JPH0856670A - Gene fragment, etc., of antibody recognizing mucin-type synthetic glycolipid - Google Patents

Abstract

PURPOSE: To obtain gene fragments coding for the V-regions of a H-chain and a L- chain of an antibody recognizing a mucin-type synthetic glycolipid, having specific base sequences and capable of efficiently producing an antibody against a cancer- specific sugar chain, which is useful as the treating agent, diagnostic, etc., of cancer. CONSTITUTION: Mouse is immunized with a mucin-type synthetic glycolipid (F1α antigen) and B-cells are collected from the mouse. The B-cell is fused with a mouse bone marrow cell to prepare F1α 75 hybridoma. An mRNA is extracted from the hybridoma and a cDNA is prepared from the mRNA by an ordinary method. Polymelase chain reaction(PCR) is carried out using a template of the obtained cDNA and a probe of each of a partial base sequence of the V-region of the H-chain and the V-region of the L-chain of the antibody. Thus, a DNA coding for the V-region of the H-chain and that of the L-chain of the antibody are separately multiplied to obtain the objective gene fragments coding for the V-region of H-chain of the antibody recognizing F1α and containing the base sequence of formula I, and that coding for the V-region of L-chain of the antibody recognizing F1α and containing the base sequence of formula II.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a gene fragment of an antibody that recognizes a mucin-type synthetic glycolipid.

[0002]

2. Description of the Related Art It is known that an antibody that recognizes an antigen specifically expressed in cancer cells (cancer-specific antigen) is useful for diagnosis and treatment of cancer. Glycoproteins in which N-acetylgalactosamine and serine or threonine are O-glycosidically linked are collectively called mucins, and the binding unit of N-acetylgalactosamine and serine or threonine is called Tn antigen.

In vivo, galacto-terminals of the Tn antigen are present.
S-bound T antigen (alias: core1), sialic acid-bound sialylic Tn antigen at the end of Tn antigen, and Tn
Cor in which N-acetylglucosamine is bound to the end of the antigen
Although e3 is biosynthesized, it has been pointed out that the T antigen modified in another manner and the antigen further modified are specifically expressed in cancer cells. It has been pointed out that the F1α antigen has a structure different from that of the above-mentioned antigen and is specifically expressed in cancer cells (Japanese Patent Laid-Open No. 2-4).
5794).

[0004]

However, since other similar antigens are also expressed in cancer cells, and further, the antigenicity of sugar chains is low, immunizing cancer cells to induce the same F1α antigen as described above. It is extremely difficult to prepare an antibody against various cancer-specific sugar chains.

As a method of compensating for these drawbacks, a method of synthesizing a cancer-specific sugar chain and immunizing it to effectively prepare an antibody against the cancer-specific sugar chain has been proposed (JP-A-3-2).
No. 80894). An anti-F1α monoclonal antibody can be prepared by immunizing a mouse with the synthetic F1α antigen to prepare a hybridoma, and the cancer cell-specific expression of F1α75, which is one of the obtained antibodies, was examined. It has been reported that it is specifically expressed in gastric cancer and the like and that it is not expressed in normal tissues (Yamashita et al., Japan Gastroenterological Surgery Society 1994).

In order to develop a monoclonal antibody that recognizes F1α, which is a cancer-specific sugar chain, as an in-vivo diagnostic agent or therapeutic agent, it is necessary to administer the antibody in a large amount or repeatedly. Is. However, it is known that when a mouse-derived antibody is administered to humans, an antibody that recognizes the mouse antibody appears in human serum (Levy et al., Annu. Rev. Me.
d. 34, p107, 1983). Therefore, when a mouse-derived antibody is administered to humans in a large amount or repeatedly, the risk of anaphylaxis due to an immune response is increased, the administered antibody is rapidly decomposed, and its original activity is lost. There are challenges. To solve this problem, human antibodies may be used, but it is extremely difficult to isolate B cells producing the desired antibody from a population of human B cells, immortalize them, and culture them.

