JPH08277296A - Protein having tpo activity - Google Patents

Abstract

PURPOSE: To obtain a new protein having a specific amino acid sequence, exhibiting a thrombopoietic activity, promoting the multiplication and differentiation of megakaryocyte precursor cells, specifically increasing the production of platelets in vivo, and useful for the therapy and diagnosis of thrombopathy, etc. CONSTITUTION: This new protein has an amino acid sequence of the formula, exhibits a thrombopoietic(TPO) activity, has an activity for promoting the multiplication and differentiation of megakaryocyte precursor cells or specifically stimulating or increasing the production of platelets in vivo, and is effective for the therapy and diagnosis of thrombopathy such as thrombocytopenia, etc. The protein is obtained by separating a mRNA originated from a normal liver by a conventional method, synthesizing cDNAs with the mRNA as a template, screening the produced cDNA library with a rat TPOc DNA fragment as a probe, selecting a stain containing the gene of human TPO activity, recovering the DNA, transforming a vector with the DNA and subsequently developing the protein in a host cell.

Description

Detailed Description of the Invention

TECHNICAL FIELD The present invention relates to a novel protein having an activity of promoting the growth and differentiation of megakaryocyte progenitor cells or specifically stimulating or enhancing the production of platelets in vivo, and such a protein. Regarding the use of.

2. Description of the Related Art Megakaryocytes are large cells, which are multinucleated and rich in cytoplasm, which are mainly observed in bone marrow and produce platelets. The source of megakaryocytes is pluripotent stem cells in the bone marrow. Pluripotent stem cells are differentiated to some extent to become megakaryocyte progenitor cells (CFU-MK) directed only to megakaryocyte lineage, and further proliferate and differentiate into megakaryocytes. Megakaryocytes are further associated with increased polyploidy of the nucleus, maturation of cytoplasm.
n) and finally release the non-nucleated cytoplasmic fragments platelets into the blood circulation. On average 2000-4000 platelets are produced from one mature megakaryocyte. Although there are many unclear points about the mechanism of platelet production, megakaryocytes are localized in the subendothelium of the venous sinus of the bone marrow, and their cytoplasm penetrates the endothelium to form a string-like process on the inner wall of the sinus. It is thought to release and release platelets. It has been suggested that a specific production control mechanism exists for such megakaryopoiesis and platelet production. In healthy people and normal animals, effective platelet counts are maintained, but, for example, when anti-platelet antibody is administered to normal animals, only platelets rapidly decrease in a short period of time and then start to increase. It is known that the normal value is transiently exceeded, but finally returns to the normal value again. Further, clinically, it has been known that the number of platelets decreases (thrombocytopenia) or thrombocytosis despite the normal number of red blood cells and white blood cells. However, to date, the isolation and identification of specific regulatory factors responsible for such a production mechanism (for example, the presence of erythropoietin in erythropoiesis) have not been successful. The most important function of platelets is the formation of hemostatic plugs in the hemostatic mechanism. When the hemostatic mechanism fails to function normally due to thrombocytopenia, it tends to bleed. In cancer radiotherapy and chemotherapy, thrombocytopenia due to myelosuppression is a fatal complication, and such cancer patients are given platelet transfusion to prevent bleeding tendency. Platelet transfusions are also given to patients who have undergone bone marrow transplants and patients with aplastic anemia. Platelets for such platelet transfusions are prepared by plateletpheresis from the blood of healthy blood donors, but the transfusion platelets have a short shelf life and can be contaminated by bacterial infections. It also exposes the patient to dangerous viruses such as the human immunodeficiency virus (HIV) or various hepatitis viruses, induces the patient to receive antibodies to the histocompatibility antigen (HLA) on the surface of the transfused platelets, or There is a risk that contaminating lymphocytes may cause graft-versus-host disease (GVHD). Therefore, it would be extremely beneficial to be able to stimulate endogenous platelet production and at the same time reduce platelet transfusion dependency in patients with thrombocytopenia. Moreover, if thrombocytopenia can be corrected or prevented in patients who are undergoing radiation therapy or chemotherapy for cancer, it becomes possible to make those treatments safer and more intensive, and to further control them. A cancer effect can be expected. For that reason, many studies have been enthusiastically conducted for the isolation and identification of specific regulatory factors involved in the regulation of megakaryocyte and platelet production. According to in vitro studies, regulatory factors involved in the process of proliferation and differentiation of megakaryocyte cells are considered to be roughly classified into the following two (for example, Williams et al., J. C.
ell. Physiol. , 110, 101-104
Pp. (1982)). Megakaryocyte colony stimulating factor (Meg-CSF) is a regulatory factor that promotes the growth and differentiation of CFU-MK, and experimentally induces the formation of megakaryocyte aggregates (colony) in semi-solid culture medium. Have activity. Another regulator is the megakaryocyte amplification factor (Meg).
-Pot), megakaryocyte stimulating factor, platelet production stimulating factor and the like, which mainly act on megakaryocytes in the differentiation stage after CFU-MK and promote differentiation / maturation. In experiments, it is often detected as an activity that amplifies Meg-CSF activity.
In addition, when serum or plasma in the thrombocytopenic period of an experimentally thrombocytopenic animal is injected into another normal animal, platelets increase, so it is considered that there is a humoral factor having a thrombocytopenic effect in vivo. And thrombopoietin (t
hombopoietin (TPO). In recent years, several cytokines whose genes have been cloned have been investigated for their effects on megakaryocyte cells and in vitro thrombocytosis. Human IL-3 stimulates the formation of human megakaryocyte colonies (Bruno et al. Exp.
Hematol. 16: 371-377, (19
88)), resulting in an increase in platelet counts at least in monkeys (Donahue et al., Science, 241: 1,
820, p. (1988)). However, IL-3 is a factor affecting proliferation and differentiation of all hematopoietic cells,
It can be distinguished from megakaryohematopoietic and specific regulators of platelet production. Human IL-6 does not show Meg-CSF activity, but acts on immature megakaryocytes to promote differentiation into mature megakaryocytes (Williams et al., Exp, He.
matol. 18: 69- (1990). In mice and monkeys, it shows thrombocytosis, increases the size of bone marrow megakaryocytes, and increases ploidy of nuclei, but side effects such as weight loss and induction of acute phase proteins have also been observed (Asano et al., Blood. , Volume 75, 1602-16
05, (1990); Stahl et al., Blood, 7
8: 1467-1475, (1991)). Human I
L-11 also showed no Meg-CSF activity, and Meg-Po
T-activity is exerted and a thrombocytosis effect has been reported in mice (Neben et al., Blood, 81, 90).
1-908, (1993)). Human LIF also significantly increased platelet counts in monkeys (Maye).
r et al., Blood, 81, 3226-3233,
(1993)), the action on megakaryocytes in vitro is weak (Burstein et al., J. Cell. Phys.
iol. 153, pp. 305-312, (199
2)). These cytokines are expected to have potential clinical applications as platelet-increasing factors, but they do not specifically act only on the megakaryocyte system, and side effects are also recognized. Therefore, in the clinic, a platelet-increasing factor specific to the megakaryocyte-platelet system, which has fewer side effects, is desired. Meg-CSF, Meg-Pot, or TPO has been found in serum, plasma, urine of humans or animals that have been thrombocytopenic for a long time, or in the supernatant of certain human cultured cell lines.
The existence of activity has been reported, but it remains largely unknown as to whether such a factor exerts its activity singly or in the presence of multiple factors, and the difference with known factors.
Regarding factors derived from human organisms, Hoffman et al. Compared with those of healthy individuals in the serum of patients with aplastic anemia with a decrease in bone marrow megakaryocytes and amegakaryocytic thrombocytopenic purpura in addition to a decrease in platelets. And significantly higher Meg-CSF
Found activity (Hoffman et al., N. Eng.
Med. 305, 533-538, (198
1)), Mazur et al. Further reported that this Meg-CSF activity in the serum of patients with aplastic anemia shows IL-3 or G-3.
It was shown to be different from M-CSF (Mazur et al., B
blood, 76, 290-297, (199
0)). Similar Meg-CSF activity has also been detected in the sera of intensively chemotherapy-treated cancer patients and bone marrow transplant patients (Mazur et al., Exp. Hemato).
l. Vol. 12, pp. 624-628, (1984); de.
Alarcon and Schmieder, Prog C
lin. Bio. Res. 215, 335-340
P., (1986)). Hoffman et al. Reported that Meg-CSF having an apparent molecular weight of 46000 was purified from the plasma of a patient with thrombocytopenia of myeloid megakaryocyte hypoplasia (Hoffman et al., J. Clin. Invests.
t. 75, 1174-1182, (198
5)), and subsequent studies have shown that the purity of the purified preparation is insufficient to determine the amino acid sequence (Ho
ffman, Blood, Volume 74, 1196-1212
P., (1989)). ⁷⁵ Se-selenomethionine in mice (from plasma from similar thrombocytopenic patients or from urine of patients with idiopathic thrombocytopenic purpura (ITP))
^The TPO-like activity that promotes the uptake of ⁷⁵ Se-selenomethionine) into new blood platelets was partially purified, and the plasma-derived activity had an apparent molecular weight of 40.
000 has been shown (Grossi et al.,
Hematologica, Volume 72, 291-295.
P., (1987); Vannucchi et al., Leuke.
Mia, Vol. 2, pp. 236-240, (1988). In the urine of patients with aplastic anemia and severe ITP, Meg-C
SF activity and TPO-like activity have been detected (Kawak
ita et al., Br. J. Haematol, Volume 48, 6
09-615, (1981); Kawakita et al.,
Blood, 61, 556-560, (198
3)). Furthermore, Kawakita et al. Reported that the Meg-CSF activity contained in the urine extract of patients with aplastic anemia had an apparent molecular weight of 45,000 by gel filtration under dissociation conditions (Kawakita et al., Br.
J. Haematol, Volume 62, Pages 715-722,
(1986)). Erikson-Miller et al.
We have reported the purification of Meg-CSF from a similar sample, but its structure has not been elucidated (Erikson.
-Miller et al., "Blood Cell Grow".
th Factors; their present
and future use in hematol
ody and oncology "ed. by Mu
rphy, AlphaMed Press, Dayto
n, Ohio, p. 204-220, (1992)). T
urner et al. reported M from the urine of patients undergoing bone marrow transplantation.
A megakaryocyte-stimulating factor (MSF) having egg-CSF activity was purified and its gene was cloned (Turner
Et al., Blood, 78, 1106, 279a, (19
91) (abstr., Suppl. 1). This MSF
Is a protein dimer with a molecular weight of 28,000 to 35,000. It is unclear whether this factor is the same as Meg-CSF which has been detected in the serum or plasma of patients with thrombocytopenia and whether or not it has a platelet increasing action in vivo. The TPO-like activity with a molecular weight of 32000 was purified from the culture supernatant of a human embryonic kidney-derived cell line (HEK cells) and various properties have been investigated, but its structure has not yet been clarified (McD
onald et al. Lab. Clin. Med. 10,
Volume 6, pp. 162-174, (1985); McDona.
ld, Int. J. Cell Cloning, Volume 7,
139-155, (1989)). On the other hand, according to another investigator, the main activity of promoting the maturation of megakaryocytes in vitro, which is present in the conditioned medium of HEK cells, is that a known cytokine produced by the cells, namely IL
There are reports that it depends on -6 and EPO (Withy et al.,
J. Cell. Physiol. , Volume 15 3362-
372, (1992)). Regarding factors of animal origin,
Evatt et al., ⁷⁵ S in rabbits and mice in thrombocytopenic plasma of rabbits infused with antiplatelet antibody.
We have reported a TPO-like activity that promotes uptake of e-selenomethionine into neonatal platelets (Evatt et al.,
J. Lab. Clin. Med. , 83, 364-3
71, (1974)). There are many similar reports from the 1960s to the 1970s (eg, Odel1 et al., Proc. Soc. Bol.
Med. 108, 428-431, (196
1); Evatt and Levin, J. et al. Clin. Inv
est, 48, 1615-1626, (196
9); Harker, Am. J. Physiol. , 2
Volume 18, pp. 1376-1380, (1970); Shr.
einer and Levin, J .; Clin. Invests
t, 49, pp. 1709-1713, (1970);
Penington, Br. Med. J. 1 volume, 60
6-608, (1970)). Evatt et al., And Hill and Levin partially purified TPO-like activity from plasma of rabbits in the thrombocytopenic phase induced by administration of antiplatelet antibody (Evatt et al., Blood, 54, 37.
7-388, (1979); Hill and Levin,
Exp. Hematol. , Volume 14, 752-759
P., (1986)), and further, the activity of promoting megakaryocyte differentiation and maturation in vitro, ie, Meg-P.
Purification of this factor was proceeded using ot activity as an index, and it was revealed that it has an apparent molecular weight of 40,000 to 46,000 on gel filtration, but it has not been completely purified (Ke.
ller et al., Exp. Hematol. , 16 volumes, 26
2-267, (1988); Hill et al., Exp. H
ematol. , 20, 354-360, (199
2)). No IL-6 activity was detected in the plasma of rabbits with severe acute thrombocytopenia induced by antiplatelet antibody administration, indicating that this TPO-like activity is mediated by a molecule different from IL-6. Has been (Hill
Et al., Blood, 80, 346-351, (199
2)). Tayrien and Rosenberg were also extracted from the same rabbit plasma or HEK cell culture supernatant.
A factor having an apparent molecular weight of 15,000 that stimulates the production of platelet factor 4 in a megakaryocyte rat cell line was purified, but its structure has not been clarified (Ta.
Yrien and Rosenberg, J .; Biol. Ch
em. , 262, 3262-3268, (198
7)). Nakeff has also found Meg-CSF activity in the serum of mice that have been thrombocytopenic by administration of antiplatelet antibodies (Nakeff, "Experim.
mental Hematology Today ”e
d. by Baum and Ledney, Spri
nger-Verlag, NY, pp. 111-123,
(1977)). On the other hand, in the plasma of rabbits, which had been thrombocytopenic by the same treatment, the maturation of megakaryocytes was promoted in vitro (Keller et al., Exp. Hemato).
l. 16: 262-267, (1988); Hi.
ll et al., Exp. Hematol. , Volume 17, 903-
907, (11) 89), morphological change of megakaryocytes into platelets (Leven and Ye, Blood, 69, 104).
6-1052, (1987)) stimulating activity was detected, but Meg-CSF activity was not observed. It is unclear why these differences are due. Miura et al. Detected Meg-CSF activity in thrombocytopenic plasma of rats who underwent whole-body irradiation with sublethal doses of radiation (Miura et al., Blood, 63, 10;
60-1066, (1984)), since this activity is not diminished by platelet transfusion, in vivo Meg-
Induction of CSF activity requires reduction of megakaryocytes rather than reduction of platelets (Miura et al., Ex.
p. Hematol. , 16: 139-144,
(1988)). Mazu and South were Meg-containing in the serum of dogs that had aplastic anemia after irradiation.
CSF activity was detected and the apparent molecular weight was 17 on gel filtration.
Reported to have 5000 (Mazur and S
outh, Exp. Hematol. , Volume 13, 116
4-1172, (1985)). In addition, a factor derived from serum, plasma, or urine is Straneva et al. (Straneva et al. Exp. Hematol.
5, pp. 657-663, (1987) and the like. Thus, despite the presence of factors that promote megakaryocyte hematopoiesis and platelet production in biological samples of humans and animals with thrombocytopenia,
To date, isolation, biochemical and biological identification, and characterization of such factors has been found in natural sources such as blood and urine in extremely low amounts. Not successful because.

Therefore, an object of the present invention is to promote the activity of promoting the proliferation and differentiation of megakaryocyte progenitor cells and / or specifically stimulating or enhancing the production of platelets in vivo ( Protein having TPO activity (TPO)
PO) from natural sources, and further by isolating the gene encoding such a protein, using recombinant DNA technology to provide a means for the homogeneous mass production of said protein. Especially. If possible, it could replace or reduce the frequency of currently adopted platelet transfusions, or could be used in the treatment and diagnosis of platelet disorders.

