JPH09206078A - Polygalacturonase gene and production of polygalacturonase - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a polygalacturonase gene necessary for singly producing polygalacturonase useful for removal of endocarp of citrus fruits, clarification of juice, extraction, etc., of a useful substance from a plant cell in a large amount by genetic engineering method. SOLUTION: This polygalacturonase gene is a genome gene of polygalacturonase derived from a filamentous fungus of the genus Penicillium and has e.g. a base sequence of the formula and has a promoter region and a terminator region as well as two intron sequences (each represented by IVSI and IVS2). A DNA obtained by extracting a chromosomal DNA according to a well-known method from a fungal strain IFO7719 strain of Penicillium janthin-ellum and amplifying the extracted chromosomal DNA by PCR method is connected to a plasmid vector to afford pSR1013, etc., and a host is transformed to provide the objective clone. A base sequence of the clone is determined by dideoxy method. Polygalacturonase can be mass-produced by introducing the gene into Aspergillus oryzae.

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to a polygalacturonase which is a kind of pectin-degrading enzyme and is used for removal of endocarp of citrus fruits, clarification of juice and extraction of useful substances from plant cells. The present invention relates to a genomic gene of a polygalacturonase derived from a filamentous fungus of the genus Penicillium, a promoter of the genomic gene, a terminator thereof, a gene expression unit composed of these, and production of polygalacturonase by genetic engineering.

[0002]

2. Description of the Related Art Conventionally, it has been known that a filamentous fungus of the genus Penicillium produces polygalacturonase, but its gene structure is completely unknown, and the fact is that the gene has not even been isolated. is there.

Pectin is a kind of polysaccharides often contained in citrus fruits and the like, and polygalacturonase, pectin lyase, pectin methyl esterase and the like are known as enzymes involved in the decomposition thereof.

[0004]

However, in general, since microorganisms capable of degrading pectin simultaneously produce these plural enzymes, isolation and purification of only polygalacturonase is not easy, and pectin is not easy. The decomposition products of the product contained many components, which hindered their effective use. Furthermore, the production amount of each enzyme was not at a satisfactory level.

On the other hand, E. coli, Bacillus subtilis, yeast, animal cultured cells, etc. have been studied as hosts for producing substances using genetic engineering.
There were problems such as the presence or absence of modification with sugar chains.

Therefore, the present invention aims to solve these problems.

[0007]

Therefore, a filamentous fungus (usually called fungus) has recently received attention to achieve this object. Under these circumstances, the host of the filamentous fungus
Problems such as promoters and terminators that function effectively in vector systems have important meanings.

The present inventor newly obtained a polygalacturonase genomic gene from the chromosome of a filamentous fungus of the genus Penicillium by using a genetic engineering technique, and analyzed the entire structure thereof. The present invention has been completed by successful introduction and expression of the gene into Aspergillus oryzae.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.

The polygalacturonase genomic gene of the present invention, the promoter and terminator of the genomic gene are prepared as follows.

Methods known from strains of Penicillium yancinerum (eg, Ruttkowski et al., Molecular Mi.
crobiology, 5,1353-1361 (1991))
A is extracted, a primer (oligonucleotide) for amplifying the gene by the polymerase chain reaction method (PCR method) is added thereto, and amplified by the PCR method. The DNA thus obtained is used as a plasmid vector (for example,
pUC18, etc., and connected to a host (eg E. coli JM109 strain or
DH5 strain) to obtain the desired clone. As a plasmid into which the polygalacturonase genomic gene of the present invention has been incorporated, pSRIO13 can be mentioned (see FIG. 1 for the restriction enzyme map). The nucleotide sequence of DNA was analyzed by a known method (for example, dideoxy method).

The genomic gene of polygalacturonase derived from Penicillium yancinerum of the present invention obtained and determined as described above has the restriction enzyme cleavage map of FIG. 1 and the nucleotide sequence of FIG. In addition to the promoter region and terminator region of Escherichia coli, it has two intron sequences (indicated as IVS1 and IVS2 in the figure).

However, in addition to the base sequence shown in FIG. 2, a part of the base sequence differs from the above-mentioned base sequence.
NA, DNA consisting of a part of the above-mentioned base sequence, or DNA containing at least the above-mentioned base sequence, having equivalent functions is included in the present invention.