Recently, a mouse-human chimeric antibody has been devised to solve these problems. A mouse-human chimeric antibody is an antigen-binding region derived from an animal species other than human, that is, a variable region (V region) and a human-derived constant region (C region).
An antibody consisting of (Oi and Morrison, Biotechnology 4
Vol., P214, 1986), the human-derived C region does not receive the above-mentioned immune response, so that the above-mentioned problems can be solved. More recently, humanized antibodies have been devised. The humanized antibody is an antibody consisting of a minimal antigen-binding region derived from an animal species other than human, that is, a CDR region, and other human-derived V regions and C regions, which further reduce the possibility of receiving the immune response. Is.

[0008] Further, in order to enhance the function of the antibody as an in-vivo diagnostic agent or therapeutic agent, a fusion protein of the antibody and another protein has been devised. Furthermore, an antibody consisting only of the V region has been devised (Ward et al., Nature, 341, p544, 1).
989).

In order to produce these antibodies and develop antibodies recognizing F1α as in-vivo diagnostic agents or therapeutic agents, genes encoding the H chain and L chain of the antibody are necessary.

[0010]

In view of the above problems, the inventors of the present invention have earnestly studied the H chain or L chain gene of the F1α75 antibody (JP-A-3-280894), and as a result, They have found a gene and have solved the above problems. That is, the present invention is a gene fragment encoding the V region of the H chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the base sequence of SEQ ID NO: 1, and is represented by the base sequence of SEQ ID NO: 2. L of an antibody that recognizes a mucin-type synthetic glycolipid
It is a gene fragment encoding the V region of the chain.

The present invention is the V region of the H chain of an antibody that recognizes the mucin-type synthetic glycolipid coded by the gene fragment, that is, represented by the amino acid sequence of SEQ ID NO: 1. This is the V region of the L chain of the antibody that recognizes the mucin-type synthetic glycolipid coded by the fragment, that is, represented by the amino acid sequence of SEQ ID NO: 2.

The present invention also provides a V of the H chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 1.
A mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 2, which is a vector containing all or part of a gene fragment coding for a region and capable of expressing the gene fragment in a host cell. It is a vector containing all or part of a gene fragment coding for the V region of the L chain of an recognizing antibody and capable of expressing the gene fragment in a host cell. An antibody recognizing the mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 2 in whole or in part of the gene fragment encoding the V region of the H chain of the antibody recognizing the mucin-type synthetic glycolipid. Or all of a gene fragment encoding the V region of the L chain of Escherichia coli, a gene fragment encoding the C region of the H chain of human antibody and a gene fragment encoding the C region of the L chain of human antibody And expressing the gene fragment in a host cell. Vector can - is, and also one of these vectors - a host cell transformed with.

Furthermore, the present invention is characterized by culturing a host cell transformed with any of the above vectors,
Protein containing V region of H chain of antibody recognizing mucin-type synthetic glycolipid, protein containing V region of L chain of antibody recognizing mucin-type synthetic glycolipid or H chain of antibody recognizing mucin-type synthetic glycolipid And a method for producing a protein containing the V region of L chain. Hereinafter, the present invention will be described in detail.

The mucin-type synthetic glycolipid of the present invention (hereinafter referred to as F1
The gene fragment of the antibody that recognizes the α antigen) is represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, respectively. These gene fragments can be isolated, for example, by the method shown in Example 1 using a hybridoma producing an antibody that recognizes the F1α antigen as a starting material. It can also be prepared by using the nucleotide sequence of SEQ ID NO: 1 or 2 disclosed in the present specification as a clue, for example, by using a DNA synthesizer. The gene fragment of the present invention may have one or more bases added, one or more bases deleted, and one or more bases replaced.

The V region of the antibody that recognizes the F1α antigen of the present invention is coded by the above gene fragment and is represented by the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In the V region of the antibody, one or more amino acid residues are added, and one or more amino acid residues are deleted.
One or more amino acid residues may be substituted.

In order to genetically engineer an antibody that recognizes the F1α antigen, a vector containing a gene coding for it is required. The vector of the present invention contains the above gene fragment, that is, all or part of the gene fragment represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2, and is capable of expressing the gene fragment in a host cell. Is. The vector is a promoter / operator for expressing (transcription) a gene fragment other than the gene fragment of the present invention, and a terminator for ending the expression (transcription) of the gene fragment.
Known gene sequences such as genes for replication in cells and host cells.