According to the present invention, a TPO
New coding for amino acid sequence of active protein
A standard DNA (hereinafter referred to as "the DNA of the present invention") is provided.
Be done. The DNA of the present invention is shown in SEQ ID NO: 16.
There are DNAs encoding different amino acid sequences. D of the present invention
NA includes the amino acid sequence shown in SEQ ID NO: 16 and
And its amino acid sequence as long as it retains TPO activity.
Part of the sequence is modified (substitution, deletion, insertion, and / or addition)
Added), that is, it encodes a TPO derivative
DNA is included. In other words, the DN of the present invention
As A, the amino acid sequence is substantially as shown in SEQ ID NO: 16.
DNAs encoding the defined amino acid sequences are included. This
As used herein, "substantially the amino acid shown in SEQ ID NO: 16
“A sequence” means the amino acid sequence shown in SEQ ID NO: 16.
In addition, "as long as the TPO activity is retained, the sequence number
Substitution, deletion, insertion in part of the amino acid sequence shown in No. 16
Including "amino acid sequence with insertions and / or additions"
Things. It should be noted that the term "code for an amino acid sequence" is used here.
DNA that has all the degenerate nucleotide sequences
Means DNA that does. Furthermore, the DNA of the present invention is
Encodes the amino acid sequence of a protein having TPO activity
DNA selected from the following (a) to (c)
Includes DNA. (A) shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6
DNA or their complementary strands (b) (a) DNA or fragments thereof (under strict conditions)
Hybridizing DNA (c) D of (a), (b) if there is no degeneracy of genetic code
DNA capable of hybridizing with NA. In other words, the DNA of the present invention is
It also includes the DNA shown in either (a) or (b).
It (A) Vector pEF18S carried on Escherichia coli DH5
-A2α (contract number FERM BP-4565) embedded
Amino acid distribution of proteins with rare TPO activity
DNA encoding the sequence, or carried in E. coli DH5
Vector pHT1-231 (accession number FERM BP
-4564) having a TPO activity incorporated into
DNA encoding a protein amino acid sequence (b) the amino acid sequence of a protein having TPO activity
DNA encoding (a) or its DNA
DN hybridizing (under stringent conditions) to the fragment
A. Here is a table called "stringent" hybridization conditions.
Currently, degenerate and / or single sequence oligonucleotides
By using cleotide primer (probe)
Performing PCR amplification of DNA in the present invention
It is used in a series of examples. As an example
Sambrook et al., “Molecular C”
longing ”(Cold Spring Harbo
r Laboratory Press, 1989).
Chapters 11 and 14, or Ausubel et al.
Hen "Current Protocols in Mo
regular Biology "(Current
Protocols, U. S. A. , 1993)
See section 2.10. The DNA of the present invention is
1 to 1 in the amino acid sequence shown in column No. 16
Contains a nucleotide sequence encoding the amino acid sequence at position 63, or
DNA encoding a protein having TPO activity
included. Such DNA has a cleavage site by a restriction enzyme.
Position and / or expression that facilitates expression.
To the start, end or middle of the current vector construction
Can be included for additional donation of DNA. In addition,
If a mammalian host is selected, it is preferred for expression in it.
A new codon (preferred codon) may be incorporated. The present invention
The DNA of is, for example, mammalian cells including human.
It was prepared by a known method after preparing mRNA from which
Screen the cDNA library by known methods.
There is a cDNA obtained by culturing. This
In the case of, the source of mRNA is rat liver cell origin.
Conventional cell lines McA-RH8994 cells, HTC cells, H
4-II-E cells, rat liver, kidney, brain, small intestine, human
Liver etc. are mentioned. Moreover, as the DNA of the present invention,
Produced by known methods from mammalian cells including human
Screened from known genomic libraries by known methods
Genomic DNA may be used. In this case
Sources of nom DNA include human, rat, mouse, etc.
Chromosomal DNA of. Also get in this way
The encoded protein having TPO activity
Modify DNA using well-known site-directed mutagenesis
As a result, a part of the amino acid sequence has been modified,
That is, DNA encoding the TPO derivative can be obtained
It It also has the TPO activity disclosed herein.
Based on the amino acid sequence / base sequence of the protein,
Encodes a protein with some amino acid sequences modified
DNA that is chemically synthesized in part or in whole
Therefore, it can be easily obtained by those skilled in the art. D of the present invention
NA exhibits TPO activity by various gene recombination techniques.
It is a substance that is useful for mass-producing
It Furthermore, the DNA of the present invention is a TPO-related protein.
Gene encoding c, and c of other mammalian TPO
DNA, and labeled probes for isolation of genomic DNA.
A material suitable for use as a lobe. Also human
And useful in gene therapy in other mammalian species
is there. The DNA of the present invention is useful for producing large amounts of TPO and TPO.
Trans that can be used as a eukaryotic host for production
Useful for developing transgenic mammalian species (Palmit
er et al., Science, 222, 809-814,
(1983)). Further, according to the present invention, the TPO activity is
Incorporating a DNA that encodes a protein that has sex
Vector, host cell transformed with the vector, and the host
Tampa produced by culturing main cells and having TPO activity produced
It has TPO activity characterized by separating and purifying
A method for producing a protein is provided. Inn in this case
The primary cells are prokaryotes (eg bacteria, preferably large
Enterobacteria, eukaryotes (eg yeast, insects, or mammals)
Material) cells can be used. As an example of mammalian cells
, COS cells, Chinese hamster ovary (Ch
inse Hamster Ovary) cells, X6
3.6.5.3. Cells, C-127 cells, BHK (Ba
by Hamster Kidney) cells, human origin
Examples thereof include cells (for example, HeLa cells). Yeast
Examples include baker's yeast (Saccharomyces
cerevisiae) and methanol-assimilating yeast (Pi
chia pastoris) and the like. Insect detail
Examples of vesicles include silkworm cultured cells (eg, Sf21 cells)
Etc. To transform these host cells
The vector used for this purpose is pKC3 for E. coli.
0 (Shimake H. and M. Rosen
berg, Nature, 292, 128-132, 1
981), pTrc99A (Amann E. et al., Ge.
ne6, 69, 301-315, 1988) and the like.
Be done. For mammalian cells, pSV2-neo (So
other and Berg; J. Mol. App
l. Genet. 1, 327-341, 1982),
pCAGGS (Niwa et al .; Gene, 108, 193).
-200, 1991), or pcDL-SR α2
96 (Takebe et al .; Mol. Cell. Bio.
l. , 8, 466-472, 1988) and the like. yeast
For use, pG-1 (Schena M. and Ya
mamoto K. R. Science, 241, 9
65-967, 1988). For silkworm cells
Is a transfer vector p for recombinant virus production
Ac373 (Luckow et al., Bio / Technol
ogy, 6, 47-55, 1988) and the like. these
Vectors for replication may include origins of replication, selection markers,
The vector for eukaryotic cells contains
RNA splice site, polyadenylation site
Gnarl etc. are added. Mammalian cell as origin of replication
Vectors include SV40, adenovirus, bovine papyri
Those derived from Roman virus can be used. Big
Vectors for enterobacter include ColE1, R factor, F factor
Those derived from can be used. 2 for yeast
those derived from μmDN ARS1 can be used
It As a promoter for gene expression, a vector for mammalian cells
In the case of
Derived from omavirus, adenovirus, SV40
Etc. or derived from a chromosome (for example, EF1-α)
Etc. can be used. As a vector for E. coli,
Derived from cteriophage λ, trp, lpp, l
The ac and tac promoters can be used. Pa
For yeast, ADH, PH05, GPD, PGK,
About MAFα promoter and methanol-assimilating yeast
Can use the AOX1 promoter or the like. Silkworm
Cell vectors derived from nuclear polyhedrosis virus, etc.
Can be used. Mammals as selectable markers
Neomycin resistant genes are used for cell vectors.
Offspring, thymidine kinase (TK) gene, dihydrofolate reduction
Original enzyme (DHFR) gene, E. coli xanthine guanine
Phosphoribosyl transferase (Ecogpt)
A gene etc. can be used. As a vector for E. coli
Is a kanamycin resistance gene, ampicillin resistance gene
Offspring, tetracycline resistance gene, etc.
It Leu2, Trp1, Ura3 inheritance for yeast
A child or the like can be used. Host-vector as above
To obtain a protein having TPO activity using the system
Was the gene integrated at an appropriate site of the above vector.
Host cells were transformed with recombinant DNA bodies
Then, the obtained transformant was cultured, and the
The polypeptide may be separated and purified from the culture solution.
The means and methods used for these are combinations of known ones.
Can be done. When expressing using a host
In order to more evenly homogenize the N-terminal of the expression product.
In order to modify the original signal sequence or to
The signal sequence of may be used. Also, the N-terminal and
Modify (substitute or add) amino acid residues near
(For example, when expressing in E. coli,
In addition to thionine residue, lysine residue etc.)
Also, it is possible to make the N-terminal uniform. Also, guru
Tathione-S-transferase (GST: Glut
Athione-S-Transferase) and TP
O and fusion protein via thrombin recognition peptide
Expression in a suitable host, isolated, and then fused
GST part by treating protein with thrombin
Gly with a glycine residue added at position -1
^-1A TPO protein can be obtained. T of the present invention
A novel protein having PO activity (hereinafter referred to as "the protein of the present invention"
Sequence ") and was shown in SEQ ID NO: 16.
There is a protein consisting of an amino acid sequence. Also, the present invention
As long as it retains TPO activity,
Altered columns (substitutions, deletions, insertions, and / or additions)
And TPO derivatives are also included. Another way of saying
Then, the protein of the present invention has an amino acid sequence
It is substantially the amino acid sequence shown in SEQ ID NO: 16.
Contains eel protein. Say here, "substantially
The "amino acid sequence shown in SEQ ID NO: 16" means "SEQ ID NO:
In addition to the "amino acid sequence shown in 16," "TPO activity
As long as the amino acid sequence shown in SEQ ID NO: 16 is retained.
Substitution, deletion, insertion and / or addition to a part of the acid sequence
And the like. Of the present invention
As the protein, the amino acid shown in SEQ ID NO: 16
Comprises an amino acid sequence from position 7 to 151 of the sequence, and
Also included are proteins having PO activity. More specifically
Is the 1st position in the amino acid sequence shown in SEQ ID NO: 6
231st, 1st-211th, 1st-191st, 1st
~ 171st, 1st ~ 163rd, 1st ~ 157th, 1st ~
156th, 1st to 155th, 1st to 154th, 1st to 1st
53th, 1st to 151st and 7th to 163rd
The TPO protein is a protein of the present invention.
Be done. Furthermore, within the sequence from the 7th position to the 151st position or
Externally, at least 1 as long as the TPO activity is not impaired.
Substitution, deletion, insertion and / or addition of one amino acid
The protein possessed is also included in the protein of the present invention.
It Other examples of the TPO derivative of the present invention include, for example,
Amino acid modification (substitution, deletion, insertion and / or addition)
To improve stability and sustainability in the body.
For one or more potential sites for sugar chain addition.
Deletion or addition, alteration, one or more systems
Either delete the in residue or add cysteine to another amino acid.
Substitute with no acid residue (eg, alanine or serine residue)
The ones that have been done are listed. Protein thermodynamics in general
Introduction of proline residue as a method to improve the biological stability
Theoretically shown that removal of glycine and glycine residues is effective
Have been. (Matthews et al., Proc. Nat
l. Acad. Sci. U. S. A. 84,6663−
6667.1987). Therefore, with the aim of improving stability
Introducing a proline residue when designing a modified TPO derivative
TPO derivative and TPO with glycine residue removed
Derivatives can be considered. Proline to human TPO
For example, when selecting a residue introduction site,
TPO derived from another species having the same sex (mouse TPO:
Si Lok et al., Proc. Natl. cad. Sc
i. U. S. A. 369, 565-568, (19
94), dog TPO: T. D. Bartley et al., Ce
77, 111-124, (1994)).
Amino acid sequences can be utilized. For example, human type
And a rat-type amino acid sequence (SEQ ID NO: 15) were compared,
Not proline in human form but proline in rat form
The site it has, or glycine in the human form, but rat
Choose a site that has an amino acid other than glycine in the type
Can be. For example, as such a site, SEQ ID NO: 16
Of the amino acid sequence of human TPO shown in
Isine residue, glycine residue at position 82, glycine at position 146
Amino acid residues, serine residues at position 148, etc.
Derivatives in which the glycine residue of the amino acid has been replaced with another amino acid residue
And derivatives in which serine residues are replaced with proline residues
Conceivable. In addition, proteins generally have hydrophobic amino acids.
A three-dimensional structure is formed with acid inside and hydrophilic amino acid outside.
Therefore, the amino acids present on the protein surface should be
By substituting a highly hydrophilic charged amino acid
It can be expected that the solubility of the protein will be improved. Hi
Even in the case of topo TPO, the derivative is designed from this viewpoint.
can do. For example, lysine residue at position 14, 52
Lysine residue at position 59, Lysine residue at position 59, Glue at position 115
Tamine residue, 119th threonine residue, 138th residue
Those in which gin residues have been replaced with arginine residues, etc.
Is mentioned. Furthermore, in TPO and amino acid sequence
Erythropoietin with similarities pointed out
In EPO, the helicopter located fourth in the primary structure
X (D helix) was predicted and positive charge was introduced
Around the same time, improvement in biological activity has been recognized (Japanese Patent Laid-Open No. 3-7).
2885), the amino acid sequence of TPO
Predict D-helix from row and design TPO derivative
be able to. Prediction of D-helix of protein in general
For example, the secondary structure prediction program I by Kanehisa et al.
DEAS (Kanehisa, IDEAS user's manu
al) etc. can be used. Next, the D helix is located
Estimate the amino acids located outside in the predicted region
And select amino acid residues that are candidates for introducing a positive charge.
It Selection of such a candidate can be performed, for example, by selecting a wheel in the target area.
Models (Shiffer and Edmundson, Bi
ophys. J. 7, 121-135.1967)
It is possible by In the case of human TPO, D
The position of the lix is the region from 126th to 142nd
As an amino acid residue selected in this region,
For example, leucine residue at position 129, histidine at position 133
And a methionine residue at position 143. Obedience
These amino acid residues are arginine residues or
Is a derivative that substitutes a lysine residue to introduce a positive charge
Can be considered. More specific examples of the TPO derivative of the present invention
If indicated, at least the serine residue at position 1 of human TPO
Is the alanine residue, and the alanine residue at position 3 is the valine residue.
Protein substituted in the base, arginine residue at position 25
Proteins substituted with asparagine residues, the 33rd position
Protein in which stidine residue is replaced with threonine residue
Quality, the arginine residue at the 25th position becomes an asparagine residue,
Glutamic acid residue at position 231 is replaced with a lysine residue
Proteins, and Th at the C-terminus of these proteins
rSerIleGlyTyrProTyrAspVal
ProAspTyrAlaGlyValHisHisH
to which isHisHisHisHis polypeptide has been added.
The quality of the material can be mentioned. Furthermore, at least
A protein lacking the histidine residue at position 33, 116
Protein lacking the glycine residue at position 117
Protein lacking arginine residue, histidine at position 33
Threonine residue between the amino acid residue and the proline residue at position 34
Inserted protein, histidine residue at position 33 and 34
Alanine residue inserted between the proline residues at position
Protein, histidine residue at position 33 and proline residue at position 34
Protein with a glycine residue inserted between groups, position 33
Between the histidine residue and the proline residue at position 34
Amino acid residue was inserted, and the proline residue at position 38 was serine.
Protein substituted with residue, glycine residue at position 116
And an asparagine residue between the arginine residue at position 117
Inserted protein, glycine residue at position 116 and 11
An alanine residue was inserted between the 7th arginine residue
Protein, glycine residue at position 116 and al at position 117
Protein with glycine residue inserted between ginine residues
Can be mentioned. Also, at least the 129th place
Protein with leucine residue replaced by arginine residue
Quality, 133 histidine residue is replaced with arginine residue
Protein, the methionine residue at position 143 is algi
Protein substituted with nin residue, glycine residue at position 82
A protein in which the group is substituted with a leucine residue,
A protein in which a glycine residue is replaced with a leucine residue,
Tanine in which the serine residue at position 148 was replaced with a proline residue
Protein, lysine residue at position 59 was replaced with arginine residue
Protein, glutamine at position 115 left arginine
The protein substituted in the group is mentioned. Also, the present invention
Is shown as SEQ ID NO: 16.
Human TPO having an amino acid sequence, and the aforementioned derivatives
Of the methionine residue at the -2 position and a lysine residue at the -1 position of
Added protein, methionine residue added at position -1
Included proteins are also included. Preferably, the tag of the present invention
The protein is cDNA, genomic DNA, or chemically synthesized.
The recombinant vector containing the DNA obtained by
Obtained by separating and purifying from the transformed host cells
It is characterized by As a host, bacteria (eg, large intestine)
Bacteria) to express in cells, TPO activity
The initiation methionine residue is attached to the N-terminal side of the protein
It is possible to obtain the added protein.
Quality is also included in the present invention. Also, depending on the host used,
The protein having TPO activity produced is glycosyl
Can be glycosylated or glycosylated
In some cases, the protein of the present invention
included. In addition, the protein of the present invention is
Source (eg, conditioned medium containing TPO activity, or
TPO purified and isolated from human urine, serum, plasma)
Also included are naturally occurring active proteins. Also,
According to Ming, TPO is purified from such natural sources.
Method. As such a purification method,
Process used for protein purification (ion exchange chromatography
Chromatography, lectin affinity chromatography
-, Dye adsorption chromatography, hydrophobic mutual chromatography
Raffy, gel filtration chromatography, reverse phase chromatography
Chromatography, heparin affinity chromatography
ー, Sulfated gel chromatography, hydroxy lure
Patite chromatography, metal chelating chroma
Matography, isoelectric focusing chromatography, preparative electricity
One or more of electrophoretic method and isoelectric focusing method)
There is a method of combining. Also, from the examples described below
Combining by utilizing the physicochemical properties of ATP
The possible methods are also included in the present invention. Furthermore, TP
There is also an antibody column that uses an antibody that can recognize O.
Can be used. In addition, TPO is an Mpl ligand
(De Sauvage
Et al., Nature 369, 533-538 (199
4), Bartley et al., Cell 77, 1117-.
1124 (1994), Kaushansky et al., N.
volume 369, pages 565-568 (199
4)), coupling Mpl to the activated gel
Prepare an affinity gel column with and use it
By doing so, TPO can be purified. Twist
Physically, the extracellular region of Mpl (Mpl-X) is CHO
Production and preparation by gene recombination method using cells as hosts
An example of the manufactured and prepared Mpl-X column is described above.
Bartley et al. (1994)). The present invention further provides T
Protein code of human cDNA or genomic DNA of PO
Of the type encoded by the portion of DNA complementary to the strand
Protein, namely Tramontano et al. (Nucl.
Acids Res. , 12, 5049-5059 (1
984)) as described in "Complementary Reverse Proteins"
Including. The present invention includes solid tissue and blood or urine
Of TPO or its receptor-bearing cells in various liquid samples
And detectable to provide reagents useful for quantitation
Label with a marker substance (eg¹²⁵Radiolabel with I
Or biotinylated) protein of the invention
Quality is also included. Biotinylated protein of the invention
Remove megakaryoblastic cells from bone marrow during autologous bone marrow transplantation.
When binding to immobilized streptavidin to remove
Useful for. Furthermore, autologous or allogeneic bone marrow transplantation
In order to enrich autologous or allogeneic megakaryocyte cells
Useful for binding to immobilized streptavidin on
It Between toxins such as ricin and diphtheria toxin and TPO
Toxin conjugates, and radioisotopes, for anti-cancer therapy
Or as a conditioning regimen for bone marrow transplantation
It is useful. The present invention also provides a detectable marker (eg,
Radiolabel or non-isotopic marker such as biotin
Knowledge) or human TP in the chromosome map
O gene position and / or any related gene family
Hybridization method for locating
Also provided are nucleic acid materials useful for use in. They are D
To confirm the human TPO gene disorder at the NA level
Useful to identify flanking genes and their disorders
It is also used as a genetic marker for further,
In the present invention, useful and suitable diluents, preservatives, solubilizers,
Treatment with emulsifiers, adjuvants and / or carriers
Also a pharmaceutical composition containing an effective amount of the protein of the present invention
included. As used herein, "therapeutically effective amount"
The term refers to a therapeutic effect for a given condition and administration method.
Indicates the amount to be supplied. Such compositions are liquid or
Or in a lyophilized or otherwise dried dosage form
A buffer with various pH and ionic strength
(Eg Tris-hydrochloric acid, acetate, phosphate)
Diluent, albumin to prevent adsorption on the surface
Or an additive such as gelatin, a surfactant (eg T
ween 20, Tween 80, Pluronic
 F68, bile salts, solubilizers (eg glycero)
, Polyethylene glycol), antioxidants (eg
Scorbic acid, sodium metabisulfite), preservatives (eg
For example, thimerosal, benzyl alcohol, paraben),
Excipients or tonicity agents (eg lactose, mannito)
Preparations containing the same) are included. Also, for proteins
A covalent bond with a polymer such as polyethylene glycol,
Complexation with metal ions, polylactic acid, polyglycol
Granular formulations of polymeric compounds such as phosphoric acid, hydrogels, etc.
Inside or on its surface, or in liposomes, micro
Emulsions, micelles, unilamellar or multilamellar vesicles, red blood cells
Of the substance in a blast or spheroplast
Including inclusion. Such a composition has the physical properties of TPO
State, solubility, stability, in vivo release rate, in
 It seems to affect in vivo clearance
So, the choice of composition depends on the physics of the protein with TPO activity.
Depending on physical and chemical properties. In addition, polymers such as
Loxamer or poloxamine) and tissue-specific receptor
Bound to, or with antibodies to the body, ligands or antigens
Or with TPO that binds to the tissue-specific receptor ligand.
Granular compositions to be coated are also included in the present invention. The invention set
Alternative dosage forms of the product include parenteral, pulmonary, nasal, and
Due to various routes of administration, including oral, granular form, protective
Incorporate membranes, protease inhibitors, or absorption enhancers
It The pharmaceutical composition containing the protein of the present invention is active
Usually 0.05μg / kg body weight to 1mg / kg as an ingredient
Depending on the medical condition, sex, route of administration, etc.
It can be administered to a degree. Contains the protein of the present invention
The pharmaceutical composition of
Relative activity in essay Usually 25,000-500,
, 000,000 / kg body weight, medical condition, sex and route of administration
Depending on the situation, etc., once to several times a day, about 1 to 7 days a week
It can be administered. Furthermore, the present invention provides the tamper of the present invention.
EPO, G-CSF, GM-CSF, M-
CSF, IL-1, IL-2, IL-3, IL-4, I
L-5, IL-6, IL-7, IL-8, IL-9, I
L-10, 1L-11, IL-12, IL-13, LI
One or more of factors such as F and SCF as additional hematopoietic factors
And the composition contained therein. Protein of the present invention
Alone or in combination with other additional hematopoietic factors
Is also useful in the treatment of many thrombocytopenia. Other additions
Hematopoietic factors include EPO, G-CSF, GM-CS
F, M-CSF, IL-1, IL-2, IL-3, IL
-4, IL-5, IL-6, IL-7, IL-8, IL
-9, IL-10, IL-11, IL-12, IL-1
3, LIF, SCF can be mentioned. According to the invention
Then, the protein of the present invention as an active ingredient
Chemotherapy or radiation therapy by administration of immunosuppressant, or
Is a therapeutic agent for thrombocytopenia in bone marrow transplantation (BMT)
Provided. In addition, platelet disorders such as platelet production disorders
Harm and shortened platelet life (increased platelet destruction or blood
The present invention is characterized by thrombocytopenia due to increased platelet consumption).
There are numerous diseases that can be treated with the proteins of example
For congenital Fanconi anemia, chemotherapy and radiation
Aplastic anemia with associated, myelodysplastic syndrome, acute myelogenous white
Blood loss due to blood disease or myelodysplasia such as bone marrow transplant
Platelet dystrophy, etc.
It can be used to facilitate rehabilitation. Also, TPO
It is also useful for thrombocytopenia due to abnormal production. Platelets
Examples of thrombocytopenia due to shortened life of megakaryocytes,
Idiopathic thrombocytopenic purpura, acquired immunodeficiency syndrome (A
IDS), disseminated intravascular coagulation syndrome, thrombotic thrombocytopenia
It is also possible to promote platelet recovery in such patients.
It is for. In addition, TPO should be administered before surgery
Increase platelets and use the platelets for blood transfusion during your surgery
For use as platelets (autologous platelet transfusion)
Is also useful. Further uses of the protein of the present invention
Is, for example, another chemical or drug, or a therapeutic
Due to temporary platelet loss or damage due to placement
It is the treatment of the disorder caused by the damage. TPO is such a patient
Used to promote the release of new "intact" platelets in
be able to. The present invention further binds specifically to TPO
And an antigen for obtaining the same. Departure
A clear protein or a protein having an antigenic determinant
Can be used as an antigen. Such antibodies are
Both monoclonal and polyclonal antibodies, and
And a chimeric antibody produced by known methods, ie, “recombinant
E) Including antibodies, etc. Various antigenic determinants (epitope)
Conventional antibodies (poly-
Clonal)
Each is an antibody against a single antigenic determinant on the antigen. TP
Specific antibodies to O are diagnostics using the antigen-antibody reaction.
And improved selectivity and specificity of analytical assays
Therefore, it is useful for separating and purifying TPO. further,
They are used to neutralize or remove TPO from serum
Can be. The advantages of monoclonal antibodies are that they
Hybrid in a medium free of immunoglobulin
It can be synthesized by human cells. Monochrome
Null antibody from the culture supernatant of hybridoma cells
Decided to inoculate mice intraperitoneally with hybridoma cells
It is thus prepared from the ascites induced. With Kohler
Hybridoma technology first described by Milstein
(Eur. J. Immunol. 6, 511-519.
(1971)) showed high levels of
Produce a hybrid cell line carrying a monoclonal antibody
It can be widely used to make. Hereinafter, the present invention will be described in more detail.
explain. (A) Purification of rat TPO-partial purification of rat TPO
Analysis of Minoic Acid Sequence-Biological Characteristics of Rat Purified TPO
Analysis The inventors of the present invention firstly promote the growth and differentiation of rat CFU-MK.
Tried to purify a protein (rat TPO) with progressive activity
saw. This purification involves the selection of various natural sources,
Is the choice of chromatographic carrier and separation means.
However, many trials and errors were repeated regarding the assembly of purification.
As a result, the inventors of the present invention used X-ray or γ-ray irradiation.
From plasma of thrombocytopenic rats induced by
Based on the rat CFU-MK assay described in
Protein having TPO activity using TPO activity as an index
The quality was purified and its partial amino acid sequence was determined. <Example
1-2>. Moreover, the biological properties of the plasma-derived rat TPO
<Example 3> tested for properties. From the purification,
Until determination of partial amino acid sequence of purified rat TPO
The outline of is as follows. (1) Thrombocytopenia caused by X-ray or γ-ray irradiation
Plasma of about 1100 animals was collected, and Sephadek was collected.
G-25 chromatography, anion exchange chromatography
Ruffy (Q-Sepharose FF)
Chin chromatography (WGA-Agarose)
Proceed to the step, WGA-Agarose adsorption TPO
The active fraction was obtained. (2) Next, this WGA-Agarose adsorption TPO
Active fraction dye adsorption affinity chromatography
(TSK AF-BLUE 650MH), hydrophobic interaction
Chromatography (Phenyl Sepharo)
se. 6 FF / LS), gel filtration chromatography
Processing up to (Sephacryl S-200 HR)
Was carried out. This Sephacryl S-200 H
In R, the TPO activity has four peaks (larger molecular weight).
It was divided into F1, F2, F3, F4)
Then, concentrate the TPO active fractions F2 and F3,
As molecular TPO preparation F2 and low molecular weight TPO preparation F3,
Each proceeded to the next purification step individually. (3) Preparative reverse phase chromatograph of low molecular weight TPO preparation F3
Fee (YMC-Pack PROTE IN-R
P), reverse phase chromatography (YMC-PackCN
-AP), and reverse phase chromatography (Capcel
Separation with 1 Pack C1). Obtained TPO activity
The fractions were subjected to SDS gel electrophoresis and
When TPO activity was extracted, it was apparently non-reducing.
TPO activity in the band with a molecular weight of about 17,000 to 19000
Was confirmed to exist. (4) Then, all the TPO active fractions were subjected to S under non-reducing conditions.
It was subjected to DS gel electrophoresis and transferred to a PVDF membrane. Next
For systematic limited enzymatic degradation of proteins on PVDF membrane
Peptide fragmentation by
We were able to determine the partial amino acid sequence of
Based on the amino acid sequence information of the fragment, the gene clone of rat TPO
The training was carried out. ). (5) On the other hand, Sephacryl S-200 HR
The high molecular weight TPO preparation F2 from
Purification is carried out in the same manner as the standard F3, and the reverse phase
With Matography (Capcell Pack C1)
The obtained TPO active fraction was subjected to SDS gel electrophoresis,
Extraction of TPO activity was performed. When you check the activity, F3
Similar to the original TPO, it has an apparent molecular weight of about 1 under non-reducing conditions.
TPO activity is present in the 7000-22000 band
I was able to confirm that. (B) Specification of rat TPO-producing cells-preparation of mRNA
-Construction of rat cDNA library Since purified rat TPO is derived from plasma,
Organs that are the source of mRNA for cloning
Alternatively, it was necessary to select cells. There rat blood
Based on the biochemical and biological properties of serum-derived TP0
The activity of TPO in the culture supernatant of various organs or cells.
Sex was screened. As a result, rat liver cells
The original cell line, McA-RH8994 cells, HTC cells.
Cells, in the culture supernatant of H4-II-E cells, and in rat
Rat plasma-derived TPO was also added to the culture supernatant of primary liver cells.
An almost equivalent TPO activity was found <Example 4>. one
On the other hand, a cDNA expression vector in monkey cells (COS1 cells)
-PEF18S, two types of expression vector pME18S
And a combination of pEFBOS and <Example 5
>. The construction of this vector allows for the integration of inserts.
Expression efficiency with multiple cloning sites that can be used
It is possible to clone cDNA using
And became easier. To build a cDNA library
In addition to the expression vectors described above, plasmids of pUC system and pBR system
Mainly used vector vectors, lambda phage vectors, etc.
It We have cultured McA-RH8994 cells.
Then add guanidine thiocyanate solution and homogenize.
Then, total RNA was obtained by CsCl density gradient centrifugation <
Example 6>. RNA is prepared by the hot phenol method or acidic guar.
It can also be performed by the nidinphenol chloroform method.
come. From this total RNA, oligo dT-immobilized latex particles
Poly (A) by child⁺After purifying RNA, the restriction enzyme N
The oligo dT added with the otI cleavage sequence was used as a primer.
, Single-stranded cDNA was synthesized by reverse transcriptase, and RNas
e H and E. E. coli DNA polymerase I is used
Then, double-stranded cDNA was obtained. The obtained double-stranded cDNA
An EcoRI linker was added to A, which was constructed in Example 5.
The constructed cDNA expression vector pEF18S was named NotI.
Connect it with the one cut with EcoRI, and
Live E. coli DH5 strain transformed with cDNA
A rally was constructed <Example 7>. (C) Acquisition of rat TPO cDNA fragment by PCR method
(Cloning) Partial amino acid sequence of rat TPO purified from rat plasma
DNA considered to encode the sequence based on the sequence
Predict the sequence and use the polymerase chain reaction (P
The degenerate primer used for CR) was synthesized. use
The primer may have a position other than the primer used in the present invention.
It may be based on the amino acid sequence. Also, Ino
It is also possible to use highly degenerate primers without using syn.
come. Furthermore, codons that are frequently used in rats are used.
Can also be used to design primers with reduced degeneracy.
Come (Wada et al. Nucleic Acids Re
s. , 18, 2367-2411, 1990). Destination
Plasmid D from the whole cDNA library prepared in
NA is extracted and PCR is performed using this DNA as a template.
A band of about 330 bp was detected, and the base sequence was
Once determined, it encodes part of the rat TPO gene
Was found to be a DNA fragment (A1 fragment) that
Example 8>. (D) Screening of rat TPO cDNA by PCR method
Sequencing of rat TPO cDNA
About 10,000 clones of the cDNA library constructed in advance
Divided into two pools, of which 100 pools
Smid DNA was extracted. Using these DNA as templates,
A newly synthesized primer based on the base sequence of one fragment
PCR was performed using 3 pools in 100 pools.
A band that was considered to be specific to the enzyme was detected. There
Then, choose one of these pools and
Divide into subpools of about 900 clones each
The same PCR was performed for 100 pools.
A band was detected in 3 subpools. Out of these
Select 1 pool and add 40 clones to each sub-pool.
Finally, each clone is finally analyzed by the same PCR.
As a result of the screening,
Fragment carrying the plasmid pEF18S-A2α
Successful isolation of loans <Examples 9 to 10>. This cd
When the nucleotide sequence of the NA fragment was determined, it was found in rat plasma.
Purified and partially determined amino acid sequence
And it is considered to be the rat TPO gene.
The obtained <Example 10>. Ku obtained as described above
Purify the plasmid DNA from the loan and use it for COS1 cells.
Upon transfection, T was added to the culture supernatant.
The PO activity could be detected. As a result,
pEF18S-A2α encodes rat TPO
It was confirmed that it carried cDNA <Example 11
>. (E) Detection of TPO mRNA in various rat tissues PCR was performed on tissues expressing TPO mRNA in the rat body.
In the brain, liver, small intestine, and kidney
Specific expression was detected <Example 12>. (F) Construction of human cDNA library From the results of Examples 4 and 12, human TPO cDNA library was constructed.
The liver was selected as the starting tissue for the rolling. So
Here, from commercially available normal human liver-derived mRNA, cDNA
A library was constructed. The vector of rat rye
PEF18S was used in the same manner as in the case of Braley,
CDNA was synthesized by the same procedure and the restriction enzymes NotI and Eco
As a library with directionality using RI site
Was. A library clone prepared by introducing into E. coli strain DH5
The number of loans was about 1.2 million <Example 13>. (G) Acquisition of human TPO cDNA fragment by PCR method
(Cloning) The rat TPO carried on pEF18S-A2α was coated.
For several types of PCR based on the nucleotide sequence of the cDNA
Primers were synthesized. Commercially available mR derived from normal human liver
Synthesized cDNA from NA and used these primers
When PCR was carried out, a band around 620 bp was found.
Was observed. When the nucleotide sequence was determined, rat TPO
It was revealed to be a DNA fragment having about 86% homology with
And part of the gene encoding human TPO
<Example 14>. (H) Screening of human TPO cDNA by PCR method
Sequence of human TPO cDNA-Confirmation of expression Amplification of the previously prepared human cDNA library
Divided into pools of 0,000 clones each, or 90 pools
The plasmid was extracted from Using these DNA as templates,
Based on the nucleotide sequence of the human-TPO fragment obtained in Example 14.
PCR was performed using the newly synthesized primers
However, bands were observed in the three pools. These
1 pool and select 5000 clones
90 pools among them
The plasmid DNA was purified from the plasmid. With these as molds
When the same PCR was performed with 5 sub-pools
A band was detected. Therefore, 1 pool is selected from these
And 250 clones as one pool
Divided into 90 and pooled 90
When NA was purified and detected by PCR again,
Bands were observed in the 3 pools. So out of this
Select one pool and set 30 clones as one pool.
Divide into pools and play 90 pools of them
As a result of purifying the Smid DNA and performing PCR,
Band was observed. From one of these pools
Pick 90 colonies, prepare plasmid DNA,
Finally, the clone HL34 was obtained by carrying out PCR.
<Example 15>. The plasmid DN of this clone
When the base sequence of A was determined, the base sequence of rat TPO was determined.
It carries a cDNA with about 84% homology to the sequence.
<Example 16>. This clone
Of the plasmid DNA of Escherichia coli and purified into COS1 cells
Upon Tfection, TPO activity was detected in the culture supernatant.
The cloned plasmid DNA of this clone was human T
It must carry a gene cDNA fragment encoding PO.
Was confirmed <Example 17>. However, this c
The DNA fragment has no stop codon and is poly-A tail-like
I have a row at the 3'end, this is the person
It was considered an artifact. Therefore, poly-A tail-like array
Construct an expression vector that encodes the amino acids up to the last amino acid
And expressed in COS1 cells, the culture supernatant
TPO activity was detected therein <Example 18>. Full length c
Human TP using PCR to analyze the structure of DNA
A DNA fragment on the O3 'end side was obtained. Nucleotide sequence of this fragment
Was determined, the clone HL34 obtained in Example 15 was determined.
It was found that it overlaps with the cDNA of
The reading frame also extends to a total of 353 amino
It was expected to encode a protein consisting of acid. sand
Human TPO protein contains 21 signal sequences.
It was suggested that it consists of 353 amino acids.
Example 19>. The cDNA cloning of human TPO is as described above.
Other than cloning methods such as pUC and pBR
Plasmid vector, lambda phage vector, etc.
Rat TPOc using the library constructed by
Colony hybridise using DNA fragment as probe
Or plaque hybridization
Can also be done. Designed for degenerate probes
Use inosine to reduce the degree of degeneracy
You can also. Detect TPO activity specifically and sensitively
If an available assay is available, use it with the present invention.
Expression cloning using a unique expression library
Can also be done. However, in Example 15
As shown, in normal human liver, human TPO was
The content of RNA to be loaded is considered to be extremely low (see
The content calculated from the examples is 1 in 3 million
, The synthesized oligonucleotide probe or
And cDNA fragments of human TPO as a probe
By the screening method by hybridization
Results in a huge number of clones and plaques to process.
In addition, the sensitivity and specificity of hybridization are
It is expected to be extremely difficult as it does not reach the CR law.
In fact, the inventors of the present invention also prepared a normal mouse prepared in Example 13.
About 2 million clones of liver cDNA library
Colonies using a rat TPO cDNA fragment as a probe.
-Hybridization was performed, but human TPOc
It was not possible to obtain a DNA clone. (I) Reconstruction of human TPO cDNA library Clone HL34 obtained in Example 15 has incomplete cDNA
Since it was considered to be a clone containing NA, full-length
Commercially available normal human liver for the purpose of obtaining human TPO cDNA
Origin poly (A)⁺Human TPO cDNA using RNA
The library (hTPO-F1) was reconstructed. colon
Of the clone of the library prepared by introducing it into the strain DH5
The number was about 1 million. <Example 20> (J) Human TP by colony hybridization
Rescreening of OcDNA-of human TPO cDNA
Sequence-confirmation of expression Salt of human TPO cDNA of partial length obtained in Example 14
Base sequence (SEQ ID NO: 3) and predicted in Example 19
Nucleotide sequence of the full-length human TPO cDNA (SEQ ID NO:
Based on No. 6), PCR primers were synthesized. Implementation
CDNA library constructed in Example 20 (hTPO-F
1) is divided into 3 pools (# 1-3),
Plasmid DNA was prepared from the pool and these DNAs were prepared.
PCR using primers synthesized using
did. Predicted using DNA from pool # 3
As the size of DNA was amplified, pool # 3 was
Divide into 15,000 sub-pools,
When PCR was performed with Immer, 6 pools out of 90 pools
The expected size of DNA was amplified. These
1 pool and select 1000 clones
And prepare plasmid DNA
PCR was performed, but no DNA amplification was observed
Was. This is because the desired clones grow more than other clones.
Poor recovery of plasmid DNA due to slowness
Was thought to be the cause. So, I returned to the pool of # 3, L
Make 4100 colonies per B plate
Clone, 100 plates, and each
These replica plates were produced. Plate colony
PCR was performed on the DNA extracted from
However, band amplification was observed in 1 out of 100 pools
Was done. 2 replica files from this pool plate
To produce a radiolabeled probe (plasmid pEF
18S-HL34 EcoRI / BamHI fragment)
Colony hybridization was performed. That conclusion
As a result, one positive signal was observed, so the original plate
More colonies are picked up and re-plated on the LB plate.
Plasmid DNA from 50 colonies
By carrying out R, the clone pHTF1 is finally obtained.
Got <Example 21> Thus, in the screening of DNA clones
Is hybridization, PCR, expression clonin
It is mainly used for the
Increase cleaning efficiency, sensitivity, or
The force can be reduced. Clones obtained here
When the base sequence of pHTF1 was determined,
There is a reading frame and this open reading
Ami, a protein thought to be frame-encoded
The no acid sequence is the amino acid sequence of the human TPO deduced in Example 19.
The amino acid sequence (SEQ ID NO: 6) was completely matched. The base sequence is
Although it differs from SEQ ID NO: 6 at three positions, the amino acid changes
No substitution occurred. This results in human TPO protein
Is 353 amino acids including a 21-residue signal sequence
It was confirmed that <Example 22> The clone pHTF1 obtained as described above was used as a plasmid.
Prepare Smid DNA and transfect COS1 cells
Detected, TPO activity was detected in the culture supernatant
We were able to. <Example 23> (K) Human TP by plaque hybridization
Screening of O chromosomal DNA-human TPO chromosome D
Sequence of NA-Confirmation of expression Human beings from Professor Tokio Yamamoto, Gene Research Facility, Tohoku University
One NZYM plate from the genomic library
Sprinkle the phages so that the number becomes 30,000, and
And a replica filter for each
Was. Human TPO cDNA contained in clone pHTF1
Fragment (base sequence number 178-1025 of sequence number 7)
Amplified by PCR and purified³²P-labeled probe
Used to perform plaque hybridization
Was. As a result, 13 positive signals were detected
Therefore, pick up plaques from the original plate, NZY
 Make sure that there are 1000 plaques per plate.
Remake and use replica filters made from each
Then repeat plaque hybridization
Was. As a result, positive CIGNA was obtained with all 13 sets of filters.
Were detected, plaques were isolated and phage DN was isolated.
A was prepared and human TPO was prepared for each of the 13 clones.
P whether it contains the coding region of cDNA
Checked by CR. 5 clones out of 13
Contains all the coding regions expected from the cDNA.
1 clone (λHGT1) because it was considered
Select the Southern blot analysis (the
Move the same as before). With the restriction enzyme HindIII
A single band of approximately 10 kbp was observed upon digestion
Therefore, the DNA of clone λHGT1 is restricted to the restriction enzyme Hind
After digestion with III, electrophoresis on an agarose gel
The band was cut out and purified, and the cloning vector pU was used.
Subcloned into C13 and finally cloned pHG
I got T1. <Example 24> When the nucleotide sequence of this clone was determined, it was found to be carried.
The chromosomal DNA present is the human TPO tag shown in SEQ ID NO: 6.
All coding areas, and
Regarding the nucleotide sequence, the nucleotide sequences were completely the same. Also to Exxon
The corresponding region is divided by 4 introns.
Carried on clone pHTF1 obtained in Example 21
The full-length human TPO cDNA
Turned out to be different. 5 clones finally selected
Of the remaining 4 clones, the nucleotide sequence was determined.
As a result, the two sites were identical with the clone pHGT1 and the remaining
2 clones coincided with pHGT1 at one location
And it was in agreement with the other two clones pHTF1. <Implementation
Example 25> Plasmid clone pHGT obtained as described above
The EcoRI fragment of 1 was ligated into the expression vector pEF18S.
, Human TPO expression plasmid pEFHGTE was prepared.
Then, when COS1 cells were transfected,
TPO activity could be detected in the culture supernatant.
<Example 26> (L) Preparation of human TPO deletion derivative-in COS1 cell
Expression-Activity Confirmation From the results of Examples 18 and 22, the human TPO protein was confirmed.
Does not require full-length amino acids to express its activity
Was expected. Therefore, for the active expression of human TPO protein
For the purpose of analyzing the required region, the claw obtained in Example 18 was used.
Using the plasmid DNA of pHT1-231 as a template
By performing PCR with the prepared primers, human TP
An expression plasmid in which the C-terminal side of O protein has been deleted,
That is, amino acids 1-211, 1-291, 1-17
Deletion derivative coding for positions 1 and 1-163
Rasmid DNA was obtained. Each obtained plasmid
DNA transfected into COS1 cells
The TPO activity was not detected in any of the culture supernatants.
It was <Example 27> In order to examine the region responsible for TPO activity in more detail,
Induction by sequentially deleting the 151st amino acid from the C-terminal side
Neither the conductor nor the 6th, 7th and 12th amino acids on the N-terminal side are missing.
Lost derivatives were prepared and expressed in COS1 cells for activity
Was detected, the 7th amino acid was missing on the N-terminal side.
If deleted, up to the 151st amino acid on the C-terminal side
The activity became undetectable when deleted. <Example
28, 29> Based on the cDNA thus obtained, a derivative (deletion,
Replacement, insertion, addition, etc.)
It is possible to obtain modified proteins responsible for protein activity.
It The method used in this case is PCR, Sit
e directed mutagenesis method
There are scientific and synthetic methods. (M) Expression of human TPO cDNA in CHO cells-purification A cDNA animal encoding the amino acid sequence of SEQ ID NO: 6
An expression plasmid for cells, pHTP1, was constructed. <Example
30> This TPO cDNA region of pHTP1 is used to
Cell expression vector pDEF202-hTPO-P1
Built <Example 31> CHO cells were transfected with this vector and selected.
As a result of selection, the gene encoding human TPO in the chromosome
Transformed cells in which the current vector was integrated were obtained. This
When the cell clones were cultured, the TPO activity was found in the culture supernatant.
Sex was detected. <Example 32> In Example 32, human TPO expression plasmid pDE
Transfecting F202-hTPO-P1 into CHO cells
Human TPO-producing CHO cell line (C
HO28-30 cells, 25nM MTX resistant)
Cultivated <Example 55>. Human from the culture supernatant 100L
The TPO was purified. <Example 56> In addition, from the culture supernatant obtained in Example 55 by another method, T
The PO was purified. <Example 57> (N) Human TPO cDNA X63.6.5.3. cell
Expression-Activity Confirmation in T. of PBLTEN, the plasmid prepared in Example 30
Generating for X63.6.5.3 cells using POcDNA region
Construction of current vector, BMCGSneo-hTPO-P1
did. <Example 33> X63.6.5.3 cells were transfected with this vector.
When it was isolated, it encodes human TPO in the chromosome
Transformed cells containing the expression vector
Was. When this cell was cultured, TPO activity was found in the culture supernatant.
Sex was detected. <Example 34> (O) Large-scale expression of human TPO in COS1 cells-purification-
Molecular Weight Measurement, Biological Properties Expression vector prepared in Example 30, pHTP1
On culture transfected and expressed in OS1 cells
A large amount (about 40 l in total) of Qing was prepared. <Example 35> Expression vector, pHTP, prepared by the method of Example 35
Approximately 7 liters of COS1 cell serum-free culture supernatant containing 1-derived TPO
Then, TPO was purified. Hydrophobic interaction chromatography
Raffy, cation exchange column, WGA column, reverse phase column
Through each step of lamb, highly active TPO can be obtained
Was. <Example 36> Thus partially purified T from COS1 cell culture supernatant
For PO, molecular weight measurement and analysis of biological properties
Was done. <Examples 37 and 38> (P) Expression of human TPO in Escherichia coli Glutathione-S-transferase and human TPO
(Amino acid 1-174) fusion protein ("GST
-TPO (1-174) ") E. coli expression vector,
pGEX-2T / hT (1-174) was constructed. this
A part of the base sequence of human TPO cDNA (5 'side and
The other half of the region) was converted to E. coli preferred codons. <Implementation
Example 39> GST-TPO (1-174) was expressed in Escherichia coli,
After crushing the body, GST-TPO (1-
174) was solubilized. Next, rewind the TPO
(Refolding) conditions, purification conditions
(Glutathione affinity column, cation exchange column
(Rum et al.), Cutting of GST protein region by thrombin digestion
As a result of combining stages such as disconnection,
The protein containing the amino acid sequence could be partially purified. This protein
Quality has TPO activity in rat CFU-MK assay system.
I was able to confirm that. <Examples 40 and 41> Further, S at the 1st position of human TPO (amino acids 1-163).
er residue to Ala residue and Ala residue at position 3 to Va
Converted to l residue, Lys residue at -1 position, and Lys residue at -2 position
Mutant human TPO protein with addition of Met residue
(Referred to as "h6T (1-163)") for expressing E. coli
Constructed pCFM536 / h6T (1-163)
did. The human TPO cDNA carried by this vector
The base sequence of the amino acid (1-163) encoded by
All were converted to preferred codons in E. coli. <Example 42> h6T (1-163) is expressed in Escherichia coli, and the cells are disrupted.
Then, solubilization of h6T (1-163) contained in the precipitate fraction
And the refolding conditions were examined.
As a result, a protein containing the amino acid sequence of TPO as designed
Was partially purified. This protein is rat CFU-M
It can be confirmed that it has TPO activity in the K assay system.
Was. <Examples 43 and 44> Furthermore, human TPO cDNA (amino acids 1-163)
Modification with Lys residue at position -1 and Met residue at position -2
Atypical human TPO protein ("hMKT (1-63)"
E. coli expression vector pCFM536 / hM)
KT (1-163) was constructed. hMKT (1-16
3) was expressed in E. coli in the same manner as in Example 43.
Transfer the expressed protein to PVDF membrane after SDS-PAGE
As a result of N-terminal amino acid sequence analysis,
It was confirmed that it contained an amino acid sequence. <Example 52> In addition, at position -1 of human TPO (amino acids 1-332)
Lys residue, mutant human with Met residue added at -2 position
TPO protein (referred to as "hMKT (1-332)"
E. coli expression vector pCFM536 / hMKT
(1-332) was constructed. hMKT (1-332)
Expression was performed in E. coli in the same manner as in Example 42, and Example 4 described later was performed.
Wes using the anti-human TPO peptide antibody prepared in
Expression was confirmed by tan blotting. <Example 6
6> (Q) Preparation of anti-TPO peptide antibody-anti-TPO peptide
Preparation of antibody column Amino acid of rat TPO found in Example 10
Peptides corresponding to three partial regions in the sequence are combined.
And produce rabbit polyclonal anti-TPO peptide antibody
Made. These antibodies recognize rat and human TPO
I was sure that. Also, SEQ ID NO: 6 (or SEQ ID NO:
6) among the amino acid sequences of human TPO shown in No. 7).
The peptide corresponding to the partial region of
A clonal anti-TPO peptide antibody was prepared. these
It was confirmed that the antibody of 1. recognizes human TPO. <Implementation
Example 45> Molecules having a binding affinity for TPO, ie, anti-
TPO antibody, TPO receptor, etc. are bound to the column carrier.
And T by affinity column chromatography
A method for purifying PO can be considered. Therefore, first, Example 4
The anti-TPO peptide antibody obtained in 5 was bound to a gel carrier.
Anti-TPO antibody column was prepared. <Example 46> Anti-TPO of human TPO expressed in (R) COS1 cells
Purification using peptide antibody column-Molecular weight measurement, Biology
Transfection of expression vector pHTP1 into COS1 cells
Partially purified TPO was obtained using the collected culture supernatant as a material.
And applied it to an anti-TPO antibody column. T in the adsorption fraction
Since it was confirmed that it has PO activity,
The molecule was purified by reverse-phase column chromatography.
The quantity and biological activity were investigated. <Example 47> Partial purification of human TPO expressed in (S) COS1 cells
Confirmation of activity of authentic sample The TPO active fraction purified in Example 36,
Transfection of the current vector pHTP1 into COS1 cells
From the culture supernatant obtained by
T purified to the stage of the Pak C1 300A column
As a result of investigating the biological activity of PO, blood pressure was reduced in vivo.
It was found to have a plate increasing effect. <Example 48> Furthermore, the expression vector pHTP1 was transfected into COS1 cells.
33 L of the culture supernatant obtained by the transfection was used as the starting material.
Crude TPO fraction obtained by cation exchange column
As a result of examining the biological activity of
It was found to have an increasing effect. <Example 49> (T) Expression of human TPO chromosomal DNA in CHO cells-
Confirmation of activity Human TPO chromosome expression vector in CHO cells, pDE
F202-ghTPO was constructed. <Example 50> When this vector was introduced into CHO cells,
And an expression vector carrying human TPO chromosomal DNA
Integral transformed cells were obtained. Cultivate this cell
As a result, TPO activity was detected in the culture supernatant. <Actual
Example 51> (U) Partial purification of mutant human TPO expressed in Escherichia coli
~ Activity confirmation A clone encoding the human TPO nucleotide sequence expressed in E. coli.
Lone pCFM536 / h6T (1-163) -derived mutation
Type TPO Guanidine Hydrochloride and Glutathione
The refolding operation using
6T (1-163) increases platelets in vivo
Was confirmed to have. <Example 53> A clone encoding a human TPO nucleotide sequence expressed in E. coli.
Lone pCFM536 / h6T (1-163) -derived mutation
-Type human TPO, N-lauroyl sarcosin nato
Performs refolding operation using lithium and copper sulfate
In addition, use cation exchange chromatography to
H6T (1-163) produced is platelet in vivo
It was confirmed to have an increasing action. <Example 54> Further, by using another method, mutant human TPO, h6T
The refolding to purification of (1-163) was performed.
<Examples 60 and 61> (V) Expression of human TPO cDNA in insect cells-Activity confirmation
Recombinant virus for expression of human TPO in insect cells
<Example 58>, expressing in insect cell Sf21 and culturing
The activity in the supernatant was confirmed. <Example 59> (W) CHO cell of human TPO (amino acid 1-163)
Expression in cell-purification Of the amino acid sequence of human TPO shown in SEQ ID NO: 6,
Human TPO tamper having amino acid sequence at positions 1-163
For expression of CHO cells in the cytoplasm (referred to as "hTPO163")
The vector pDEF202-hTPO163 was constructed.
Expression vector pDEF202-hTPO163 was CHO
HTPO16 obtained by transfecting cells
3 CHO cell line was cultivated in a large amount, and h
TPO163 was purified. <Examples 62 to 65> (X) Preparation of human TPO derivative The Arg residue at the 25th position of human TPO was converted to an Asn residue, and 23
The Glu residue at position 1 was replaced with a Lys residue,
A derivative having an additional peptide at the C-terminus ("N3 / T
PO)), and the His residue at position 33 remains Thr.
Group having an additional peptide at the C-terminus.
Plasma coding conductor (referred to as "O9 / TPO")
In COS7 cell culture supernatant transfected with
TPO activity was detected. <Example 67> A derivative in which an amino acid is inserted into hTPO163 or hT
A derivative obtained by deleting a part of the amino acid of PO163 is used.
COS7 transfected with plasmid
TPO activity was detected in the cell culture supernatant. <Example 6
8> h6T (1-163) was used as a template and T.
A PO derivative was prepared and its TPO activity was confirmed. <Actual
Example 77> (Y) Pharmacological action of TPO The intravenous administration of the human TPO obtained in Example 56, and
Subcutaneous administration confirmed the platelet-increasing effect in normal mice
I accepted. <Examples 69 and 70> Further, the human TPO obtained in Example 56 was treated with an anti-cancer agent.
Inhibitory effect of thrombocytopenia by administration and thrombocytopenia
Platelet count recovery promotion effect, and further BMT (bone marrow transplant) performed
It has the effect of accelerating the recovery of platelet count after and after irradiation.
Confirmed to do. <Examples 71 to 74> In addition, in the normal mouse of human TPO obtained in Example 65,
Thrombocytosis and blood loss due to the administration of anti-cancer drugs
The effect of promoting platelet number recovery from plate reduction was confirmed. <Implementation
Examples 75, 76> (Z) Preparation of human TPO preparation An example of preparation of a preparation containing human TPO as an active ingredient was shown. <
Formulation Examples 1 to 9> In addition, the method for measuring TPO activity used in the present invention (i
n vitro assay system) as a <reference example>
explain. <Reference Example> A. Rat megakaryocyte progenitor cell (CFU-MK) assay
(Rat CFU-MK Assay) System (Liquid Culture System) Megakaryocytes use extracellular serotonin (s) in an energy-dependent manner.
Erotonin) is taken up and accumulated in the deep dyeing granules
(Fedorko, Lab. Invest., Vol. 36,
310-321, (1977)). This phenomenon is less
Differentiation stages between at least CFU-MK and recognizable megakaryocytes
Small, mononuclear acetylcholine-positive cells located in the
Already recognized (Bricker and Zuckerma
n, Exp. Hematol. , Volume 12, 672-67
P. 5, (1984)), and then on the increase of megakaryocyte size
Correspondingly, the amount of serotonin uptake increases (S
check and Weinstein, J. Lab. Cli
n. Med. , 98, 607-615, (198
1)). Moreover, among the bone marrow cells, only megakaryocytes
Specific (Schick and Weinstein,
J. Lab. Clin. Med. , Volume 98, 607-6
Page 15, (1981)). Book Asse
The i strain is highly concentrated in rat CFU-MK (GpI
Ib / IIIa⁺CFU-MK fraction; described later) test sample
Culture in the presence of¹⁴C-cello
Tonin (¹⁴C-5-hydroxy tryptam
ine creatine sulphate;
¹⁴C-5HT)) uptake as an index
It The advantage of this assay system is that the CF contained in the cells used is
The ratio of U-MK is extremely high (see "Assay Method" below).
), On the contrary, other than the target cells of TPO contaminated
Since there are few cells, indirect effects due to contaminating cells (eg
For example, if some substance other than this factor acts on contaminated cells, M
Inducing eg-CSF activity, or contaminating cells with this factor
To produce some co-acting factor)
Can be reduced and cultured in one well
Good for a relatively long period due to low total cell count
It is to be able to maintain the culture environment. further,
Generated from CFU-MK with an active preparation during the culture period
A number of large mature megakaryocytes under a phase contrast microscope
Can be observed in a
It is also an advantage that it can be set. The result of this qualitative judgment is¹⁴
Corresponds well with the quantification result by the incorporation of C-serotonin.
ing. Therefore, by using qualitative judgment together, quantitative
The reliability of the result can be increased. "Assay Method" First, the highly concentrated assay used
Rat CFU-MK ("GpIIb / IIIa⁺C
FU-MK fraction ") has already been reported (Miya)
zaki et al., Exp. Hematol. , Volume 20, 85
5-861 (1992))
So prepared. The outline is as follows. Wis
femur of tar rat (♂, 8-12 weeks old), and
Extract the tibia and prepare a bone marrow cell suspension according to the standard method.
It Levine and Fed for preparation of bone marrow cell suspension
The medium for separation of megakaryocytes (Levine and
Fedorko, Blood, Volume 50, 713-725
Page, (1977)) with slightly modified medium (13.6 mM
Trisodium citrate, 11.1 mM glucose, 1 m
M adenosine, 1 mM theophylline, 10 mM HEP
ES (pH 7.25), 0.5% bovine serum albumin
(Hereinafter, abbreviated as BSA) (Path-O-Cyte
4; Seikagaku), and Ca²⁺And Mg²⁺Not include
Solution consisting of Hanks balanced salt solution: HAT
CH solution) is used. Bone marrow cell suspension, Per
HATCH the coll stock solution (Pharmacia)
Percoll discontinuous density gradient prepared by diluting with solution
Solution (density: 1.050 g / ml / 1.063 g / ml
/1.082 g / ml) and then 40 at 20 ° C.
Centrifuge for 20 minutes at 0xg. After centrifugation, density 1.063g
The cells collected at the interface of 1.08 g / ml and 1.082 g / ml.
To collect. After washing the cells, 10% fetal calf serum (hereinafter FC
Abbreviated Dulbecco culture containing S)
Float with a nutrient solution (hereinafter abbreviated as IMDM culture solution), diameter 1
Put in a 00 mm tissue culture plastic dish
Incubate for 1 hour at 37 ° C in a 5% CO 2 incubator.
It After culturing, the non-adherent cell fraction was collected and the diameter of 10
Put it in a 0 mm plastic dish for another 37
After culturing at 0 ° C for 1 hour, the non-adherent cell fraction is collected. Times
Resuspend the collected cells in HATCH solution and
Monoclonal anti-rat platelet GpIIb / IIIa anti-
The body's P55 antibody (Miyazaki et al., Throm
b. Res. , 59, 941-953, (199
0)) adsorbed 100 mm petri for bacteria test
Dish (Falcon 1005; Becton-D
ickinson) and let stand for 1 hour at room temperature
It Then, wash the non-adsorbed cells thoroughly with HATCH solution.
After separating and removing, the cells adsorbed to the immobilized P55 antibody were picked up.
Remove by petting and collect. Usually 1 rat
From 3 to 4 x 10⁵Individual cells are obtained. Obtained cells
Rat CFU-MK is highly concentrated in the fraction
(Hereinafter, "GpIIb / IIIa⁺CFU-MK fraction "
The saturation concentration in the colony assay system described later
Usually 5-10% by assay in the presence of rat IL-3
It has been found to include some CFU-MK. What
The hybridoma producing the above P55 antibody (p55
(Cells) is the industrial technology of the Ministry of International Trade and Industry on February 14, 1994.
Contract number FERM BP at the Institute of Biotechnology, Institute of Biotechnology
Deposited as -4563. Next, the obtained Gp
IIb / IIIa⁺CFU-MK fraction with 10% FCS
96 wells for tissue culture, resuspended in IMDM culture medium containing
10 per well to flat bottom plate^FourIndividual cells enter
And then fully permeate IMDM medium.
Add the analyzed standard product (detailed later) and the test sample,
The final culture volume is 200 μl / well. Charcoal plate
Place in an acid gas incubator and incubate at 37 ° C. for 4 days. 4th day
0.1 μCi per well 3 hours before the end of culture
(3.7 KBq)¹⁴Add C-serotonin and pull
Then, the cells are cultured at 37 ° C. After culturing, plate 100
Centrifuge at 0 rpm for 3 minutes and aspirate the supernatant. Continued
Then, 1 well of PBS containing 0.05% EDTA was applied.
Add 200 μl of each well and centrifuge, remove the supernatant by suction and remove the cells.
Wash. This washing operation is repeated once again. Got
Add 1% of 2% Triton X-100 to the cell pellet.
Add 200 μl per plate and plate to plate mixer
Shake for about 5 to 10 minutes to lyse the cells sufficiently. Got
150 μl of the prepared cell lysate was placed in a commercially available cup
Solid Scintillator (Ready Cap; Beckm)
an) and left overnight in a dryer at 50 ° C.
And dry to dryness. The next day, Ready Cap was
In the liquid and at the liquid scintillation counter
¹⁴The radioactivity of C is measured. In addition, the above-mentioned cell lysate
Acetylcholinesterase activity in Ishiba
hi and Burstein's method (Ishibashi and
Burstein, Blood, Volume 67, 1512-1
514, (1986))¹⁴C
-Very similar to the quantitation results from serotonin uptake
The result is obtained."Standard goods" First, the thrombocytopenia assay used to prepare the standard product.
The plasma was prepared by the following method. 7-8 weeks old Wis
1 to the normal tar rat (♂)
Dosage is 0.5 mg and 2 at intervals of about 24 hours.
Platelets once and intravenously, about 24 hours after the second administration
During the period of decrease, laparotomy was performed under ether anesthesia and used as an anticoagulant in advance.
1 ml 3.8% (v / v) trisodium citrate solution
Abdominal aorta using a 10 ml syringe
Blood was taken from. Blood centrifuge tube made of plastic
And centrifuge at 1200 xg for 10 minutes to collect the plasma fraction.
Recovered. This plasma fraction was again stored at 1200 xg for 10 minutes.
Centrifugation for a period of time, and after centrifugation, a pellet consisting of cells and platelets
Be careful not to suck up the plasma
Collected and pooled (hereinafter, blood obtained in this way)
Serum is called "TRP"). Then, from TRP to Example 1
Ca-treated TRP prepared according to the method described in
Product C), WGA-Agarose column active fraction (standard
Item W) or Phenyl Sepharose
6 FF / LS column active fraction (standard product P)
Thoroughly dialyzing against IMDM culture solution for activity assay
The standard product. The rat TPO shown in Example 1
In the purification process, the standard product C was used in the initial stage, but
Was used as the standard product W, and thereafter, the standard product P was used. Arbitrary
The activity of the standard product C is defined as 1 and the standard product W is
And the relative activity of Standard P was determined. Relative activity of test sample
To determine the sex, draw a dose-response curve between the standard and the test sample.
The activity of the test sample was n times that of standard C
The relative activity of the sample was designated as n. B. Colony assay system Bone marrow cells are cultured in semi-solid culture medium in the presence of the test sample.
And CFU-MK grows and differentiates to form megakaryocytes
By calculating the number of Ronnie, Meg-CSF activity
The assay method to measure. "Assay Method" (a) When using rat non-separated bone marrow cells, etc. Rat non-separated bone marrow cells, the above A. GpIIb / III
a⁺Obtained at each stage of CFU-MK separation / concentration operation
Cells, or GpIIb / IIIa⁺CFU-MK drawing
Min, 10% FCS, 2 mM glutamine, 1 mM pyruvin
Sodium acid salt, 50 μM 2-mercaptoethanol,
0.3% agar (AGAR NOBLE, DIFCO
IMDM culture solution with a final volume of 1 ml containing
mm in tissue culture plastic dish at room temperature
After solidifying at 37 ° C, incubate at 37 ° C in a carbon dioxide incubator.
It Usually the number of seeded cells per dish
Non-separated bone marrow cells, Percoll centrifugation step and
And the plastic dish adherent cell removal step
Cells and GpIIb / IIIa⁺CFU-MK fraction
And 2 to 4 x 10 respectively⁵, 2-5 × 10^Four, 0.
5 to 2 x 10^ThreeTo be individual. Did agar gel on day 6-7
Remove from slide and slide glass (76mm × 52
mm), nylon mesh with a pore size of 50 μm, and then
Absorb the water by placing a filter paper on it and remove them, then room temperature
To dry thoroughly. 5 minutes on a hot plate at 50 ° C
After heat fixing for a while, the method of Jackson (Jackso
n, Blood, 42, 413-421, (197).
3)) Acetylcholinesterase dyeing prepared according to
Soaking in colored liquid for 2 to 4 hours, megakaryocytes are sufficiently stained
After confirming, take it out, wash it with water, dry it, and
Post-stain with hematoxylin solution for 30 seconds and water
Wash and air dry. Acetylcholinesterase positive giant
Meganucleus consisting of agglomerates consisting of three or more nuclear cells as one colony
Count the number of ball colonies. (B) When non-separated bone marrow cells of mouse are used. The number of seeded cells per dish is 2 to 4 × 1.
0⁵As an individual, the same method as in (a) above can be used.
it can. (C) When using human bone marrow cells or human cord blood cells Human bone marrow cells or human cord blood cells may be used as they are.
Can, but concentrated from them as follows:
The K fraction can be used. First, the bone marrow fluid or cord blood is Lymphphoprep
Layered on top (made by Daiichi Kagaku Co., Ltd.) and collected at the interface after centrifugation.
Collect the white blood cell fraction. Biotinylated from this cell fraction
Human cell surface antigens (CD2, CD11c, and
Biotinylated monoclonal antibody against CD19)
The cells that bind to the
Remove using. Cells that can be removed by this magnetic bead method
Mainly B cells, T cells, macrophages, and some
Are granulocytes. The remaining cells were treated with FITC-labeled anti-
CD34 antibody, and PE-labeled anti-HLA-DR antibody
Stain on the body, followed by a cell sorter (eg ELIT
E; manufactured by COULTER), CD34 positive,
The HLA-DR positive cell fraction is collected. In this fraction
CFU-MK is enriched (CD34⁺DR⁺CF
(Abbreviated as U-MK fraction). Human colony assay
Almost the same as the colony assay using rat bone marrow cells described above.
Do the same, but use one plastic dish
CD34 per game⁺DR⁺Spreading of CFU-MK fraction
3-5 × 10^ThreeInstead of 10% FCS
A mixture of 12.5% human AB plasma and 12.5% FCS
To use. In addition, culture until formation of megakaryocyte colonies
The period is 12 to 14 days. Detection of human megakaryocytes
Include human GpIIb / III, a surface antigen of megakaryocytes.
Alkali using mouse monoclonal antibody against a
Phosphatase-anti-alkaline phosphatase antibody method
Immunostain the megakaryocytes with (for example, Teramura et al.,
Exp. Hematol. Volume 16, pp. 843-848,
(1988)) colonies consisting of three or more megakaryocytes
Count as megakaryocyte colonies. C. Assay system using human megakaryoblastic cell line (M-0
7e assay) M-07e cells, which are a human megakaryoblastic cell line, are GM-
Increased in response to CSF, IL-3, SCF, IL-2, etc.
It is known to be a cell line that propagates (Avanz
i, J. et al. Cell. Physiol. Volume 145, 4
58-464, (1990), Kiss et al., Leuk.
Emia, Volume 7,), found to respond to TPO
And an alternative assay method for the rat CFU-MK assay system
Can be used. "Assay Method" Subcultured in the presence of GM-CSF
M-07e cells were collected, washed thoroughly, and then washed with 10% FCS.
Resuspend in IMDM culture medium containing. 96 for tissue culture
The number of cells per well is 10 per well.^Four
M-07e cells so that the number of cells becomes
And the test sample are added to bring the final volume to 200 μl / well.
To Place the plate in a 5% CO 2 incubator and
Incubate at C for 3 days. 4 hours before the end of culture on day 3 1
μCi (37KBq) / well^ThreeH-thymidi
After adding ne and culturing, cells are harvested with a cell harvester.
Collect on a glass fiber filter,^ThreeLiquid radioactivity of H
Scintillation counter (eg beta play
G; manufactured by Pharmacia). In addition, M
The definition of the relative activity amount in the −07e assay is as described above.
A. Same definition as in rat CFU-MK assay
Is. D. Assay system using mouse pro B cell line (Ba / F
3 assay) Mouse pro B cell line Ba / F3 cells are
Known to be a cell line that proliferates in response to -4 and the like
(Palacios et al., Cell, Volume 41, 72
7-734). The sub-strain, BF-TE22 cells,
Cells that respond to TPO as well as IL-3 and IL-4
It was found to grow, and rat CFU-MK assay and human
Assay using megakaryoblastic cell line (M-07e
Can be used as an alternative assay method. This
The outline of the assay system is as follows. First, 1 ng
Subcultured in the presence of 1 / ml mouse IL-3
-TE22 cells were collected and Iscove's modified DME medium (I
10% after washing 3 times with MDM; GIBCO
Resuspend in IMDM medium with FCS. Then the organization
Number of cells per well in 96-well flat bottom plate for culture
Is 1x10^FourCells are inoculated so that individual
Add O standard or test sample to bring the final volume to 200
Set the plate to be ml / well and add 5% carbon dioxide to the plate.
Incubate for 2-3 days in an incubator. 2 or 3 day culture
4m before the end of 1mCi (37KBq) / well^ThreeH
-Add thymidine and continue culturing
It After culturing, use a cell harvester to remove the cells.
Collected on a fiber filter and taken up by cells^ThreeH
Radioactivity of liquid is measured by liquid scintillation counter
I do. Test sample containing no TPO activity in this assay system
Then the cells are almost dead^ThreeH-thymidine
Tests that include TPO activity, while they are rarely incorporated
In the body, cells show active proliferation in a TPO concentration-dependent manner.^Three
Incorporation of H-thymidine is observed. Well
In addition, this assay is based on the M-07e assay and CFU-MK.
Results parallel to the assay are shown.

