaction space. In addition, a hole formed in the substrate 12 penetrates through the substrate 12, and heat conduction is promoted directly by the temperature controller (1) laminated with the substrate 12 or interposed between the temperature controller (1). The bottom may be formed by means or a suitable intermediate sheet or film to form a reaction space. When the holes are through holes, immersing the substrate having the through holes in a solution containing a reaction medium, a reagent, or the like has an advantage that the solution can be supplied to many holes at once.

[0015] The incubator of the present invention is capable of performing a favorable reaction even with a small amount of a sample,
Therefore, it can be particularly preferably used for a reaction having a small volume.
However, the present invention can be similarly applied to a large capacity range, and there is no limitation on the capacity of the holes provided in the reaction vessel. However, from the viewpoint of a small amount of sample (a large number of small samples are processed), the volume of the reaction vessel is 1 to 100 μm.
l, preferably in the range of 1 to 50 μl [the volume of the reaction mixture (analyte) contained therein is 0.5 to 50 μl
, Preferably in the range of 0.5 to 20 μl]. However, the volume of the reaction vessel and the volume of the reaction mixture (specimen) can be further reduced to reduce the size. For example, the reaction vessel and the reaction mixture (specimen) can be microchip-shaped and nl (nanoliter) order. It is also possible to create an incubator to do.

The temperature controller (1) 21 can be composed of one or a plurality of parts, for example, a Peltier device can be used. Temperature controller (1)
21 controls the temperature (1) of the reaction mixture 10 stored in the hole of the reaction vessel 13. In FIG. 1, the temperature controller (1) 21 is in contact with the reaction vessel 13 via a sheet as a heat conduction promoting means. The temperature controller (2) 22 can be composed of one or more parts, for example, a Peltier device can be used. The temperature controller (2) 22
A member (not shown) for closing the opening 14 of the third hole is in contact with the reaction vessel 13 so as to control the temperature (2) of the liquid surface forming the inner wall of the hole. The hole 1 of the reaction vessel 13
The member for closing one opening 14 is suitably a sheet or a film, for example, from the viewpoint that a plurality of holes can be closed at the same time. When a sheet serving as a heat conduction promoting means is interposed between the temperature controller (2) 22 and the reaction vessel 13, the opening 14 of the hole 11 can be closed by the sheet serving as the heat conduction promoting means.

However, the process is performed while substantially preventing the steam generated from the reaction mixture from flowing out of the container.
When advantageous for the progress of the reaction, the opening 14 of the hole 11 of the reaction vessel 13 is preferably closed so that the reaction mixture is substantially sealed. By preventing the steam from flowing out of the container, the reaction can be favorably performed. When a certain amount or more of water vapor flows out of the container and is dried, the reaction may be stopped.

Using the above incubator of the present invention,
The reaction of the reaction mixture can proceed by changing the temperature of the reaction mixture stored in the hole of the reaction vessel with time. However, in the incubator of the present invention, there is no limitation on the components contained in the reaction mixture to be incubated there and the reaction proceeding there. Any reaction that changes the reaction temperature over time may be used. Biological reactions such as enzymatic reactions can be exemplified. Furthermore, a PCR method can be exemplified as an example of the enzyme reaction. Further, the reaction of the reaction mixture can be a reaction in which the temperature of the temperature controller (1) is periodically changed over time.
R method can be mentioned.

When the reaction is carried out using the incubator of the present invention, the temperature of the reaction mixture in the reaction vessel (1) and the temperature of the liquid surface facing at least the surface of the reaction mixture on the inner wall of the reaction vessel in contact with the space. (2) is controlled so that the temperature (2) is higher than the temperature (1) and the temperature (1) and the temperature (2) are changed in conjunction with each other. It is more preferable from the viewpoint of accurately controlling the temperature. That is, if the temperature (1) rises, the temperature (2) rises in conjunction therewith, and conversely, if the temperature (1) falls, the temperature control is performed so that the temperature (2) falls. Is preferred.

However, the temperature difference between the temperature (1) and the temperature (2) need not always be constant, but may be within a certain range with a certain width. On the other hand, if the temperature difference between the temperature (1) and the temperature (2) is too large, it becomes difficult to control the temperature (1) (the temperature (1) becomes too high), and it is difficult to promote the reaction well. Become. On the other hand, temperature (1) and temperature (2)
When the temperature difference is small, the temperature (1) is particularly high, and when the water vapor pressure is high, water in the sample is likely to disappear. Therefore, for example, the temperature difference between the temperature (1) and the temperature (2) is within a range of 1 to 30 ° C.
Preferably, it is appropriate to change in conjunction with each other so as to be maintained in the range of 2 to 20 ° C.

[0021]

The present invention will be further described with reference to the following examples.
In the following examples, a PCR reaction was taken as an example, and the incubator (RIKEN GS-384) of the present invention shown in FIG. 1 was used.
In addition, as a conventional model, DNA engine manufactured by MJ research
Was used. Example PCR Reaction solution PCR used BS750, which is a cDNA clone of β-chain of human thyroid stimulating hormone, as a template DNA. The size of the insert DNA is 680 bp. The reaction solution was 10 pg of BS750 and dNTP (dGTP, dCTP).
TP, dATP, dTTP) 50 μM, 10 ×
EX buffer (25 mM TAPS buffer, 50 mM
1 μl of KCl, 2 mM MgCl ₂ , 1 mM 2-mercaptoethanol, primer L220 and primer 1211 (L2205′TAACAATTTCACACAGGAAACA3 ′, 1)
211: 5 'ACGTTGTAAAACGACGGCCAGT3', respectively) 0.
Add 2 pmole and EX Taq (5 U / μl) and adjust to a total volume of 10 μl with sterile distilled water.