By further adding a gene fragment coding for the C region of human antibody to the vector of the present invention,
It can be used as a vector for producing H chain or L chain of mouse-human chimeric antibody. In this case, regarding the human antibody gene fragment, the C chain of the H chain is adjusted so that the C chain of the H chain is in a state in which the frame matches the V region of the H chain of the present invention.
The region is prepared so that the frame matches the L chain V region of the present invention. C of human antibody H or L chain
The gene fragment coding for the region is well known (for example, Kameyama et al., FEBS Lett., Vol. 244, p301, 1989).

Among the vectors of the present invention, the vector for producing a mouse-human chimeric antibody that recognizes the F1α antigen includes all or part of the gene fragment represented by the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2. Containing all or a part of the gene fragment represented by the nucleotide sequence of, the gene fragment encoding the C region of human antibody H chain and the gene fragment encoding the C region of human antibody L chain, It is a vector capable of expressing the gene fragment in cells. Here, regarding the human antibody gene fragment, the H chain C region is in a state where the frame matches the H chain V region, and the L chain C region is in the frame matching the L chain V region. Construct a vector so that it is in a state.

In the present invention, the gene fragment represented by the base sequence of SEQ ID NO: 1 and the gene fragment represented by the base sequence of SEQ ID NO: 2 may be included. With such a vector, an antibody (Fv antibody) that does not include the C region and that recognizes the F1α antigen consisting of only the V region can be produced.

The present invention is also a host cell transformed with the vector described above. Transformation of a host cell with the above vector may be carried out according to an ordinary method and is not particularly limited. For example, if the vector is for E. coli, E. coli may be used as a host, and if the vector is for yeast, yeast may be used as a host.

By culturing the host cells thus transformed under appropriate conditions, antibody proteins recognizing various forms of F1α antigen can be produced.

For example, by selecting and using the above-described vector of the present invention, a protein containing only the V region of the H chain of an antibody that recognizes the F1α antigen, the V region of the L chain of an antibody that recognizes the F1α antigen, Containing a protein, a chimeric protein containing the V region of the H chain of an antibody that recognizes the F1α antigen and the C region of the H chain of a human antibody, the V region of the L chain of the antibody that recognizes the F1α antigen and the L chain of a human antibody In addition to chimeric proteins containing a C region, the V region of the H chain of an antibody that recognizes the F1α antigen, the C region of the H chain of a human antibody, the V region of the L chain of an antibody that recognizes the F1α antigen, and the L chain of a human antibody It is also possible to obtain a chimeric protein containing the C region of Of course, as described above, an antibody (Fv antibody) that recognizes the F1α antigen consisting only of the V region can also be produced.

[0023]

EXAMPLES Examples will be shown below to explain the present invention in more detail, but the present invention is not limited to these examples.

Example 1. Isolation of F1α75 antibody gene 1 × 10 ⁶ F1α75 hybridomas cultured in RPMI 1640 (manufactured by Gibco) (JP-A-3-280894).
MRNA extraction kit (made by Pharmacia)
Was used to prepare mRNA of F1α75 hybridoma, and cDNA was prepared according to a conventional method.

Next, using this cDNA as a template, oligonucleotide primer-VH1BACK; 5'-AGGT
(C / G) (A / C) A (A / G) CTGCAG (C /
G) AGTC (A / T) GG-3 'and VHFORSA
L1; 5'-GGGGGTCGACGCTGAGGGAG
ACGGGTGACCGTGGTCCCTGTGCCCC
DN which encodes the H chain V region of an antibody by carrying out a polymerase chain reaction (PCR) using AG-3 '
A fragment was amplified, and the amplified DNA fragment was PstI and S
Digested with alI and digested DNA fragment with restriction enzyme Sse
PEdHCG1-inserted into pEdHCG1 (Japanese Patent Application No. 6-189277) digested with 8387I and SalI
F1α75 was constructed.