The present invention will be described in detail below with reference to examples. <Example 1-1> Purification of rat TPO from plasma of thrombocytopenic rat by administration of antiplatelet antibody "Preparation of plasma of rat by thrombocytopenia by administration of antiplatelet antibody"<Referenceexample> A. Rat megakaryocyte progenitor cells (C
FU-MK) assay system for about 100 rats
0 TRP was prepared and used as a source of purification. “Purification of rat TPO from TRP” At the beginning, based on the estimation that the TPO content in TRP would be at most 1/3 million, purification of TRP from approximately 1000 rats resulted in 1 pmole. A partially purified preparation of weak rat TPO was obtained. Next, analysis of the partial amino acid sequence of this sample was tried, and the results of three types of partial amino acid sequences were obtained. Do these match the amino acid sequence of the serine protease inhibitor (SPI) produced in the liver,
It was similar. Therefore, neither the possibility that TPO has a structure similar to that of a serine protease inhibitor or the possibility that it is a sequence derived from a contaminating protein other than TPO cannot be denied. TPO gene cloning from a rat cDNA library was carried out based on these uncertain sequences, but it was not possible to obtain a candidate gene after all. This was thought to be due to the lack of purity and quantity of the analyzed sample, and it was decided to repeat intensive research. In order to obtain the final purified preparation required for amino acid sequence analysis, the purification described in Example 1-2 below was performed. It should be noted that, from the results of this Example 1-2, the amount of TPO present in TRP or XRP (described later) is surprisingly 1/100 to 1/1 billion of the total plasma protein. It has been found that the content is so small that it is usually extremely difficult to purify it. <Example 1-2> Purification of rat TPO from plasma of thrombocytopenic rats by X-ray or γ-ray irradiation “Preparation of plasma of rat with thrombocytopenic rats by X-ray or γ-ray irradiation” Sublethal dose (6 ~ 7 Gy) X-ray or γ-ray 7-8 weeks old Wistar normal rats (♂)
Whole-body irradiation was performed, and blood was collected on the 14th day of the thrombocytopenic period, and a plasma fraction was prepared by the same operation as that of the TRP described above (hereinafter, this plasma is referred to as "XRP"). Here, XRP (about 8 L) of about 1100 rats in total was used as a purification source. "Purification of rat TPO from XRP" Rat about 1100
Since the total protein amount of the blood plasma of the animals reached 493,000 mg, it was impossible to process them all at once. Therefore, in the purification steps (1) to (4) described below, about 100 animals were divided into 11 lots and carried out. Then, in (5) to (7), the batch was divided into 6 batches.
After (8), the crude purification from about 1100 animals was performed collectively. Of these, one lot (XW
9), a purification example in the batch (XB6) is given as a representative for description, and each purification step is also described. In all the steps of purification, the TPO activity was measured using the rat CFU-MK assay system described in <Reference Example> above. Purification was carried out at 4 ° C., unless stated otherwise, except that reverse phase chromatography was carried out at room temperature. In addition, protein quantification was performed using the Coomassie dye binding method (P
IERCE reagent, Catalog No. 23236X) or bicinchoninic acid method (PIERCE reagent, Catalog No. 23225). The outline of the purification is shown in Table 1.

[Table 1] (1) Calcium chloride treatment / centrifugal treatment / protease inhibitor treatment of rat plasma XRP (742 ml, protein concentration 54.8 mg / m) of about 100 animals stored at −80 ° C.
1, total protein mass 40686 mg) was thawed and transferred to a polypropylene centrifuge tube (Nalgen). Calcium chloride powder was added to each so that the final concentration was 100 mM, and the mixture was allowed to stand overnight at 4 ° C. Then, after centrifuging at 8000 RPM for 60 minutes, the supernatant was collected. This supernatant containing TPO activity (742 ml, protein concentration 54.9 mg / ml, total protein mass 40740 mg) was added to p-APMSF (p-aminodiphenylmethanesulfonyl fluoride hydrochloride, Wako Pure Chemical Industries, Ltd., Catalog No. 010-10393) was added and the process proceeded to the buffer exchange step using the Sephadex G-25 column described below. In this way, about 100
For each animal, combine into one lot and
Treated with p-APMSF, a total of 11 lots of about 1100 XRP (total volume 8184 ml, total protein mass 4930).
07mg) treatment is repeated to separate Sephade
x G-25 column. (2) Sephadex G-25 <buffer exchange> The supernatant obtained after treatment with calcium chloride (742) (742)
ml, protein concentration 54.9 mg / ml, total protein mass 407
40 mg) was pre-equilibrated with 20 mM Tris-HCl, pH 8 (Sephadex G-25M column (Pharmacia Biotech, Catalog No. 1).
7-0033-03; diameter 11.3 cm, bed height 47
cm) at a flow rate of 40 to 70 ml / min, and 1300 ml until the protein was eluted was discarded. Next, from the time when ultraviolet absorption started to rise, the electric conductivity was 50
Collect until reaching 0 μS / cm, and add 20 mM Tris
-Protein fraction containing TPO activity replaced with HCl pH 8 solution (1377 ml, protein concentration 27.56 mg / m
l) was recovered. The total protein content of the TPO active fraction was 37.
882 mg, the protein yield at this step was 93%. The relative activity of TPO was 2.3. In this way, Sephad for each lot
As a result of carrying out the ex G-25 column, the total volume is 21117 ml, and the total protein mass is 480306 m.
g, average relative activity 1.8, relative activity amount 864600
Sephadex G-25 TPO active fractions were obtained. (3) Q-Sepharose FF <strong anion exchange chromatography> Sephadex G-25M TP obtained in (2)
O active fraction (1375 ml, protein concentration 27.5 mg / m
l, total protein mass 37841 mg, relative activity 2.3) at a flow rate of 40 ml / min and Q-Sepharose FF.
(Pharmacia Biotech, Catalog No. 17-0
510-01; diameter 5 cm, bed height 27 cm), and passed through 20 mM Tris-HCl, pH 8 Fraction F1 (3949 ml, protein concentration 0.98 mg / m2)
1, total protein mass 3870 mg, relative activity 0) were eluted. Next, 20 mM Tr containing 175 mM NaCl
Instead of is-HCl, pH8 buffer, TPO active fraction F2 (4375 ml, protein concentration 5.36 mg / ml) was eluted. Finally, 20 containing 1000 mM NaCl
mM Tris-HCl pH8 buffer, F3 (12
21 ml, protein concentration 3.9 mg / ml, total protein mass 47
83 mg, relative activity 3.8) was eluted. The total protein mass of the TPO active fraction F2 was 23440 mg, and the protein yield of F2 in this step was 61.9%. Also, T
The relative activity of PO increased to 6.8. As a result of subjecting all lots of the TPO active fraction of Sephadex G-25 to Q-Sepharose FF in this manner, the total volume was 35842 ml and the total protein mass was 314.
384 mg, average relative activity 8.6, relative activity amount 27
04000 of Q-Sepharose FF TPO active fraction F2 was obtained. (4) Wheat germ agglutinin (WGA) -Agaros
e <lectin affinity chromatography> TP of Q-Sepharose FF obtained in (3)
The O-active fraction F2 was divided into three times, and WGA-Agaros
e (Hornen Co., Catalog No. 800273; diameter
5 cm, bed height 22.5 cm) and flow rate 5 ml / mi
n is added, and Dulbecco's phosphate isotonic buffer (DPB
Fraction F1 that passes through S) (9336 ml, protein concentration 2.3)
0 mg / ml, total protein mass 21407 mg, relative activity 6.9) were obtained. Next, 0.2M N-acetyl-D-
Glucosamine (GlcNAc, manufactured by Nakarai Co., Ltd., Catalog No. 005-20), 150 mM NaCl, 0.02
20 mM Na Phosp with% sodium azide
The pool eluted with a hate, pH 7.2 buffer solution was concentrated with an ultrafiltration unit (Filtron, Omega Ultraset molecular weight 8000 cut), and WGA-
Agarose adsorption TPO active fraction F2 (2993m
l, protein concentration 0.376 mg / ml) was obtained. This TP
The total protein mass of the O-active fraction F2 was 1125 mg, and the protein yield of F2 in this step was 4.8%. The relative activity of TPO increased to 101. The F2 obtained here was stored at -80 ° C. In this way, Q
-As a result of repeatedly applying WGA-Agarose to all lots of the TPO active fraction F2 of Sepharose FF, the total volume was 33094 ml, and the total protein mass was 15.
030 mg, average relative activity 132, relative activity 198
7000 WGA-Agarose TPO active fraction F
2 was obtained. (5) TSK-gel AF-BLUE 650 MH
<Dye Adsorption Affinity Chromatography> The WGA-Agarose adsorbed TPO active fraction of lot XW8 and the WGA-Agarose adsorbed T of lot XW9 obtained from (4) and starting from XRP for a total of 215 animals.
The PO active fraction F2 was collected as batch XB6 (59
74 ml, protein concentration 0.388 mg / ml, total protein mass 2319 mg, relative activity 150). This volume is 5974m
0.81 moles of NaCl (296.7
6 g) was added to give a final concentration of 0.822 M NaCl, 61
After making 32 ml of solution, 1M NaCl, 20 mM
TSK-gel AF-BLUE 650 M previously equilibrated with Na Phosphate, pH 7.2
A flow rate of 7 ml / m was applied to an H column (manufactured by Tosoh Corporation, catalog number 08705; diameter 5 cm, bed height 23 cm).
added in. After the addition was completed, at a flow rate of 10 ml / min, 20 mM Na Phosphate, 1M Na was added.
Cl, eluted at pH 7.2 (approx. 8470 m
l) was collected and concentrated with an ultrafiltration unit (Filtron, Omega Ultraset molecular weight 8000 cut), and passed through fraction F1 (543 ml, protein concentration 2.05).
mg / ml, total protein mass 1112 mg, relative activity 31)
I got Next, the eluate was changed to 2M NaSCN, and the eluted TSK-gel AF-BLUE 650MH was eluted.
Adsorbed TPO active fraction F2 (1427 ml, protein concentration 0.
447 mg / ml) was obtained. The total protein amount of this TPO active fraction F2 was 638 mg, and the protein yield of F2 in this step was 27.5%. Also, the relative activity of TPO increased to 1500. In this way, WGA-A
All the batches of the Garose adsorbing TPO active fraction F2 were subjected to TSK AF-BLUE 650MH, respectively. As a result, the total volume was 10655 ml and the total protein mass was 4236 m.
g, average relative activity 905, relative activity amount 3834000
TSK-gelAF-BLUE 650MH TPO
Active fraction F2 was obtained. (6) Phenyl Sepharose 6 FF /
LS <hydrophobic interaction chromatography> (5) TSK-gel AF-BLUE 6
1.5m against the volume of 1424ml of 50 MH TPO active fraction F2 (1424ml, protein concentration 0.447mg / ml, total protein mass 638mg, relative activity 1500)
oles of Ammonium Sulfate (28
2.2 g) powder was added to give a final concentration of 1.35 M Amm.
onium Sulfate, 1581 ml of solution. This is 1.5M Ammonium Sulfat
e, 50 mM Na Phosphate, pH 7.2
Sepharo that had been previously equilibrated with
se 6 FF (Low Sub) column (Pharmacia Biotech, Catalog No. 17-0965-0
5; diameter 5 cm, bed height 10 cm), flow velocity 7 m
l / min, and add 0.8M of eluate after the addition.
Ammonium Sulfate, 36 mM Na
Instead of Phosphate, up to a fraction (about 3160 ml) eluted at a flow rate of 10 ml / min was collected and concentrated with an ultrafiltration unit (Filtron, Omega Ultraset molecular weight 8000 cut) to obtain F1 (48
5 ml, protein concentration 0.194 mg / ml, total protein mass 9
4.2 mg, relative activity 0) was obtained. Then, eluate 20
Change to mM Na Phosphate, pH 7.2,
The eluted TPO active fraction F2 (about 3500 ml) was obtained. This was concentrated in an ultrafiltration unit (Omega Ultraset molecular weight 8000 cut, manufactured by Filtron) and once sampled. TPO active fraction F2 at this stage
The protein concentration of (220 ml) was 1.45 mg / ml, the total protein mass was 319 mg, and the protein yield of F2 in this step was 50.0%. The relative activity of TPO is
It was 1230. In this way, TSK-gel
Repeated Phenyl Sepha for all batches of AF-BLUE 650 MH TPO active fraction F2.
As a result of applying to roseFF / LS, total volume 1966m
1, total protein mass 2762 mg, average relative activity 84
7. Phenyl Se with relative activity of 2339000
A TPO active fraction F2 of pharose FF / LS was obtained. (7) Sephacryl S-200 HR <gel filtration chromatography> (6) Phenyl Sepharose obtained in
6 FF / LS TPO active fraction F2 (217 ml, protein concentration 1.45 mg / ml, total protein mass 315 mg,
Relative activity 1230), 144.8 ml of 5M NaC
1 solution to make 362 ml 2M NaCl,
Further, it was concentrated to about 50 ml with an ultrafiltration unit (Amicon; YM3 membrane, diameter 76 mm). Equal volume (50 ml) of 8M urea was added to this, and the final concentration was 1M NaC.
l to about 100 ml of 4M urea solution. About 80 more
Concentrate to ml and finally make 88.78 ml sample, Sephacryl S-200 HR column (Pharmacia Biotech, Catalog No. 17-05).
84-01; diameter 7.5 cm, bed height 100 c
m) was injected. Then at a flow rate of 3 ml / min, D
Develop with PBS, void volume (1200 ml) and later 45
The polypropylene was collected in 60 polypropylene tubes.
This elution pattern is shown in FIG. Assay every 2 strains, the rest are all Sephacry for 1100
-85 ° C until the S-200HR process is completed
It was frozen and stored at. Based on the results of the assay, XB6 collected the following fractions (FIG. 1). (F1) Tube number 1 to 15 (fraction having a molecular weight of 94000 or more near the void volume) (F2) Tube number 16 to 26 (molecular weight 94000)
~ 33000) (F3) tube number 27-44 (molecular weight 33000)
~ 3000) (F4) tube number 45-55 (molecular weight 3000 or less) In this way, Phenyl Sepharose
All batches of TPO active fraction F2 obtained with 6 FF / LS were subjected to Sephacryl S-200HR, assayed for each fraction, and stored frozen at -85 ° C. After completion of Sephacryl S-200 HR for all batches, following reverse phase chromatography (YMC-Pack PRO
Immediately before performing TEIN-RP), it was thawed and concentrated with an ultrafiltration unit (Amicon; YM3 membrane, diameter 76 mm) to obtain the following two standards. Below, this Seph
The concentrated preparation of the TPO active fraction F2 of acryl S-200 HR was designated as "polymer TPO preparation F2", Sephacr
The concentrated preparation of the TPO active fraction F3 of yl S-200HR is referred to as "low molecular weight TPO preparation F3". For convenience, the high molecular weight TPO preparation F2 and the low molecular weight TPO preparation F3 described here are
It refers to a collection of fractions having different elution positions by gel filtration chromatography, and does not necessarily represent the true molecular weight.

[Table 2] Thereafter, the low molecular weight TPO preparation F3 and the high molecular weight TPO preparation F2 were each subjected to the next purification step. Below (8)
Each step of purifying the low molecular weight TPO preparation F3 is described in (11). (8) YMC-Pack PROTEIN-RP <Reverse Phase Chromatography> (7) The low molecular weight TPO preparation F3 (total protein mass 5)
0.3 mg, protein concentration 0.184 mg / ml, relative activity 20000, relative activity 1007000, total volume 274
ml) developing solvent A (0.025% trifluoroacetic acid (TFA)) and developing solvent B (0.025% TFA).
Containing 1-propanol) to give a final volume of 508.6.
3 ml, the final propanol concentration was about 20%, the TFA concentration was 0.012%, and the protein concentration was 0.0989 mg / ml. Insoluble matter was generated here, so centrifuge it and centrifuge only 254.3 ml (25.2 mg) of the supernatant.
YMC-that had been equilibrated with 30% B in advance
Pack PROTEIN-RP (YMC, catalog number A-PRRP-33-03-15; diameter 3 cm,
Bed height 7.5 cm) was added to the column at a flow rate of 2 ml / min. The precipitate was 5 mM CHAPS (3-[(3-
Colamidopropyl) dimethylammonio] -1-propanesulfonate; manufactured by Dojindo Laboratories, Catalog No. 7
20 mM sodium acetate containing 5621-03-3),
20 ml of pH 5.5 was added to solubilize it and the mixture was sent to the column. After adding the sample, about 50 ml of a solvent (developing solvent A: developing solvent B = 3: 1) was passed through, and first, a flow-through fraction was collected. Next, start the development program (30% B to 45% B linear concentration gradient for 120 minutes), and
A total of 36 fractions of each ml were collected in a polypropylene tube and collected. Since this was repeated and collected in the same tube, a total of 36 fractions were finally collected in 20 ml. The pass-through fraction is directly used for 2 with an ultrafiltration unit (Amicon; YM 3 membrane, diameter 76 mm).
It was concentrated to 0 ml. Pass-through fraction and tube number 1
Take 0.1 ml from each 20 ml fraction of 36,
After adding 20 μl of 5% BSA, the mixture was dried by centrifugal evaporation, finally dissolved in 0.25 ml of IMDM assay culture medium, and assayed to identify the TPO active fraction. As a result, tube Nos. 17 to 27 (with a propanol concentration in the range of 36.0 to 43.0%) had TPO activity.
It was designated as TPO active fraction F2 of ack PROTEIN-RP. It was stored at -85 ° C until just before proceeding to the next YMC-Pack CN-AP. YMC-Pack PRO derived from low molecular weight TPO preparation F3
TIN-RP TPO active fraction F2 Total volume 220 ml Protein concentration 0.0130 mg / ml Total protein mass 2.85 mg Relative activity 130000 Relative activity 371,000 (9) YMC-Pack CN-AP <Reverse phase chromatography> (8) YMC-derived from the low molecular weight TPO preparation F3 obtained in
Pack PROTEIN-RP TPO active fraction F2
214.9 ml (total protein mass 2.79 mg, protein concentration 0.0130 mg / ml, relative activity 130000,
The relative activity amount of 36300) was adjusted to 50% glycerol.
6 ml was added, and the mixture was concentrated to 1.8 ml. Finally volume 5
In ml, the propanol concentration was below 20% and glycerol was about 6%. This was carried out 5 times (each injection protein mass 0.555 mg, volume 1 ml). Each time, 1-propanol containing 0.1% TFA in developing solvent A and 0.05% TFA in developing solvent B was used.
YMC-Pack CN-AP (YM equilibrated with% B
C company, catalog number AP-513; diameter 6 mm, bed height 250 mm), column, flow rate 0.6 ml / min.
Injected at. After completion of the injection, the propanol concentration was increased from 15% B to 25% B, and further developed from 25% B to 50% B in a linear concentration gradient of 65 minutes. In the last round, 1 ml of a protein-free solution of the same composition was injected and developed to collect the TPO activity remaining in the column. Since it was collected in the same polypropylene tube for a total of 6 times, each fraction had 44 tubes of 7.2 ml. 30 of these
Take μl (1/240 fraction) and add 20 μl of 5
% BSA was added, the mixture was evaporated to dryness by centrifugal evaporation, and finally dissolved in 0.24 ml of IMDM assay medium,
An assay was performed to identify the TPO active fraction. As a result, tube numbers 28 to 33 (3 in propanol concentration
It has a strong TPO activity in the range of 7.0 to 42.0%).
It was used as the main TPO active fraction FA of ck CN-AP. YMC-Pack CN- derived from low molecular weight TPO preparation F3
TPO active fraction of AP FA Total volume 43.20 ml Protein concentration 0.00863 mg / ml Total protein mass 0.373 mg Relative activity 800000 Relative activity amount 298400 (10) Capcell Pak Cl 300A <Final reverse phase chromatography> (9) 43.12 ml (total protein mass 0.372 mg, protein concentration 0.00863 mg / of the TPO active fraction FA43.20 ml derived from the low molecular weight TPO preparation F3 obtained in
ml, relative activity 800000, relative activity amount 29760
0.2 ml of 50% glycerol was added to 0.
Concentrate to 1 ml glycerol solution. In this, developing solvent A (0.1% TFA): developing solvent B (0.0
1-propanol containing 5% TFA = 85: 15 (1
2 ml of a solution of 5% B) was added to a final volume of 2.1.
ml, a propanol concentration of about 14%, a glycerol concentration of about 4.8%, and a protein concentration of 0.177 mg / ml. Capcell equilibrated with 15% B
Pak Cl 300A (Shiseido, Catalog No. C
1TYPE: SG300A; diameter 4.6 mm, bed height 250 mm) column injection, 27% B to 38%
Flow rate 0.4 ml / min with a linear concentration gradient of 65 minutes to B
Deployed at 0.6m in 72 polypropylene tubes
I collected each. From each fraction, 3 μl (1/200 fraction) was taken, 20 μl of 5% BSA was added, and finally replaced with 225 μl of IMDM assay medium, and a 75-fold dilution from the original volume was assayed. 1 for each electrophoresis from each fraction
μl (fraction of 1/600) was taken, centrifugally evaporated, 10 μl of SDS gel electrophoresis sample buffer containing no reducing agent was added, and the mixture was treated at 95 ° C. for 5 minutes. This was subjected to SDS gel electrophoresis using 15-25% SDS-polyacrylamide precast gel (manufactured by Daiichi Pure Chemicals Co., Ltd.), and 2D-silver staining reagent / "Daiichi" silver staining kit (manufactured by Daiichi Pure Chemicals, It was stained with catalog number 167997, hereinafter referred to as "silver staining kit"). For the molecular weight marker, “Daiichi” III low molecular weight marker (Daiichi Pure Chemicals Co., Catalog No. 181061, hereinafter “DPCII”
I ") was used. As a result of the above analysis, tube numbers 35 to 43 (30.0 to 32.5 in propanol concentration)
% Range) clearly had TPO activity. Tube number 36 to 42 (30.5 in propanol concentration)
.About.32.0% range) was used as the main TPO active fraction FA. The above results are shown in FIG. When the protein amount was estimated from the chromatogram and evaluated together with the assay results, the total protein amount was 39.6 μg and the protein concentration was 9.4 μg / m 2.
1, relative activity 4890000, relative activity 193600
Became. TPO active fraction S of tube number 36 to 42
When the DS gel electrophoresis image was examined, it was revealed that there was a band in which the intensity of activity correlated with the stained density. Moreover, the molecular weight of this band is apparently, that is, 17,000 to 1 relative to the standard molecular weight protein in the reduced state.
It was found to be a strong band that is a candidate for TPO at the position of 9000. (11) Extraction of TPO activity from electrophoresis gel <15%
SDS polyacrylamide gel electrophoresis> TPO derived from low molecular weight TPO preparation F3 obtained in analysis example (10) of TPO active fraction FA
Active fraction FA 4200 μl (total protein mass 39.6 μ
g, protein concentration 9.4 μg / ml, relative activity 489000
0, relative activity amount 193600), 5.5 μl (76
2.5 μl for active extraction
(1680th fraction) was taken in each sample tube for silver staining, centrifugally evaporated, 10 μl of SDS gel electrophoresis sample buffer containing no reducing agent was added, and the mixture was treated at 37 ° C. for 1 hour, then at room temperature for 18 hours. It was converted to SDS by leaving it to stand. Prestained low range marker (Bio-R
Ad company 161-0305), and a DPCIII marker were used. These samples were prepared by a conventional method (Laemmli,
Nature, Volume 227, 680-685, (197).
0)) according to 15% S using microslab gel
DS polyacrylamide gel electrophoresis was performed at 4 ° C. Immediately after the migration, the portion to be stained with silver was cut with a knife, put in a fixative, and stained with silver using a silver staining kit.
On the other hand, the portion from which the activity is to be cut out is sliced into 34 gels with a width of 1.5 to 2.5 mm using a knife over the entire molecular weight, and Kobayashi's method (Mikihiko Kobayashi, Biochemistry, No. 5) is used.
The gel was crushed by a modified method of Volume 9, No. 9 (1987). 0.3 for each gel crushed into fine pieces
ml extraction buffer (20 mM Tris-HCl,
pH8, 500 mM NaCl, 0.05% BSA) was added, and the mixture was shaken at 4 ° C. for 6 hours for extraction. Then a final concentration of 20 mM 500 mM potassium phosphate, pH 6.8.
, And shake for 1 hour at 4 ° C to remove precipitated SDS. Ultrafree C3GV 0.22μm filter unit (Millipore Co., model UFC3 OGV
15) at 1000xg (4000 RPM)
After centrifuging for a minute, the filtrate was collected. This is Ultra Free C
The mixture was transferred to a 3-LGC molecular weight 10,000 cut ultrafiltration unit (manufactured by Millipore, model number UFC3 LGC 00) and centrifuged at 3000 xg (7000 RPM). When the concentrated solution reached about 50 μl, 300 μl of 20 mM Na
A buffer of Phosphate, pH 7.2 was added, and ultrafiltration was performed again. This was repeated twice to remove the residual SDS. Further, the same operation was repeated for the assay culture medium to finally prepare 300 μl.
This was sterilized and the TPO activity was measured. As a result of such an experiment, the protein that could be clearly detected by silver staining was DPCI.
Apparent molecular weight of about 17,000 to II marker
There were three kinds, 19000, 14000 and 11000.
Electrophoresis of the TPO active fraction on a Capcell Pak Cl column showed an apparent molecular weight of about 17,000 to 1900, in which the intensity of the activity and the density of the stained band were correlated.
Although the band of 0 was observed, the apparent molecular weight in which TPO activity was detected in this experiment was about 17,000 to 19
It was 000. The above results are shown in FIG. As a result of the above, the protein exhibiting TPO activity was confirmed to be incapable of finally being confirmed on the electrophoresis gel by Capcell Pak Cl.
It could be confirmed that it was purified in the active fraction of the 300A column. This sample was subjected to 15% SDS polyacrylamide gel electrophoresis (under non-reduction) and the density of the silver-stained band revealed that the apparent molecular weight in the total TPO active fraction was about 170.
The amount of TPO candidate protein from 00 to 19000 is about 1.7.
It was μg. Hereinafter, polymer TPO will be described in (12) to (15).
Each step of refining the standard F2 will be described. (12) YMC-Pack PROTEIN-RP <Reverse Phase Chromatography> (7) Polymeric TPO preparation F2 (total protein mass 2
57 mg, protein concentration 0.894 mg / ml, relative activity 7
840, relative activity amount 2015,000, total volume 287m
1) developing solvent A (0.025% TFA) and one third volume of the sample 95.8 ml developing solvent B (0.0
1-propanol containing 25% TFA) was added to give a final volume of 383 ml, final propanol concentration about 25%, TFA.
The concentration was 0.006% and the protein concentration was 0.671 mg / ml. Since insoluble matter was generated here, only 62.3 ml (42.8 mg) of the supernatant after centrifugation was divided into 6 times,
YMC-Pack P previously equilibrated with 30% B
ROTEIN-RP (YMC, Catalog No. AP
RRP-33-03-15; diameter 3 cm, bed height 7.5 cm) was injected into the column at a flow rate of 2 ml / min.
The precipitate could be solubilized by adding 10 ml of 20 mM sodium acetate, pH 5.5 containing 5 mM CHAPS.
Combined and sent to the column. After injecting each sample, about 50 ml of solvent (developing solvent A: developing solvent B =
3: 1), and collect the flow-through fractions, then start the development program (linear concentration gradient from 30% B to 45% B for 120 minutes), and collect a total of 24 fractions in 15 ml polypropylene tubes. I collected it. The same procedure was repeated from the 1st time to the 6th time, and finally, 90 ml fractions were 24. The flow-through fraction and the tube number 1 remain as they are in the ultrafiltration unit (Amicon; Y
Concentrated to 90 ml with M3 membrane, diameter 76 mm). 0.3 ml was taken from the fractions containing the flow-through tubes Nos. 1 to 24, 10 μl of 5% BSA was added, and the mixture was dried by centrifugal evaporation to finally give 0.3 ml of I.
MDM Assay Dissolved in culture medium, assayed, TP
The O-active fraction was identified. As a result, tube number 10
15 (range of 34.0 to 39.5% in propanol concentration) has TPO activity.
2 derived YMC-Pack PROTEIN-RP T
It was designated as PO active fraction F2. Next YMC-Pack CN
-Stored at -85 ° C until immediately before proceeding to AP. YMC-Pack PROTEI derived from polymer TPO preparation F2
N-RP TPO active fraction F2 Total volume 540 ml Protein concentration 0.021 mg / ml Total protein mass 11.4 mg Relative activity 227,000 Relative activity amount 2588000 (13) Superdex 75 pg <Gel filtration chromatography in the presence of CHAPS> ( 12) YMC derived from polymer TPO preparation F2 obtained in 12)
-Pack PROTEIN-RP TPO active fraction F
Out of 2, 538.2 ml (total protein mass 11.3 mg,
Protein concentration 0.021 mg / ml, relative activity 22700
0, relative activity amount 2565000) was added with 0.6 ml of 50% glycerol, and then concentrated by centrifugal evaporation.
Then 6 ml of 20 mM CHAPS was added. Further, add 18 ml of 20 mM CHAPS, stir, and mix.
C. and 41 hours later the first sample was HiLoad
26/60 Superdex 75 pg (Pharmacia Biotech, Catalog No. 17-1070-0
(1; diameter 2.6 cm, bed height 60 cm), and injected with DPBS containing 5 mM CHAPS at a flow rate of 1 ml / min. 4 ml at a time (protein concentration of 0.
A sample of 466 mg / ml and protein amount of 1.86 mg) was injected into the column. Divide into columns for the 6th time,
TP of all YMC-Pack PROTEIN-RP
The O active fraction was collected on a Superdex 75 pg column. Fraction is 5 ml, 6 times, 3 in total
There were 45 0 ml fractions. Take 0.1 ml from each fraction and 10 μl of 5% BS
After A was added, the mixture was dried by centrifugal evaporation, finally dissolved in 0.25 ml of IMDM assay culture medium, and subjected to an assay to identify a TPO active fraction. As a result, tube numbers 13 to 31 (molecular weight: 78000 to 3000)
Range)), there was TPO activity.
Superdex 75 pg T from PO standard F2
It was designated as PO active fraction F2. Superdex 75 derived from polymer TPO preparation F2
pg TPO active fraction F2 Total volume 540 ml Protein concentration 0.00216 mg / ml Total protein mass 1.17 mg Relative activity 1750000 Relative activity 204204 (14) YMC-Pack CN-AP <reverse phase chromatography> (13) Derived from the prepared polymer TPO preparation F2
Of the 540 ml of TPO active fraction F2 (molecular weight 78000-3000) of erdex 75 pg, 513.2
ml (total protein mass 1.11 mg, protein concentration 0.0021
6 mg / ml, relative activity 1750,000, relative activity 1
943000) to 1/10 volume of developing solution B (0.05%
After adding TFA-containing 1-propanol), using a developing solvent A (0.1% TFA) and a developing solution B, 15% B was added.
Was injected into a YMC-PackCN-AP (YMC, Catalog No. AP-513; diameter 6 mm, bed height 250 mm) column equilibrated with 1. at a flow rate of 0.6 ml / min. After the injection was completed, the propanol concentration was increased from 15% B to 25% B, and further 6% from 25% B to 50% B.
It was developed with a linear concentration gradient of 5 minutes. YMC-Pack C
Upon advancing to the N-AP column, it was confirmed that 1/20 of all the input samples were first advancing in a pilot manner and the activity could be recovered well. Therefore, the remaining 19/20 was divided into two and separated. In other words, a total of three deployments were conducted. Since the respective fractions collected in a total of 3 times were collected in 44 polypropylene tubes, the total amount was 3, 6 ml. Of this, 5 μl (1/720 fraction) was taken and finally 0.25 ml of I
The medium was replaced with the MDM assay medium. As a result of the assay, tube numbers 24 to 30 (36.0 in propanol concentration)
42.0% of the range) had an extremely strong TPO activity, so this was used as a polymer TPO preparation F2-derived YMC-Pa.
It was used as the main TPO active fraction FA of ck CN-AP. Superdex 75 derived from polymer TPO preparation F2
pg TPO active fraction FA Total volume 25.20 ml Protein concentration 0.0246 mg / ml Total protein mass 0.620 mg Relative activity 700000 Relative activity 434000 (15) Capcell Pak Cl 300A <Final reverse phase chromatography> (14) YMC derived from polymer TPO preparation F2 obtained in
-Pack CN-AP TPO active fraction FA25.2
Of 0 ml, 24.66 ml (total protein mass 0.606
mg, protein concentration 0.0246 mg / ml, relative activity 70
0000, relative activity 424,000), 0.4 ml of 50% glycerol was added, and the mixture was concentrated by centrifugal evaporation. Finally, 2 ml of propanol concentration of several%, glycerol of 10%, and protein concentration of 0.303 mg / ml.
It became a sample of. Developing solvent A (0.1% TF
A), Capce equilibrated with developing solvent B (1-propanol containing 0.05% TFA) at 15% B
ll Pak Cl300A (Shiseido Catalog No. C
l TYPE: SG300A; diameter 4.6 mm, bed height 250 mm) column, 27% B to 38
Flow rate 0.4 ml / mi with a linear concentration gradient to 65% for 65 minutes
n is expanded to 0.6 in 72 polypropylene tubes
Collected by ml. 0.75 μl from each fraction
Take 1/800 fraction, 20 μl of 5%
BSA was added and finally replaced with 225 μl of IMDM assay medium, and a 300-fold dilution of the original volume was assayed. From each fraction, take 2 μl (1/300 fraction) for electrophoresis, centrifuge-evaporate, add 10 μl reducing agent-free SDS electrophoresis sample buffer,
For 5 minutes. This was subjected to SDS gel electrophoresis using 15 to 25% SDS-polyacrylamide precast gel (manufactured by Daiichi Pure Chemicals) and stained with a silver staining kit. A DPCIII marker was used as a molecular weight marker. As a result of the above analysis, TPO was clearly observed in tube numbers 33 to 39 (in the range of 29.5 to 31.5% in propanol concentration).
There was activity. Of these, tube numbers 34 to 39
(Propanol concentration in the range of 30.0 to 31.5%) was used as the main TPO active fraction FA. Examining the SDS gel electrophoresis image of the main TPO active fraction, (1
It was revealed that there is a band in which the intensity of activity correlates with the intensity of dyeing in the apparent molecular weight range of 17,000 to 22,000 as in the case of starting from the low molecular weight TPO preparation F3 described in 0). . <Example 2> Analysis of partial amino acid sequence of rat purified TPO Iwamatsu's method (Iwamatsu et al., New Basic Biochemistry Experimental Method, Volume 4, 3)
Pages 3-84 (published by Maruzen); Akihiko Iwamatsu, Biochemistry, Volume 63,
No. 2, pp. 139-143, (1991); Akihi.
ro Iwamastu, Electrophore
sis, vol. 13, pages 142-147, (1992)).
According to the above, the Capcell obtained in (10) of Example 1
Analysis of the amino acid sequence of the rat TPO candidate protein in the TPO fraction FA of the Pak Cl 300A column was performed. That is, the sample was subjected to SDS gel electrophoresis and electrically transferred to a polyvinylidene difluoride (PVDF) film. Then, the protein on the PVDF membrane was subjected to reductive S-alkylation, systematically and stepwise subjected to limited enzymatic digestion with three proteases to form a peptide fragment, which was separated and purified by reverse phase chromatography to obtain The peptides were analyzed by a sensitive amino acid sequencing method. The details will be described below. Capcell Pak derived from low molecular weight TPO preparation F3
Cl 300A TPO fraction FA of TPO candidate protein
Analysis Example (1) Concentration of TPO Fraction FA (Tube Nos. 36 to 42) on Capcell Pak Cl 300A Column T from a low molecular weight TPO preparation F3 obtained in (10) of Example 1, T on a CapcellPak Cl300A column.
PO active fraction FA (tube number 36 to 42) 4200
μl (total protein mass 39.6 μg, protein concentration 9.4 μg /
ml, relative activity 4890000, relative activity amount 19360
0, out of 4151 μl (98.8 of total fraction)
%) For analysis for amino acid sequences. The protein mass estimated from the chromatogram is 39.1 μg,
Of these, the amount of TPO candidate protein having an apparent molecular weight of about 17,000 to 19000, which was stained with silver by SDS gel electrophoresis, was about 1.6 μg. Glycerol was added to this sample, concentrated by centrifugal evaporation, and 5 μl
As a glycerol solution. S containing no reducing agent
DS electrophoresis sample buffer, and 1M Tris-HCl, pH 8 was added to adjust pH, and finally 200 mM Tris-HCl, pH 8.0, 50.
mM Tris-HCl, pH 6.8, 1.1% SD
About 25 μl of a sample containing S, 2 mM EDTA, 0.02% BPB and 30% glycerol was prepared. The sample was first left at room temperature for 14 hours and then treated at 60 ° C. for 5 minutes in order to fully SDS it without undue heating. (2) Electrophoresis A microslab gel (4.0% acrylamide concentrated gel, 15% acrylamide separation gel) was prepared according to a conventional method, and SDS gel electrophoresis was performed at room temperature at a constant current of 12.5 mA and then 17.5 mA. It took 2 hours. The molecular weight marker includes a prestained low range marker (Bio-Rad 161-0305),
And DPCIII markers were used. P immediately after migration
It was transferred to a VDF film (next item). In addition, a part of the sample subjected to the analysis is non-reduced and is reduced with dithiothreitol (DTT) to obtain a 15 to 25% polyacrylamide precast gel (manufactured by Daiichi Pure Chemicals Co .; Multi-Gel 1).
Electrophoresis on 5/25, Catalog No. 211072). When this was silver stained using a silver staining kit, T
The band expected to be PO has a molecular weight of about 1 under reduction.
9000 and Capcell PakCl 300
It was confirmed that the purity of the TPO candidate protein in the TPO active fraction on the A column was about several%. Also non-reduction
It was suggested that at least one S—S bond is present inside the molecule because the mobility of each reduction is different. (3) Transfer / band detection by electroblotting onto PVDF membrane Using a semi-dry transfer device (Marisol, wet for transfer device model KS-8460), according to a conventional method,
PVDF membrane (ProB manufactured by Applied Biosystems) at a constant current of 160 mA (11 to 17 V) for 1 hour.
transfer to Lott, Catalog No. 400994). As an anolyte, 0.3 M Tris, 20% methanol, pH 10.4, and as a transfer membrane solution, 25 mM Tris-
25% in 20% methanol, pH 10.4, catholyte
Tris, 40 mM aminocaproic acid, 20% methanol, pH 10.4 was used. The transferred film was stained with Ponceau S dye solution (0.1 g Ponceau S in 100 ml and 1 m
(including 1 acetic acid), a plurality of bands were stained, in which TPO was expected to have a molecular weight of about 1900.
A band of 0 could be confirmed. Cut this out,
We proceeded to the fragmentation of the peptide. (Next section) (4) Peptide fragmentation and peptide mapping
Amino acid sequence analysis TPO transferred / reduced S-alkylated on PVDF membrane
In order to systematically fragment the candidate protein, stepwise limited enzymatic degradation was performed with the following three proteases. Primary digestion Lysyl endopeptidase (Achromb
Acter lyticus m497-1, manufactured by Wako Pure Chemical Industries, Ltd., catalog number 129-02541) Secondary digestion endoproteinase Asp-N (manufactured by Boehringer Mannheim, catalog number 1054558)
9) Tertiary digestion Trypsin-TPCK (Worthingt
on Biochemical, Catalog No. 3
740) Peptide fragments obtained by each enzymatic digestion were recovered, and 0.05% TFA was used for developing solvent A and 0.02% T was used for developing solvent B.
Isopropanol containing FA: acetonitrile = 7: 3
Wakosil-II 5C18 C using a mixture of
18 reverse phase column (manufactured by Wako Pure Chemical Industries; diameter 2.0 mm,
Length 150 mm, column temperature 30 ° C., flow rate 0.25
Mapping was performed by developing a linear concentration gradient of 1% B to 50% B at 30 ml / min (FIG. 4), and the obtained peptide fragment was recovered. Each peptide fragment was digested with a gas phase amino acid sequencer (manufactured by Shimadzu Corporation, PPSQ-2) by Edman degradation, and the N-terminal PTH amino acids sequentially recovered were identified by C18 reverse phase column chromatography by an isocratic elution method. I went. The results are summarized below. Amino acid sequence of peptide fragment by primary digestion lysyl endopeptidase Fragment name Amino acid sequence