However, when RIKEN GS-384 is used, the reaction vessel is made of an aluminum plate (about 4 mm thick) with a diameter of 3 mm.
The PCR reaction solution was accommodated as a hole (capacity: about 21 μl) having a diameter of 3 mm and a depth of 3 mm. For the DNA engine, prepare the PCR reaction solution on a 5-fold scale and make the final volume 50 μl.
It was made to become. The test tube is 50
A volume of 0 μl was used.

Detection of amplification by PCR cycle and electrophoresis
Out 94 ° C., was incubated for 3 min, repeated 35 cycles [94 ° C. 1 min -55 ° C. 1 min -72 ° C. 1 min]. Thereafter, the mixture was incubated at 72 ° C for 10 minutes,
Store at ° C.

[94 ° C. for 1 minute-55 ° C. for 1 minute-72 ° C.
Minutes), the DNA engine manufactured by MJ research
Then, in the case of RIKEN GS-384 without using the heat conduction promoting means, the case of not using the heat conduction promoting means and the case of using the heat conductive silicone sheet (radiating rubber sheet TC) as the heat conduction promoting means.
-A type, manufactured by Shin-Etsu Silicone) or a heat conductive carbon graphite sheet (Panasonic Graphite, manufactured by Matsushita Electric Industrial) is interposed between the reaction vessel 13 and the temperature controller (1) 21 (incubator of the present invention). We did three things.

Further, as shown in Table 1, when the PCR reaction solution contains a template DNA and a primer (lanes 1 to 5)
4) When the PCR reaction solution does not contain the template DNA (lanes 5 to 8), and when the PCR reaction solution does not contain the primers (lanes 9 to 12), the PCR reaction is carried out. It was subjected to electrophoresis in 1 × TBE buffer using a 0.8% agarose gel. The pattern is shown in FIG. 3 as a photograph replacing the drawing.

From the electrophoresis photograph of FIG. 3, it can be seen that the PCR reaction solution contained lanes 5 to 12 containing no template DNA or primer.
For, no spot of the PCR amplification product is observed.
In the case of RIKEN GS-384 without using the heat conduction promoting means (lane 2), no spot of the PCR amplification product was observed, indicating that the reaction did not proceed well. In contrast, despite the reaction volume or 10 μl,
Lanes 3 and 4 in which PCR was performed using a thermally conductive silicone sheet or a thermally conductive carbon graphite sheet
(Example of the method of the present invention) In the same manner as in the case of DNAengine (lane 1) using a 5-fold amount of PCR reaction solution,
A spot of the amplification product is seen, which indicates that the PCR reaction has progressed favorably.

[0027]

[Table 1]

[Brief description of the drawings]

FIG. 1 is a schematic diagram of an incubator of the present invention.

FIG. 2 is a schematic diagram of a conventional incubator.

FIG. 3 is a photograph instead of a drawing showing an agarose gel electrophoresis pattern of a PCR product of an example.

Claims (10)

[Claims] 1. A reaction container comprising a substrate having a plurality of holes for accommodating a reaction mixture and at least one temperature controller for changing a temperature of the reaction container, wherein the reaction mixture accommodated in the hole is provided. An incubator for changing the temperature of the reaction mixture over time to advance the reaction of the reaction mixture, wherein between the reaction vessel and the temperature controller, heat transfer between the reaction vessel and the temperature controller. An incubator characterized by interposing means for promoting (hereinafter referred to as heat conduction promoting means). 2. A temperature controller comprising a pair of a temperature controller (1) and a temperature controller (2), wherein the temperature controller (1) controls a temperature (1) of a reaction mixture contained in a hole of a reaction vessel; The temperature controller (2) controls the temperature (2) of the inner wall of the hole of the member for closing the opening of the hole of the reaction vessel and facing the liquid surface of the reaction mixture contained in the reaction vessel. A heat conduction promoting means between the temperature controller (1) and the reaction vessel, between the temperature controller (2) and the reaction vessel,
Alternatively, a temperature controller (1) and a temperature controller (2) are provided between each of the reaction vessel and the temperature controller.
Incubator as described. 3. The temperature (1) and the temperature (2) are set so that the temperature (2) becomes higher than the temperature (1) and the temperature (1) and the temperature (2) change in conjunction with each other. 3. The incubator according to claim 2, which controls. 4. The incubator according to claim 1, wherein the heat conduction promoting means between the reaction vessel and the temperature controller is a flexible and heat conductive sheet. 5. The incubator according to claim 4, wherein the flexible and thermally conductive sheet is a thermally conductive resin sheet. 6. The incubator according to claim 5, wherein the heat conductive resin sheet is a heat conductive silicone sheet. 7. The method according to claim 4, wherein the flexible and thermally conductive sheet is a flexible graphite sheet. 8. The incubator according to claim 1, wherein the substrate having a plurality of holes is made of metal. 9. The incubator according to claim 4, wherein the hole of the reaction vessel is a through hole having two openings or a hole having one opening, and the opening of the hole is closed by the sheet. . 10. The incubator according to claim 1, wherein the temperature controller is a Peltier device.