On the other hand, using the same cDNA as a template, oligonucleotide primer-Vκ1BACK; 5'-GACAT
TCAGCTGACCCAGTCTCCA-3 'and V
κ1FOR; 5'-GTTAGATCTCCAGCTT
PCR was performed using GGTCCC-3 ′ to detect the L
A DNA fragment coding for the chain V region was amplified, and amplified D
The NA fragment was digested with PvuII and BglII, and the digested DNA fragment was inserted into pEdHCκ (Japanese Patent Application No. 6-189277) digested with restriction enzymes PvuII and BglII to construct pEdHCκ-F1α75.

Example 2. Determination of nucleotide sequence of F1α75 antibody gene The nucleotide sequences of the V region of the H chain and the V region of the L chain of the F1α75 antibody isolated as in Example 1 were determined by a conventional method. The determined base sequence and the amino acid sequence deduced from the base sequence are described as SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

Example 3. Preparation of F1α75 mouse / human chimeric antibody Transient expression in COS cells was confirmed by the following procedure. p
EdHCG1-F1α75 and pEdHCκ-F1α7
COS-1 cells were co-transfected with 5 by the calcium phosphate method, and the culture supernatant was collected 3 days later.
The same operation was performed without DNA, and the recovered culture supernatant was used as a control. The chimeric antibody titer in the collected culture supernatant was measured.

The chimeric antibody titer in the culture supernatant was measured as follows. The 96-well immunoplate on which the _anti -human IgG ₁ antiserum was immobilized was blocked with PBS containing 0.5% BSA. After washing the plate with PBS, the culture supernatant was added and the mixture was left at room temperature for 1 hour. After washing the plate with PBS, horseradish peroxidase (HRP) -labeled anti-human Igκ antibody was added and the plate was allowed to stand at room temperature for 1 hour. Then, after washing the plate, a commercially available coloring reagent (ABTS, manufactured by Dainippon Pharmaceutical Co., Ltd.) was added, and the degree of color development was measured by a commercially available measuring device (Microtiter Plate-Tri-Der-MPR-4, East). Saw Co., Ltd.). As a result, it was found that about 0.20 μg / ml of chimeric antibody was produced in the culture supernatant.

[0030]

EFFECT OF THE INVENTION A gene encoding the V region of the H chain and L chain of the antibody recognizing the F1α antigen provided by the present invention, F
H-chain and L-chain V regions of an antibody recognizing 1α antigen, a vector for producing the antibody and the like using a genetic engineering technique, a host transformed with the vector, and further culturing the host Of the H chain and L chain of an antibody that recognizes the F1α antigen
A large amount of the antibody having various additional functions can be produced by a method for producing a protein containing a region or the like. These are important for the analysis of the physiological role of cancer-specific mucin and have great significance in the development of therapeutic and diagnostic agents for cancer.