[Table 3]

[Table 4]

[Table 5] Of the above sequences, those shown in () are amino acid residues that can be deduced from systematic enzymatic digestion. (5) Similarity analysis of obtained amino acid sequence <homology search> Whether the obtained amino acid sequence is contained in a known protein that has already been reported, or whether there is a protein having a similar sequence , Sequence analysis software Mac Vector (Kodak Intern
national Biotechnologies, In
c. ) Was used for analysis. Information on known proteins or known genes can be found in the Entrez Release 6 database (National Center fo
r Biotechnology Informationi
on, National Library of Me
dicine, National Institute
s of Health, published August 15, 1993)
Was used. The various databases included in this are as follows. As a result, the sequence (K) DSFLADVK of AP12 is
Rat corticosteroid-bindin
g globulin (CBG) precursof
[PIR database registration number A40066; smi
th and Hammond; "Rat cortic
Osteroid-binding Globulin:
primary structure and mes
singer ribonucleic acid l
evels in the deliverer under
different physiological con
positions. "Mol. Endocrinol,
(1989), 3,420-426,] internal array KD
It was completely consistent with SFLADVK. Upon closer examination, the AP3 sequence (K) XYYESZ ((X is A, S,
It was found that a sequence of KQYYESE, which has high similarity to G, M, or Q), (Z is E or K), is contained in the amino acid sequence of rat CBG. These A
The sequences corresponding to P12 and AP3 are continuous in rat CBG and correspond to the internal amino acid sequence KDSFLADVKQYYESE. However, AP12, A
Regarding the amino acid sequences of fragments other than P3, no known protein or gene whose similarity should be considered was found. <Example 3> Analysis of biological properties of TPO derived from thrombocytopenic rat plasma (1) Rat CFU-MK assay system (liquid culture system)
As a typical example, a partially purified preparation of TPO from thrombocytopenic rat plasma (YMC Pa described in (8) of Example 1) was used.
ck Protein-RP column TPO active fraction F
The dose-response curve when 2) was used is shown in FIG. When the culture was observed under a microscope over time, the differentiation of megakaryocytes, the progress of maturation, that is, the increase in cell size was observed over time, and it was considered that the increase in cells was also occurring. As a particularly remarkable change, protrusion formation by numerous megakaryocytes was observed on day 4 of the last day of culture (almost not observed on day 3 of culture). This protrusion formation is cyto
plastic process formation
(Leven and Ye, Blood, Volume 69, 1046
-1052, (1987)) or propl
atlet process formation
(Topp et al., Blood 7, Vol. 76, 912-924.
Page, (1990)) and the like, which is a precursor structure of platelets that have further differentiated from megakaryocytes, and is considered to be the final form of megakaryocyte differentiation that can be observed in vitro so far. Since such a morphological change was frequently observed in the TPO preparation alone, this factor was used alone as C
There is a possibility that FU-MK proliferation and differentiation are promoted, mature megakaryocytes are generated, and finally, platelet production is advanced. (2) In a colony assay system, a partially purified preparation of TPO from thrombocytopenic rat plasma, a colony of rat non-separated bone marrow cells, cells at each stage of separation / concentration, or GpIIb / IIIa ⁺ CFU-MK fraction was used. When assayed by the assay system, TPO derived from rat plasma formed megakaryocyte colonies. T
Megakaryocyte colonies formed by PO and other known cytokines, namely rat IL-3, mouse GM-CS
Comparing the megakaryocyte colonies formed by F or human EPO, the megakaryocyte colonies formed by TPO have a small number of megakaryocytes forming individual colonies, but the size of each megakaryocyte is large. It has a characteristic that it has advanced maturity. Furthermore, colonies of other cell lines were scarcely formed, and TPO showed Meg-C.
SF activity is considered to be megakaryocyte-specific activity. From these facts, TPO is
Other known cytokines exerting the activity of eg-CSF, namely rat IL-3, mouse GM-CSF, and human EPO, have different biological properties and are unique Me
It was revealed to exert g-CSF activity. CD34 ⁺ DR derived from human bone marrow cells or human cord blood cells
⁺ T from thrombocytopenia rat plasma even for cell fraction
The partially purified PO preparation showed Meg-CSF activity and formed a significant number of human megakaryocyte colonies. This indicates that this factor has no species specificity. <Example 4> Specification of rat TPO producing cells (1) Search for rat TPO producing organs First, cloning of rat TPO gene based on partial amino acid sequence of rat TPO, or purpose of securing mRNA source for expression cloning And rat T
The PO-producing organs were searched and specified. Initially, bone marrow, lung, liver, and spleen were excised with time from a rat that had been thrombocytopenic by administration of P55 antibody, and the culture supernatant of the cells (organ sections in the case of lung and liver) was collected to prepare rat CFU- M
The activity in the supernatant was evaluated by the K assay system, but no definite result was obtained. Then, the liver and T in the rat
A report suggesting a relationship with PO production (Siemensm
a. Lab. Clin. Med. , Volume 86, 81
7-833, (1975)), hepatocytes prepared by the collagenase perfusion method were cultured from the liver of a rat that had been thrombocytopenic by administration of P55 antibody, and the supernatant was applied to a WGA-Agarose column. The adsorbed fraction is V
When developed on a ydac phenyl reverse phase column,
Rat plasma-derived TP in rat CFU-MK assay system
A very similar activity was observed at the same position as the O activity.
Although weak, the activity was observed in the culture supernatant of normal rat hepatocytes. These results strongly suggested that the liver might be one of the TPO-producing organs. (2) Screening of rat TPO-producing cell line Based on the above results, screening of rat TPO-producing cell line was performed. First, 20 types of rat liver-derived cell lines were cultured in each subculture medium until they became almost confluent, and then the serum contained in the culture medium was adjusted to 5%.
The culture medium was replaced with% FCS, and the culture was continued for 3 days, and the culture supernatant was collected. The supernatant was partially purified by the method described in (1) and
When the presence or absence of PO was examined, three types of rat liver parenchymal cell-derived cell lines, namely, McA-RH8994 cells (A
TCC deposit number CRL1602, Becker et al., “O
ncodevelental Gene Expr
session "ed.byFishman and s
ell, Academic Pres. , NY, 259
-271, (1976), purchased from Dainippon Pharmaceutical Co., Ltd., H
4-II-E cells (ATCC deposit no. CRL1548,
Pitot et al., Nat. Cancer Inst. Mo
nogr. , 13: 229-245, (196
4), purchased from Dainippon Pharmaceutical Co., Ltd., and HTC cells (Th
mpson et al., Proc Natl. Acad. Sc
i. USA, 56, 296-303, (196.
6), purchased from Dainippon Pharmaceutical Co., Ltd.), production of TPO activity was clearly confirmed. (3) Detailed analysis of TPO activity produced by McA-RH8994 cells, H4-II-E cells, and HTC cells Purification proceeded in parallel with TPO activity secreted from these three types of rat cell lines. Rat plasma-derived TPO
The activity was examined in more detail in terms of both biochemical and biological properties. 10 McA-RH8994 cells
The suspension was suspended in an alpha-MEM (-) culture solution containing% FCS and placed in a culture plastic flask for tissue culture having a bottom area of 175 cm ² at 1 × 10 ⁶ cells / flask to be placed in a 5% carbon dioxide incubator. After culturing at 37 ° C. for 3 days, the medium was replaced with IMDM culture medium containing 5% FCS, the cells were further cultured for 3 days, and the supernatant was collected. Dulbecco-modified Eagl containing H4-II-E cells containing 10% FCS
e culture solution (containing 4.5 g / l glucose) (hereinafter, DM
EM culture solution) and placed in a plastic flask for tissue culture having a bottom area of 175 cm ² at 5 × 10 ⁵ cells / flask at 37 ° C. in a 5% carbon dioxide incubator.
After culturing for 3 days, the medium was replaced with IMDM culture medium containing 5% FCS, and the culture was continued for 3 days, and the supernatant was collected. In addition, HTC cells were suspended in a DMEM culture solution containing 5% FCS and placed in a plastic flask for tissue culture having a bottom area of 175 cm ² at 2.5 × 10 ⁵ cells / flask to incubate a 5% carbon dioxide gas incubator. After culturing in the medium at 37 ° C for 3 days, the medium was replaced with IMDM culture medium containing 5% FCS,
The culture was further continued for 3 days, and the supernatant was collected. From 2 liters of the culture supernatant of each of the three types of cell lines thus obtained, the cell line-derived TPO was partially purified according to the method for purifying TPO from XRP described in Example 1-2. The outline will be described below. First, the culture supernatant was concentrated about 6 times with an ultrafilter, and then the buffer was exchanged with 20 mM Tris-HCl (pH 8.0) using a Sephadex G-25 column. Eluate Q-Sepharose F
20 mM Tris-HCl (pH
After washing with 8.0), the adsorbed fraction was washed with 175 mM NaCl.
Elution with 20 mM Tris-HCl (pH 8.0) containing This fraction was added to a WGA-Agarose column, washed with PBS, and then the adsorbed fraction was washed with 0.2 MGlc.
20 mM N containing NAc and 0.15 M NaCl
Elution with a Phosphate (pH 7.2). This eluate was added to TSK-gel AF-BLUE 6
20 onto a 50 MH column, containing 1 M NaCl
After washing with mM NaPhosphate (pH 7.2), elution was performed with 2M NaSCN. This is Phen
yl-Sepharose 6 FF / LS column, and 1.5M ammonium sulfate (Ammonium
50 mM Na Phosph containing Sulfate)
ate (pH 7.2), and then washed with 36 mM Na Phosphate containing 0.8 M ammonium sulfate, and then washed with 20 mM Na Phosphate (p
H7.2). After concentrating this adsorption fraction,
Reverse-phase Vydac Protein C4 column (The
Separations Group Catalog No. 214TP51015; diameter 1 cm, bed height 15
cm). Using 1-propanol containing 0.1% TFA as the developing solvent A and 0.05% TFA as the developing solvent B, the column was preliminarily equilibrated with 20% B, and after injecting the sample, 20% B at a flow rate of 1 ml / min. From 9 to 40% B
Elution was performed with a linear concentration gradient of 0 minutes. As a result, the TPO activity derived from any cell line was 1% at a concentration of 30% to 43%.
Eluted with propanol. As a result of measuring the activity of the preparations at each purification stage with the rat CFU-MK assay system, the TPO activities derived from the three cell lines were all TP derived from XRP.
The behavior was very similar to that of O activity (see Example 1-2) (Table 6 describes relative specific activity, activity yield, etc. at each step in the rat CFU-MK assay system). Furthermore, the elution fraction from the final reverse phase column was used as a rat CF.
As a result of measuring the activity by the U-MK assay system, the TPO activity derived from three types of cell lines and the TPO activity derived from XRP were eluted at the same peak position. Focusing on the active fraction of this reversed phase column, rat GpIIb / IIIa ⁺ CFU-M
A colony assay was performed using non-adherent cells obtained in the step of removing adherent cells in the process of separating and concentrating K. As a result, it was found that the megakaryocyte colonies were almost in agreement with the elution pattern of activity in the rat CFU-MK assay system. Formation was observed (Table 7), and like the XRP-derived TPO activity, 3
All of the cell line-derived activities exclusively formed megakaryocyte colonies and almost no colonies of other lineages. According to the method described in Example 1-2, the pooled active fractions of the reversed-phase column were subjected to SDS polyacrylamide gel electrophoresis, and the protein was extracted from the gel after the electrophoresis, and the activity was measured by a rat CFU-MK assay system. As a result, TRP derived from XRP had an apparent molecular weight of 17,000.
~ 22000, TPO derived from McA-RH8994 cells
Has an apparent molecular weight of 33,000 to 39000, H4-II
-EPO cell-derived TPO has an apparent molecular weight of 31000-3
8000, TPO derived from HTC cells has an apparent molecular weight of 1
7,000-22,000, and molecular weight 28,000-35
Had 000. As described above, McA-RH89
The TPO activity produced by 94 cells, H4-II-E cells, and HTC cells has a biological property slightly different from that of XRP-derived TPO in terms of apparent molecular weight, but has a biological property. It became clear that it was equivalent in. In the present invention, it should be noted that a molecule having a TPO activity present in blood has a specific intramolecular structure in the producing cell or after being secreted from the producing cell.
Or it suggests that it may have been cut at an unspecified position. In addition, TPO gene (mRNA and cDNA)
It also shows the possibility that various lengths exist.

[Table 6]

[Table 7] <Example 5> Expression vector for producing a cDNA library (pEF18
Construction of S) A vector was prepared which was easy to incorporate the cDNA fragment into the vector and had high expression efficiency of the cloned cDNA, and prepared for cloning and expression of TPO cDNA. That is, the promoter of the elongation factor 1α (EF1α), which is known as a promoter with high expression efficiency, is used as the SRα of the expression vector pME18S which is easy to handle.
The expression vector pEF18S was constructed by replacing the promoter (see FIG. 6). Elongation factor 1
The promoter of α is the expression vector pEF-BOS (Mi
zushima et al., Nucleic Acids Re
s. , 18 , 5322, 1990) 1 μg of restriction enzyme H
2% after partial digestion with indIII and EcoRI
About 1200 bp DNA was subjected to electrophoresis using agarose gel (FMC Bioproducts).
Fragments were separated and prep-A-gene DNA purification kit (Bio-Rad; Willis et al., BioTech).
Nikes, 9 , 92-99, 1990, and was purified using a kit for selectively purifying DNA by adsorption using a porous silica-based matrix. 100 ng of this DNA fragment is similarly converted to H
50 ng of the expression vector pME18S (Liu et al., Proc. Natl.
Acad. Sci. USA, 90 , 8957-896.
1, 1993). Competent high E. coli DH5 (manufactured by Toyobo Co., Ltd .; Ha
nahan et al. Mol. Biol, 166 , 55
7-580, 1983, using a competent host bacterium prepared by a modification of the method, the 12 colonies obtained were randomly selected and the plasmid DNA was purified.
Based on the digestion pattern with the restriction enzyme A, one was selected from 10 clones containing the desired plasmid (pEF18S), and a large amount of plasmid DNA was prepared. Purification of plasmid DNA is essentially molecular cloning.
ing [Sambrook et al., Cold Spring
Harbor Laboratory Press
(1989)].
That is, clone pME1 obtained as described above
8S containing 50 μg / ml Ampicillin 50
ml LB medium (1% Bacto-tryptone,
0.5% Bacto-east extract,
After culturing overnight in 0.5% NaCl), the cells obtained by centrifugation were treated with 4 ml of TEG-lysozyme (25 m).
M Tris.Cl (pH 8), 10 mM EDTA,
50 mM Glucose, 0.5% lysozym
e) Suspended in the solution, 8 ml 0.2N NaOH / 1%
Add SDS solution and suspend well. Furthermore, 3M pot
Add 6 ml of the assium / 5M acetate solution, suspend well, and centrifuge to obtain a supernatant. The supernatant was treated with phenol-chloroform (1: 1), added with an equal amount of isopropanol and centrifuged to obtain a pellet. Pellet is T
E solution (10 mM Tris-hydrochloric acid (pH 7.5), 1 mM
After dissolution in EDTA), RNase treatment, phenol-
Chloroform (1: 1) treatment is performed and ethanol precipitation is performed. Dissolve the pellet in TE solution again,
0.63 each of polyethylene glycol 3000
Add M to 7.5% and centrifuge. Finally, the pellet is dissolved in TE solution and then ethanol precipitated. As a result, about 300 μg of plasmid DNA was obtained. 100 μg of this DNA was digested with restriction enzymes EcoRI and NotI.
After complete digestion with 0.8% agarose gel (FMC
BioProducts), and the vector fragment was recovered and purified with Prep-A-Gene DNA purification kit (Bio-Rad) to obtain about 55 μg of plasmid D.
I got NA. This DNA was used for the following cDNA library construction. <Example 6> Purification of mRNA from McA-RH8994 cells McA-RH8994 cells, which had relatively higher activity than the results of the colony assay of Example 4, were transferred to rat TPOcDN.
It was selected as a material for A cloning and used in the following experiment. All R
Isolation of NA is essentially Molecular Cloni
ng [Sambrook et al., Cold Spring
Harb or LaboratoryPress (1
989)]. Mc
The A-RH8994 cells were completely and densely grown on 15 petri dishes having a diameter of 90 mm, the culture solution was removed from the petri dishes, and 0.8 ml of 5 M guanidine solution (5 M guanidine thiocyanate, 5 mM citrate was added to each petri dish. Sodium (pH 7.0), 0.1M β-mercaptoethanol, 0.5% sodium sarcosyl sulfate) was added,
After being well suspended, the mixed solution was collected in one tube, and a guanidine solution was added to make the total volume 20 ml. The mixture in which the cells were broken and became viscous was inhaled and discharged repeatedly about 20 times using a 20 ml syringe equipped with an 18G and 21G needle, until the viscosity became almost zero. Add 18 ml of 5.7M CsCl-0.1 to a polyallomer centrifuge tube that fits the Beckman SW28 rotor.
M EDTA (pH 7.5) was previously added as a cushion, and about 20 ml of the above mixed solution was gently overlaid so that the layers were not disturbed so that the tube was almost filled. The centrifuge tube prepared in this way is subjected to 250 at 20 ° C.
00r. p. m. After centrifugation for 20 hours, the obtained pellet was washed twice with a small amount of 80% ethanol.
The pellet was dissolved in TE solution, extracted with phenol-chloroform (1: 1), and then 1/10 amount of 3M sodium acetate and 2.5 times amount of ethanol were added to perform ethanol precipitation to obtain total RNA ( Total R from about 10 ⁸ cells
About 2.5 mg NA was obtained). Poly (A) from total RNA
⁺ RNA is purified by Oligotex ^™ -dT30 (S
upper) (manufactured by Nippon Synthetic Rubber / Nippon Roche); oligo dT is covalently immobilized on the surface of latex particles, and poly (A) ⁺ RNA is used in the same manner as the oligo dT column used for purifying poly (A) ⁺ RNA. Can be purified). From about 500 μg of total RNA, 20 μg of poly (A) ⁺ RNA was obtained. Example 7 Construction of Rat cDNA Library From 5 μg of poly (A) ⁺ RNA obtained in Example 5 to T
imageSave ^™ cDNA Synthesis
Kit (Pharmacia; Okayama-B)
erg method: Mol. Cell. Biol, 2 , 161
-170, 1982, modified kit for cDNA synthesis) and DIRECTIONAL CLONING
TOOLBOX (Pharmacia; primer for synthesizing cDNA containing NotI sequence: 5'-AA
CTGGAAGAATTCGCGGGCCGCAGGAA
_(T) 18 -3 'and adapter for EcoRI sequence added: 5'-AATTCGGCACGAG-3' and 5'-CTCGTGCCG-3 with a set) of '
A double-stranded cDNA having EcoRI at the 5 ′ end and a NotI recognition site at the 3 ′ end was synthesized. The synthesized cDNA is 1.2
7. Ligated with expression vector pEF18S (see Example 5) previously treated with μg of EcoRI and NotI, 8.
4 ml of competent high E. E. coli DH5 (manufactured by Toyobo Co., Ltd.) was transformed. As a result, 5.3 × 10
^Five transformants were obtained. <Example 8> Acquisition of rat TPO cDNA fragment by PCR method (cloning) 530,000 clones of the McA-RH8994 cDNA library prepared in Example 7 were treated with 50 μg / ml Ampic.
After culturing overnight in 50 ml of LB medium containing ilin,
From cells obtained by centrifugation, QIAGEN-tip10
0 (manufactured by DIAGEN; silica gel based anion exchange column for DNA purification) using McA-RH8994.
Purify the cDNA library plasmid to about 200μ
g plasmid DNA was obtained. Two types of antisense nucleotide primers AP8-1R and AP8-, which correspond to the amino acid sequence of the peptide fragment AP8 described in Example 2.
2R, and sense nucleotide primers EF1α-1 and EF1α-2 corresponding to the first intron of human elongation factor 1α of plasmid vector pEF18S shown in FIG.
Was synthesized. Applied Biosystems 394 DNA / RNA synthesizer (synthesizer based on β-cyanoethylamidite method) is used for synthesis, and OPC column for synthetic DNA purification (a column packed with reverse phase silica gel and having a trityl group is manufactured by the same company) It was purified using a column for purifying DNA. The purified synthetic DNA was dissolved in TE solution to 50 μM and kept at -20 ° C until use.
Saved in. All synthetic oligonucleotides used below were similarly synthesized and purified before use. Primer AP8
-1R and AP8-2R are mixed primers consisting of 17 consecutive nucleotides and used deoxyinosine as in the work of Takahashi et al. (Takah).
ashi, et al, Proc. Natl. Aca
d. Sci. (USA) 82 , 1931-1935 (1
985)). Primers EF1 α-1, EF1 α-2
Are described in Uetsuki, et al. Biol. ch
em. 264 , 5791-5798 (1989), genomic sequences 1491-1512, 1513-1532.
21 synthesized based on the nucleotide sequence corresponding to
It is a primer consisting of 20 nucleotides. Table 8 shows the sequences of the synthesized primers.

[Table 8]McA-RH8994 cDNA library plasmid
Using 3 μg as a template, AP8-1R (500 pmol),
EF1 α-1 (100 pmol) was used as a primer
GeneAmp^TMPCR Reagent Ki
t with AmpliTaq^TMDNA Pol
ymerase (Takara Shuzo; heat-resistant TaqI for PCR)
Polymerase, reaction buffer, dNTP set)
Using GeneAmp^TMPCR System 9
600 (manufactured by PERKIN-ELMER; reaction for PCR
PCR reaction (2 at 95 ° C) with a volume of 100 μl
After heating for 1 minute, denaturing conditions of 1 minute at 95 ° C, 1 minute at 40 ° C
35 times under annealing condition between 72 ° C and 1 minute synthesis condition
Reaction, and incubate at 72 ° C for an additional 7 minutes)
Was done. To increase the specificity of the amplified DNA fragment
Using 1 μl of the obtained PCR reaction solution as a template,
α-2 (100 pmol), AP8-2R (500 pm
ol) as a primer in the same volume of 100 μl
PCR reaction (after heating at 95 ° C for 2 minutes, then at 95 ° C for 1 minute
Denaturing conditions, annealing conditions at 45 ° C for 1 minute, 1 at 72 ° C
The reaction was repeated 35 times under the synthetic condition of 7 minutes
Incubation at 2 ° C.). Reaction obtained here
2% agarose gel (FMC BioProdu
This PCR reaction is performed by electrophoresis using Cts).
The DNA fragment of about 330 bp, which is the main product of
Prep-A-Gene DNA Purification Kit (Bio-Rad
(Manufactured by the company). This DNA fragment is called T4DNA
PCR using ligase (Life Technology)
^TMII (manufactured by Invitrogen; PCR product TA
Cloning vector: heat-resistant poly used for PCR
Because merase has terminal transferase activity
In addition, deoxyadene was added to the 3'end of the DNA amplified by PCR.
Utilizing the property of adding one nitric acid, 5'-dT protruding end
Vector pCR with edges^TMSubclaw as it is on II
The method was subcloned into a vector. Arbitrarily
QIAGEN-tip1 for 28 selected clones
00 (manufactured by DIAGEN) using plasmid DNA
Was purified, and was purified by Taq Dye Deoxy^TMTe
rminator Cycle SequencingK
it (manufactured by Applied Biosystems; using PCR)
Dideoxy method with fluorescent dye: Sanger
Et al., Proc. Natl. Acad. Sci. USA,
74, 5463-5467, 1977).
373A DNA sequence manufactured by Ride Biosystems
Sequencing (fluorescence sequencer)
The nucleotide sequence of the clone was determined. Of the obtained DNA fragment
Of the amino acids of AP8 at the N-terminal side (Ile / Th
r / Ser) -Val-Pro with AP8-2R ply
Select the code adjacent to the mar and seek the full length
When enced, it contained a cDNA having 261 bp
I was out. 173 to 175 nucleotide sequence of this cDNA fragment
Is the code for methionine.
The frame matches the amino acid frame of AP8. Also
Before and after this sequence, the sequence of Kozak (Kozak,
M. , Cell,44, 283-292, 1986).
It is presumed to be the initiation site of translation from the fact that it is compatible, and rat T
A cDNA fragment encoding the N-terminal part of the PO protein,
it was thought. This cDNA fragment was named A1. Vek
And the base sequence of the A1 fragment excluding the target sequence
The deduced amino acid sequence is shown in the sequence listing (SEQ ID NO: 1).
Was. <Example 9> Screening of rat TPO cDNA by PCR method The above cDNA library was cloned into about 10,000 clones.
And contain 50 μg / ml Ampicillin.
After overnight culture in 1 ml of LB medium,
Motion Separation Device PI-100 (Kurashiki Spinning Company, VER-3.
0; Alkaline SDS method: Molecular Clon
ing [Sambrook et al., Cold Spring
g Harbor Laboratory Pres
s, 1989]: plasmid DNA based on a modified method of
Plasmid DNA was extracted using a dynamic extractor. That
Designed based on fragment A1 using 1/30 amount as template
2 kinds of synthetic oligonucleotides 5'CGAGGGGTTACCTGGGTCCTG3 '
(Sense sequence 1-17 of the sequence of SEQ ID NO: 1; CGAG
Is the sequence of the adapter) and 5'CAGAGTTAGT
CTTGCGGTGAG3 '(21 of the sequence of SEQ ID NO: 1
2-232 antisense sequence) as a primer
Generate and purify, GeneAmp^TMPCR Regen
tKit with AmpliTaq^TMDNA P
Gene using olmerase (Takara Shuzo)
Amp^TMPCR System 9600 (PERKI
PCR reaction by N-ELMER (30 at 94 ° C)
Denaturing condition for 2 seconds, annealing condition at 66 ° C. for 30 seconds, 7
The reaction was performed 30 times under the synthetic conditions of 2 ° C. for 1 minute.
As a result, a specific van of 236 bp was found in 3 of 100 pools.
Detected. One pool out of these is about 900 claws
The plasmid DNA is extracted by
PCR reaction of 3 pools out of 100 pools
A band was detected at. In addition, 4 of 1 pool
It was divided into pools of 0 clones each, and the same selection was performed.
Results Vans considered to be specific in 3 out of 100 pools
De was observed. Select 1 pool out of these 50 μg
LB plate containing 15 ml / ml Ampicillin (15
Each one that appeared after being plated on LB medium containing% agar)
Plasmid DNA was extracted from the colonies of
As a result of CR reaction, 2 out of 100 clones
A positive band was detected. Example 10 Sequence of rat TPO cDNA Purification of plasmid DNA is essentially Molecular
 Cloning [Sambrook et al., Cold S
pring Harbor Laboratory P
[ress (1989)].
gave. The two clones finally obtained in Example 9 were
50 ml containing 50 μg / ml Ampicillin
After culturing overnight in LB medium, purification was carried out in the same manner as in Example 5,
Finally, about 300 μg of plasmid DNA was obtained. here
The plasmid DNA obtained in step 1 was used as Taq Dye Deo.
xy^TM Terminator Cycle Seq
uening Kit (Applied Biosystems)
(Manufactured by K.K.) and sequenced in the same manner as in Example 8 to obtain cD
The base sequence of NA full length was determined. As a result, two blacks
The nucleotide sequences of the clones are completely identical and must be identical clones.
And became clear. Select one clone from this
A plasmid clone carrying NA was designated as pEF18S-A.
It was named 2α. The base sequence and the
The mino acid sequence is shown in the sequence listing (SEQ ID NO: 2). Sequence listing
The features of the sequence shown in (SEQ ID NO: 2) are remarkable. 172
The sequence after the 5'untranslated region of bp begins with methionine.
Signal sequence for secretion consisting of 21 proteins
It encodes a highly hydrophobic amino acid that is presumed to be
It This protein has 126 amino acid residues,
1022 bases 3'untranslated after the stop codon (TAA)
Followed by multiple adenines of sequence and poly A tail. This tongue
The partial amino acid sequence analyzed in Example 2 was found in the protein.
Only the sequence corresponding to AP8 was included (SEQ ID NO: 2
Amino acid numbers 1 to 12). Of N-glycosylation
There is no sequence site for Also, the 3'untranslated sequence end
The nucleotide sequences of 1624 to 1629 near the end are consensus
Although it is different from the sequence, it is considered as a potential polyadenylation sequence.
Can be Vector pEF18 carried in E. coli DH5
S-A2α is Ministry of International Trade and Industry on February 14, 1994.
Contract number FERM B at the Institute of Biotechnology, Institute of Technology
Deposited as P-4565. This is also 1995
Republic of China Food Industry Development Institute (FIRD)
It was deposited in I) under accession number 940083. <Example 11> Expression of rat TPO cDNA in COS1 cells-Activity confirmation
Of the plasmid pEF18S-A2α to COS1 cells
Transfection is DEAE including chloroquine treatment
-Dextran method (sompayrac et al., Proc.
Nanl. Acad. Sci. USA Volume 78, 757
5-7578, (1981); Luthman et al., N.
ucl. Acids Res. , Volume 11, 1295-1
308, (1983)) with some modifications.
It was carried out according to the method. DMEM culture containing 10% FCS
COS1 cells suspended in liquid (ATCC CRL165
0) is a plastic shaker for tissue culture with a diameter of 100 mm
40% at 37 ° C in a 5% CO 2 incubator.
The cells were cultured until they became% confluent. On the other hand, 500μ
g / ml DEAE-Dextran (Pharmacia
, 80 μM chloroquine (Sigma), 8% (v /
v) HBS (21 mM HEPES-145 mM Na
Cl, pH 7.1) and 9% (v / v) Nu-Se
4 ml DMEM containing rum (Collaborative)
Plasmid pEF dissolved in 30 μl HBS in culture
18S-A2α (10 μg) was mixed and transfected.
Immediately before the treatment, the above-mentioned CO was washed twice with DMEM culture solution.
After adding to S1 cells, 37 in a 5% CO 2 incubator
The cells were cultured at 0 ° C for 5 hours. Then, the culture supernatant is removed by suction and D
After washing the dish twice with MEM culture solution, 10% FC
Add 15 ml of DMEM culture solution containing S, 5% carbon dioxide gas
Incubate at 37 ° C for 3 to 5 days in an incubator
The supernatant was collected. The obtained culture supernatant is used as IMDM culture medium.
After sufficient dialysis, the rat CFU-MK assay system was used.
evaluated. As a result, plasmid pEF18S-A2α
Of COS1 cells transfected with and expressed
TPO activity was observed in the culture supernatant in a dose-dependent manner (Fig.
7) In addition, as in the case of rat TP, a large amount was observed on day 4 of culture.
Number of cytoplasmic process for
formation was observed. Meanwhile, including the insert
Transfection of plasmid pEF18S
No TPO activity was detected in the COS1 cell culture supernatant
It was (Fig. 7). In addition, in the M-07e assay system
Also transfected the plasmid pEF18S-A2α
Dose in the culture supernatant of COS1 cells expressed by
M-07e cell growth-promoting activity was observed in a dependent manner.
Transfer the plasmid pEF18S containing no sart
Activity was observed in the treated COS1 cell culture supernatant.
I couldn't. From these results, pEF18S-A2α
Is a gene encoding a protein having TPO activity
It was confirmed that they were supported. Next, this TPO activity
In order to investigate the platelet-increasing effect of
Was. To measure TPO activity in the preparation process, rat CFU-
The MK assay system was used. First, the plasmid pEF18
COS1 cells transfected with S-A2α
For 3 days in a serum-free medium containing 0.2 mg of BSA.
Culturing was performed to obtain about 5.8 L of serum-free culture supernatant. Its serum-free
To the culture supernatant, p-APMSF was added at a final concentration of 1 mM,
Filter the filtrate through a 0.22 μm filter.
Was. This volume 5793 ml (protein concentration 0.229 mg
/ Ml, total protein mass 1326 mg, relative activity 1000,
Relative activity 1326080) per 1000 ml
Add 0.85 moles of NaCl (total 288g)
The final concentration of 0.822M NaCl, 5849 ml
After making a solution, 1M NaCl, 20 mM NaPho
TS previously equilibrated with sphate pH 7.2
K-gel AF-BLUE 650 MH column
-Saw, Catalog No. 08705; Diameter 5 cm, Be
(6 cm height of the head) at a flow rate of 7 ml / min.
After the addition is complete, 20 mM NaPhosphate, 1M
Pass-through (approximately 7900) eluted with NaCl, pH 7.2
ml) and collect it in an ultrafiltration unit (Filtron).
Company, Omega Ultra set molecular weight 8000 cut)
Concentrate and pass through F1 (460 ml, protein concentration 2,
11 mg / ml, total protein mass 973 mg, relative activity 1
6.3) was obtained. Then the eluate was washed with 2M NaSCN.
Eluted TSK-gel AF-BLUE 65
Limit 0MH adsorbed TPO active fraction F2 (2840ml)
External filtration unit (Amicon; YM3 membrane, diameter 76m
m) was used to concentrate to 6.81 ml. This TPO
The total protein content of the active fraction F2 was 12.5 mg.
The protein yield of F2 was 0.62%. Also,
The relative activity of TPO was 240. Next, HiLo
ad 26/60 Superdex 200 pg
Armacia Biotech, Catalog No. 17-10
71-01; diameter 2.6 cm, bed height 60 cm)
Inject it into a ram and apply 50 mM Na at a flow rate of 1 ml / min.
20 mM Na Acetate, pH 5.
Deployed in 5. 2 from 194 ml eluted after the start of development
TPO activity was confirmed in the fractions up to 60 ml.
So, this is put together, Superdex 200p
g TPO active fraction F2 (66 ml, protein concentration 0.1
12 mg / ml, total protein mass 7.41 mg, relative activity 1
42860 and relative activity amount 1058600). Next
And developing solvent A (20 mM Na Acetate, p
H5.5) and developing solvent B (500 mM Nacl
Containing 20 mM Na Phophate, pH 7.2)
Prepared and equilibrated with 100% A strong cation exchange color
RESOURCE S (Pharmacia Biotech)
Co., Ltd., Catalog No. 17-1178-01; diameter 0.
64 cm, bed height 3 cm) column, flow rate 1 ml /
injected at min. Then, flow rate 0.3 ml / min
Then, a straight line from 100% A to 100% B over 40 minutes
It was developed with a concentration gradient. As a result of the assay, a wide range (5
TPO activity is eluted in the range of% B to 32% B)
I found out. Collect the TPO active fractions
External filtration unit (Amicon; YM3 membrane, diameter 25m
m), concentrated, and the TPO active fraction of RESOURCE S
F2 (1.65 ml, protein concentration 4.74 mg / ml,
Total protein mass 7.82 mg, relative activity 71400, relative activity
It was possible to obtain a sex of 558600). Obtained standard
Was not a pure TPO preparation, but rat CFU-M
A sufficiently high activity was confirmed in the K assay system
Therefore, the administration experiment to mice was carried out. That is, the day before administration
ICR mice (9 weeks old;
♂) subcutaneously into the TPO partial purified product (474 μg (100
μl) / mouse / day), BSA (200 μg) as a control
(100 μl) / mouse / day) or T as a control
A buffer with the same composition as the buffer solution in which the PO partially purified product is dissolved
Immersion solution (100 μl / mouse / day) was administered every day for 5 days,
On the 6th day, blood was collected from the heart to measure the platelet count (F80
0; Toa Medical Electronics). In mice treated with partially purified TPO products
2.14 times increase in platelet count on average compared to before administration
Admitted. Also, when comparing between the administration groups, the TPO part
Compared to BSA-administered mice, purified mice
1.74-fold, or compared to mice that received only buffer solution
A total of about 1.90-fold increase in platelet count was observed. As a result
Shows that TPO has an effect of increasing platelets in vivo
It became clear. In addition, TPO partial purified product administration
Im, which is a type of mouse acute-phase protein in mouse
munosuppressive acidic pro
Was there no increase in tein (IAP)?
TPO showed that IL-6 and I were involved in the induction of acute phase proteins.
It was strongly suggested that the personality was different from that of L-11. <Example 12> Detection of TPO mRNA in various rat tissues
To confirm whether it is expressed, various rat tissues are used.
RNA was extracted. As described in Example 1
Similarly, on the 11th to 14th day after the X-ray irradiation,
Various tissues from 6 rats (brain, thymus, lung, liver, heart, spleen)
Promptly remove the internal organs (small intestine, renal gland, testis and bone marrow cells)
Frozen with liquid nitrogen. RNA isolation for total RNA extraction
The reagent ISOGEN (Wako Pure Chemical Industries, Ltd.) was used. Frozen
Add the amount of ISOGEN reagent according to the weight of the tissue,
Genizer (Hiscotron; Nichine Medical Instrumentation Co., Ltd .; N)
S-60) until the tissue is completely disrupted (and
After processing at 10000 RPM for 45 to 60 seconds, all R
An NA extraction procedure was performed (Chomczynski et al.
Acid Guanidium Phenol Chr
Extraction method based on oloform method: Anal. Bio
chem. ,162156-159, 1987
See). As a result, 1.1 mg to 5.
6 mg of total RNA was obtained. Poly (A) from total RNA
⁺Purification of RNA is performed by Oligotex^TM-DT30
(Super) (Nippon Synthetic Rubber / Nippon Roche)
20 μg of total RNA from about 500 μg
(A)⁺RNA was obtained. Poly (A) of various tissues obtained
⁺Random primer is used from 1 μg of each RNA
Then, the first strand of the cDNA was synthesized. Poly (A)⁺RN
Dissolve 1 μg of A in 10 μl of sterilized water at 70 ° C for 15 minutes
75 pmole random primer
(Manufactured by Takara Shuzo), 10U RNase Inhibit
or (Boehringer Mannheim), 50 mM Tr
is-Hcl (pH 8.3), 75 mM KCl, 3 m
M MgCl₂, 200U SuperScript
^TMII (Life Technologies reverse transcriptase)
Add each reagent (total volume 20 μl), and incubate at 37 ℃
It was kept warm for 1 hour. Ferment the reaction solution by heating it at 70 ℃ for 10 minutes.
After deactivating the element, it was stored at -20 ° C until use. Implementation
New from the rat TPO cDNA sequence obtained in Example 10.
A PCR primer was synthesized. Synthesized primer
The array of is as follows.Use 0.1 volume of each synthesized cDNA reaction solution as template
Primers synthesized here (rTPO-I, rTPO
PCR was performed using 1 μM each of —N). G
eneAmp^TMPCR Reagent Kit W
it AmpliTaq^TMDNA Polymer
GeneAmp using asase (Takara Shuzo)^TMP
CR System 9600 (PERKIN-ELM
PCR reaction (95 μm) by ER) in a volume of 100 μl.
After heating at ℃ for 2 minutes, denaturing condition at 95 ℃ for 1 minute, 57 ℃
1 minute annealing condition, 72 ° C 1 minute synthesis condition
Perform the reaction 30 times and incubate at 72 ° C for another 7 minutes.
I went). The reaction solution obtained here was mixed with 2% agaro.
Sugel (made by FMC BioProducts)
The amplified band was observed by electrophoresis.
Filter, which is considered to be specific to the brain, liver, small intestine, and kidney.
Was observed. Judgment of expression level based on this result
No, but in rats TPOmR
It was considered that NA was expressed. The same applies to people
Although it is suggested that the expression pattern is shown, the results are not consistent with those of Example 4.
Considering this, the liver is used to obtain human TPO cDNA.
Was determined to be suitable as a starting material. <Example 13> Construction of human normal liver-derived cDNA library From the results of Example 12, the liver was cloned into human TPO cDNA.
Choose from commercially available normal human liver
Poly (A)⁺RNA (manufactured by Clontech: chom
Acid Guanidium P by czynski et al.
Extraction based on the henol Chloroform method
5 μg was used in the same manner as in Example 7.
ver^TMcDNA Synthesis Kit
(Pharmacia) and DIRECTION
AL CLONING TOOLBOX (Pharm
Aca), and EcoRI at the 5'end, 3 '
A double-stranded cDNA having a NotI recognition site at the end was synthesized.
Was. The synthesized cDNA had 1.2 μg of EcoRI and
And the expression vector pEF18S treated with NotI
And 8.4 ml of Competent High E. col
i DH5 (manufactured by Toyobo Co., Ltd.) was transformed. That conclusion
Fruit, 1.2 × 10⁶Individual transformants were obtained. <Example 14> Acquisition of human TPO cDNA fragment by PCR (Kuroni
Commercially available normal human liver-derived poly (A)⁺RNA (Clon
(manufactured by tech) using a random primer from 1 μg
To synthesize the first strand of the cDNA. Poly (A)⁺RNA
Dissolve 1 μg in 10 μl sterile water and add at 70 ° C for 15 minutes.
After warming and quenching, 75pmole random primer (Treasure
Sake Brewing Company) 10U RNase Inhibitor
(Manufactured by Boehringer Mannheim), 50 mM Tris
-HCl (pH 8.3), 75 mM KCl, 3 mM
MgCl₂, 200U Super Script^TM
II (made by Life Technology Co., Ltd.)
Reagent (total volume 20 μl) and incubate at 37 ° C for 1 hour
Was. The reaction solution was heated at 70 ° C for 10 minutes to inactivate the enzyme.
After that, it was stored at -20 ° C until use. Rat TPOcDN
A PCR primer was synthesized from the A sequence (SEQ ID NO: 2).
Was. The primer sequences are as follows. Here, 0.1 volume of the synthesized cDNA reaction solution was used as a template.
Synthesized primers (rTPO-AIN, rTPO-
PCR was performed using 1 μM each of N). Ge
neAmp^TMPCR Reagent Kit wi
th AmpliTaq^TMDNA Polymer
GeneAmp using se (Takara Shuzo)^TMP
CR System 9600 (PERKIN-ELM
PCR reaction (95 μm) by ER) in a volume of 100 μl.
After heating at ℃ for 2 minutes, denaturing condition at 95 ℃ for 1 minute, 40 ℃
1 minute annealing condition, 72 ° C 1 minute synthesis condition
Perform the reaction 35 times and incubate at 72 ° C for an additional 7 minutes.
I went). The reaction solution obtained here was mixed with 2% agaro.
Sugel (made by FMC BioProducts)
Subject to electrophoresis and is the major product of this PCR reaction
A DNA fragment of about 620 bp was isolated and separated by prep-A-di
DNA purification kit (manufactured by Bio-Rad)
Made. This purified DNA fragment was designated Taq Dye D
eoxy^TMTerminator Cycle Se
Quinging Kit (Applied Biosystems
Manufactured by Applied Biosystems Co., Ltd. 37
3A DNA sequencer for direct sequencing and salt
The base sequence was determined. Nucleotide sequence excluding primer and
And the deduced amino acid sequence from the sequence listing (SEQ ID NO:
It is shown in 3). This DNA fragment excludes the primer sequence
And a rat cDNA base sequence having a length of 580 bp
As a result of comparison, it was found that they have 86% homology.
The DN that encodes a part of human TPO cDNA
It was considered to be the A fragment. <Example 15> Screening of human TPO cDNA by PCR method PC corresponding to human TPO based on Sequence Listing-SEQ ID NO: 3
The R primer was synthesized. The sequence is as follows.Human cDNA library constructed in Example 13
A pool of approximately 100,000 clones into one population
Divided into 50 μg / ml Ampicillin
After overnight culture in 1 ml of LB medium,
Motion Separation Device PI-100 (Kurashiki Spinning Company, VER-3.
0) was used to extract the plasmid DNA. Extracted D
NA was dissolved in the TE solution. Cast 5% of the extracted DNA
Used as a template and synthesized primers (hTPO-I,
PCR was performed using 1 μM each of hTPO-J)
Was. GeneAmp^TMPCR Reagent Ki
t with AmpliTaq^TMDNAPolym
Using Genease (manufactured by Takara Shuzo Co., Ltd.)
^TMPCRSystem 9600 (PERKIN-E
PCR reaction (9 with LMER) in a volume of 20 μl
Denaturation conditions at 5 ° C for 1 minute, annealing conditions at 59 ° C for 1 minute
In this case, the reaction was performed 35 times under the synthesis condition of 72 ° C. for 1 minute,
Incubation at 72 ° C for 7 minutes)
Bands considered to be specific were detected in 3 out of 90 pools.
Was issued. Choose one of these pools
Divided into loan pools and plasmid D from 90 pools
NA was purified and PCR was performed again under the same conditions. So
As a result, bands were detected in 5 pools. These
Select 1 pool and set 250 clones as 1 pool
Sub-pool and plasmid D for 90 pools
NA was extracted. PCR is performed on these in the same manner.
As a result, bands were observed in 3 pools. Than these
Select 1 pool and set 30 clones as 1 pool.
Make a pool and purify the plasmid DNA from the 90 pool.
As a result of the production and PCR, bands were observed in 3 pools
Was done. Choose one of these pools to obtain 50 μg / ml
Sprinkle on LB plate containing Ampicillin, 90
Similarly, plasmid DNA was extracted from each colony.
As a result of confirmation by PCR, clone H was finally obtained.
L34 was obtained. Example 16 Sequence of human TPO cDNA Purification of plasmid DNA is essentially Molecular
 Cloning [Sambrook et al., Cold
Spring Harbor Laboratory
Press (1989)].
Carried out. Clone HL34 with 50 μg / ml Amp
Cultured overnight in 50 ml of LB medium containing icilin
Then, the bacterial cells obtained by centrifugation were treated with 4 ml of TEG-lys.
Suspended in ozyme solution, 8 ml 0.2N NaOH
Add 1% SDS solution and suspend well. 3M more
6m potassium / 5M acetate solution
l and well suspended, then centrifuged to obtain a supernatant. The supernatant is
After treatment with ethanol-chloroform (1: 1), an equal volume of iso
Propanol was added and the mixture was centrifuged to obtain a pellet. Peret
After dissolving in TE solution, RNAse treatment, phenol-
Chloroform (1: 1) treatment and ethanol precipitation
To do. The pellet is redissolved in TE solution, NaCl,
0.63 each of polyethylene glycol 3000
Add M to 7.5% and centrifuge. Finally,
Lett dissolve in TE solution and then perform ethanol precipitation. This
This gave approximately 300 μg of plasmid DNA pEF18
S-HL34 was obtained. For the purified plasmid DNA
Taq Dye Deoxy^TMTerminate
r Cycle Sequencing Kit
Applied Bio)
System 373A DNA sequencer
Sequenced and the full-length nucleotide sequence was determined. Base sequence
And the amino acid sequence deduced from it
No. 4). The primers required for nucleotide sequencing are
The primer synthesized based on the sequence of row No. 3 and its
Analyzed by sequencing reaction with these primers
A synthetic primer designed based on the internal sequence was used.
As a result, the obtained plasmid clone pEF18S-
HL34 contains a 861 base pair cDNA fragment,
Partial amino acid sequence AP8 of rat TPO analyzed in 2
(SEQ ID NO: 4: amino acid numbers 1 to 12) and TP2 / T
Phase with P3 (SEQ ID NO: 4: amino acid numbers 157 to 162)
A highly homologous sequence was confirmed. This DNA fragment contains 25
Code the open reading frame starting from the base
Although there is no stop codon at the 3'end
Had a poly A tail-like sequence consisting of 76 bases. Po
The 253 amino acid sequence immediately before the A tail-like sequence is
Of TPO cDNA (of 147 residues of SEQ ID NO: 2
84% homology with the amino acid sequence part)
Part of the human cDNA corresponding to rat TPO
It was considered to be a coding DNA fragment. No stop codon
Since it had a poly A tail-like sequence at the 3'end,
The clone does not reflect the complete cDNA and is c
Suggested to be an artifact of DNA library production
Was done. <Example 17> Expression of human TPO cDNA in COS1 cells-confirmation of activity C of the obtained plasmid clone pEF18-HL34
Transfection of OS 1 cells is described in Example 11
According to. That is, 10 μg of plasmid DNA
DEAE-dextran method using chloroquine treatment
For 3 days to 5 days
After a day, the culture supernatant was collected. The obtained culture supernatant is IMD
After sufficient dialysis against M culture solution, rat CFU-MK
It was evaluated by the essay system. As a result, pEF18S-HL3
COS1 cells expressed by transfection of 4
TPO activity was observed in the culture supernatant in a dose-dependent manner (Fig.
8) Also, on the 4th day of culture, protrusion formation by many megakaryocytes
Was observed. On the other hand, expression plus without insert
Mido-transfected COS1 cell culture supernatant
No activity was observed in (Fig. 8). Also, M-07
In the e assay system, pEF18S-HL34 was also
COS1 cell culture supernatant expressed by transfection
Only, the M-07e cell growth promoting activity was observed. this
From these results, pEF18S-HL34 showed TPO activity.
Is responsible for the gene cDNA fragment that encodes the protein
It turned out to have. In addition, human TPO is rat
It was also revealed that it also acts on (no species-specificity)
Was. <Example 18> Expression of human TPO-deficient cDNA-confirmation of activity Human TPOc of clone HL34 obtained in Example 15
The DNA has a poly A tail-like continuous adenylation sequence on its 3'side.
The rat TPOcDN
Not seen in A, suggesting that it may be an experimental artifact
It was Therefore, this poly-A tail-like continuous adenine distribution
The cDNA that was created by deleting the sequence was
It was examined whether it showed activity as TPO. For making deletions
Used PCR. Sequences of PCR primers are shown in Table 9.
Shown in. Addition of restriction enzyme recognition sequence to each 5'end
Yes (EcoRI for hTPO5 and hTPO3
With NotI and two stop codons TAATGA
Added).