[Examples] Examples are shown below, but the present invention is not limited thereto.

1. Preparation of chromosomal DNA of Penicillium yancinerum Extraction of chromosomal DNA of Penicillium yancineram
It carried out by the method described below.

First, one platinum loop of Penicillium yancinerum IFO7719 strain obtained from the Fermentation Research Institute was taken from a slant medium for preservation, and 5 ml of pectin medium (2% was added to a test tube.
Bactopeptone, 2% pectin, 1% yeast extract) was inoculated and shake-cultured at 30 ° C. for 2 days to prepare a preculture liquid. Add this culture to 100 ml pectin medium in a flask,
The culture was further shaken for 2 days.

The cells collected by the glass filter were thoroughly washed with distilled water and then washed with distilled water (equal to the wet cell weight of sterile sea sand No. B (manufactured by Nacalai Tesque)) and an extraction buffer (50 mM T).
It was ground with ris-HCl (pH 8.0), 150 mM NaCl, 100 mM EDTA) in an ice-cooled mortar for about 5 minutes. The ground bacterial cell paste was placed in a centrifuge tube, 10% SDS was added to a final concentration of 2%, and the mixture was centrifuged. After adding 5 M sodium perchlorate to the resulting supernatant to a final concentration of 0.5 M, it was extracted twice with an equal volume of a phenol solution (phenol: chloroform: isoamyl alcohol = 24: 23: 1). Take the aqueous layer, add 1/2 volume of PEG solution (30% PEG6000, 1.5M NaCl), and add 30% in ice.
After standing for a minute, centrifugation was performed to obtain a precipitate consisting of nucleic acid.

The precipitate was washed with 70% ethanol and dried, and then 1 ml of TE buffer (100 mM Tris-HCl (pH 8.0), 10 mM was added.
EDTA). 5 μl of RNase A solution (1 mg / ml) was added, and the mixture was reacted at 37 ° C. for 30 minutes. After the reaction, 0.5 ml of isopropanol was added, the resulting precipitate was collected by centrifugation, washed with ethanol, dried, and then dissolved in 0.1 ml of TE buffer (10 mM Tris-HCl (pH 8.0), 1 mM EDTA). .

2. Synthesis of primers for PCR reaction When cloning a genomic gene, a genomic gene library is prepared and oligonucleotides or
It was general to select a clone having a target genomic gene by colony hybridization or clone hybridization using cDNA as a probe. However, this method has a drawback that it is very complicated and takes a long time. Therefore, PC has become a popular method for gene isolation recently.
The R method was used.

When the amino acid sequences of the polygalacturonase derived from filamentous fungi known so far were compared, it was found that there are the common parts shown below.

[0021]

Embedded image These sequences are important for the expression of polygalacturonase activity, and it is highly likely that the polygalacturonase of Penicillium yancinelam also contains a similar amino acid sequence.
Based on the above amino acid sequence, primers for PCR reaction shown below were chemically synthesized by the phosphoamidite method.

[0022]

Embedded image 3. Amplification by PCR method Approximately 1 ng of the chromosomal DNA prepared in the previous section was used as a template, 20 pmol of each primer synthesized in the previous section, and 1 unit of "TAKARA Ex Taq" (Takara Shuzo) as a thermostable DNA polymerase were added, followed by DNA thermal cycler. (Perkin Elmer), 70 ° C: 3 minutes, 94 ° C: 1 minute,
50 ° C .: 30 minutes of 1 minute reaction. As a result of analyzing the reaction solution by polyacrylamide gel electrophoresis,
Several bands mainly containing about 500 bp were observed. Therefore, after cutting out a band near 500 bp to extract DNA, PCR reaction was carried out again using this as a template under the same conditions as above. As a result, a band of 500 bp was clearly amplified, so DNA was extracted from this band and cloned using the cloning vector pCRII included in "TA Cloning Kit" (Invitrogen).

4. Cloning of full-length genomic gene Since the DNA cloned in the previous section was considered to be part of the polygalacturonase genomic gene, the cassette genome walking method (eg, Isegawa, Y. et al., Mol.
ecular and Cellular probes, 6, 467-475 (1992)) was used to clone the front and rear parts of the gene obtained in the previous section.