[0031]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 357 Sequence type: Nucleic acid Number of sequences: Double-stranded topology-: Linear Sequence type: cDNA to mRNA Origin Cell line: Hybridoma F1α sequence CAG GTC CAG CTG CAG GAG TCT GGG ACT GAG CTG GTG AGG CCT GGA GCT 48 Gln Val Gln Leu Gln Glu Ser Gly Thr Glu Leu Val Arg Pro Gly Ala TCA GTG AAG CTG TCC TGC AAG GCT TCT GGC TAC ACA TTC ACC AGC TAC 96 Ser Val Lys Leu Ser Sys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr TGG ATG CAC TGG GTG AAG CAG AGG CAT GGA CAA GGC CTT GAG TGG ATT 144 Trp Met His Trp Val Lys Gln Arg His Gly Gln Gly Leu Glu Trp Ile GGA AAT ATT TAT CCT GGT AGT GGT AGT ACT AAC TAC GAT GAG AAG TTC 192 Gly Asn Ile Tyr Pro Gly Ser Gly Ser Thr Asn Tyr Asp Glu Lys Phe AAG AGC AAG GGC ACA CTG ACT GTA GAC ACA TCC TCC AGC ACA GCC TAC 240 Lys Ser Lys Gly Thr Leu Thr Ver Asp Thr Ser Ser Ser Thr Ala Tyr ATG CAC CTC AGC AGC CTG ACA TCT GAG GAC TCT GCG GTC TAT TAC TGT 288 Met His Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Ver Tyr Tyr Cys ACA AGA GAA GGG GAT GGT TAC CAC TAC TTT GAC TAC TGG GGC CAA GGG 336 Thr Arg Glu Gly Asp Gly Tyr His Tyr Phe Asp Tyr Trp Gly Gln Gly ACC ACG GTC ATC GTC TCC TCA 357 Thr Thr Val Ile Val Ser Ser SEQ ID NO: 2 Sequence length: 318 Sequence type: Nucleic acid Number of sequences: Double-stranded topology-: Linear Sequence type: cDNA to mRNA Origin Cell line: Hybridoma F1α sequence GAC ATC GAG CTC ACT CAG TCT CCA GCA ATC ATG TTT GCA TCT CTA GGG 48 Asp Ile Glu Leu Thr Gln Ser Pro Ala Ile Met Phe Ala Ser Leu Gly GAG AAG GTC ACC ATG AGC TGC AGG GCC AGC TCA AGT GTA AAT TAC ATG 96 Glu Lys Val Thr Met Ser Cys Arg Ala Ser Ser Ser Val Asn Tyr Met TAC TGG TAC CAG CAG AAG TCA GAT GCC TCC CCC AAA CTA TGG ATT TAT 144 Tyr Trp Tyr Gln Gln Lys Ser Asp Ala Ser Pro Lys Leu Trp Ile Tyr TAC ACA TCC AAC CTG GCT CCT GGA GTC CCA GCT CGC TTC AGT GGC AGT 192 Tyr Thr Ser Asn Leu Ala Pro Gly Val Pro Ala Arg Phe Ser Gly Ser GGG TCT GGG AAC TCT TAT TCT CTC ACA ATC AGC AGC ATG GAG GGT GAA 240 Gly Ser Gly Asn Ser Tyr Ser Leu Thr Ile Ser Ser Met Glu Gly Glu GAT GCT GCC ACT TAT TAC TGC CAG CAG TTT ACT AGT TCG TAC ACG TTC 288 Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Phe Thr Ser Ser Tyr Thr Phe GGA GGG GGG ACC AAG CTG GAA ATA AAA CGG 318 Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg

Claims (12)

[Claims] 1. A gene fragment encoding the V region of the H chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 1. 2. A gene fragment encoding the V region of the L chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 2. 3. A V region of an H chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the amino acid sequence of SEQ ID NO: 1. 4. A V region of an L chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the amino acid sequence of SEQ ID NO: 2. 5. A host cell containing the whole or part of a gene fragment coding for the V region of the H chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 1. A vector capable of expressing a gene fragment. 6. A host cell containing the whole or a part of a gene fragment coding for the V region of the L chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 2. A vector capable of expressing a gene fragment. 7. The vector according to claim 5, which further comprises a gene fragment encoding the C region of the H chain of a human antibody. 8. The vector according to claim 6, which further comprises a gene fragment encoding the C region of the L chain of a human antibody. 9. A whole or a part of a gene fragment coding for the V region of the H chain of an antibody that recognizes a mucin-type synthetic glycolipid represented by the nucleotide sequence of SEQ ID NO: 1, or the nucleotide sequence of SEQ ID NO: 2. Of the gene fragment encoding the V region of the L chain of the antibody recognizing the mucin-type synthetic glycolipid represented, the gene fragment encoding the C region of the H chain of human antibody, and the human antibody L
A vector containing a gene fragment coding for the C region of a chain and capable of expressing the gene fragment in a host cell. 10. The vector according to any one of claims 5 to 9.
Host cells transformed with. 11. A protein containing the V region of the H chain of an antibody recognizing a mucin-type synthetic glycolipid, an antibody recognizing a mucin-type synthetic glycolipid, which comprises culturing the host cell according to claim 10. A method for producing a protein containing the V region of the L chain or a protein containing the V region of the H chain and L chain of an antibody that recognizes a mucin-type synthetic glycolipid. 12. The produced protein comprises a V region of an H chain of an antibody that recognizes a mucin-type synthetic glycolipid, a V region of an L chain of an antibody that recognizes a mucin-type synthetic glycolipid, and a C of an H chain of a human antibody. 12. The method for producing a protein according to claim 11, which is a protein containing the region and the C region of the L chain of a human antibody.