[Table 9] Plasmid clone pEF18S obtained in Example 16
PCR was performed using 1 μg of HL34 plasmid DNA as template and 10 μM each of the synthesized primers (hTPO5, hTPO3). GeneAmp
^TM PCR Reagent Kit with Am
GeneAmp ^™ PCR Sys using pliTaq ^™ DNA Polymerase (Takara Shuzo)
PCR reaction (denaturation condition at 95 ° C. for 1 minute, annealing condition at 65 ° C. for 1 minute, 72 ° C.
The reaction was performed 15 times under the synthetic condition of 7 minutes, and then for 7 minutes 7
Incubation at 2 ° C.). About 800b obtained
The expression vector pEF obtained by digesting the p band with the restriction enzymes EcoRI and NotI and purifying the same, and similarly treating it with the restriction enzymes.
Subcloned into 18S. From the obtained transformants, 5 clones containing a DNA fragment of about 800 bp were selected and a large amount of plasmid DNA was prepared (see Example 5 for the method). For each plasmid, the nucleotide sequence was determined for the entire region of about 800 bp amplified by PCR, and the nucleotide sequence analyzed in Example 16 (SEQ ID NO: 4).
1-780) of the above.
This plasmid clone was named pHT1-231. Vector pHT1-23 carried on E. coli DH5
1 was submitted to the Ministry of International Trade and Industry, Agency of Industrial Science and Technology, Institute of Bioengineering and Industrial Technology on February 14, 1994, under the contract number FERM BP-45.
Deposited as 64. This is also March 22, 1995
It was deposited at the Food Industry Development Institute of the Republic of China (FIRDI) with the deposit number 940082 on the date. Expression of the obtained plasmid in COS1 cells was performed according to Example 11. That is, 10 μg of each plasmid DNA was used for transfection using the DEAE-dextran method including chloroquine treatment, and the culture supernatant was recovered after 3 to 5 days. The obtained culture supernatant was dialyzed against IMDM culture medium and evaluated by the rat CFU-MK assay system. As a result, TPO activity was observed in the COS1 cell culture supernatant expressed by transfection with pHT1-231 (FIG. 9), and protrusion formation by a large number of megakaryocytes was observed on day 4 of culture. On the other hand, no activity was observed in the COS1 cell culture supernatant transfected with the expression plasmid containing no cDNA insert (FIG. 9). In addition, in the M-07e assay system, the pH
C expressed by transfection with T1-231
M-07e cell growth promoting activity was observed only in the OS1 cell culture supernatant. From these results, it became clear that the cDNA fragment contained in pHT1-231 is a gene encoding a protein having TPO activity. <Example 19> Cloning of human TPOC terminal region by PCR Human TPOc of clone HL34 obtained in Example 15
The DNA has a poly A tail-like sequence at its 3'end, suggesting that the 3'portion is an incomplete clone. Therefore, an attempt was made to obtain the full-length 3'region by PCR. From the nucleotide sequence determined in Example 16, PC
Four kinds of 5'-side primers for R were synthesized.

[Table 10] As the 3'-side primer, the following primer containing 4 bases of mix nucleotides at the 3'-end was synthesized in expectation of amplification immediately after the poly A portion. In addition, an anchor primer containing no mix part was also synthesized.