About 5 μg of chromosomal DNA prepared in the previous two sections
After digesting each of them separately with a restriction enzyme (HindIII or PstI), the HindIII cassette or P
Ligation reaction was performed with stI cassette (20 ng each).

[0025]

[Chemical 6] Next, Takara Shuzo's cassette primer C1 (GTACATATTGT
CGTTAGAACGCG) and N-terminal side primer R1 (ACCGTCCGAA
TTGTCAATAG) or C-terminal side primer F1 (CCAACGGA
GTTCGCATCAAG) 10 pmol each and 1 unit of "TAKARAEx Taq" (Takara Shuzo) as a thermostable DNA polymerase, and then a DNA thermal cycler (Perkin Elmer)
, 70 ° C: 3 minutes, 94 ° C: 30 seconds, 55
C .: 25 minutes of reaction for 2 minutes was performed.

Next, 1 μl of this reaction solution was added to Takara Shuzo's cassette primer C2 (TAATACGACTCACTATAGGGAGA) and N-terminal side primer R2 (TGATAAGATTGTCAGACTGG) or C.
Terminal side primer F2 (TTACGATGCTACTGGCTCTG) 10pmol each
And as a thermostable DNA polymerase, "TAKARA Ex Ta
q ”(Takara Shuzo) After adding 1 unit, 2 as before
The second PCR reaction was performed. As a result, N-terminal side is PstI
When the cassette is used, the DNA of about 2 kb is Hi
When the ndIII cassette was used, a DNA of about 0.5 kb was amplified.

Next, a primer (CTGCAGCCAGAAAA-TCACAC) synthesized based on the N-terminal upstream nucleotide sequence and a primer synthesized based on the C-terminal downstream nucleotide sequence (AAGCT
TGAC-TTGCCGTCGAT) and the PCR reaction was performed again using the chromosomal DNA of Penicillium yancineram as a template.
As a result, as expected, about 3.6 kb of DNA believed to contain the full-length polygalacturonase genomic gene was amplified, so cloning was performed using the cloning vector pCRII included in the TA cloning kit (Invitrogen). PSRI013 was obtained as a plasmid containing the genomic gene for full-length polygalacturonase.

5. Determination of DNA nucleotide sequence of polygalacturonase genomic gene The nucleotide sequence of the polygalacturonase genomic gene cloned in pSRI013 was determined by primer walking. The dideoxy method was used as the method for determining the nucleotide sequence, and the reaction was performed using the “Auto Read Sequenci
ng Kit "(manufactured by Pharmacia), electrophoresis and nucleotide sequence determination were performed by using" ALFred DNA sequencer "(manufactured by Pharmacia). The obtained nucleotide sequence was analyzed by the DNA analysis software" GeneWorks "(Intelligenetics). The product was ligated and analyzed by using the product (manufactured by the company), and as a result, it was found that there were two introns in the polygalacturonase genomic gene.

6. Construction of expression vector The polygalacturonase genomic gene was introduced into Aspergillus oryzae, a type of Aspergillus oryzae.
The vector for expression in 1. was prepared by the strategy shown in FIG.

First, about 10 μg of pSRI013 obtained in the previous section was added to Sa.
After digestion with II (Takara Shuzo), dephosphorylation with alkaline phosphatase (Takara Shuzo), the digested fragments were separated by 0.8% agarose gel electrophoresis, and DNA was recovered from the main band of about 7.5 kb.

Next, a plasmid pSTA14 containing a nitrate reductase gene derived from Aspergillus oryzae (reported by Unkles et al., Molecular and General Genetics, 218, 99-104 (1
989)) 0.8% after digesting about 10 μg with SalI (Takara Shuzo)
Separate the digested fragments by agarose gel electrophoresis and perform about 7.
DNA was recovered from the 8 kb band.

Then, the two kinds of recovered DNA fragments were ligated with "DNA ligation kit" (Takara Shuzo) to transform Escherichia coli DH5 strain. A plasmid was extracted from the obtained ampicillin-resistant strain and screened to obtain the desired plasmid pSRI018. pSR
I018 is a vector capable of introducing a polygalacturonase genomic gene into Aspergillus oryzae using nitrate reductase as a selection marker.