[Table 11]Human normal liver-derived poly (A) as in Example 14.⁺RN
1 μg of cDNA from 1 μg of A (Clontech)
The main chain was synthesized. However, as a primer, oligo
dT primer (TimeS manufactured by Pharmacia)
aver^TMcDNA Synthesis Kit
0.5 μg) attached to the above was used. cDNA synthesis
1st PCR using 0.1 volume of reaction solution
did. GeneAmp for PCR^TMPCR Reag
ent Kit with AmpliTaq^TMDN
A Polymerase (Takara Shuzo) and
GeneAmp^TMPCR System 9600
(Manufactured by PERKIN-ELMER) was used. Primer
HTPO-H (20 μM) and hTPO3mix
The reaction was performed in a volume of 50 μl using (10 μM)
(96 ° C for 2 minutes, 96 ° C for 1 minute / 48 ° C for 1 minute
/ 72 ℃ 1 minute react for 10 cycles, 72 more
℃ 7 minutes). 0.1 volume of the first reaction solution as a template
A second PCR was performed. HTPO- for the primer
Using K (20 μM) and hTPO3mix (10 μM)
Reaction at a volume of 50 μl (96 ° C. for 2 minutes)
Later, 96 ℃ 1 minute / 63 ℃ 1 minute / 72 ℃ 1 minute
For 10 cycles, and 72 ° C for 7 minutes). 2
PCR of the third time using 0.1 volume of the reaction solution of the second time as a template
I did. HTPO-N (20 μM) and primer
And hTPO3mix (10 μM) in a volume of 50 μl
The reaction was carried out in an amount (96 ° C. for 2 minutes, then 96 ° C.
1 cycle / 63 ℃ 1 minute / 72 ℃ 1 minute 10 cycles
Reaction at 72 ° C for 7 minutes). Of the third reaction
The fourth PCR was performed using 0.1 volume as a template. Plastic
HTPO-O (20 μM) and hTPO3m for immers
Perform the reaction in a volume of 50 μl using ix (10 μM)
(96 ° C for 2 minutes, 96 ° C for 1 minute / 63 ° C 1
Min / 72 ° C 1 minute 10 cycles, 7 more
2 ° C for 1 minute). Using 0.1 volume of the 4th reaction mixture as a template
The fifth PCR was performed. HTPO- for the primer
O (20 μM) and hTPO3 anchor (20 μM
M) was used to carry out the reaction in a volume of 50 μl (96 ° C.
 After 2 minutes, 96 ° C for 1 minute / 58 ° C for 1 minute / 7
10 cycles of 2 minutes 1 minute, 72 ℃
Minutes). The reaction solution obtained here was mixed with 2% agarose gel.
Electricity using (manufactured by FMC BioProducts)
About 600, which is the main product of this PCR reaction
The bp DNA fragment was isolated and prep-A-gene DN
It was purified using an A purification kit (manufactured by Bio-Rad).
This purified DNA fragment was used as TaqDye Deoxy
^TMTerminator Cycle Sequen
ing Kit (manufactured by Applied Biosystems)
Using Applied Biosystems 373AD
Sequenced directly by NA sequencer
It was determined. Nucleotide sequence and amino deduced from it
The acid sequence is shown in the sequence listing (SEQ ID NO: 5). This DNA break
One piece is 130 amino acids starting with primer hTPO-O.
It has a base sequence that encodes an acid, and further on the 3'side
Sequences of 180 bases or more continued (after the 577th base)
Could not be deciphered). Encoded by this DNA fragment
The 30 amino acid sequence starting with glycine is SEQ ID NO: 4.
The amino acid sequence of amino acid numbers 203 to 232 described
Matched. At the same time, the nucleotide sequences from 1st to 94th are also distributed.
It was consistent with that of column number 4, 692-785. Implementation
Analysis of cDNA fragment of Example 17 and PCR amplified fragment of this Example
From the results of the analysis of
The TPO protein contains a 21-residue signal sequence.
It is estimated to consist of 3 amino acids. The sequence number
The mature protein portion of the human TPO protein shown in 6
The amino acid sequence corresponding to
Was. <Example 20> Reconstruction of human normal liver-derived cDNA library The clone HL34 obtained in Example 15 was an open library.
3'end without the stop codon in the reading frame
It has a poly-A tail-like sequence at the end and is useful for cDNA synthesis.
Since it was considered to be an artifact, a new commercial
Poly (A) derived from normal human liver⁺RNA (Clontech
Rebuild cDNA library using 5 μg)
did. For the synthesis of cDNA, SuperScript^TM
Lambda System for cDNA Sy
nthesis and λ Cloning Kit
Bini SuperScript^TMII RNaseH-
(Both made by LIFE TECHNOLOGIES)
used. Poly (A)⁺After denaturing RNA by heat, attach it to Kit
Includes oligo dT with NotI sequence of the genus as a primer
20 μl of reaction solution (50 mM Tris-HCl, p
H8.3 / 75 mM KCl / 3 mM MgCl₂/ 1m
M DTT / 1mM dNTP / 200U SuperS
script^TMII RNase H-), 37 ° C
And kept warm for 60 minutes. Synthesize the second strand of cDNA (25
mM Tris-HCl, pH 8.3, 100 mM K
Cl, 5 mM MgCl₂, Each 250 μM dNTP
5 mM DTT, 40 U E.S. coli DNA
polymerase I, 2U E. coli RN
aseH, 10U E. coli DNA ligas
(Incubate at 16 ° C for 2 hours in 150 μl reaction solution containing e)
Then, 10 U T4 DNA polymerase was added.
Furthermore, the temperature was kept at 16 ° C. for 5 minutes. Reaction mixture at 65 ℃ 1
After heating for 0 minutes, extract once with an equal volume of phenol-chloroform.
Out, SizeSep^TM400 spun colu
mn (Pharmacia's TimeSaver
^TMLow attached to cDNA Synthesis Kit
400 bp by span column for removing molecular weight DNA)
The smaller cDNA was removed. EcoR for this sample
I Adapter (Tim manufactured by Pharmacia)
eSaver^TMcDNA Synthesis Ki
(attached to t) was added and digested with the restriction enzyme NotI.
Things again, SizeSep^TM400 spun c
Low molecular weight DNA was removed by lysis. this
Obtained by EcoRI at the 5'end and No at the 3'end
Double-stranded cDNA with tI recognition sequence is 1.3μ each
g, which was previously treated with EcoRI and NotI
It was ligated with the current vector pEF18S and the
Pitent High E. coli DH5 (manufactured by Toyobo Co., Ltd.)
Was transformed. As a result, the obtained human liver cDNA
Library (hTPO-F1) is 1.0 x 10⁶Of
It contained a transformant. <Example 21> From human liver cDNA library hTPO-F1
Screening of TPO cDNA clone Human TPO cDNA based on Sequence Listing-SEQ ID NOS: 3 and 6
A PCR primer corresponding to was synthesized. The array is
Street Human liver cDNA library constructed in Example 20
Lee hTPO-F1 (1.0 x 10⁶3) Pooh
(# 1 to 3) and stored frozen. Each pooh
Plasmid DNA was prepared from the
And synthesized primers (hTPO-I and hTPO-
KU) PCR was performed using 1 μM each. GeneA
mp^TMPCR Reagent Kit with
AmpliTaq^TMDNA Polymerase
Using (Takara Shuzo), GeneAmp^TMPCR
 System 9600 (PERKIN-ELMER
PCR in a volume of 100 μl (1 minute at 95 ° C)
Between denaturing conditions, 59 ° C for 1 minute annealing conditions, 72 ° C
The reaction was repeated 35 times under the synthetic conditions of 1 minute, and then for 7 minutes.
Incubation at 72 ° C)
Of the expected size when using plasmid DNA derived from
The DNA of Kisa was amplified. So, this pool # 3
Divided into 15,000 subpools, 50 μg / ml
1 in 1 ml LB medium containing Ampicillin
After culturing at night, use the automatic plasmid separator PI-100
Was used to extract plasmid DNA. The extracted DNA is
Dissolve in TE solution and perform PCR using 5% of it as template
(The used primers and reaction conditions were the same as above.
). As a result, 6 pools out of 90 are expected to be large
The DNA of Kisa was amplified. Select one of these pools
Subpool with 1000 clones selected as one group
And prepare plasmid DNA as described above,
CR was performed, but no amplification of DNA was observed. one
Of electrophoretic bands of DNA amplified by a series of PCRs
The density gets thinner as the sub-pool becomes finer.
Came. Therefore, the desired clones did not grow well.
Therefore, recovery of plasmid DNA is poor, and amplification by PCR is
It is thought that it became weak
Was. So we went back to the pool # 3 and colony hybrid dye
We decided to carry out screening by zeation.
41 per 15 cm LB plate from pool # 3
Spread the clones so that there are 00 colonies, and
A number of plates were made. For each plate
Make replica plates one by one, and choose one of them
Incubate the plate at 37 ° C for a further 6 hours before
Was recovered and the plasmid DNA was extracted. These DN
When PCR similar to the above was carried out for A, 10
Amplification of band of expected size in 1 out of 0 pool
Was observed. So, from this pool plate,
A replica filter was manufactured (BIOD manufactured by PALL)
YNE^TMA TRANSFER MEMBRANE
use). Denaturation of the filter is 10% SDS for 10 minutes,
0.5N NaOH / 1.5M NaCl for 10 minutes,
0.5M Tris-HCl (pH8.0) /1.5M
 NaCI for 10 minutes, air dry for 30 minutes
Bake in vacuum oven for 1 hour. Baking
The filter is 6 x SSC (20 x SSC is 1 in 1 l)
75.3g NaCl, containing 88.2g, pH 7.0
Liquid) / 1% SDS, lightly wash, and then pre-hybridize
I made an option. The composition of the reaction solution is 50% formami
Do, 5xSSC, 5xDenhardt's solu
section (50 × Denhardt's soluti
on is 5g Ficoll, 5g po in 500ml
lyvinylpyrrolidone, 5g bov
ine serum albumin fraction
solution containing nV), 1% SDS, 20 μg / ml salmon
Contains sperm DNA at 42 ° C 3 in 30 ml of solution
Incubated with shaking for 0 minutes. Pre-hybridization
Solution, and then the hybridization solution of the same composition.
After replacing with 30 ml of liquid, [α-³²P] dCTP (Amashi
Radiolabeled probe (plasmid pEF)
18S-HL34 EcoRI / BamHI fragment: Sequence
No. 4, purified from the 5'end to the 458th base,
Labeled by the dam primer method; Anal. Bioc
hem. , 132, 6-13, 1983.
Used Amersham kit Megaprime DN
Add A labeling system)
Then, it was kept warm while shaking at 42 ° C. for 20 hours. filter
-In a 2 x SSC / 0.1% SDS solution at 42 ° C for 30 minutes
After washing for a while, 0.2 × SSC / 0.1% SDS solution
Washed in 42 ° C for 30 minutes. Filter enhancement screen
And X-OMATTM AR5 film (Eastma
Auto-radio at -70 ° C for 16 hours by Nkodak
A graph was taken. As a result, positive
One gnoll was observed. So from the original plate
Scrap the colony around the signal and remove the 10 cm LB
I re-rated the rate. Cultivate 50 colonies obtained
After preparing DNA, primers hTPO-I and hTPO
-PCR was performed using KU (conditions are the same as above)
one). As a result, only one clone had more bands as expected.
Was widened. This clone was named pHTF1. <Example 22> Sequence of human TPO cDNA clone pHTF1
Purification of plasmid DNA is essentially molecular
 Cloning [Sambrook et al., Cold S
pring Harbor Laboratory P
[ress (1989)].
gave. Clone pHTF1 with 50 μg / ml Amp
Incubate in 50 ml LB medium containing icillin overnight
Then, the bacterial cells obtained by centrifugation were treated with 4 ml of TEG-ly.
Suspended in sozyme solution, 8 ml 0.2N NaO
Add H / 1% SDS solution and suspend well. 3M more
 Potassium / 5M acetate solution 6
After adding ml and suspending well, centrifugation is performed to obtain a supernatant. The supernatant is
After treatment with phenol-chloroform (1: 1)
Sopropanol was added and the mixture was centrifuged to obtain a pellet. Pele
After dissolving in TE solution, RNAse treatment, phenol
-Chloroform (1: 1) treatment and ethanol precipitation
Perform Dissolve the pellet in TE solution again and
l, polyethylene glycol 3000 each 0.6
Add 3 M, 7.5% and centrifuge. Finally,
The pellet is dissolved in TE solution and then ethanol precipitated.
This gives approximately 300 μg of plasmid DNA pHTF1
Got For purified plasmid DNA Taq D
ye Deoxy^TMTerminator Cycle
e Sequencing Kit (Applied Bio
Applied Biosystems, Inc.
Sequenced by 373A DNA Sequencer
Then, the full length base sequence was determined. Nucleotide sequence and
The deduced amino acid sequence is shown in the sequence listing (SEQ ID NO: 7).
did. The primer required for nucleotide sequence determination is SEQ ID NO: 6.
Primers synthesized based on sequences and their primers
The internal sequence analyzed by the sequencer reaction by Immer
Originally designed synthetic primers were used. as a result,
The resulting clone pHTF1 has 1721 base pairs of cDNA.
Amino acid sequence A, which consists of the A fragment and was analyzed in Example 2.
P8 (SEQ ID NO: 7: amino acid numbers 1 to 12) and TP2
/ TP3 (SEQ ID NO: 7: amino acid numbers 157 to 162)
A highly homologous sequence was confirmed. This DNA fragment
Following the 5'non-coding region up to the 101st base,
Starting with the methionine encoded at the 102nd to 104th bases
Glycine encoded at bases 1158 to 1160
Open reading consisting of 353 amino acids
Frame code, and the subsequent
3'non-coding region after the stop codon (TAA)
It had 531 bases and 30 poly A tail sequences. This
Thought to be coded in the open reading frame of
The amino acid sequence of the protein is shown in SEQ ID NO: 6.
Perfectly matches the predicted amino acid sequence of human TPO
did. The nucleotide sequence is 77 salts on the 5'side of the sequence of SEQ ID NO: 6.
347 in the region just before the poly A tail sequence on the 3'side
It encoded a cDNA with a long base. Also the base sequence
Was different from SEQ ID NO: 6 at 3 positions. Different base arrangement
In the sequence, A (84th base) of SEQ ID NO: 7 is SEQ ID NO: 6
C, A (740th base) is T, G (1198th base)
It was A. Only the second base (740th base)
Although it was a mutation in the coding region of the protein,
It is the third codon of nin, and amino acid conversion has occurred.
There wasn't. What is the cause of this base sequence substitution?
It was not clear at the time point of
From the analysis of TF1, the human TPO protein has 21 residues.
Consist of 353 amino acids including the signal sequence
It could be confirmed. Estimated amount of protein excluding signal sequence
The offspring amount was 35466. Supported on Escherichia coli DH5
Vector pHTF1 is traded as of March 24, 1994
Entrusted number F to the Institute of Biotechnology, Industrial Technology Institute, Ministry of Industry
Deposited as ERM BP-4617. This is also
Republic of China food industry development research on March 22, 1995
Deposited under the deposit number 940085 at the FIRDI
Was. <Example 23> COS1 cells of human TPO cDNA clone pHTF1
Expression-Activity Confirmation of Transcription of Clone pHTF1 Obtained into COS1 Cells
Sfection was performed according to Example 11. sand
Chloroquine treatment using 10 μg of plasmid DNA
Transfection using the DEAE-dextran method with
And the culture supernatant was collected after 3 days. Got
After dialysis of the obtained culture supernatant against IMDM culture solution,
It was evaluated by the CFU-MK assay system. As a result, pHT
Dose-dependent in COS1 cell culture supernatant expressing F1
TPO activity was observed in the
CO transfected with the expression plasmid
No activity was observed in the S1 culture supernatant (FIG. 10).
a). Similar results were obtained with the M-07e assay system.
The obtained COS1 cell culture supernatant expressing pHTF1
A significant M-07e cell proliferation-promoting activity was observed in the (FIG. 1
0b). From these results, the cD contained in pHTF1
NA is a gene encoding a protein having TPO activity
It became clear that he was a child. <Example 24> Cloning of human TPO chromosome DNA Human TPO chromosome using human TPO cDNA as a probe
DNA was cloned. Used for cloning
The genomic library
Professor Norio Yamamoto (Sakai et al., J.B.
iol. Chem. 269, 2173-2182, 1
The library described in 994 was used to control human chromosomal DNA.
The one partially digested by the restriction enzyme Sau3AI is Str
atagene's phage vector Lambda E
Library constructed by connecting to BamHI site of MBL3
Lee). Human TPO cDNA was prepared from this library.
Screening was performed as a lobe, but the method used
Is essentially Molecular Cloning
[Sambrook et al., Cold Spring Har
bor Laboratory Press (198
9)]. E. coli L
15 cm NZYM plate using E392 as a host bacterium
(10g NZamine in 1 liter, 5g Nacl,
5g bacto yeast extract, 2g
 MgCl_Four7H₂O, containing 15% agar. pH
7.0) Phage so that there will be 30,000 per plate
And 18 plates were prepared. Each pre
Two replica filters were prepared from each sheet (PA
BIODYNE made by LL^TMA TRANSFER M
Using EMBRANE). Filter denaturation is 0.5N
 NaOH / 1.5M NaCl 10 minutes, 0.5M
 Tris-HCl (pH 8.0) /1.5M NaC
l Perform 10 minutes, air dry for 30 minutes, and vacuum at 80 ° C.
Bake for 1.5 hours in a bun. Pre-hybrid
Zeation is 50% formamide, 5xSSC, 5xD
enhancet's solution, 1% SDS,
500 ml solution containing 20 μg / ml salmon sperm DNA
At 42 ° C for 1 hour. The probe is human TPOcD
NA fragment (base sequence number 178-102 of sequence number 7)
Random P was obtained by purifying 5) after amplification by PCR.
rimer DNA labeling kit
Sake Brewing Co .; Anal Biochem. , 132, 6-
13, the random primer method described in 1983 is used.
DNA labeling kit)³²Use the one labeled P
I was there. The sequences of the primers used for PCR are as follows.
RHybridization is pre-hybridization
Using 500 ml of a solution with the same composition as
A lobe was added and the reaction was carried out at 42 ° C for 20 hours. The filter is
5 minutes at room temperature in 2 x SSC / 0.1% SDS solution 3
After washing twice, 6 in 1.1 × SSC / 0.1% SDS solution
After washing at 8 ° C for 1 hour, the intensifying screen and
X-OMAT^TMAR5 film (Eastman Kodak
Autoradiography at -70 ° C for 16 hours
-I did it. As a result, 13 positive signals were obtained.
It was Around the 13 positive signals from the original plate
Pick up the plaque, one 15 cm NZYM plate
Re-rolled to 1000 plaques. That
Make two replica filters from each plate
And perform hybridization under the same conditions as above.
Was. As a result, a positive signal was obtained with all 13 filters.
Was detected. Isolate one plaque from each plate
And Pl as described in Molecular Cloning
Phage DNA was prepared by the ate Lysate method.
About the clone DNA of 13 clones
Check whether it contains the coding region by PCR.
I checked. The sequences of the primers used for the check are as follows.
As below.PCR was performed with a combination of these primers.
By the way, 5 out of 13 clones
Contains all predicted amino acid coding regions
Was thought to be. Chromosome D contained in these 5 clones
The length of NA is about 20 kbp, and the preliminary inspection
The restriction enzyme analysis discussed showed almost the same pattern.
So one of these clones (clone λHGT
Select 1) and perform Southern blot analysis.
It was. That is, 1 μg of each DNA of clone λHGT1
Completely with the restriction enzymes EcoRI or HindIII.
And then run on a 0.8% agarose gel, then manufactured by PALL
BIODYNE^TMA TRANSFER MEMBR
Transferred to ANE. Filter is air dried for 30 minutes at 80 ℃
Baked in a vacuum oven for 2 hours. Prehive
Redidation is 50% formamide, 5xSSC,
5x Denhardt's solution, 1% S
50 ml of DS, containing 20 μg / ml salmon sperm DNA
It was carried out at 42 ° C. for 1 hour in the solution. The probe is human TPO
cDNA fragment (base sequence number 178-10 of sequence number 7)
Random was obtained by purifying 25) after amplification by PCR.
Primer DNA labeling kit
Using (manufactured by Takara Shuzo)³²Use the one labeled with P
Was. Hybridization is pre-hybridization
Radiolabeled with 50 ml of the same composition as
A probe was added and the reaction was carried out at 42 ° C for 20 hours. filter
For 5 minutes at room temperature in 2x SSC / 0.1% SDS solution
After washing 3 times, in 0.1 x SSC / 0.1% SDS solution
After washing at 68 ° C for 1 hour, the intensifying screen and
And X-OMATTM AR5 film (Eastman Koda
Autoradiograph at -70 ° C for 16 hours
I did it. As a result, with the restriction enzyme HindIII
When digested, a single band of about 10 kbp was observed
Was. Therefore, control 10 μg of DNA of clone λHGT1.
0.8% agarose gel after digestion with HindIII restriction enzyme
Electrophoresis at 10 bp and cut out the 10 kbp band
-A-gene DNA purification kit (Bio-Rad)
Cloning purified and similarly digested with HindIII
Substituting into vector pUC13 (Pharmacia)
Cloned (host fungus is Competent manufactured by Toyobo Co., Ltd.
・ High E. E. coli DH5 was used). Obtained
Includes a 10 kbp HindIII fragment of the loan
A clone was selected and named pHGT1. Phage black
Figure 11 shows a rough restriction map of λHGT1.
You <Example 25> Sequence of human TPO chromosome clone pHGT1 The pHGT1 clone was cultured to purify the plasmid DNA.
I did. The method is essentially Molecular Clo
ning [Sambrook et al., Cold Spring
g Harbor Laboratory Press
(1989)].
50 μg / ml Ampicil of clone pHGT1
After culturing in 50 ml of LB medium containing lin overnight,
The bacterial cells obtained by heart separation were treated with 4 ml of TEG-lysozy.
suspended in me solution, 8 ml 0.2N NaOH / 1%
Add SDS solution and suspend well. Furthermore, 3M pot
Add 6 ml of assium / 5M acetate solution
Well and then centrifuge to obtain the supernatant. Supernatant is phenol
After treating with chloroform (1: 1), an equal volume of isoprop
A pellet was obtained by adding a nol and centrifuging. Pellet is T
After dissolving in E solution, RNase treatment, phenol-chloro
Perform form (1: 1) treatment and perform ethanol precipitation.
U Dissolve the pellet in TE solution again,
0.63M each of ethylene glycol 3000,
Add to 7.5% and centrifuge. Finally, Peret
Is dissolved in TE solution and then ethanol precipitated. to this
About 300 μg of plasmid DNA pHGT1 was obtained from
Was. About purified plasmid DNA Taq Dye
 Deoxy^TMTerminator Cycle
Sequencing Kit (Applied Biosystem
3) manufactured by Applied Biosystems, Inc.
73A DNA sequencer for sequencing, c
Protein codedies predicted from DNA nucleotide sequences
The nucleotide sequence around the coding region was determined. Nucleotide sequence and
Sequence listing of the deduced amino acid sequence (SEQ ID NO: 8)
It was shown to. The primer required for nucleotide sequence determination is Example 2
The same as that used for the nucleotide sequence analysis of the cDNA used in 2.
And the sequence reaction with those primers.
Use synthetic primers designed based on the analyzed internal sequence.
I used it. As a result, the plasmid clone pHGT1 is responsible for
The chromosomal DNA possessed is the amino acid predicted by SEQ ID NO: 6.
Including all the acid coding regions,
The nucleotide sequences were in perfect agreement. In addition,
The region corresponding to the exon to be added is four introns.
The length of the intron is in order from the 5'side.
231bp, 286bp, 1932bp, 236bp
Met. 3 is the cDNA base sequence shown in SEQ ID NO: 7
The place was different. The different nucleotide sequences are described in Example 22.
It is the same as the place (the difference between SEQ ID NOS: 6 and 7),
A (84th base) of SEQ ID NO: 7 is C, A (740 bases)
Eyes was T, and G (1198th base) was A. Sanawa
The human TPO cDNA clone obtained in Example 21
The base sequence of pHTF1 is the same as that of the human chromosome.
It became clear that they were different. Therefore, this base sequence
Analysis of whether the mutation in the sequence reflects the original sequence
5 stains finally selected for screening
Of the somatic DNA clones, the rest of which the base sequence has not been determined
The sequence was determined for the four clones. Array
Analysis is described in Molecular Cloning
Phage DNA prepared by the plate lysate method
Was carried out by the direct nucleotide sequencing method using. Up for reaction
Example 2 at the positions where the nucleotide sequence mutation points at the three positions can be analyzed
Sequence primer synthesized in 2 and Taq
Dye Deoxy^TMTerminator Cyc
le Sequencing Kit (Applied Bio
Applied Biosystems
Sequenced by 373A DNA sequencer manufactured by the company
did. As a result, 8 of SEQ ID NO: 7 was observed in all four clones.
The 4th base is C, the 740th base is T, and
Unlike the cDNA, it matched that of SEQ ID NO: 6. 1
For the 198th base, there are two G clones and one A clone.
There were two. That is, the original salt of chromosomal DNA
It became clear that there are two types of base sequences. This array difference
Or genes derived from homologous chromosomes or multiple genes
It is unknown at this point if it is derived from. Also, purchase
Entered Clontech poly (A)⁺RNA is Ca
It is derived from ucasian, but the origin of chromosomal DNA
Since Japanese are Japanese, mutations in the nucleotide sequence are different in race.
It is also suggested that it may be due to the Supported on E. coli DH5
The modified vector pHGT1 is dated March 24, 1994.
Entrusted with the Institute of Biotechnology, Institute of Technology, Ministry of International Trade and Industry
Deposited under the number FERM BP-4616. this is
In addition, as of March 22, 1995, the
Contract No. 940084 at the Exhibition Institute (FIRDI)
Deposited. <Example 26> Expression and activity of human TPO chromosomal DNA in COS1 cells
Plasmid clone pH obtained by confirmation subcloning
GT1 has 3 inserts and 1 in the vector
There are 4 EcoRI recognition sequences in total,
The 5'-most EcoRI recognition sequence in the insert and
Approximately 4.3 kb sandwiched between EcoRI recognition sequences
The human TPO protein chordin was added to the DNA fragment of p.
It was revealed from the analysis of the nucleotide sequence that the entire region was included.
Or it becomes. Therefore, this fragment was treated with EcoRI.
Connected to the current vector pEF18S and generated 4 human TPO
The current plasmid pEFHGTE # 1-4 was obtained (see above figure)
11). We prepared these plasmid DNAs for expression experiments.
I did. Purification of plasmid DNA is essentially Mole
color Cloning [Sambrook et al., C
old Spring Harbor Laborat
ory Press (1989)]
Thus, about 250 μg of plasmid DNA was obtained.
Was. COS of the obtained clones pEFHGTE # 1-4
Transfection of 1 cell was carried out according to Example 11.
I did it. That is, use 10 μg of plasmid DNA
DEAE-dextran method including chloroquine treatment
And transfection was performed 3 days later and the culture supernatant was
Was recovered. The obtained culture supernatant to IMDM culture medium
After dialysis, it was evaluated by the rat CFU-MK assay system.
As a result, COS1 cell culture expressing pEFHGTE
Dose-dependent TPO activity was observed in the nutrient supernatant, while
Transfect expression plasmids without DNA inserts
Activity was observed in the transfected COS1 cell culture supernatant
I couldn't. Almost the same for all clones # 1 to # 4
The results were obtained, but as a typical example, pEFHGTE # 1
The result in Fig. 12a is shown in Fig. 12a. In addition, M-07e
Also in the essay system, CO expressing pEFHGTE
Dose-dependent significant M-07e cells in S1 cell culture supernatant
A vesicle growth promoting activity was observed. As a typical example, pEFH
The results for GTE # 1 are shown in Figure 12b. these
From the results, the obtained clone pEFHGTE is carried.
DNA is a functional chromosomal DNA of human TPO
However, it became clear. <Example 27> Preparation of human TPO deletion derivative and expression in COS1 cells-
Activity Confirmation From the results of Example 18, human TPO was not required to be full length.
Although it was revealed that the activity could be expressed, the expression of the activity
For the purpose of analyzing the region required for
Expression was performed. The plasmid claw obtained in Example 18
Based on the pHT1-231, 20
Amino acid deleted expression plasmid and TP2 / 3
Expression including amino acids immediately after (163rd)
Mido was prepared. PCR was used for the production. For PCR
The sequences of the primers prepared in the above are as follows. Plasmid of clone PHT1-231 obtained in Example 18
Primer synthesized using 1 μg of DNA as a template
-(Use hTPO-5 as 5'side, hTPO-2,
-3, -4, and -S are used as the 3'side) and 10 respectively
PCR was performed using μM. GeneAmp^TMPC
R Reagent Kit with AmpliTa
q^TMDNA Polymerase (Takara Shuzo)
Using GeneAmp^TMPCR System 9
100 by 600 (manufactured by PERKIN-ELMER)
PCR in a volume of μl (denaturing conditions at 95 ° C. for 1 minute, 66
Annealing condition for 1 minute at ℃, Synthesis condition for 1 minute at 72 ℃
The reaction is performed 20 times at room temperature, and the reaction is incubated at 72 ° C for 7 minutes.
Beet). Bands obtained by each PCR
Digested with restriction enzymes EcoRI and NotI, and
Loose gel (manufactured by FMC BioProducts)
Prediction of each PCR reaction by electrophoresis used
The major DNA fragment of the size
-Purification with Gene DNA Purification Kit (BioRad)
Expression vector pEF18S treated with a restriction enzyme in the same manner
Subcloned into
Competitive High E. E. coli DH5).
Of the transformants obtained, each of the expected length
4 to 5 clones each containing insert
Were selected and plasmid DNA was prepared. Method is essential
By Molecular Cloning [Sambro
ok et al., Cold Spring Harbor La
laboratory Press (1989)].
It was carried out as described above. A series of operations
Deletion Derivatives Encoding Noic Acid 1-163 (pHT1-1
63 # 1-5), a deletion encoding amino acids 1-171.
Derivative (pHT1-171 # 1-4), amino acid 1-1
Deletion derivative encoding 91 (pHT1-191 # 1-
4), a deletion derivative encoding amino acids 1-211 (p
HT1-211 # 1-4) plasmid DNA was obtained.
For purified plasmid DNA see Taq Dye
Deoxy^TMTerminator Cycle S
equaling Kit (Applied Bio System
Manufactured by Applied Biosystems, Inc. 37
Sequenced by 3A DNA sequencer, full length
As expected, TPOcD
It was confirmed to have an NA sequence. Each obtained
Transfection of COS1 cells from the loan
Performed according to Example 11. That is, plasmid DNA
DEAE-de containing 10 μg each and including chloroquine treatment
Transfection using the kisstran method,
After 3 days, the culture supernatant was collected. IMDM culture of culture supernatant
After dialysis against the liquid, it was evaluated by the rat CFU-MK assay system.
I paid. As a result, pHT1-211, pHT1-19
Expresses pHT1-171, and pHT1-163
Dose-dependently with any COS1 cell culture supernatant
TPO activity was observed. As a typical example, pHT1-211 #
1, pHT1-191 # 1, and pHT1-171 #
The results in 2 are shown in FIG. 13a and pHT1-163 # 2.
The result is shown in FIG. 13b. Similar results are M-0
Also obtained in the 7e assay system, pHT1-211,
pHT1-191, pHT1-171, and pHT1
-163 in any COS1 cell culture supernatant expressing
Also recognized a significant M-07e cell growth promoting activity in a dose-dependent manner
I have As a typical example, pHT1-211 # 1, pHT1
-191 # 1, pHT1-171 # 2, and pHT1
The results for -163 # 2 are shown in FIG. these
From the results, amino acid 3 which constitutes human TPO protein
164 out of 53 (including 21 signal sequences)
Even if the amino acid after arginine at the position is deleted,
It was revealed that the activity in vitro was retained.
Of TPO activity before arginine at position 164
Therefore, it was suggested that the essential region was included. <Example 28> Preparation of human TPO C-terminal deletion and development in COS1 cells
Present-Activity Confirmation The region essential for the activity expression of human TPO protein was analyzed.
For the purpose of
A derivative having a deletion of the terminal amino acid was prepared to improve TPO activity.
It was examined whether it could be expressed. Plus obtained in Example 16
Based on the mid clone pEF18S-HL34, 163
Amino acids are sequentially deleted from the C-terminal side based on the th serine
The expressed expression plasmid was constructed. PCR is used for construction
I used it. The sequences of the primers prepared for PCR are as follows:
On the street. The clone pEF18S-HL34 clone obtained in Example 16
Using 1 μg of rasmid DNA as a template,
Limer (hTPO-5 is used as 5'side, hTPO-5
-150, -151, -153, -154, -155,
-156 and -157 are used as 3'side) 1
PCR was performed using 0 μM. GeneAmp^TMP
CR Reagent Kit witn Ampli
Taq^TMDNA Polymerase (Takara Shuzo)
Manufactured by GeneAmp^TMPCR System
m 9600 (manufactured by PERKIN-ELMER)
PCR reaction in a volume of 100 μl (denaturation at 95 ° C for 1 minute
Conditions, 66 ° C for 1 minute annealing condition, 72 ° C for 1 minute
The reaction was performed 20 times under the synthetic conditions of and further 72 minutes at 72 ° C.
Incubation). Obtained by each PCR
The digested band was digested with restriction enzymes EcoRI and NotI.
Then, 1% agarose gel (FMC BioProduct
Electrophoresis using ts company)
Isolate major DNA fragments of the expected size for the R reaction
Prep-A-Gene DNA Purification Kit (Biora
Expression vector treated with a restriction enzyme in the same manner.
Subcloned into pEF18S
Competent high E. made by Toyobo Co., Ltd. coli D
H5 used). Of the transformants obtained,
3 clones each containing the insert of the expected length
Select one to five and prepare plasmid DNA
Was. The method is essentially Molecular Clonin
g [Sambrook et al., Cold Spring
Harbor Laboratory Press (1
989)]. Series
The amino acid number 1-
A deletion that encodes 150 (pHT1-150 # 21,
22 and 25), and lacks the amino acid number 1-151.
Lost body (pHT1-151 # 16, 17, 18), amino
Deletion form encoding acid number 1-153 (pHT1-15
3 # 1-5), a deletion encoding amino acid numbers 1-154.
Loss body (pHT1-154 # 1-5), amino acid number 1-
Deletion product encoding 155 (pHT1-155 # 1-
5), a deletion product encoding amino acid numbers 1-156 (p
HT1-156 # 1-5), amino acid numbers 1-157
Plas of the encoded deletion (pHT1-157 # 1-5)
Sumid DNA was obtained. Purified plasmid DNA pH
T1-150 # 21, 22, 25 and pHT1-15
For 1 # 16, 17, and 18, Taq Dye De
oxy^TMTerminator Cycle Seq
uening Kit (Applied Biosystems)
Manufactured by Applied Biosystems 373A
Sequenced by DNA sequencer and
The expected TPO cDNA without any substitution of the nucleotide sequence
I confirmed that I had an array. Each claw obtained
Transfection of COS 1 cells with
Performed according to Example 11. That is, each plasmid DNA
DEAE-DEX with 10 μg and chloroquine treatment
Transfection using the Strand method was performed. 3
After a day, the culture supernatant was collected. Culture supernatant is IMDM culture solution
After fully dialysis against, evaluated with M-07e assay system
Was. As a result, cysteine, which is the 151st amino acid,
Including amino acids 1-151, 1-153,
1-154th, 1-155th, 1-156th, 1-15th
A clone encoding a C-terminal deletion derivative consisting of position 7
In the transfected COS1 cell culture supernatant,
TPO activity was detected in a dose-dependent manner. However,
Amino acid 1-deleted up to the 151st cysteine
A clone encoding the C-terminal deletion derivative at position 150 was cloned.
T was present in the transfected COS1 cell culture supernatant.
No PO activity was detected. <Example 29> Preparation of human TPO N-terminal deletion and development in COS1 cells
Present-Activity Confirmation The region essential for the activity expression of human TPO protein was analyzed.
In order to achieve the above, based on the deletion product obtained in Example 28, N-terminal
A derivative having a deletion of the amino acid on the side is prepared to generate TPO activity.
I examined whether it could appear. Plasma obtained in Example 18
Doclone pEF18S-HL34 and Example 27
Based on the plasmid clone pHT1-163 obtained in
Expression with deletion of N-terminal amino acid following signal sequence
The plasmid was constructed. PCR was used for the construction. P
The sequence of the primer prepared for CR is as follows.
It (1) A derivative lacking amino acid numbers 1-12 (pHT
13-231) Production of clone pEF18S-HL34 obtained in Example 18
Synthesized using 1.4 μg of Lasmid DNA as a template
Primers (hTPO-13 and hTPO3 used in combination
For: hTPO-5 and hTPO-13R are used in combination)
PCR was performed using 5 μM of each of the above. GeneA
mp^TMPCR Reagent Kit with
AmpliTaq^TMDNA Polymerase
GeneAmp using (manufactured by Takara Shuzo)^TMPCR
System 9600 (PERKIN-ELMER)
PCR reaction (5 at 95 ° C) in a volume of 100 μl
After denaturing for 1 minute, denaturing conditions at 95 ° C for 1 minute, 1 minute at 65 ° C
Annealing conditions between, 30 times under synthesis conditions of 72 ° C for 1 minute
Reaction, and incubate at 72 ° C for an additional 7 minutes)
Was done. 1.2% agarose for each PCR product
Using gel (FMC BioProducts)
Electrophoresed, each expected size of major DN
The A fragment was isolated and the prep-A-gene DNA purification kit was isolated.
(Made by Bio-Rad) and 15 μl TE bag
Dissolved in fur. Use 1 μl of this solution as a template
A second round of PCR was performed. Synthesized primer (hT
PO-5 and hTPO3 are used) 5 μM each
PCR was carried out. GeneAmp^TMPCR
Reagent Kit with AmpliTaq
^TMUses DNA Polymerase (Takara Shuzo)
And GeneAmp^TMPCR System 96
00 (made by PERKIN-ELMER) 100μ
PCR reaction in a volume of 1 (after denaturing at 95 ° C for 5 minutes, 95 ° C
Denaturing conditions for 1 minute at 60 ° C., annealing conditions at 60 ° C. for 1 minute,
Perform the reaction 30 times under the synthetic condition of 72 ° C for 1 minute, and further
For 7 minutes at 72 ° C.). PCR product
1.2% agarose gel (FMC BioProd
expected by electrophoresing using cts)
The major DNA fragments of size were isolated and separated by prep-A-di
DNA purification kit (manufactured by Bio-Rad),
It was dissolved in 15 μl of TE buffer. Restriction enzyme Eco
After digestion with RI and NotI, equal amount of phenol / black
After extraction once with Loform, ethanol precipitation was performed. Centrifugation
After dissolving the precipitate obtained in (1) in 15 μl of TE buffer,
Similarly, the restriction vector-treated expression vector pEF18S was
Cloned (as a host fungus, manufactured by Toyobo Co., Ltd.
Pitent High E. E. coli DH5). Got
Inserts of the expected length among the
Select 45 clones containing and prepare plasmid DNA
did. The method is essentially Molecular Clon
ing [Sambrook et al., Cold Spring
 Harbor Laboratory Press
(1989)].
In SEQ ID NO: 4, encodes amino acid numbers 1-231
Deletion derivative (pH 1-12)
T13-231) plasmid DNA was obtained. To these
For hTPO-5 and hTPO3 primers
PCR was performed and 8 out of 45 clones
An insert of the expected size was confirmed. That
Taq Dye Deo for 3 of these clones
xy^TMTerminator Cycle Sequ
ening Kit (Applied Biosystems)
Manufactured by Applied Biosystems 373A
Sequence with a DNA sequencer, 1 claw
The expected deletion has occurred in the
Designed without replacement of the base sequence over the entire length including
Clone pHT13- with a unique TPO cDNA sequence
231 # 3 was obtained. (2) A derivative lacking amino acid numbers 1-6 (pHT7
-163) In the preparation of the deletion derivative of (1) above, the TPO protein
Was designed as the 231st amino acid of the
Even if the terminal side is further deleted, TPO activity may be expressed.
Since it was confirmed that C
The terminal was designed up to the 163rd amino acid. following
Also in (3), the 163rd amino acid is similarly added to the C-terminal.
Designed as Clone pHT1-obtained in Example 27
Using 1.4 μg of 163 plasmid DNA as a template
And synthesized primers (hTPO-7 and hTPO-
Use S in combination: hTPO-5 and hTPO-7R in combination
Used in 5 μM). G
eneAmp^TMPCR Reagent Kit wi
th AmpliTaq^TMDNA Polymer
GeneAmp using se (Takara Shuzo)^TMPC
R System 9600 (PERKIN-ELMER
PCR reaction (at 95 ° C) in a volume of 100 μl
After denaturing for 5 minutes, denaturing conditions of 95 ° C for 1 minute, 1 at 65 ° C
30 minutes under the annealing condition of 72 minutes and the synthesis condition of 1 minute at 72 ° C.
Incubate at 72 ° C for another 7 minutes.
G) 1.2% agaro of each PCR product
Segel (made by FMC BioProducts)
Subjected to the electrophoresis used, each of the major
Separation of DNA fragments and purification of prep-A-gene DNA
Purified with kit (Bio-Rad), 15 μl TE
Dissolved in buffer. 1 μl each of this solution as template
A second PCR was performed. Synthesized primer
(Using hTPO-5 and hTPO-S)
PCR was performed using 5 μM. GeneAmp^TMP
CR Reagent Kit with Ampli
Taq^TM DNA Polymerase (Takara Shuzo)
Manufactured by GeneAmp^TMPCR System
m 9600 (manufactured by PERKIN-ELMER)
PCR reaction in a volume of 100 μl (denaturation at 95 ° C for 5 minutes
Then, denaturing conditions of 95 ° C for 1 minute and annealing at 60 ° C for 1 minute
Reaction at 72 ° C for 1 minute
And then incubate at 72 ° C for an additional 7 minutes)
Was. The PCR product was analyzed by 1.2% agarose gel (FMC B
Electrophoresis using ioProducts)
Isolate the major DNA fragment of the expected size and
Rep-A-Gene DNA Purification Kit (Bio-Rad
Product) and dissolved in 15 μl of TE buffer.
After digesting with the restriction enzymes EcoRI and NotI,
Ethanol precipitation after extraction once with ethanol / chloroform
I did. The precipitate obtained by centrifugation is mixed with 15 μl of TE buffer.
Expression vector p, which had been similarly digested with restriction enzymes and treated with restriction enzymes
Subcloned into EF18S
YOBO CORPORATION Competent High E. coli DH5
use). Expected length of the transformants obtained
Select 30 clones containing the insert of
DNA was prepared. The method is essentially Molecul
ar Cloning [Sambrook et al., col
d Spring Harbor Laboratory
 As described in Press [(1989)].
Was carried out. Amino acid number 1 in SEQ ID NO: 4
A deletion of 1-6 out of the protein encoding -163
Obtaining the plasmid DNA of the loss derivative (pHT7-163)
Was. For these clones, hTPO-5 and hTPO-5
PCR using PO-S as a primer
Contains inserts of the size expected for all clones.
Was confirmed. Select 3 from these clones
And TaqDye Deoxy^TMTerminate
r Cycle Sequencing Kit
Applied Bio)
System 373A DNA sequencer
Sequence and 2 clones had the expected deletion
In addition, the base sequence is distributed over the entire length including other parts.
Has no TPO cDNA sequence as designed, with no column replacement, etc.
Two clones pHT7-163 # 4 and # 29 were obtained.
It was (3) A derivative lacking amino acid numbers 1-7 (pHT8
-163) Preparation A derivative lacking amino acid numbers 1-7 (pHT8-16
In the production method of 3), the above-mentioned amino acid numbers 1-6 are deleted.
Essentially the same as the preparation of the derivative (pHT7-163)
By the way. Clone pHT1-obtained in Example 27
Using 1.4 μg of 163 plasmid DNA as a template
And synthesized primers (hTPO-8 and hTPO-
Use S in combination: hTPO-5 and hTPO-8R in combination
Used in 5 μM). G
eneAmp^TMPCR Reagent Kit w
it AmpliTaq^TMDNA Polymer
GeneAmp using asase (Takara Shuzo)^TMP
CR System 9600 (PERKIN-ELM
PCR reaction (95 μm) by ER) in a volume of 100 μl.
After denaturing at 5 ℃ for 5 minutes, denaturing condition at 95 ℃ for 1 minute, 65 ℃
1 minute annealing condition, 72 ° C 1 minute synthesis condition
Perform the reaction 30 times and incubate at 72 ° C for another 7 minutes.
I went). 1.2% agar for each PCR product
Roth gel (manufactured by FMC BioProducts)
Electrophoresis using
DNA fragments were isolated and prep-A-gene DNA purified.
Purified with a kit (manufactured by Bio-Rad), 15 μl of T
It was dissolved in E buffer. 1 μl each of this solution was used as a template
A second PCR was performed. Synthesized primer
(Using hTPO-5 and hTPO-S)
PCR was performed using 5 μM. GeneAmp^TMP
CR Reagent Kit with Ampli
Taq^TMDNA Polymerase (Takara Shuzo)
Manufactured by GeneAmp^TMPCR System
m 9600 (manufactured by PERKIN-ELMER)
PCR reaction in a volume of 100 μl (denaturation at 95 ° C for 5 minutes
Then, denaturing conditions of 95 ° C for 1 minute and annealing at 60 ° C for 1 minute
Reaction at 72 ° C for 1 minute
And then incubate at 72 ° C for an additional 7 minutes)
Was. The PCR product was analyzed by 1.2% agarose gel (FMC B
Electrophoresis using ioproducts)
Isolate the major DNA fragment of the expected size and
Rep-A-Gene DNA Purification Kit (Bio-Rad
Product) and dissolved in 15 μl of TE buffer.
After digesting with the restriction enzymes EcoRI and NotI,
Ethanol precipitation after extraction once with ethanol / chloroform
I did. The precipitate obtained by centrifugation is mixed with 15 μl of TE buffer.
Expression vector p, which had been similarly digested with restriction enzymes and treated with restriction enzymes
Subcloned into EF18S
YOBO CORPORATION Competent High E. coli DH5
use). Expected length of the transformants obtained
Select 30 clones containing the insert of
DNA was prepared. The method is essentially Molecul
ar Cloning [Sambrook et al., Cold
Spring Harbor Laboratory P
[ress (1989)].
gave. In SEQ ID NO: 4, amino acid numbers 1-163
Deletion derivative lacking 1-7 of proteins encoding
A plasmid DNA of (pHT8-163) was obtained. this
For these clones hTPO-5 and hTPO-
PCR was performed using S as a primer to
Include an insert about the size of the loan
Was confirmed. Select 3 clones from these clones,
aq Dye Deoxy^TMTerminator
Cycle Sequencing Kit (Applied
Applied Systems
Seek with Thames 373A DNA sequencer
And two clones caused the expected deletions to occur.
And salt over the entire length including other parts
TPO cDNA sequence as designed without substitution of base sequence
Two clones with pHT8-163 # 33, # 48
was gotten. (4) Expression of deletion derivative in COS1 cells and TPO activity
Confirmation of COS 1 cells of each deletion clone obtained
Transfection according to Example 11
Was. That is, 10 μg each of plasmid DNA was used to
Using DEAE-Dextran method including Rokin treatment
Conduct the transfection and collect the culture supernatant after 3 days
did. Sufficient dialysis of culture supernatant against IMDM culture
Then, it was evaluated by the M-07e assay system. As a result,
A clone encoding a deletion derivative at position 7-163
Weak in the transfected COS1 cell culture supernatant
However, TPO activity was observed in a dose-dependent manner. On the other hand,
Minoic acid 8-163, deletion derivative of 13-231 position
COS1 transfected with the clone
No TPO activity was observed in the cell culture supernatant. <Example 30> Human TPO full-length cDNA plasmid (pHTP1)
Construction of human TPO cDNA predicted as shown in SEQ ID NO: 6
Animal cell expression vector containing all mino acid coding regions
The construction of the tar was performed. Human TPOcDN by PCR
A DNA fragment that covers the entire A coding region is shown below.
Was prepared as follows. The nucleotide sequences of the primers used are as follows.
It is Ri.The clone pEF18S-HL34 obtained in Example 16
The first PCR was performed using 300 ng of the above as a template.
Primer hTPO-I and SA 0.5 μM each are used
I, Vent R^TMDNA Polymerase
(New England BioLabs) 1
Reaction using the unit (96 ° C for 1 minute, 62 ° C for 1 minute
After 30 cycles of 1 minute at 72 ° C
72 ° C. for 7 minutes). The composition of the reaction solution is as follows.
R 10 mM KCl and 10 mM (NH_Four)₂
 SO_Four, 20 mM Tris-HCl (pH 8.
8) 2 mM MgSO_Four, 0.1% Triton X-1
00, 200 μM dNTP mix. Commercially available human normal
Liver-derived poly (A) + RNA (manufactured by Clonetech) 1
μg was heated at 70 ° C for 10 minutes and then rapidly cooled on ice to give 10 mM.
 DTT, 500 μM dNTPmix, 25 ng r
and primer (manufactured by Takara Shuzo), 10 units
RNase Inhibitor (Boehringer Man
Made by Heim), 200 units SuperScript
t^TMII RNaseH- (LIFE TECHNO
LOGIES) was added and kept warm at 37 ° C for 1 hour. C
DNA was synthesized. 20 minutes of synthesized CDNA reaction solution
A second round of PCR was performed using 1 volume as template.
Primer hTPO-P and hTPO-KO 2.5 each
μM, 2.5 units of AmpliTaq^TMDNA
Reaction using Polymerase (Takara Shuzo) (9
30 minutes reaction at 5 ℃ 1 minute, 58 ℃ 1 minute, 72 ℃ 1 minute
Cycle). PCR solution of 2 times 1% agaro
Sel gel electrophoresis, each of the expected size
Prep major band Prep-A-Gene DNA purification kit
(Manufactured by Bio-Rad). Each spirit
Third PCR using 1/20 of each of the production amounts as a template
Was carried out. Vent R^TMDNA Polymer
ase (New England BioLabs)
Reaction (after heating at 96 ° C for 2 minutes,
3 cycles of 96 ° C for 2 minutes and 72 ° C for 2 minutes
After that, 72 ° C. for 7 minutes). This reaction liquid
HTPO-I and hTPO at 1 μM each
-After adding KO, heating at 96 ° C for 2 minutes,
Then reaction at 96 ° C for 1 minute, 62 ° C for 1 minute, 72 ° C for 1 minute
25 cycles and then react at 72 ° C for 7 minutes
Let An equal volume of water saturated phenol-chloroform was added to the reaction mixture.
Extract once with chloroform and then once with an equal volume of chloroform.
After that, ethanol precipitation (0.3 M sodium acetate,
0.5 μl Boehringer Mannheim glycogen,
Recover DNA by performing 2.5 times the amount of ethanol)
did. The recovered DNA is treated with the restriction enzymes BamHI and No.
Digested with tI and subjected to 1% agarose gel electrophoresis
Prep a major band of the indicated size-A-Gene D
Purified using NA purification kit (manufactured by Bio-Rad)
After that, the restriction enzymes BamNI and NotI were deleted in the same manner in advance.
PBluescript II SK + vector
After connecting to (Stratagene), competent
E. E. coli DH5 (manufactured by Toyobo Co., Ltd.) was transformed.
Was. 4 clones are selected from the obtained colonies
DNA was prepared. About purified plasmid DNA
Is Taq Dye Deoxy^TMTerminate
r Cycle Sequencing Kit (Apply
Applied Biosystems)
Seeds with Stems 373A DNA sequencer
After quenching, in the area from BamHI to NotI
Predicted TPO cDNA sequence with no nucleotide sequence substitution
A clone pBLTP that was confirmed to have the above gene was obtained. p
Digests BLTP with restriction enzymes EcoRI and BamHI
After 1% agarose gel electrophoresis, high molecular weight van
Prep-A-Gene DNA Purification Kit (Biola
(Manufactured by Dodd). Similarly, pEF18S-H
L34 was also treated with a restriction enzyme to purify the 450 bp band.
Was. Ligate each DNA and compete
Transformation of Tohai E, coli DH5 (manufactured by Toyobo Co., Ltd.)
Changed. Preparation of plasmid DNA from the obtained colonies
And clone p containing the human TPO cDNA insert.
I got BLTEN. The obtained pBLTEN was used as a restriction enzyme E.
After digestion with coRI and NotI, 1% agarose gel
Approximately 1200 bp band was prepared by electrophoresis-
Use A-Gene DNA Purification Kit (Bio-Rad)
Expression vector treated with the same restriction enzymes after purification
Connected to pEF18S, competent high E. coji
DH5 (manufactured by Toyobo Co., Ltd.) was transformed. The obtained roller
Plasmid DNA was prepared from knee and human TPOcDN was prepared.
A clone pHTP1 containing all A coding regions
Obtained. Prepare a large amount of plasmid DNA for this clone
It was used in the following experiments. Preparation of plasmid DNA is essential
Molecular Cloning (Samb
look et al., Cold Spring Harbor
Laboratory Press, 1989).
It was carried out as described above. <Example 31> pDEF202-hTP, recombinant vector for CHO cells
Construction of OP-1 Plasmid pMG1 containing the mouse DHFR minigene,
1 μg was treated with restriction enzymes EcoRI and BamHI
After that, agarose gel electrophoresis was performed and mouse DHFR mini inheritance was performed.
A fragment containing the offspring (approximately 2.5 kbp) was recovered. Collected
Fragment 50 mM Tris-HCl (pH 7.5), 7 m
M MgCl₂1 mM mercaptoethno
l, in a 25 μl reaction solution consisting of 0.2 mM dNTP
Dissolve and add 2 units of Klenow fragment at room temperature
The reaction was carried out for 30 minutes to blunt the ends of the DNA. Next
Phenol / chloroform treatment, ethanol precipitation
After that, 10 mM Tri-HCl (pH 8.0), 1 mM
 It was dissolved in 10 μl of a solution consisting of EDTA. Then profit
Containing mouse DHFR minigene and animal cell
Expression vector pEF18S for treatment with restriction enzyme SmaI
Then, remove with alkaline phosphatase (Takara Shuzo).
The vector DNA obtained by the
Expression vector pDEF2
I got 02. Then restrict this vector pDEF202
Treated with the enzymes EcoRI and SpeI and agarose gel
The larger vector fragment was recovered by electrophoresis.
This fragment and human TPO cDNA (P1 clone
Plasmid pHTP1 containing the lone) restriction enzyme Eco
Human TPO cDNA obtained by treatment with RI and SpeI
A (P1 clone) and T4 DNA ligase (Takara Shuzo
Expression vector pDEF202-hTP
O-P1 was obtained. This plasmid is the replication initiation region of SV40
Region, human elongation factor-1-alpha pro
Motor, SV40 early polyadenylation site, mouse DH
FR minigene, pUC18 origin of replication, β-lac
Tamase gene (Amp^r), Human Elongation
Human factor T downstream of the factor 1-alpha promoter
PO cDNA is connected. <Example 32> Expression of human TPO in CHO cells CHO cells (dhfr- strain, Urlaub and Chasi).
n; Proc. Natl. Acad. Sci. USA;
Vol. 77, p. 4216, 1980) 6 cm diameter plate
(Falcon) α minimum containing 10% fetal calf serum
Essential medium (α-MEM (-), thymidine, hypoxanthine
Cultivated and proliferated by adding calcium phosphate)
Shaped by (CellPhect, Pharmacia)
The quality has changed. That is, pDEF prepared in Example 31
Buffer 10 μg of 202-hTPO-P1 plasmid
-A: 120 μl and H₂O: Add 120 μl and mix
After that, it was left at room temperature for 10 minutes. Next, this solution
Buffer B: 120 μl was added to and mixed again
Then, it was left at room temperature for 30 minutes. Play this DNA solution
CO after dripping₂6 hours in the incubator
Cultured. Remove the medium from the plate and α-MEM
After washing twice with (-), 10% dimethyl sulfoxy
Add α-MEM (-) containing gut and treat at room temperature for 2 minutes
Was. Then, non-selective medium containing 10% dialyzed fetal bovine serum (previously
Α-MEM (-), hypoxanthine, thymidine added)
10% dialyzed fetal bovine serum after culturing for 2 days
Containing selection medium (α-MEM (−), hypoxanthine, chi
Selection was performed with no added midine. Select cells
After lipsin treatment, per 6 cm diameter plate,
5 10cm diameter plates or 24 well plates 2
After dividing into 0 sheets, change medium every 2 days with selective medium
It was carried out by continuing the culture while carrying out. Cells
For plates or wells that have grown,
Human TPO activity in nutrient supernatant was analyzed by M-07e assay and B
When measured using the a / F3 assay,
Activity was also observed in the essay system. In the culture supernatant,
New play for those with recognized TPO activity
Or well containing 25 nM methotrexate
Divide the cells 1:15 in selective medium and continue culturing.
To grow cells resistant to methotrexate and
I made a row. The transformation of CHO cells is C
Co-transformation of pHTP1 and pMG1 into HO cells
(Co-transfection)
Can also be done. Plasmid pDEF202-hT
CHO cell line transformed with PO-P1 (CH
O-DUKXB11) traded on January 31, 1995.
Entrusted number F to the Institute of Biotechnology, Industrial Technology Institute, Ministry of Industry
Deposited as ERM BP-4988. this is
In addition, the food industry of the Republic of China was developed on March 22, 1995.
Consignment number 960023 to the Institute (FIRDI)
It is entrusted. <Example 33> X63.6.5.3. Recombinant vector for cells, BMCG
Construction of Sneo-hTPO-P1 Restriction of 1 μg of BMCGSneo expression vector for animal cells
After treatment with the enzymes XhoI and NotI, agarose gel
Electrogel electrophoresis was performed to recover the vector DNA portion.
Then, the obtained DNA fragment and human TPO cDNA were included.
The plasmid pBLTEN with restriction enzymes XhoI and Not
Human TPO cDNA (P 1
Lane) with T4 DNA ligase,
Lasmid BMCGSneo-hTPO-P1 was obtained. This
The expression plasmid for Escherichia coli
The intron from the rabbit β-globin gene and
Polyadenylation site Part of human β-globin gene
69% of the Pilomavirus 1 gene, thymidine kinase
Promoter and polyadenylation site, phosphotrans
Ferrase I (neomycin resistance gene), pBR32
2 replication initiation region and β-lactamase gene (Amp
^r) Is included downstream of the cytomegalovirus promoter.
To TPO cDNA is connected. <Example 34> X63.6.5.3. Expression in cells X63.6.5.3. Cells contain 10% fetal bovine serum D
ulbecco's minimal essentia
1 (DME) medium was grown in culture and electroporated.
It was transformed by the poration method. That is, implementation
The BMCGSneo-hTPO-P1 prepared in Example 33
20 μg of rasmid 10⁷DME medium 7 containing individual cells
In addition to 50 μl, 4 mm for electroporation
Set in a cap cuvette and leave at 4 ° C for 10 minutes
Was. This cuvette is an electroporation device (B
TX600, manufactured by BTX), set to 380V, 25
The gene was introduced under the condition of mF and 24 angstrom.
After gene transfer, leave the cuvette again at 4 ° C for 15 minutes.
After that, the cells are washed once with DME containing 10% fetal bovine serum.
Clean The cells then contain 50 ml of 10% fetal calf serum
Suspended in DME and divided into 5 96-well plates
Chi, CO₂Cultured for 2 days in an incubator. That
Then, the culture solution was added with 1 mg / ml of G418 (GIBCO).
Co., Ltd.) Replaced with DME containing 10% fetal bovine serum, and then 3
The medium was changed every day. The well where the cells grew
Furthermore, the human TPO activity in the culture supernatant was measured by CFU-MK.
Assay, M-07e Assay and Ba / F3 Assay
Was measured using
Was also found to be active. Confirmation of human TPO activity in the culture supernatant
For resistant cells, grow resistant cells twice.
Cloning to establish human TPO producing cell line
Was. <Example 35> Large-scale expression of human TPO in COS1 cells Transfection of COS1 cells into Example 11 was performed.
DEAE-dextran containing chloroquine treatment according to claim 1.
Carried out by law. COS1 cells (ATCC CRL165
175cm which treated 0) with collagen coating²The culture
IMDM with 10% (v / v) FCS in Rasco
In a 5% CO2 incubator at 37 ° C
The cells were cultured until they became about 100% confluent. Culture
Rasco's collagen coating treatment is 1 mM HCl
Collagen solution adjusted to 0.3 mg / ml (Iwaki
Cellmatrix type I-C) manufactured by 175c
m²Add 25 ml per culture flask for 1 hour at room temperature
After standing, the collagen solution is collected and 20-50 ml of PB
It was performed by washing once with S. Transfection
175 cm²250μ per culture flask
g / ml DEAE-Dextran (Pharmacia
, 60 μM chloroquine (Sigma), and 10
% (V / v) Nu-Serum (Collaborative
500 ml of HB in 20 ml of IMDM solution containing
Mix plasmid pHTP1 (40 μg) dissolved in S
And wash once with IMDM immediately before transfection
After addition to the above COS1 cells, 5% carbonic acid at 37 ° C was added.
The cells were cultured in a gas incubator for 3 hours. Then cultivate
50m after removing the nutrient supernatant by suction and washing once with IMDM
1% serum-free medium was added, and 5% carbon dioxide ink at 37 ° C was added.
The cells were cultured in an incubator and the culture supernatant was recovered after 5 days.
175 cm for one operation²From the culture flask 100
Using 260 sheets, 5 to 13 l of the culture supernatant was collected.
The composition of serum-free medium is 5 μg / ml Insulin
(Manufactured by Sigma) 5 μg / ml Transferferri
n (manufactured by Sigma), 10 μM monoethanol
mine (Wako Pure Chemical Industries), 25 nM Sodium s
elenite (manufactured by Sigma), 200 μg / ml B
SA (Nichirei's fatty acid-free high-purity beef album
IMDM including Example 36 Human full-length TPO expressed in COS1 cells (expression plus
Purification of Mido pHTP1 and P1 clones and confirmation of activity Human full-length TPO expressed in COS1 cells (expression plus)
Examples of the activity and purification of amide pHTP1) are described below.
Bell. Partial purification in order to investigate the platelet increasing effect of TPO
To prepare high purity TPO sample
Purified. For measuring TPO activity in the following preparation process
Mainly used the M-07e assay system, but rat CF
Similar TPO activity was shown in U-MK assay system
It was The final concentration of 0.02
~ 0.05% human serum albumin (HSA) as standard
Was added. First, plasmid pHTP1 from Ohashi and Sudo
Method (Hideya Ohashi and Tada
shi Sudo, Biosci. Biotech. B
iochem. , 58 (4), 758-759, 199.
COS1 cells transfected with 4)
0.2g BSA, 5mg cow per 1000ml
Does insulin contain 5 mg of human transferrin?
0.02 mM monoethanolamine, 25 nM
Serum-free IMDM containing Sodium Selenite
Culture for 5 days at 37 ℃ in a 5% carbon dioxide incubator.
Then, about 7 L of serum-free culture supernatant was obtained. Its serum-free culture
The supernatant was treated with p-APMSF and a protease inhibitor.
And Pefabloc SC (4- (2-Aminoet
hyl) -benzenesulfonyl fluo
Ride hydrochloride, Merk
Manufactured by Catalog No. 24839) with a final concentration of about 1 mM.
Then, the filtrate of a 0.22 μm filter was taken. This
This is an ultrafiltration unit (Omegaul manufactured by Filtron)
TRASET molecular weight cut 8000 or Millipore
・ PLGC Pellicon cassette with a molecular weight of 10,000
10 times concentrated with a volume of 723 ml (protein concentration
3.38 mg / ml, total protein mass 2445 mg, relative activity
Sex 43000, relative activity 105100000)
1.6 moles of Ammonium per 1000 ml
 Add Sulfate (288g total) to final concentration
8 including 1.5M Ammonium Sulfate
After making 04 ml of solution, 1.25M Ammoniu
20 mM sodium citrate containing mSulfate
Macr previously equilibrated with a buffer solution (pH 5.2)
o-Prep Methyl HIC column (Bio-
Rad, Catalog No. 156-0080; Diameter 5c
m, bed height 9 cm) at a flow rate of 10 ml / min.
did. After the addition is complete, 1.25M Ammonium S
20 mM sodium citrate buffer containing ulfate
Pass-through fraction F1 (2384) eluted at (pH 5.2)
ml, protein concentration 0.864 mg / ml, total protein mass 2
061 mg, relative activity 6000) was obtained. Then the eluate
20 mM Na Citrate, pH 5.8
Eluted fraction F2 (1092 ml, protein concentration
0.776mg / ml, total protein mass 847mg, relative activity
Sex 150,000). Furthermore, Macro-Pr
ep Methyl HIC column F2 (1081m
1) in 20 mM sodium citrate buffer (pH 5.
8) Pre-equilibrated SP Sepharose Fa
st Flow (Pharmacia Biotech, Kata
Log number 17-0729-01; diameter 3 cm, bed height
10 cm) column and added at a flow rate of 10 ml / min.
Added After the addition was completed, 110 mM NaCl was added.
20 mM sodium citrate buffer (pH 5.6)
Fraction F1 (2262 ml, protein)
White matter concentration 0.270 mg / ml, total protein mass 610 m
g, relative activity 30000) was obtained. Next, eluate 40
20 mM sodium citrate buffer containing 0 mM NaCl
The eluted fraction F2 (85
6 ml, protein concentration 0.189 mg / ml, total protein mass
162 mg, relative activity 300000) was collected. next,
The eluate was 20 mM with 1000 mM NaCl.
Elution was performed by changing to sodium acid buffer (pH 5.2)
Fraction F3 (370 ml, protein concentration 0.034 mg / m
1, total protein mass 12.6 mg, relative activity 150000)
Collected. In addition, SP Sepharose Fas
The main TPO active fraction F2 in the t Flow column
(845 ml), and a final concentration of about 10% 1-propano
20 mM citrate containing 400 mM NaCl.
L pre-equilibrated with sodium phosphate buffer (pH 5.4)
A-WGA column (Honen Co., Catalog No. WG-
007; diameter 2 cm, bed height 14 cm)
And added at a flow rate of 3 ml / min. 40 minutes after addition
20 mM sodium citrate buffer containing 0 mM Nacl
A mixed solution of an impact solution (pH 5.4) and 1-propanol (9:
Fraction F1 (64.4 m), which is a mixture of those eluted in 1)
l, protein concentration 0.0178 mg / ml, total protein mass
1.15 mg, relative activity 17220) was obtained. Then melt
The effluent was 0.4 M GlcNac, 10% 1-propanol
20 mM sodium citrate buffer (pH 6.
Eluted fraction F2 (45 ml, protein concentrated)
0.0104mg / ml, total protein mass 0.470m
g, relative activity 675,000). Therefore, LA-
The major TPO active fraction F2 (34
0 ml) with a final concentration of about 0.005% TFA.
After that, YMC-Pack CN-AP (made by YMC,
Log number AP-513; diameter 6 mm, bed height 250 m
m) developed in column. That is, 0.1% in developing solvent A
TFA, 1-pro containing 0.05% TFA in developing solvent B
YMC-Pac equilibrated with 15% B using propanol
k CN-AP column with a flow rate of 0.6 ml / min
I entered. After infusion, propano was changed from 15% B to 25% B.
The concentration of alcohol is increased, and from 25% B to 50% B 65
Develop with a linear concentration gradient of 1.5 min (1.5 ml (2.5 mi
n) were collected in polypropylene tubes. Respectively
Take 0.5 μl (1/3000 fraction) of HS
A was added, concentrated by ultrafiltration, and finally 0.05% HSA
0.25 ml IMDM assay medium solution containing
And assayed it to identify the TPO active fraction.
Was. As a result, tube numbers 24 to 30 (propanol
Strong concentration of TPO in the range of 35.0 to 42.0%)
Sex (relative activity about 630000-4800000)
Therefore, the TPO active fraction FA (13.5 ml) was used.
So, in addition, it was obtained with YMC-Pack CN-AP
FA to 0.1% TFA in developing solvent A and developing solvent B
Ca using 1-propanol containing 0.05% TFA
pcell Pak C1 300A (Shiseido, Kata
Log number C1TYPE: SG300A; diameter 4.6m
m, bed height 150 mm, diameter 4.6 mm, bed
With a pre-column with a height of 35 mm)
Expanded. That is, obtained with YMC-Pack CN-AP
A portion (8.9 ml) of FA was removed and
After adding lycerol, after concentrating by centrifugal evaporation,
Add about 2.5 ml of 10% B solution and equilibrate with 20% B
Flow rate on a Capcell PakC1 300A column
It was injected at 0.4 ml / min. 20% B after injection
After elution for 5 minutes at 50% from 20% B to 40% B
With a linear concentration gradient of 1 ml (2.5 min) each
Collected in polypropylene tubes. 1 μl each
(1/1000 fraction), add HSA,
Concentrated by ultrafiltration, and finally containing 0.05% HSA.
Prepare 25 ml of IMDM assay culture solution and use this solution.
It was subjected to assay and the TPO active fraction was identified. As a result,
Tube number 20-23 (28.5 in propanol concentration
~ 32.5% range) strong TPO activity (relative activity about
Highly active standard showing 300000 to 22500000)
I was able to get <Example 37> Molecular weight measurement of human TPO expressed in COS1 cells Human full-length TPO expressed in COS1 cells (expression plus
The molecular weight of amide pHTF1 and F1 clone) is sugar chain.
Can be inferred from the size of the peptide chain as a result of the addition of
It was considered to be larger than the molecular weight. So first, C
Human full-length TPO expressed in OS1 cells (expression plasmid
From the culture supernatant containing pHTF1 and F1 clones)
The partially purified TPO fraction was prepared as follows. That is, the exhibition
Opening solvent A (0.1% trifluoroacetic acid (TFA)) and
And developing solvent B (1-propanol containing 0.05% TFA
YMC-Pa pre-equilibrated with 25% B
ck PROTEIN-RP (YMC, catalog number
A-PRRP-33-46-25; diameter 0.46 cm,
Pour 0.3 ml of culture supernatant into the column (bed height 15 cm).
And flow 25% B for 5 minutes at a flow rate of 0.4 ml / min.
After that, linear concentration from 25% B to 50% B for 50 minutes
Fractionation was performed on a gradient. TPO activity is 34.5% -43.5
It was eluted in the range of% 1-propanol, and this was centrifuged.
It was dried by poration to obtain a partially purified sample. Then the real
The non-reducing SDS-PAGE gel described in Example 1 was used to extract proteins.
After white matter extraction operation, TPO activity in M-07e assay system
Or the Western analysis described in Example 45.
To the reduced DPCIII marker by
The molecular weight was measured. As a result, an apparent molecular weight of about 69
000 to 94000 has a wide range of TPO activity,
The non-uniformity of molecular weight could be confirmed. And like this
N-Glycanase (Genzyme, Catalysis
After the N-linked sugar chain cleavage according to log number 1472-00)
Reducing DPCIII marker for TPO
The apparent molecular weight for
~ 40,000, which should be estimated from the size of the peptide chain
It is found that the molecular weight is still higher than about 35,000.
However, it was strongly suggested that it also contains an O-linked sugar chain. this
Human full-length TPO expressed in COS1 cells as in
(Expression plasmid pHTP1, derived from P1 clone)
When the apparent molecular weight was also examined, 630000-
It was 83000. <Example 38> Biological characteristics of human TPO Primarily, the expression plasmid pHTF1 was transfected into COS1 cells.
Culture containing TPO activity obtained by transfection
Human and rat blood system of human TPO using supernatant
The effect on cells was examined. C prepared from human cord blood
D34⁺, DR⁺Colony assay system using cell fraction
When tested with, a significant number of megakaryocytes by human TPO
Colonies formed. For example, the expression plasmid pHT
COS transfected and expressed 1-231
6000 cells under the condition of adding 10% of 1 cell culture supernatant
CD34⁺, DR⁺An average of 11.5 megakaryocytes from cells
Colonies formed. Human peripheral blood from Ficoll-
White blood cell fraction obtained by specific gravity centrifugation using Paque
Plastic-adherent cells from the
AIS cells that have an affinity for (soybean agglutinin)
Using Micro Selector CD34 (Asahi Medical Co., Ltd.)
Removed by the panning method and finally
Panning method using Kuta CD34 (Asahi Medical Co., Ltd.)
At CD34⁺A cell fraction was obtained. Human T
PO (transfection of the expression plasmid pHTF1
The expressed COS1 cell culture supernatant),
After liquid culture for a day, large size GpIIb /
IIIa⁺Selective growth of cells was observed, and this G
pIIb / IIIa⁺In cells, ploidy of the nucleus (ploid
y) was increasing. From this, human TPO
Acts specifically on megakaryocyte progenitor cells to promote their proliferation and differentiation
It was strongly suggested to promote. Minutes from rat bone marrow cells
Separated and purified GpIIb / IIIa⁺Cell fraction, and G
pIIb / IIIa⁺The plaster of the previous stage to obtain the cell fraction
Colony assay system using non-adherent cell fraction
As a result of the assay, human TPO showed a significant number of megakaryocytes.
Ronnie was formed. For example, the expression plasmid pHTF
COS1 cell culture in which 1 was transfected and expressed
100% on the 5th day of culture under the condition of adding 20% of nutrient supernatant.
0 GpIIb / IIIa⁺Average of 34.5 cells
Megakaryocyte colonies and 20,000 plastics
An average of 28.5 megakaryocyte colonies formed from non-adherent cells
Was made. In addition, the plastic non-adherent cell fraction
There are various types of progenitor cells other than karyocytes, but human
Only megakaryocyte colonies were formed by addition of TPO
TPO strongly acts on megakaryocyte progenitor cells specifically
Was suggested. In addition, GpIIb / I derived from rat bone marrow
IIa⁺The cell fraction was converted to human TPO (expression plasmid pHT
COS1 cells transfected and expressed with F1
Liquid culture in the presence of 20% culture supernatant) for 3-5 days
And examined the ploidy of the nucleus,
The ploidy was clearly increased on the 5th day. <Example 39> Glutathione-S-transferase (GST) and histone
To TPO (amino acids 1-174) fusion protein (hereinafter
Below, this fusion protein was labeled as "GST-TPO (1-17
4) ")) E. coli expression vector construction In order to facilitate expression of human TPO in E. coli,
Artificial encoding TPO and containing E. coli preferred codons
The gene was created. This DNA base sequence is E. coli
Amino terminal methionine codon (ATG) for translation initiation
-1 position. 1-12 shown in Table 12
Producing Rigonucleotides and Synthetic Oligonucleotides of 2-11
Reotide 1 with T4 kinase (Pharmacia)
mM ATP, 10 mM Tris-acetate,
10 mM Mg-acetate, 50 mM K-ac
Phosphorylated in a solution of etate. These synthetic orientations
In order to convert the gonucleotide into 6 double-stranded DNAs, 1
And 2; 3 and 4; 5 and 6; 7 and 8; 9 and 10; 1
10 single-stranded DNA combinations of 1 and 12 respectively
mM Tris / HCl (pH 7.5), 10 mM M
gCl₂Annealed in a solution of 50 mM NaCl
Was. Then 3 double strands of 1 and 2; 3 and 4; 5 and 6
DNA and three sets of 7 and 8; 9 and 10; 11 and 12
Double-stranded DNA of T4 ligase (life techno
(Manufactured by Rosie Co., Ltd.)
Was similarly reacted with T4 ligase. This rye
The DNA obtained by the gation reaction was digested with BamHI
2% agarose gel after digestion with Ngermannheim)
Electrophoresis, and the fragment size of about 390-400bp.
Prep 7A-Gene DNA Purification Kit
Purified and digested with XbaI, BamHI pUC18
Subcloned into E. coli DH5
was used). Among the obtained clones, shown in Table 13.
Encoded human TPO and contains E. coli preferred codons
A clone containing an artificial gene
And select this as pUC18 (XB) (1-123).
did. Sequence listing of the DNA sequences of the coding strands of Table 13
It is shown in (SEQ ID NO: 9).

[Table 12]

[Table 13] CD from 1 μg of poly (A) ⁺ RNA derived from normal human liver
The first strand of NA was synthesized using an oligo dT primer as a primer, and PCR was performed using 0.1 volume of the cDNA synthesis reaction solution as a template. Using hTPO-C and hTPO-co (EcoRI) as primers, the reaction was performed in a volume of 100 μl (after 96 ° C. for 2 minutes, 95 ° C. for 1 minute / 58 ° C. for 1 minute / 72 ° C. for 1 minute for 30 cycles. React,
72 ° C for 7 minutes). Human T obtained by this
2 after digestion of POcDNA fragment with BamHI and EcoRI
% Agarose gel, fragments about 600 bp in size were collected, purified with Prep-A-gene DNA purification kit, and subcloned into pUC18 digested with EcoRI and BamHI (host was E. col.
i DH5α was used). A clone encoding the correct human TPO nucleotide sequence was selected by analysis of the nucleotide sequence and designated as pUC18 (BE) (124,332). The sequences of the PCR primers used here are as follows. pUC18 (BE) (124-332) was digested with BamHI and EcoRI, and then electrophoresed on a 2% agarose gel to recover a C-terminal fragment of human TPO cDNA having a size of about 600 bp to prepare a prep-A-gene DNA purification kit. Purified with E. coli and digested with EcoRI and BamHI
It was subcloned into UC18 (XB) (1-123) (the host used E. coli DH5α). The clone obtained here was designated as pUC18 (XE) 1-332).
And From the examples in which various deletion constructs on the C-terminal side of human TPO cDNA were prepared and expressed in vitro and human TPO activity was measured, it was revealed that human TPO amino acids 1-163 retain human TPO activity. Therefore, we decided to construct an expression vector containing this peptide fragment. Here, GST
-Expression of TPO (1-174) was performed. Since the base sequence corresponding to 681-686 (amino acids 173-174) of the pHTF1 clone is recognized by the restriction enzyme SacI, a stop codon was introduced by two synthetic oligonucleotides utilizing this restriction enzyme recognition site. Specifically, two synthetic oligonucleotides SSE1 and SSE
2 to 10 mM Tris / HCl (pH 7.5), 10
Annealing was performed in a solution of mM MgCl ₂ , 50 mM NaCl, and the double-stranded DNA obtained here was treated with SacI, E
About 4 C-terminal side of human TPO cDNA after digestion with coRI
It was introduced into pUC18 (XE) (1 to 332) excluding 80 bp using DNA Ligation Kit (manufactured by Takara Shuzo), and clone pUC18 (XS) (1-17).
4) was obtained (the host was E. coli DH5
was used). The sequences of the synthetic oligonucleotides used here are shown in Table 14.

[Table 14] pUC18 (XS) (1-174) was added to XbaI, Eco
After digestion with RI, electrophoresis on 2% agarose gel
A fragment of about 600 bp in size encoding PO amino acids 1-174 was recovered to prepare prep-A-gene D.
Purified with NA purification kit and subcloned into pBluescript IISK ⁺ (manufactured by Stratagene) digested with XbaI and EcoRI (host is E.col).
i DH5α was used). The clone obtained here was designated as pBL (XS) (1-174). Further, in the same manner as above, pBL (XS) (1-174) is replaced with XbaI,
After digestion with HindIII, human TPO amino acids 1-17
A fragment of about 550 bp in size encoding 4 was recovered, purified with Prep-A-Gene DNA Purification Kit, and digested with XbaI, HindIII to pCFM53.
6 (specification Sho 60-501988) (E. coli DH5α was used as the host). The clone obtained here was cloned into pCFM536 / hT (1-17).
4). PGE, a fusion protein expression vector with glutathione-S-transferase (GST)
GST-TP by X-2T (Pharmacia)
To express O (1-174), the following was performed. PCR was performed using pCFM536 / hT (1-174) as a template and two PCR primers GEX1 and GEX3 (after 96 ° C. for 2 minutes, 95 ° C. for 1 minute / 41 ° C. for 1 minute / 72 ° C. for 1 minute). For 22 cycles and 72 ° C. for 7 minutes). The thus obtained fragment encoding human TPO was digested with NaeI and EcoRI and then electrophoresed on a 2% agarose gel to recover a fragment having a size of about 550 bp to prepare prep-A-gene D.
It was purified with NA purification kit and cloned into pGEX-2T digested with EcoRI and Smal (the host was E.co.
Clone pGEX-2T / hT (1-17), which encodes the correct human TPO nucleotide sequence.
4) was selected by analysis of the nucleotide sequence, and this was selected as GST-
It was used as a transformant for expressing TPO (1-174). The sequences of the PCR primers used here are as follows. This expression plasmid also contains a GST protein followed by a thrombin recognition sequence, and human TPO (amino acids 1-17).
4) which contains the sequence encoding. The thrombin recognition sequence and the sequence encoding human TPO (amino acids 1-174) are shown in the sequence listing (SEQ ID NO: 10). <Example 40> Expression of GST-TPO (1-174) in Escherichia coli The transformant obtained in Example 39 was treated with ampicillin 50.
60 ml of LB medium containing μg / ml was cultured by shaking at 37 ° C. overnight, and 25 ml of this culture solution was added to 50 μg / ampicillin.
In addition to 1000 ml of LB medium containing 100 ml, OD is A
Shaking culture was carried out at 37 ° C. until ₆₀₀ reached 0.7-0.8. Then IPT to a final concentration of 0.1 mM
G was added, and the mixture was further cultivated with shaking for 3 hours to give GST-TP.
The expression of O (1-174) was induced. <Example 41> GST derived from clone pGEX-2T / hT (1-174) encoding a human TPO nucleotide sequence expressed in Escherichia coli.
-TPO (1-174) purification and activity confirmation Clone pGEX-2 encoding human TPO nucleotide sequence
GST-TPO (1-17) derived from T / hT (1-174)
4) 10 ml of water was added to 5.9 g of the production recombinant frozen cells to suspend the cells, and the cells were crushed with a high-pressure crusher. GST-TPO (1-174) was recovered in the precipitated fraction by centrifugation, and most of the mixed proteins, bacterial components, etc. were removed. Next, 5 ml of water was added to the recovered precipitation fraction containing GST-TPO (1-174) to suspend it, and then 6 ml of 1M Tris buffer solution pH 8.5 was added with stirring to 10M urea 1
20 ml and 16 ml of water were added. After stirring and solubilizing at room temperature for 5 minutes, the solution was divided into four equal portions, and each of the following (1) to
Four operations of (4) were performed. (1) 20 mM Tris
It was diluted 10-fold with buffer pH 8.5. Reduced glutathione and oxidized glutathione were added thereto to make final concentrations of 5 mM and 0.5 mM, respectively, and the mixture was allowed to stand at 4 ° C. overnight. GST-TPO (1-174) was added to the supernatant by centrifugation.
Of 20 mM sodium citrate buffer pH
After 2-fold dilution with 5.5, the pH was adjusted to 5.5 with acetic acid. 20 mM sodium citrate buffer pH 5.5
Sepharose Fast F equilibrated with
low (Pharmacia Biotech, catalog number 17-0729-01) GST-on a cation exchange column.
TPO (1-174) was adsorbed. 20 mM of the same resin
After washing with sodium citrate buffer pH 5.5, 5
GST-TPO (1-1) was prepared using 20 mM sodium citrate buffer pH 5.5 containing 00 mM sodium chloride.
74) was eluted. To 129 ml of the eluate, 2.6 ml of 1M Tris buffer pH 8.5 was added to adjust the pH to 8.1.
Glutathione sepharose 4B (Pharmacia Biotech, Catalog No. 17-0756-0).
1) It was added to the column to adsorb GST-TPO (1-174). After washing with PBS, GS was added with 20 mM Tris buffer (pH 8.5) containing 10 mM reduced glutathione.
T-TPO (1-174) was eluted. Thrombin 37 NIH Unit was added to the eluate, and the mixture was allowed to stand at room temperature for 4 hours, diluted 10-fold with PBS, and added to a glutathione Sepharose 4B column to adsorb the cut GST,
TPO (1-174) was collected in the non-adsorbed fraction. The collected non-adsorbed fraction was treated with 20 mM sodium citrate buffer
SP Se diluted 3-fold with 5.5 and equilibrated with the same buffer
PhaloseFast Flow cation exchange column was added, and sodium chloride concentration of 0M to 5 was added in the same buffer solution.
Elution was performed by the linear gradient method up to 00 mM. (2) All the operations of (1) are 0.1% polysorbate 80.
Done in the presence. (3) Diluted 10 times with 20 mM Tris buffer pH 8.5. To this, reduced glutathione and oxidized glutathione were added to give final concentrations of 5 mM and 0.5 mM, respectively.
Let stand overnight at 4 ° C. GST in the supernatant by centrifugation
-TPO (1-174) was recovered, diluted 20-fold with 20 mM sodium citrate buffer (pH 5.5), and adjusted to pH 5.5 with acetic acid. SP Seph equilibrated with 20 mM sodium citrate buffer pH 5.5
arose Fast Flow G for cation exchange resin
ST-TPO (1-174) was adsorbed. Same resin 2
After washing with 0 mM sodium citrate buffer pH 5.5, GST-TPO using 20 mM sodium citrate buffer pH 5.5 containing 500 mM sodium chloride.
(1-174) was eluted. 1 MTris for eluate
The pH was adjusted to about 8 by adding a buffer solution pH 8.5, and thrombin 320 NIH Unit was added and allowed to stand at room temperature for 4 hours, and then 5 mM with a 20 mM sodium citrate buffer solution pH 5.5.
SP Sepharo that has been diluted twice and equilibrated with the same buffer
se Fast Flow cation exchange column, and sodium chloride concentration 0M to 500m in the same buffer.
Elution was performed by the linear concentration gradient method up to M. (4) All the operations of (3) are 0.1% polysorbate 80.
Done in the presence. SP Sepharo obtained by the operations of (1) to (4)
SE Fast Flow cation exchange chromatography sodium chloride concentration of about 200 mM to 400 mM
Each of the fractions eluted in 1. was sufficiently dialyzed against an IMDM culture solution and evaluated by a rat CFU-MK system. As a result, TPO activity was observed in a volume-dependent manner. As a result of analyzing the same fraction by SDS-PAGE in the presence of a reducing agent, a band having a molecular weight of 19 KDa was detected as one of the main protein bands of this fraction (purity 1-20%). For this band, the SDS-PAG was prepared by the method described in Example 1.
After E, it was transferred to a PVDF membrane and subjected to N-terminal sequence analysis. As a result, this pGEX-2T / hT (1-174)
It was confirmed that it contained the sequence of TPO to be expressed as the derived fusion protein. <Example 42> Amino acid 1 (Ser → Ala), amino acid 3 (Ala →
Human TPO (amino acids 1-163) converted to Val)
Construction of E. coli expression vector pUC18 (XE) (1-33) prepared in Example 39
2) was digested with XbaI and EcoRI and then electrophoresed on a 2% agarose gel to recover a fragment of about 1000 bp encoding human TPO amino acids 1-332 and purified with Prep-A-gene DNA purification kit. , X
pBluescript digested with baI and EcoRI
It was subcloned into II SK + (manufactured by Stratagene) (E. coli DH5α was used as a host). The clone obtained here was cloned into pBL (XE) (1-
332). Next, this clone pBL (XE) (1
-332) to the amino acid 163 from the BamHI recognition sequence.
(366-489) was changed to Escherichia coli preferential codon. The synthetic oligonucleotides of 13-20 shown in the table were prepared, and the synthetic oligonucleotides of 13 and 14; 15 and 16; 17 and 18 were T4 in the same tube.
0.1 mM A using kinase (Pharmacia)
TP, 10 mM Tris-acetate, 10 mM
Mg-acetate, 50 mM K-aceta
Phosphorylated in a solution of te. 1/10 amount of 10
0 mM Tris / HCl (pH 7.5), 100 mM
A solution of MgCl ₂ and 500 mM NaCl was added, and the mixture was boiled in a water bath for 3 minutes and then left to stand to form a double-stranded chain D.
It was set to NA. Next, three sets of double-stranded DNAs of 13 and 14; 15 and 16; PCR reaction was performed. PCR obtained by this
The product was digested with BamHI and HidIII and then electrophoresed on a 2% agarose gel to give a fragment of about 130 bP to Prep-A.
-Recovered by Gene DNA Purification Kit. This is Ba
pBL (XE) (1- digested with mHI and HidIII
332) (the host is E. coli)
DH5 was used). Table 15 among the obtained clones
Those having the nucleotide sequence shown in (1) were selected by sequencing and designated as pBL (XH) (1-163).

[Table 15] Furthermore, for the purpose of increasing the expression level of human TPO (amino acids 1-163) and preventing degradation by N-terminal protease, human TPO (amino acids 1-163)
The amino acid at position 1 of Ser is converted to Ser → Ala, and the amino acid at position 3 is converted to Ala → Val.
Mutant human TPO (amino acids 1-163) that encodes Met at the position (hereinafter, such protein is referred to as "h
6T (1-163) ”was constructed to construct an expression vector. Four kinds of synthetic oligonucleotides shown in the table were prepared, and 2-9, 3-3 synthetic oligonucleotides were added to 1 mM ATP, 10 mM Tris-acetate, using T4 kinase (Pharmacia).
10 mM Mg-acetate, 50 mM K-ac
Phosphorylated in a solution of etate. To convert these synthetic oligonucleotides into two double-stranded DNAs, 1-
9 and 2-9; single-stranded DNA in the combination of 3-3 and 4-3, respectively, was added to 10 mM Tris / HCl (pH
7.5), 10 mM MgCl ₂ , 50 mM NaCl
Annealed in the above solution. Then 1-9 and 2-9; 3-
Two sets of double-stranded DNAs, 3 and 4-3, were treated with DNA Liga.
Reaction was performed using a Tion Kit (manufactured by Takara Shuzo). The DNA obtained by this ligation reaction was treated with XbaI,
Subcloning into pBL (XH) (1-163) digested with NruI, and selecting a clone which was correctly replaced by the synthetic oligonucleotide shown in Table 16 by analysis of the nucleotide sequence (E. coli DH5α was used as the host) This was designated as pBL (XH) h6T (1-163).

[Table 16] pBL (XH) h6T (1-163) was added to XbaI, Hi
After digestion with ndIII, mutant human TPO amino acids 1-
A fragment of about 500 bp encoding 163 was recovered, purified with Prep-A-gene DNA purification kit, and digested with XbaI, HindIII to pCFM.
The clone was cloned into E. coli JM109 previously transformed with pMW1 (ATCC No. 39933). The clone obtained here was designated as pCFM536 / h6.
T (1-163), the E. coli strain containing this expression vector was mutated human TPO, that is, h6T (1-16).
3) Used as a transformant for expression. This expression plasmid contains the DNA sequence shown in the sequence listing (SEQ ID NO: 11). <Example 43> Expression of h6T (1-163) in Escherichia coli The expression plasmid pCFM536 is controlled by the λPL promoter, which itself is under the control of the cI857 repressor gene. The transformant obtained in <Example 42> was shake-cultured in 60 ml of LB medium containing 50 μg / ml of ampicillin and 12.5 μg / ml of tetracycline at 30 ° C. overnight, and 25 ml of this culture solution was added with 50 μg / ml of ampicillin. In addition to 1000 ml of LB medium containing OD, OD was 30 until A ₆₀₀ reached 1.0-1.2.
The cells were cultured with shaking at ℃. Then, about 330 ml LB medium at 65 ° C. was added so that the final temperature was 42 ° C., and further 3
The culture was shaken at 42 ° C. for an hour to induce the expression of h6T (1-163). <Example 44> h6 derived from clone pCFM536 / h6T (1-163), which encodes a human TPO nucleotide sequence and was expressed in E. coli.
Purification of T (1-163) and Confirmation of Activity 10 ml of water was added to 3.6 g of the frozen h6T (1-163) producing recombinant frozen cells to suspend the cells, and the cells were crushed with a high-pressure crusher. The precipitate fraction is collected by centrifugation to remove most of the mixed proteins, bacterial components and the like. Recovered h6T (1-
After adding 7 ml of water to the precipitate fraction containing 163) to suspend it, 1M Tris buffer pH 8.5 was added to 3 while stirring.
After adding ml, urea (final concentration 8M), guanidine hydrochloride (final concentration 6M), and N-lauroylsarcosine sodium (final concentration 2%) were added, respectively, and solubilized by stirring at room temperature for 5 to 20 minutes. This is 20 mM Tris buffer pH
After 10-fold dilution with 8.5, the protein was rewound (refolding) overnight at 4 ° C. At this time, in addition to air oxidation, glutathione and copper sulfate were added as additives. H6T was added to the supernatant by centrifugation.
(1-163) was recovered. As a result of analyzing each collected fraction by SDS-PAGE in the presence of a reducing agent, a band having a molecular weight of about 18 K daltons was detected as a main protein band of this fraction by any method (purity: 30-
40%). According to the method described in Example 1, this band was subjected to SDS-PAGE and then transferred to a PVDF membrane to give N.
As a result of end sequence analysis, this pCFM5
It was confirmed that the TPO sequence to be expressed as the mutant TPO derived from 36 / h6T (1-163) was included.
Each fraction was thoroughly dialyzed against IMDM culture medium and evaluated by the rat CFU-MK system. As a result, TPO activity was observed in all fractions in a volume-dependent manner. <Example 45> Preparation of anti-TPO peptide antibody and detection of TPO by SDS-PAGE-> Western analysis If an anti-TPO antibody can be prepared, TP can be obtained by an immunological technique.
O protein can be detected. Therefore, among the first amino acid sequence of rat TPO, three regions (shown in Table 17) that were considered to be relatively suitable as antigens were selected, and Tam (Proc Natl. Aca
d. Sci. USA, 85, 5409-5413, 19
88) the method of four strands MultiPle Ant
As a result of synthesizing igenPeptide (MAP) type peptide and immunizing 2 rabbits each with 100 μg each 8 times, these antisera could be obtained. Amino acid sequence contained in synthetic peptide antigen

[Table 17] Next, of these antisera, first, the anti-RT1 peptide and anti-RT2 peptide antibodies were subjected to a protein A column (PROSEP-A; Bioprocessing).
IgG, manufactured by Ltd., catalog number 8427)
Fractions (2344 mg and 1920 mg, respectively) were obtained, and 54 mg and 32 mg of these fractions were taken, and activated biotin (NHS-LC-Biotin II, PIER) was obtained.
Biotinylated by coupling with CE, Catalog No. 21336). . Similar to the method described in Example 1, the preparation containing recombinant TPO was treated with SDS-P.
It was subjected to AGE, and then electroblotted onto a PVDF or nitrocellulose membrane, and Western analysis was carried out by using these biotinylated antibodies as primary antibodies according to a standard method. That is, the membrane after blotting is 20 mM
Tris-HCl, 0.5M NaCl (pH 7.5)
After washing for 5 minutes with (TBS) and twice with TBS containing 0.1% Tween 20 (TTBS) for 5 minutes, a blocking agent (BlockAce, manufactured by Dainippon Pharmaceutical Co., Ltd., catalog number u)
It was treated with k-B25) for 60 minutes. Then biotinylated anti-TPO peptide antibody at a concentration of 10 μg / ml, 0.05% B
6 with TTBS solution containing SA and 10% BlockAce
After the 0-minute post-treatment, it was washed twice with TTBS for 5 minutes. Next, alkaline phosphatase labeled avidin (Leinco T
manufactured by technologies, catalog number A108)
Was treated with a solution containing 10% BlockAce and a TTBS solution diluted 5000 times for 30 minutes, and then treated for 5 minutes twice with T solution.
After washing with TBS for 5 minutes, the color was developed with an alkaline phosphatase substrate (Bio-Rad, Catalog No. 170-6432). The above Western analysis was carried out at room temperature. As a result, not only various recombinant rat TPO expressed in COS1 cells but also C
Various recombinant human TP expressed in OS1 cells and E. coli
O (specifically, plasmid pHTP1 or human TPO derived from plasmid pHTF1 expressed in COS1 cells and TPO after cleavage of its N-linked sugar chain, GST-TPO (1- 17
4) and its thrombin-digested TPO, and the mutant TPO expressed in E. coli, h6T (1-163), were also recognized. Then, it became possible to use for analysis of these various recombinant human TPOs. It was shown that it is possible to prepare an anti-human TPO peptide antibody in the same manner as the above method. With the antibodies obtained by these methods, not only Western analysis but also TP by antibody column
It can be applied to all immunological techniques using antibodies that are usually considered, including O purification. Further, in the amino acid sequence of human TPO shown in SEQ ID NO: 6, it was found that 6 regions were considered to be relatively suitable as an antigen (Table 1
9) and select Tam (Proc. Natl. Ac
ad. Sci. USA, 85, 5409-5413, 1
988) and a four-stranded Multiple An
A peptide of Tepten Peptide (MAP) type was synthesized, and 100 μg of each peptide was immunized into 2 rabbits 8 times each. C of each peptide region shown in Table 19
When a single-chain peptide having a cysteine residue at the end was separately synthesized and the antibody titer was examined by using this as a test antigen and enzyme immunoassay, an increase in the antibody titer was confirmed in all sera. Therefore, these were designated as antisera. Since two rabbit antisera were immunized for each antigen peptide, the antibody was prepared separately for each rabbit. Specifically, the individual rabbit rabbits derived from these are distinguished, and the anti-HT1 peptide antibodies are referred to as anti-HT1-1 peptide antibody and anti-HT1-2 peptide antibody, respectively. The purification of anti-HT1-1 peptide antibody is shown below as an example. First, 30 mg of the HT1 single-chain peptide having a cysteine residue bound thereto was added to 12 ml of Sul.
It was bound to foLink coupling gel (Pierce, Catalog No. 44895). That is, 6 times the gel volume of the coupling buffer (50 mM Tri
The peptide solution containing the antigen was coupled to the gel equilibrated with s, 5 mM EDTA-Na pH 8.5) for 15 minutes. Then, after allowing to stand for 30 minutes, the gel was washed with a coupling buffer having a volume three times the volume of the gel. Next, a coupling buffer containing 0.05 M L-Cystein-HCl was added at a rate of 1 ml / ml gel to block unreacted groups for 15 minutes. Then, after standing for 30 minutes, the gel was washed with a coupling buffer having a volume 8 times the volume of the gel. The above coupling was performed at room temperature. In this way, the peptide containing the antigenic region was covalently bound to the gel with a coupling efficiency of 28.3% to give 1 ml.
An antigen peptide antigen column was prepared with 0.8 mg of bound peptide per gel. Next, anti-H after whole blood sampling
Of the 78.4 ml of antiserum containing the T1-1 peptide antibody, 76.7 ml (protein amount of 3620 mg) was preliminarily set to 150 m.
50% M NaCl, 0.05% sodium azide
After adding to the antigen column equilibrated with mM phosphate buffer (pH 8) and further washing with the same buffer, 105.9 ml of the flow-through fraction (protein mass 3680 mg) was obtained. Then 0.1M
The adsorbed fraction was eluted with citrate buffer (pH 3.0) and immediately 21.1 ml of 0.1 M carbonate buffer (pH 9.
9) was added and neutralized, followed by ultrafiltration (YM30 manufactured by Amicon).
Concentrate with a membrane and 11.2 ml (protein mass 77.7 m)
It was possible to obtain a purified anti-HT1-1 peptide antibody in a solution of g) in 50 mM phosphate buffer (pH 8) containing 150 mM NaCl, 0.05% sodium azide. Similarly, an anti-HT1-2 peptide antibody (60.0
mg), an anti-HT2-1 peptide antibody (18.8 mg),
An anti-HT2-2 peptide antibody (8.2 mg) could be obtained. Anti-HT3-6 peptide antibody can be obtained in the same manner. Affinity-purified anti-HT1-1 peptide antibody, anti-HT1-2 peptide antibody, anti-HT2-1
Peptide antibody, anti-HT2-2 peptide antibody 3 each
Take mg to obtain active biotin (NHS-LC-Bioti
n II, PIERCE, Catalog No. 2133
6) Biotinylated by coupling with 6).

[Table 19] Recombinant human T partially purified from the culture supernatant of CHO cells into which the gene encoding the amino acid sequence of
The PO sample was subjected to SDS-PAGE according to a standard method, then electroblotted onto PVDF or a nitrocellulose membrane, and Western analysis was carried out in the same manner as in the case of the above-mentioned anti-RT peptide antibody. It was confirmed that human TPO was recognized and detected. <Example 46> Preparation of anti-TPO peptide antibody column The anti-rat TPO peptide antibody obtained in Example 45 was
Since it was able to recognize rat and human TPO, the immunoglobulin (IgG) fractions of the anti-RT1 peptide antibody and the anti-RT2 peptide antibody were bound to the chromatography carrier as follows, and the anti-TPO peptide antibody column was loaded. It was made. The antibody used as the material was derived from 2 rabbit antisera for each antigen peptide, and the antibody was prepared separately for each rabbit. Specifically, the anti-RT1 peptide antibody is referred to as an anti-RT1-1 peptide antibody and an anti-RT1-2 peptide antibody, respectively.
For peptide antibodies, anti-RT2-1 peptide antibody and anti-RT
It is called a 2-2 peptide antibody. Since these were separately prepared as antibody columns, the number of anti-RT1 peptide antibody columns was 2
Species (respectively referred to as anti-RT1-1 antibody column and anti-RT1-2 antibody column), anti-RT2 peptide antibody column includes two species (respectively referred to as anti-RT2-1 antibody column and anti-RT2-2 antibody column), and further anti-RT1 -2 peptide antibody and anti-RT2-1 peptide antibody were mixed and coupled to a gel to prepare 5 kinds of antibody columns (anti-RT1-2 + 2-1 mixed antibody column). 5 mg / ml of each antibody
50 mM Na Ph at a concentration of (2.5 mg / ml in which anti-RT1-2 peptide antibody and anti-RT2-1 peptide antibody were mixed in equal amounts in the anti-RT1 + 2mix antibody column)
osphate, 0.15M NaCl (pH 8.0)
2.31 ml of the swollen formyl-activated gel (Formyl-Cel).
lulofine, manufactured by Chisso Corporation), 4 ° C
And the coupling reaction was carried out for 2 hours. Then 10 mg /
ml reducing agent solution (Trimethylamin
1.1 ml of e borane (TMAB), manufactured by Seikagaku Corporation, catalog number 680246) was added, and after coupling reaction for 6 hours, only the gel portion was recovered by centrifugation. To this, 10 ml of purified water was added, and the operation of collecting only the gel portion by centrifugation was repeated 4 times,
Unreacted antibody was removed. Then 4.6 ml of blocking buffer (0.2 M Na Phosphate, 1
Methanol amine (pH 7.0)) and 1.1 ml of a reducing agent solution were added, and the mixture was treated at 4 ° C. for 2 hours or more to block the active groups of the unreacted gel. Finally, the gel was washed with purified water and DPBS using centrifugation, packed into a small column tube, 3M potassium thiocyanate solution, 0.1M glycine-HCl (pH 2.
5) After washing with the solution, it was re-equilibrated again with DPBS and stored. The anti-RT1-1 antibody column, the anti-RT1-2 antibody column, the anti-RT2-1 antibody column, the anti-RT2-2 antibody column, and the anti-RT1-2 + 2-1 mixed antibody column each have five types of anti-TPO peptide antibody gels. The coupling efficiencies of IgG fractions are 97.4%, 95.4%, 9 in order.
It reached 8.4%, 98.3% and 99.4%. The amount of IgG fraction coupled per gel volume was 5.6 mg / ml gel, 5.8 mg / ml gel,
5.7 mg / ml gel, 5.7 mg / ml gel, 2.9
It was a mg / ml gel. Therefore, it was confirmed that there was no great difference in the coupling efficiency and the coupling amount depending on the origin of the antibody and the difference in the antigen. Therefore, the experiment shown in Example 47 was performed using these antibody columns. <Example 47> Purification of culture supernatant-derived TPO obtained by transfecting expression vector pHTP1 into COS1 cells by anti-TPO antibody column → reverse phase column chromatography-confirmation of biological activity As an in vitro assay method for evaluation, the M-07e assay system was used. A partially purified preparation of TPO derived from the culture supernatant of Example 35 obtained by transfecting COS1 cells with the expression vector pHTP1 (a fraction that is not the main fraction in which TPO was recovered, that is, Macro-Prep Methyl HI).
C column flow-through fraction F1 and F2 followed by 20 mM N
a Citrate, column washed with pH 5.8 and eluted, F3, SP Sepharose Fast Flo
F1 and F3 of the w column were collected together and the TPO subpool fraction (546.379 ml, protein concentration 0.490 mg / m
1, total protein mass 2676 mg, relative activity 12100, relative activity 32380000), ultrafiltration unit (Filtron Omega Ultraset molecular weight 8)
(000 cut), the solvent was first replaced with DPBS, and when the volume became small, an ultrafiltration unit with a YM-10 membrane (manufactured by Amicon) was used to finally obtain 120.
The solution was 2 ml of DPBS containing 0.05% sodium azide. Next, 5 kinds of anti-TPO prepared in Example 46
All the peptide antibody gels were mixed, put together in one antibody column (diameter 1.6 cm, bed height 4.8 cm, referred to as anti-RT1 + 2 mixed antibody column), and flow rate 0.033 at room temperature.
The TPO subpool fraction was added at ml / min. After the addition was completed, the eluate was collected until the UV absorption of the eluate was sufficiently reduced, and further concentrated by an ultrafiltration unit with a YM-10 membrane (manufactured by Amicon) to pass-through fraction F1 (82.6).
2 ml, protein concentration 14.3 mg / ml, total protein mass 1
184 mg, relative activity 67500, relative activity amount 7990
0000) was collected. Next, a column adsorption fraction F2 (92.97 ml, protein concentration 0.12 mg / m) eluted with an acidic eluent (0.1 M glycine-HCl (pH 2.5)) was used.
1, total protein mass 11.1 mg, relative activity 257100,
The relative activity amount 2860000) was eluted. Pass-through fraction F
1 had a considerable amount of TPO activity, but TPO adsorbed on the antibody column showed an increase in relative activity of about 20-fold, and therefore was further purified. That is, developing solvent A
1-propanol containing 0.1% TFA as the developing solvent and 0.05% TFA as the developing solvent B was used for Capcell Pak.
C1 300A (manufactured by Shiseido, catalog number C1 TYP
E: SG300A; diameter 4.6 mm, bed height 15
In addition to 0 mm, a pre-column with a diameter of 4.6 mm and a bed height of 35 mm was connected.) In a column, 1/10 volume of developing solvent B was added to F2 obtained in the antibody column.
Capcell Pak C13 equilibrated with 0% B
It was injected into the 00A column at a flow rate of 0.4 ml / min. After the injection was completed, elution was performed with 20% B for 5 minutes, and then a linear concentration gradient from 20% B to 40% B was developed for 50 minutes to obtain 1 ml.
(2.5 min) each was collected in a polypropylene tube. Take 2 μl (1/500 fraction) of each, add HSA, concentrate by ultrafiltration, and finally 0.02%
A 0.25 ml IMDM assay culture solution containing HSA was prepared and assayed to identify the TPO active fraction. As a result, it was possible to obtain a preparation having a strong TPO activity in tube numbers 20 to 23 (in the range of 28.5 to 32.5% in propanol concentration). Further, when these samples were subjected to Western analysis by the method described in <Example 45>, the apparent molecular weight under reduction was 60000 to 7000 with respect to the DPCIII molecular weight marker.
There is certainly a TPO of 0, apart from this, 32000
It was found that there are also molecules having a molecular weight of ˜43,000 and 20,000 to 30,000. <Example 48> Capsell derived from the culture supernatant obtained by transfecting the expression vector pHTP1 into COS1 cells.
Confirmation of biological activity of TPO purified to the stage of Pak C1 300A column The TPO active fraction purified in Example 36, namely Capc
Tube number 2 for the ell Pak C1300A column
Up to 0-23 (in the range of 28.5-32.5% in propanol concentration) was collected, 0.21 ml of glycerol was added, and then concentrated by centrifugal evaporation. Add 0.21 ml of 6M guanidine hydrochloride solution to this and add 1 with DPBS.
After diluting to ml, Sephadex G25 column (NA
P-10, Pharmacia Biotech, Catalog No. 17-0854-01) was replaced with a DPBS solution containing 0.01% HSA, and 1.1 ml of 0.01% was added.
DPBS containing HSA was added to finally prepare a TPO active fraction FA (2.6 ml). An in vivo assay was performed to examine the biological TPO activity of this preparation. That is, 100 μl of the active fraction (including the relative activity amount of 87400 in the M-07e assay system) was added to 4 male ICR mice (8 weeks old) per group once a day for 5 days.
It was subcutaneously administered every day. As a control, 0.01% HSA
100 μl of DPBS containing was subcutaneously administered on the same schedule. Blood was collected from the fundus immediately before the start of administration and on the day after the end of administration, and a blood cell measuring device (F80 manufactured by Toa Medical Electronics Co., Ltd.
0) was used to measure the platelet count. In the TPO administration group,
After the end of administration, the average increase in platelets was 1.42 times compared to that before administration, and it was 1.23 times higher than the number of platelets in the control group, showing a significant difference (p <0,
05, Student-test). From this result, it became clear that the above human TPO produced in animal cells has a platelet increasing action in vivo. <Example 49> Confirmation of biological activity of crudely purified TPO fraction obtained by cation exchange column using 33 L of culture supernatant obtained by transfecting COS1 cells with expression vector pHTP1 as a starting material (1 ) In- vitro for evaluation of the following purified samples
The ro assay method used was the M-07e assay system.
Serum-free culture supernatant obtained by transfecting COS1 cells with 33 L of the expression vector pHTP1 was obtained in the same manner as in the method described in Example 36 to obtain 0.22 μm.
The filtrate of the m filter was taken. This was concentrated about 10 times with an ultrafiltration unit (PLGC Pellicon cassette, molecular weight cut 10,000, manufactured by Millipore), and p-APMSF, which is a protease inhibitor, was added to a final concentration of about 1 mM, and the volume was 2018 ml (protein concentration 3.22 mg. / M
1, total protein mass 6502 mg, relative activity 66000, relative activity 429100000) were obtained. Next, the concentration process was repeated using an ultrafiltration unit (Filtron, Omega Ultraset, molecular weight cut: 30,000), and a fraction having a molecular weight of 30,000 or more (volume: 1190 ml, protein concentration: 2.54 mg / ml, total protein mass: 3020 mg, relative) Activity 82,500, relative activity amount 249000000), and a fraction having a molecular weight of 30,000 or less (volume 2975 ml, protein concentration 0.471 mg / ml, total protein mass 1402 mg,
A relative activity of 4500 and a relative activity of 6310000) could be obtained. The presence of TPO activity in the fraction having a molecular weight of 30,000 or less indicates that the culture supernatant may contain low-molecular-weight TPO in the process of expression and secretion of TPO in animal cells. Show. On the other hand, molecular weight 30
More than 000 fractions were further replaced with 20 mM sodium citrate buffer (pH 6.1) and pre-equilibrated with 20 mM sodium citrate buffer (pH 6.1) SP S.
epharoseFast Flow (Pharmacia
Biotech, Catalog No. 17-0729-01;
(Diameter: 2.6 cm, bed height: 29 cm), and the mixture was added at a flow rate of 5 ml / min. After the addition was completed, the product was washed and eluted with a 20 mM sodium citrate buffer (pH 6.1). Next, 20 mM sodium citrate buffer solution (pH 6.1) was used as the developing solvent A, and 1M N was added to the developing solvent A.
Using a solution containing aCl as developing solvent B, flow rate 3 ml
A linear concentration gradient of 0% B to 50% B for 215 minutes / min, and 50% B to 100% B for 20 minutes was developed and collected in polypropylene tubes at 30 ml (10 min). Taking a part of these and examining the distribution of activity in the M-07e assay system, T
It was found that the PO activity was eluted. Therefore, the fraction eluted with 50 mM or less of NaCl including the flow-through was
1, 50-1000 mM NaC as the main fraction of TPO
Fractions eluted with 1 were pooled as F2. F1 has a volume of 1951 ml (protein concentration 2.05 mg / ml, total protein mass 3994 mg, relative activity 13500, relative activity 5
39,000,000) and F2 had a volume of 649.8 ml (protein concentration 1.11 mg / ml, total protein mass 721 mg, relative activity 268,000, relative activity amount 193,000,000). (2) SP Sepharose Fast Flow
Confirmation of biological activity of F2 SP Sepharose Fast collected in (1)
Take 2.5 ml of F2 from Flow and use Sephadex
G25 column (NAP-25, manufactured by Pharmacia Biotech, Catalog No. 17-0852-01) was replaced with 3.5 ml of DPBS solution containing 0.01% HSA, and this sample (protein concentration 1.46 mg / ml) in order to investigate the biological TPO activity, in vi
The vo assay was performed. That is, 100 μl of active fraction (M-07e) was added to 4 male ICR mice (8 weeks old) per group.
1 day per day (including 3150 relative activity in assay system)
Subcutaneous administration was performed once every day for 5 days. As a control, 0.01%
100 μl of DPBS containing HSA was subcutaneously administered on the same schedule. Blood collection was performed from the fundus immediately before the start of administration and on the day after the end of administration, and a blood cell measuring device (Famous product manufactured by Toa Medical Electronics, F
800) was used to measure the platelet count. In the TPO-administered group, the average was 1.2 after the administration as compared with before administration.
A 9-fold increase in platelets was observed, which was 1.12-fold higher than that of the control group, indicating a significant difference (p <
0.05, Student t-test).
From this result, the above human TPO produced in animal cells
However, it was revealed that they have a platelet increasing action in vivo. <Example 50> Construction of recombinant expression vector of human TPO chromosomal DNA for CHO cells, pDEF202-ghTPO The vector pDEF202 was digested with restriction enzymes KpnI and SpeI.
The fragment containing the smaller mouse DHFR minigene and SV40 polyadenylation signal was recovered by agarose gel electrophoresis, and the plasmid pEFHG containing this fragment and human TPO chromosomal DNA was recovered.
Vector D in which TE was treated with restriction enzymes KpnI and SpeI to remove the region containing the SV40 polyadenylation signal
NA was ligated with T 4 DNA ligase (Takara Shuzo) to obtain an expression vector pDEF202-ghTPO.
This plasmid contains the replication origin region of SV40, human elongation factor-1-alpha promoter, SV
40 early polyadenyl site, mouse DHFR minigene, replication initiation region of pUC18, β-lactamase gene (Amp ^r ), and human TPO chromosome D downstream of human elongation factor-1-alpha promoter.
NA is connected. <Example 51> Expression of human TPO chromosomal DNA by CHO cells CHO cells (dhfr-strain, Urlaub and Chasi)
n; Proc. Natl. Acad. Sci. USA;
77 vol. 4216, 1980) in a 6 cm diameter plate (manufactured by Falcon) in α minimum essential medium (α-MEM (-), thymidine, hypoxanthine added) containing 10% fetal calf serum, and this is grown. Transformation was performed by the calcium phosphate method (CellPhect, manufactured by Pharmacia). That is, pDEF prepared in Example 50
After adding 120 μl of buffer A and 120 μl of H20 to 10 μg of 202-ghTPO plasmid and mixing, the mixture was left at room temperature for 10 minutes. Next, 120 μl of buffer B was added to this solution and mixed again,
It was left for 30 minutes at room temperature. After this DNA solution was dropped on the plate, it was cultured in a CO ₂ incubator for 6 hours. After removing the medium from the plate and washing twice with α-MEM (-), α containing 10% dimethyl sulfoxide was used.
-MEM (-) was added, and the mixture was treated at room temperature for 2 minutes. Then, a non-selective medium containing 10% dialyzed fetal bovine serum (the above α-M
EM (-), hypoxanthine, thymidine added) was added and cultured for 2 days, followed by selection with a selective medium containing 10% dialyzed fetal bovine serum (no α-MEM (-), hypoxanthine, thymidine added). It was For selection, trypsinize the cells and then add 10 cm to each 6 cm-diameter plate.
It was carried out by dividing the medium into 5 plates of diameter or 20 plates of 24 wells and then continuing the culture while exchanging the medium with the selective medium every 2 days. As a result of measuring the human TPO activity in the culture supernatant of the plate or well in which the cells had grown using the Ba / F3 assay, human TPO activity was recognized. In addition, the transformation of CHO cells was performed using pEFHGTE and pMG for CHO cells.
1 for co-transfection
It can also be done by doing. <Example 52> Human TP having Lys at position -1 and Met at position -2
Construction of an E. coli expression vector of O (amino acids 1-163) (hereinafter, this protein is referred to as "hMKT (1-163)"-confirmation of expression / expression) of the amino acid sequence of SEQ ID NO: 6 (position 1-163) In order to express a protein in which Lys was added to the -1 position and Met was added to the -2 position, 1-13, 2-13, 3-3, and 4- shown in Table 18 below were prepared in the same manner as in Example 42. HMKT (1-163) expression vector pCFM536 / hMKT (1-16) for E. coli using the synthetic oligonucleotide of 3
3) was constructed.