[7] Expression of the polygalacturonase genomic gene in Aspergillus oryzae pSRI018 obtained in the previous section was prepared by a known method (for example, Unkles
Et al., Molecular and General Genetics, 218,99-10.
4 (1989)), which was isolated using potassium chlorate resistance as an index, and a method known as a nitrate reductase-deficient strain of Aspergillus oryzae IFO30104 strain (Fermentation Research Institute) (for example, Un
Report of kles et al., Molecular and General Genetics, 218,9.
9-104 (1989)) to obtain a transformant in which nitrate reductase activity was restored. Similarly, a transformant into which the vector pSTA14 containing no polygalacturonase genomic gene was introduced was obtained.

The transformant thus obtained was inoculated into 50 ml of a pectin medium (2% bactopeptone, 2% pectin, 1% yeast extract) in a flask, and the mixture was incubated at 30 ° C. for 5 hours.
After shaking culture for one day, the polygalacturonase activity produced in the culture supernatant was measured. The polygalacturonase activity is obtained by reacting the culture supernatant with sodium polygalacturonate (manufactured by Sigma) as an enzyme solution, and measuring the amount of the resulting reducing ends by the dinitrosalicylic acid method (for example, Borel et al., Helv. Chim.
Soc., 4252 (1952)).

As a result, the polygalacturonase activity in 1 ml of the medium of the control pSTA14-introduced transformant was 2.2 units, whereas the transformant in which pSRI018 containing the polygalacturonase genomic gene was introduced. The polygalacturonase activity of the body was 10.0 units, and it was revealed that the introduction of the polygalacturonase genomic gene increased the polygalacturonase activity about 10-fold.

As a result, it was confirmed that polygalacturonase can be mass-produced, and that the promoter and terminator of the genomic gene of polygalacturonase of Penicillium yancinerum function in Aspergillus oryzae.

[0037]

INDUSTRIAL APPLICABILITY According to the present invention, the polygalacturonase gene of Penicillium filamentous fungus is isolated and the structure is analyzed to identify the site important for the functional expression of the gene. It was possible to newly provide a galacturonase promoter, a terminator, and an expression unit composed of these. Furthermore, it was possible to newly provide a method for producing polygalacturonase in a large amount and in a single unit by a genetic engineering technique using the polygalacturonase genomic gene. The present invention greatly contributes to the production of polygalacturonase and the production of useful substances using the filamentous fungal host-vector system.

[Brief description of drawings]

FIG. 1 is a restriction enzyme cleavage map of the polygalacturonase gene.

FIG. 2 is a diagram showing the nucleotide sequence of the polygalacturonase gene.

FIG. 3 shows a method for constructing a plasmid pSRI018 and a restriction enzyme map.

Continuation of the front page (51) Int.Cl. ⁶ Identification number Reference number within the agency FI technical display location (C12N 9/24 C12R 1:19) (72) Yuko Hirao 2109 Yashima Nishimachi, Takamatsu City, Kagawa 8 Stock Association Shikoku Research Institute

Claims (11)

[Claims] 1. A genomic gene of polygalacturonase derived from a filamentous fungus of the genus Penicillium. 2. The genomic gene for polygalacturonase according to claim 1, wherein the filamentous fungus is Penicillium janthin-ellum. 3. The genomic gene for polygalacturonase according to claim 2, which has the following base sequence. Embedded image 4. A polygalacturonase promoter derived from the genomic gene of polygalacturonase derived from a filamentous fungus of the genus Penicillium. 5. The polygalacturonase promoter according to claim 4, wherein the filamentous fungus is Penicillium janthin-ellum. 6. The polygalacturonase promoter according to claim 5, which has the following nucleotide sequence. Embedded image 7. A polygalacturonase terminator derived from a genomic gene of polygalacturonase derived from a filamentous fungus of the genus Penicillium. 8. The polygalacturonase terminator according to claim 7, wherein the filamentous fungus is Penicillium janthin-ellum. 9. The polygalacturonase terminator according to claim 8, which has the following base sequence. Embedded image 10. A gene expression unit comprising the polygalacturonase promoter according to claim 4 or 5 or 6 and the polygalacturonase terminator according to claim 7 or 8 or 9. 11. The DN according to claim 1, wherein:
A method for producing polygalacturonase, which comprises using the A fragment in another filamentous fungus.