[Table 18]This expression plasmid is shown in the sequence listing (SEQ ID NO: 12).
Containing the DNA sequence that was created. Furthermore, the same as Example 43
In this way, the expression of hMKT (1-163) was induced.
The expressed protein obtained here was used for PV after SDS-PAGE.
After transferring to a DF membrane, N-terminal amino acid sequence analysis was performed.
As a result, the amino acid of hMKT (1-163) to be expressed
It was confirmed that the sequence was included. <Example 53> Human TPO nucleotide sequence expressed in Escherichia coli
The clone pCFM536 / h6T (1-1
63) derived variant human TPO, h6T (1-163)
Refolding with guanidine hydrochloride and glutathione
Purification-Confirmation of biological activity Prepared in Example 43
To 1.2 g of recombinant h5T (1-163) -producing recombinant frozen cells
Add 3 ml of water to suspend and crush the cells with a high-pressure crusher.
Was. The precipitated fraction was collected by centrifugation and most of the mixed protein was collected.
Remove white matter and cell components. Recovered h6T (1-
163) was added to the precipitated fraction to suspend it, and the final 4
ml. 1 ml 1M Tris buffer with stirring
After adding pH 8.5, 20 ml of 8M guanidine hydrochloride
Was added and solubilized by stirring at room temperature for 5 minutes. This 2
Dilute 10-fold with 0mM Tris buffer pH 8.5, 5m
M reduced glutathione and 0.5 mM oxidized glutathione
Solution, stir to dissolve, then leave at 4 ° C overnight.
Was. H6T (1-163) was added to the supernatant by centrifugation.
Recovered. 160 ml of the obtained supernatant was used for YM10
Concentrate using an outer filtration membrane (Amicon) and use DPBS
To replace the buffer solution to a final volume of 3.4 ml (protein concentration
2.18 mg / ml). Add this fraction to IMDM culture
After sufficient dialysis, the rat CFU-MK assay system was used.
As a result of evaluation, strong TPO activity (relative activity 5800
0) was shown. TPO active fraction prepared by the above method
About minutesin vivoThe assay was performed. 4 animals per group
Of ICR male mice (7 weeks old) with an active fraction of 170 μm
l (relative activity in rat CFU-MK assay system 22
000) was subcutaneously administered once a day for 5 consecutive days.
As a control, DPBS170 was administered to 6 similar mice per group.
μl was administered subcutaneously on a similar schedule. Blood sampling
Immediately before the start of treatment, the day after the end of administration, and 3 days after the end of administration
Using a blood cell counter (F800 made by Toa Medical Electronics)
The number of platelets was measured by using In the TPO administration group, the day after the end of administration
2.15 times more platelets on average per day than before administration
Was observed and the effect was observed 3 days after the end of administration.
Remained high and maintained a high price of 2.13 times. End of administration
Platelet counts on the following day and 3 days after
1.73 times that of the control group on each day,
It shows a high value of 1.80 times and a significant difference (p <0.
001, Student t-test). This
From the results of the above, it was produced from E. coli and prepared by the above method.
Human TPO has a platelet increasing effect in vivo
Became clear. <Example 54> A clone encoding a human TPO nucleotide sequence expressed in E. coli.
Lone pCFM536 / h6T (1-163) -derived mutation
-Type human TPO, h6T (1-163) N-lauroyl
Refolding with sarcosine sodium and copper sulfate
-Purification-Confirmation of biological activity Recombinant production of h6T (1-163) prepared in Example 43
Suspended by adding 3 ml of water to 0.6 g of frozen body, high pressure
After crushing the cells with a crusher, centrifuge to separate the precipitate fraction.
Recovered. The precipitate fraction was suspended by adding 3.1 ml of water.
Then 0.19 ml of 1M Tris buffer pH 9.2, 1
1.25 μl of 1 M DTT, 38 μl of 0.5 MED
TA, 0.38 ml of 10% sodium deoxycholate
Was added with stirring, and the mixture was stirred at room temperature for 40 minutes. Distant
Precipitated fractions were collected by heart separation, and most of the mixed proteins,
The cell components and the like were removed. Suspended by adding 4 ml of water to the precipitate
And then containing h6T (1-163) by centrifugation
The precipitated fraction was collected. 3.8 ml of water was added to the obtained precipitate fraction.
After adding and suspending, while stirring, 0.2 ml of 1 MTr
is buffer pH 8 and 1 ml of 10% N-lauroyl monkey
Add cosin sodium and stir for 20 minutes at room temperature.
Solubilized. To this, add 5 μl of 1% copper sulfate,
Stir overnight (about 20 hours). H6T by centrifugation
After collecting the supernatant fraction containing (1-163), the supernatant 5 m
1 ml of 5 ml water, 10 ml of 20 mM Tris buffer p
After adding H7.7, 2.6 g of Dowex 1-x4
20-50 mesh, chloride form i
On-exchange resin was added and stirred for 90 minutes. Grass fill
After collecting the ion-exchange resin non-adsorbed fraction using a filter,
The supernatant was collected by centrifugation. 20 times the obtained supernatant
SP Se equilibrated with mM Tris buffer pH 7.7
pharose Fast Flow cation exchange color
NaCl concentration of 0M to 500 in the same buffer.
Elution was performed by the linear gradient method up to mM. Melting
After sufficient dialysis of the fractions against IMDM culture medium,
As a result of evaluation by the CFU-MK assay system, SP Sep
haroseFast Flow cation exchange chromatography
Elution is performed at about 100 mM NaCl concentration
TPO activity (relative activity about 1900000)
0) was shown. This fraction is an ultra free CL fractionated molecule
Volume 5000 ultrafiltration unit (Millipore, model number UF
Concentrated 1.6 times using C4LCC25) (2.5m
1, protein concentration 25 μg / ml). Same fraction in the presence of reducing agent
As a result of SDS-PAGE analysis at
It was detected as the main band (purity 70-80%). the above
TPO active fraction prepared by the methodin v
ivoThe assay was performed. ICR male mau with 4 mice per group
Of the active fraction (rat CFU-
1 including the relative activity amount of 47500 in the MK assay system)
Subcutaneous administration was performed once a day for 5 consecutive days. 100 as a control
20 mM Tris buffer pH 7.7 containing mM NaCl
100 μl was administered subcutaneously on the same schedule. Blood sampling
Should be performed from the fundus immediately before the start of administration and the day after the end of administration.
Blood reduction using a sphere measuring device (F800 made by Toa Medical Electronics)
The number of plates was measured. In the TPO administration group, the
Average 1.73 times more platelets than before administration
1.59 times higher than the number of platelets in the control group
And a significant difference (p <0.01, Stude
nt t-test). From this result, E. coli
The human TPO produced by
It is clear that it has a platelet increasing effect in the body
It was. <Example 55> Large-scale culture of CHO cells In Example 32, human TPO expression plasmid pDEF was used.
Transfection of 202-hTPO-P1 into CHO cells
Human TPO producing CHO cell line (C
Mass culture of HO28-30 cells, 25 nM MTX resistance)
The feeding was carried out as follows. 25nM MT cells
DMEM / F-12 medium containing X and 10% FCS
(GIBCO) was used for culture and growth. This cell
After peeling using trypsin solution, 200 ml of the same solution was used.
Falcon roller bottle containing medium (Falc
on3000) 1 x 10⁷Seed cells at 37 ℃
The cells were cultured for 3 days at a rotation speed of 1 rpm. Cultured after 3 days
Remove the liquid by suction and clean the cell culture surface with 100 ml of PBS.
After rinsing, 25 nM MTX and 10% FCS
DMEM / F-12 medium (GIBCO) that does not contain
Add 200 ml and rotate at 37 ° C and 1 rpm for 7 days
After 7 days of culturing, the culture supernatant is recovered and used for the next purification procedure.
It was the starting material. The above operation is performed with 500 roller bottles
Min., 100 L of culture supernatant was obtained. <Example 56> Purification of human TPO from human TPO producing CHO cell line (1) About 100 L of serum-free culture supernatant was obtained from Example 55.
Then, the filtrate of a 0.22 μm filter was taken. This
This is an ultrafiltration unit (PLTK Pellico manufactured by Millipore)
Cassette and molecular weight of 30,000)
Was replaced with purified water, and a proteolytic enzyme inhibitor p-A
PMSF (manufactured by Wako Pure Chemical Industries, Ltd.) with a final concentration of 1 mM and Pef
abloc SC (Merck) final concentration 0.3
5 mM added, volume 3628 ml (protein concentration 1.60 m
g / ml, total protein mass 5805 mg, relative activity 1230
000, relative activity amount 7149000000) molecular weight 3
Fractions over 0000 were obtained. This fraction is described in Example 45.
The molecular weight was 6600 when examined by solid Western analysis.
Presence of TPO protein in the range of 0 to 100,000
Became clear. After a closer examination, this is
Separately, it was found that it also contained lower molecular weight TPO
did. Separately, ultrafiltrate with a molecular weight of 30,000 or less
Ultrafiltration unit (Millipore PLGC Pelliconca
When concentrated with a set molecular weight of 10,000 cut),
Volume 1901 ml (protein concentration 0.36 mg / ml, total
Protein mass 684mg, relative activity 245500, relative activity
Since the amount was 1679000000), the molecular weight of T was lowered.
It was confirmed that PO molecules were generated in the culture process.
Next, add 76 to 3614 ml of the fraction having a molecular weight of 30,000 or more.
4 g ammonium sulphate, and 144.5 ml 0.5
Add M sodium citrate buffer (pH 5.5) and
Final concentration 1.41M ammonium sulfate, 17.7 mM
4089 ml of solution containing sodium enoate buffer
The resulting insoluble matter was centrifuged to obtain a soluble matter. this
20 mM sodium citrate containing 1.2 M ammonium sulfate
It was previously equilibrated with thorium buffer (pH 5.5)
Macro-Prep Methyl HIC column
(Manufactured by Bio-Rad, catalog number 156-008
0; diameter 5 cm, bed height 24.5 cm), flow rate approx.
It was added at 25 ml / min. After addition, 1.2M sulfur
20 mM sodium citrate buffer containing ammonium citrate
What is eluted with the liquid (pH 5.5) is the ultrafiltration unit
(Filtron's Omega Ultraset molecular weight 8
Concentrate with 000 cut) and pass through F1 (4455m)
l, protein concentration 0.400 mg / ml, total protein mass 17
80 mg, relative activity 1831000) was obtained. Then melt
Effluent to 20 mM Na Citrate, pH 6.0
Instead, the eluate was replaced with an ultrafiltration unit (filtro
Omega Ultra set molecular weight 8000
Concentrated with fraction F2 (1457 ml, protein concentration)
0.969mg / ml, total protein mass 1411mg, phase
The activity (1715,000) was collected. For SDS-PAGE
Therefore, this F2 has a molecular weight of 66,000 to 100,000.
It was confirmed that the protein was present. Further Wester
Analysis revealed that this protein is TPO
Became. Next, Macro-Prep Methyl
 HIC column F2 (1443 ml), 20 mM
Pre-equilibrated with sodium citrate buffer (pH 6.0)
SP Sepharose Fast Flow
(Pharmacia Biotech, Catalog No. 17-
0729-01; diameter 5 cm, bed height 12 cm)
It was injected into the column and added at a flow rate of 15 ml / min. Attachment
After the end of addition, 20 mM potassium containing 50 mM NaCl was added.
Eluted with sodium enoate buffer (pH 6.0)
To collect fraction F1 (3007 ml, protein concentration
0.226mg / ml, total protein mass 679mg, relative activity
Sex 88830) was obtained. Next, the eluate was added to 750 mM N
20 mM sodium citrate buffer containing aCl (pH
5.4), eluted fraction F2 (931 ml, protein)
White matter concentration 0.763 mg / ml, total protein mass 710 m
g, relative activity 5558000). This is ultrafiltered
Over unit (Omega Ultra set made by Filtron)
 (Molecular weight cut off 8000 and Amicon YM3 membrane)
Was concentrated to 202 ml. Next, SP Sephar
TPO active fraction F of ose Fast Flow column
2 concentrated solution (197 ml) was added to Sephacryl S-
200HR column (Pharmacia Biotech,
Catalog No. 17-0584-05; diameter 7.5 cm,
Bed height 100 cm), flow rate 3 ml / min
Gel filtration was performed. Eluent volume 1200-1785m
1, 1785-2010ml, 2010-2280m
1, 2280-3000 ml of each range, each
Fraction F1 (585 ml, protein concentration 1.00 mg / m
1, total protein mass 589 mg, relative activity 411800
0), Fraction F2 (225 ml, protein concentration 0.263 /
ml, total protein mass 59.2 mg, relative activity 250900
0), Fraction F3 (270 ml, protein concentration 0.119 /
ml, total protein mass 32.1 mg, relative activity 253500
0), Fraction F4 (720 ml, protein concentration 0.0467)
/ Ml, total protein mass 33.6 mg, relative activity 11550
00) was obtained. In this way, the fractionated TPO activity is
It was found that the molecular weight range by the filtration method was wide.
Western analysis was performed after DS-PAGE
By the way, most of F1 has a molecular weight of 66,000 to 10,000.
While it was 0 TPO, in F2 and F3 respectively
Molecular weight 32,000-60,000, molecular weight 32,000-4
There were 2000 TPO molecular species. Which molecule
All amounts of TPO molecules also had TPO activity. In addition,
About TPO molecules with a molecular weight of 66,000 to 100,000
N-terminal amino acid sequence analysis revealed that human TPO
Contains the amino acid sequence of the protein encoded by the gene
I was able to confirm that. Further, the molecular weight is 66,000 to 1,000.
00 TPO molecule, N-glycanase (N-g
lycanase: Genzyme, catalog number
1472-00), neuraminidase (Neuramn)
idase: manufactured by Nakarai Tesque, catalog number 242
-29 SP), endo-α-N-acetylgalactosa.
Minidase (Endo-α-N-acetylgala
ctosaminidase: manufactured by Seikagaku Corporation, catalog
No. 100453), and O-glycosidase (0-
Glycosidase: Boehringer Ma
nnheim Biochema, catalog number
No. 1347101) glycan cleaving enzyme alone or in combination
Enzyme digestion experiment was also conducted and SDS-PAGE was examined.
Around the time, the polypeptide part of TPO was estimated from theoretical values.
It has a molecular weight of about 36,000 and is N-linked and O-linked.
It was found to be a glycoprotein having both sugar chains. <Example 57> Purification of human TPO from human TPO-producing CHO cell line (1) CHO cell blood-free obtained in the same manner as in Example 55
Add 211.4 g of ammonium sulfate to 1 L of the clear culture supernatant.
Yes, 0.2 μm filter (Gelman Science
CE company, catalog number 12992)
1.2M ammonium sulfate, 20 mM sodium acetate
Macro- equilibrated with buffer (pH 5.6)
Prep Methyl HIC column (Bio-Ra
d company, catalog number 156-00811, diameter 50m
m, bed height 90 mm) at a flow rate of 15 ml / min.
did. After the addition was completed, 20 mM sodium acetate buffer (p
H5.6) was eluted with 450 ml. This eluate is Vyd
ac Reversed-phase C4 column (The Separati
ons GrouP, Catalog No. 214BTP5
4, diameter 4.6 mm, bed height 250 mm) and flow rate 0.
It was added at 75 ml / min. 15 minutes after addition is complete
10 mM Tris buffer (pH 6.
4) After washing with (developing solvent A), 10 mM from developing solvent A
94% ethanol containing Tris buffer (pH 6.4)
Elute with a linear gradient of 66 minutes until (developing solvent B)
did. This chromatogram is shown in FIG. With TPO
A molecule with an expected molecular weight of about 65,000-100,000 is
As a result of analysis by SDS-PAGE,
Fractions with a retention time of 68-72 minutes can be obtained.
It was confirmed that the band was one (see FIG. 16). It
In Western analysis, this protein was found to be TPO
Was confirmed. Take a part of this sample, N
As a result of terminal amino acid analysis,
Confirmed to contain the amino acid sequence of the encoded protein
did it. <Example 58> Preparation of recombinant virus for expression of human TPO in insect cells pHTP1 prepared in Example 30 was a restriction enzyme EcoRI.
In addition, after digestion with NotI, 1% agarose gel electrophoresis
And band about 1200 bp prep-A-gene
After purification using a DNA purification kit, the same restriction
Primed transfer vector pVL1393 (I
Competent High E. c
oli DH5 (manufactured by Toyobo Co., Ltd.) was transformed. Got
Plasmid from the isolated colonies
A clone pV containing the entire coding region of OcDNA
L1393 / hTPO was obtained. The plasmid of this clone
De-DNA for Molecular Cloning (sa
mbrook et al., ColdSpring Harbor
 Laboratory Press, 1989).
Prepare as described, BaculoGold
^TM Transfection Kit (Farmin
Insect cell Sf21 (Invitroge)
Sf-900 medium after transfection
Cultivated in (Life Technology) at 27 ℃ for 4 days
Then, the supernatant containing the virus was recovered. This supernatant
10⁹-10⁵Dilute twice and use 1 ml of the
About 7 × 10 in mm Petri dish⁵To individual Sf21 cells
Infection was carried out at 27 ° C for 1 hour. Remove the supernatant Sf-90
Pour in 1% agarose containing 0 medium and let the agarose solidify.
After cooling, it was cultured at 27 ° C. for 6 days under humidification. Shape here
Picked up the formed single plaque, 200μ
The virus was eluted in 1 of Sf-900 medium. this
Virus clones were cloned into Sf21 cells in 24-well plates.
The cells were infected and the virus was amplified. Obtained thing
Phenol / black
After loform treatment, ethanol precipitation was performed to obtain viral DNA.
Recovered. Human TPO using this viral DNA as a template
PCR is carried out using primers specific to the cDNA,
Human T depends on whether or not a specific DNA fragment is amplified.
Recombinant virus containing POcDNA was selected. here
Recombinant virus containing human TPO cDNA obtained in
Sf21 cells were infected with the supernatant containing
Ailus was amplified. <Example 59> Expression and activity confirmation of human TPO in Sf21 insect cells 175 cm²Approximately 8 Sf21 cells in the culture flask of
Cultivate to 0% confluence and produce in Example 58.
2 recombinant virus containing human TPO cDNA
After infecting at 7 ° C for 1 hour, 27 in Sf-900 medium
After culturing at 4 ° C for 4 days, the supernatant was recovered. The resulting culture
Supernatant to NAP^TMFor -5 columns (Pharmacia)
And replaced with IMDM culture solution, which was used for rat CFU-M
K assay system and M-07e assay system
, TPO activity and M-07e cells which were significant in a dose-dependent manner
Growth-promoting activity was observed. Also described in Example 45
The same Western analysis as described above was performed on Sf21 cells.
The revealed recombinant human TPO was confirmed. <Example 60> A clone encoding a human TPO nucleotide sequence expressed in Escherichia coli.
Lone pCFM536 / h6T (1-163) -derived mutation
-Type human TPO, h6T (1-163) N-lauroyl
Refolding with sarcosine sodium and copper sulfate
Method and refolding-purification h6T (1-163) production recombinant prepared in Example 43
Suspended by adding 300 ml of water to 30 g of frozen body,
Crusher (10000 psi, Rannie High
Destroy the cells with the Pressure Laboratory)
After crushing, the precipitate fraction was collected by centrifugation. Precipitation
90 ml of water was added to the suspension to suspend, and while stirring,
After adding water to make the volume 150 ml, 9 ml 1 MT
ris buffer pH 9.2, 540 μl of 1 MDTT,
1.8 ml 0.5 M EDTA, 18 ml 10% deo
Add sodium xycholate with stirring and at room temperature
Stir for 30 minutes. Collect the precipitate fraction by centrifugation,
Most of the mixed proteins and bacterial components were removed. 1 for precipitation
After suspending by adding 80 ml of 5 mM DTT, centrifuge
The precipitate fraction containing h6T (1-163) was collected by separation.
did. 300 ml of water was added to the obtained precipitate fraction to suspend it,
Water was further added with stirring to adjust the liquid volume to 570 ml.
Then, with stirring, 30 ml of 1M Tris buffer pH 8
And 150 ml of 10% N-lauroyl sarcosine natri
Um was added and solubilized by stirring for 20 minutes at room temperature. This
Add 750 μl of 1% copper sulfate to it and stir at room temperature overnight (approx.
Stir for 20 hours. Centrifuge to h6T (1-16
After collecting the supernatant fraction containing 3),
50 ml water, 1500 ml 20 mM Tris buffer
After adding pH 7.7, stir 3 ml of polysorbate while stirring.
Tooth 80 (Nikko Chemicals) was added. 600 in the same solution
g Dowex 1-x4, 20-50 mesh, ch
Add lorideform ion exchange resin to room temperature
And stirred for 90 minutes. Ions using a glass filter
After collecting the fraction not adsorbed on the exchange resin, 750 ml of 20 m
Wash the ion exchange resin with MTris buffer pH 7.7
Was. Ion exchange resin non-adsorbed fraction and washing solution
2N sodium hydroxide was added to adjust the pH to 9.2,
20 mM Tris buffer containing 0.1% polysorbate 80
Q Sepharose equilibrated at pH 9.2
Fast Flow anion exchange column (inner diameter 5 cm
x 10 cm) and the non-adsorbed fraction was collected. hydrochloric acid
Was used to adjust the pH of the non-adsorbed fraction obtained to 7.2
20 mM Tris buffer containing 0.1% polysorbate 80
SP Sepharose equilibrated with buffer pH 7.2
 Fast Flow cation exchange column (inner diameter 5 cm
 x 10 cm) and add sodium chloride in the same buffer.
The linear concentration gradient method from 0M to 500 mM
Elution was performed. About eluate SDS-PAGE
Therefore, analysis was performed and the TPO elution fractions were collected. TP0 melting
Trifluoroacetic acid was added to the fractions to a concentration of 0.1%,
Capsule pack 5 μm 300A C1 column (inner diameter 2.
1 cm x 5 cm x 2 pieces, added to Shiseido)
Then, 1-propanol concentrated in 0.1% trifluoroacetic acid.
Reversed phase HPL by linear gradient elution
C was performed. SD in the absence of reducing agent
Results by S-PAGE and by reverse phase HPLC
Fractionation into 3 fractions was performed according to the elution position, and 0.
After 3-fold dilution with 1% trifluoroacetic acid,
Add to a reversed-phase HPLC column and re-chromatography in the same way.
A graph was taken. The obtained TPO3 fraction was subjected to reverse phase H
Fr. Sa, Fr. Sb, Fr.
SDS in the absence of reducing agent as S-c (see FIG. 17)
-As a result of PAGE analysis, the molecular weight was 18K darts, respectively.
(Fr.S-a), 19K Dalton (Fr.S-a)
b), a single bar near 18K Dalton (Fr.s-c)
Band was detected (see FIG. 18). About each
As a result of amino acid composition analysis, the amino acid composition obtained was
It almost agrees with the theoretical value from the sequence information, and it is N-terminal.
The end amino acid sequence analysis yielded only the expected sequence.
It was In addition, the protein of each fraction obtained from the results of amino acid analysis
White mass is 0.64 mg (Fr.S-a) 1.8, respectively.
1 mg (Fr.S-b), 3.49 mg (Fr.S-
It was c). Add each fraction to IMDM culture
After dialysis, M-07e assay was performed and the relative activity was about
1620000 (Fr.S-a), relative activity about 2350
0000 (Fr.S-b), relative activity about 7460000
00 (Fr.S-c) showed TPO activity. <Example 61> A clone encoding a human TPO nucleotide sequence expressed in Escherichia coli.
Lone pCFM536 / h6T (1-163) -derived mutation
Type human TPO, h6T (1-163) guanidine hydrochloride
And refolding with cysteine-cystine ~
Purification h6T (1-163) production recombinant prepared in Example 43
Suspended by adding 500 ml of water to 50 g of frozen body,
Crusher (10000 psi, Rannie High
Destroy the cells with the Pressure Laboratory)
After crushing, the precipitate fraction was collected by centrifugation. Precipitation
Add water to the suspension to suspend, and add water with stirring.
After adjusting the volume to 250 ml, add 15 ml of 1M Tris buffer.
Buffer pH 9.2, 900 μl 1MDTT, 3 ml
0.5 MEDTA, 30 ml of 10% deoxycholic acid
Add sodium with stirring and stir at room temperature for 30 minutes
did. The precipitate fraction was collected by centrifugation, and most of the mixture was mixed.
Proteins, cell components, etc. were removed. 300 ml of 5 for precipitation
After adding mMDTT and suspending, centrifuge
The precipitated fraction containing 6T (1-163) was collected. Recovered
Water was added to the precipitated fraction containing h6T (1-163)
Suspended to a final volume of 104 ml. 20m while stirring
376 after adding 1 1M Tris buffer pH 8.5
Add 8 ml guanidine hydrochloride and stir at room temperature for 10 minutes.
It was solubilized by stirring. 2500 ml with stirring
20 mM Tris buffer containing 0.1% polysorbate 80
Add a pH of 8.5 and add 1M guanidine hydrochloride.
Add 2000 ml of 20 mM Tris buffer pH 8.5.
Then, add 5 mM cysteine and 0.5 mM cystine
And stirred to dissolve. After standing overnight at 4 ° C, centrifuge
H6T (1-163) was recovered in the supernatant by separation.
Prep scale UF cartridge PL
Concentrated using a DC ultrafiltration membrane (Millipore), 0.1%
20 mM Tris buffer pH containing polysorbate 80
Replaced the buffer at 9.2 with a final volume of approximately 1000 mL.
did. 20m containing 0.1% polysorbate 80
Q Seph equilibrated with MTris buffer pH 9.2
arose Fast Flow anion exchange column
(Inner diameter 5 cm x 10 cm) and added in the same buffer
Linear concentration of sodium chloride from 0M to 500mM
Elution was carried out by the gradient method, and the sodium chloride concentration was 20
Fractions eluted at salt concentrations from mM to around 150 mM
240 mL was collected. The obtained fraction was added to 20 mM Tri
s-buffer pH 7.2 to 4-fold dilution to 960 mL,
The pH was adjusted to 7.2 with acetic acid. 0.1%
20 mM Tris buffer pH containing polysorbate 80
SP Sepharose Fas equilibrated with 7.2
t Flow cation exchange column (inner diameter 5 cm x 1
0 cm) and sodium chloride concentration 0 in the same buffer.
Elution by linear gradient method from M to 500 mM
I did. The eluate was separated by SDS-PAGE.
Analysis was performed and TPO elution fractions were collected. In the TPO elution fraction
Add trifluoroacetic acid to 0.1% and add capsules.
Pack 5μm 300AC1 column (inner diameter 2.1cm x
 5cm x 2 bottles, Shiseido), then 0.1%
Increase the 1-propanol concentration in trifluoroacetic acid
Reversed-phase HPLC was performed using a linear gradient elution method.
Was. Eluent SDS-PAGE in the absence of reducing agent
According to the results of analysis by
It fractionated into 2 fractions. Reverse the obtained two fractions eluted with TPO
Fr. G-a, Fr. G-d (Figure
SD) in the absence of a reducing agent for each
As a result of S-PAGE analysis, the molecular weight was 18 Kdal, respectively.
Tons (Fr, G-a), 32K Daltons (Fr.G-a)
It was detected as a single band around d) (see Fig. 18).
See). In addition, SDS-PAGE analysis in the presence of a reducing agent
As a result, both fractions had a molecular weight of around 20K Dalton.
Was detected as a single band. Amino about each
As a result of acid composition analysis, the amino acid composition obtained was
It almost agrees with the theoretical value from the sequence information, and the N-terminal
Mino acid sequence analysis yielded only the expected sequence.
Was. In addition, the protein of each fraction obtained from the results of amino acid analysis
The mass is 2.56 mg (Fr.G-a) and 1.1, respectively.
It was 6 mg (Fr.G-d). IMDM culture of each fraction
After sufficient dialysis against the nutrient solution, perform M-07e assay
As a result, the relative activity was about 3960000 (Fr.G-a),
Relative activity about 760,000 (Fr. Gd) TPO activity
Showed sex. <Example 62> Partial length human TPO (amino acids 1-163) (hereinafter
The protein is called "hTPO163") CHO cell
For recombinant vector pDEF202-hTPO163
Construction Restriction of the vector pDEF202 obtained in Example 31
Treated with elementary EcoRI and SpeI, and agarose gel electro
The larger vector fragment was recovered by electrophoresis
Then, this fragment and the amino acids at positions -21 to 163
Up to hTPO163 cDNA (sequence listing
Plasmid pEF18S-hT containing lane no. 13)
Treatment of PO163 with restriction enzymes EcoRI and SpeI
The obtained hTPO163 cDNA and T4DNA
Expression vector pDE, which is ligated with ligase (Takara Shuzo)
F202-hTPO 163 was obtained. This plasmid
Replication origin region of SV40, human elongation fax
Tar1-alpha promoter, SV40 early polyade
Nil site, mouse DHFR minigene, pUC 18
Origin of replication, β-lactamase gene (Amp^r)
Including Human Elongation Factor 1-Alpha
HTPO163 cDNA was connected downstream of the motor
There is. <Example 63> Expression of hTPO163 by CHO cells CHO cells (dhfr- strain, Urlaub and Chasi).
n; Proc. Natl. Acad. Sci. USA;
Vol. 77, p. 4216, 1980) 6 cm diameter plate
(Falcon) α minimum containing 10% fetal calf serum
Essential medium (α-MEM (-), thymidine, hypoxanthine
Cultivated and proliferated by the transfectam method.
(Manufactured by Seikagaku Corporation). That is,
PDEF202-hTPO 16 prepared in Example 62
240 μl of 0.3M NaCl in 10 μg of 3 plasmids
After adding and mixing, 20 μl of transfectam and H
₂A mixed solution with 220 μl of O was added and mixed again. this
After dropping the DNA solution onto the plate, CO₂ink
Incubated in a tube for 6 hours. Remove medium from plate
After removing and washing twice with α-MEM (-), 10% dimethy
Rusulfoxide-containing α-MEM (-) was added, and the
Heated for 2 minutes. Then, containing 10% dialyzed fetal bovine serum
Yes Non-selective medium (alpha-MEM (-) above, hypoxanthine
And thymidine were added) and the cells were cultured for 2 days, then 1
Selection medium containing 0% dialyzed fetal bovine serum (α-MEM (−),
Hypoxanthine and thymidine are not added)
Was. For selection, trypsinize the cells and then pre-prepare the 6 cm diameter.
5 x 10 cm plates or 2 per plate
Divide into 20 4 well plates and select every 2 days
By continuing the culture while exchanging the medium with the selective medium
It was carried out. The plate or wafer on which the cells have grown
The TPO activity in the culture supernatant of Ba / F3
TPO activity was observed when measured using the assay method.
Was done. Only those in which TPO activity was observed in the culture supernatant
Alternatively, add 25 nM meso to a new plate or well.
Split cells 1:15 in selective medium containing trexate
And tolerate methotrexate by continuing the culture
Cells were grown and cloned. In addition, CH
O cells were transformed with pEF18S-h for CHO cells.
Co-transformation of TPO 163 and pMG1 (co-tr
can also be done by
it can. Plasmid pDEF202-hTPO163
Thus, the transformed CHO cell line (CHO-DUKX
B11) is the Ministry of International Trade and Industry Industrial Technology on January 31, 1995.
Contract number FERM BP at the Institute of Biotechnology, Institute of Biotechnology
Deposited as -4989. This is also 199
Republic of China Food Industry Development Institute (F
IRDI) with deposit number 960024
It <Example 64> Large-scale culture of CHO cells In Example 63, hTPO163 expression plasmid pD was used.
Transfer EF202-hTPO163 to CHO cells
HTPO163-producing CHO cells obtained by
Mass cultivation of strains (CHO109 cells, OnM MTX resistance)
The feeding was carried out as follows. Cells with 10% FCS
Using a DMEM / F-12 medium (GIBC0) containing
Cultured and propagated. Remove the cells with trypsin solution.
Falcon containing 200 ml of the same medium after separation
1000 in a roller bottle (Falcon 3000)
Inoculate 10,000 cells and rotate at 37 ° C at a rotation speed of 1 rpm for 3
Cultured for a day. After 3 days, remove the culture solution by suction and
After rinsing the cell culture surface with l PBS, 10% F
DMEM / F-12 medium without CS (GIBCO
200 ml) and added at 37 ° C and a rotation speed of 1 rpm.
Culture for 7 days, and after 7 days, collect the culture supernatant and purify
Used as the starting material for the operation. Roller bottle 3
This was carried out for 00 times to obtain 60 L of serum-free culture supernatant. <Example 65> hTPO163 was produced from an hTPO163 producing CHO cell line.
Purification (1) 60 L of serum-free culture supernatant obtained from Example 64
Then, the filtrate of a 0.22 μm filter was taken.
Furthermore, ultrafiltration unit (Molecular weight 1 manufactured by Filtron)
Concentrated fraction (600 ml, protein
Quality concentration 11.2 mg / ml, total protein mass 6430 mg)
Got This fraction was diluted with anti-HT1 peptide antibody.
Apparent molecular weight of 2000 when examined by stern analysis
HTPO163 protein expressed in the range of 0 to 26000
It became clear that quality exists. This concentrated culture supernatant
573 ml at a flow rate of about 20 ml / min and 10 mM solution
Pre-equilibrate with sodium phosphate buffer (pH 6.8)
Sephadex G-25 Fine column
(Pharmacia Biotech, Catalog No. 17-
0032-02; diameter 10 cm, bed height 30 cm)
Treated with 10 mM sodium phosphate buffer
Solution (pH 6.8) solution of protein fraction F1 (938
ml, protein concentration 4.9 mg / ml, total protein mass 459
4 mg) was obtained. This Sephadex G-25 F
The ine column protein fraction (929 ml) was preliminarily diluted to 10 mM.
SP equilibrated with sodium phosphate buffer (pH 6.8)
Sepharose Fast Flow
A Biotech, Catalog No. 17-0729-0
1; Diameter 5 cm, bed height 12 cm) Flow rate to the column 1
It was added at 5 ml / min. 10m after addition
M sodium phosphate buffer (pH 6.8), then 10
10 mM sodium phosphate buffer containing 10% ethanol
Collect up to that eluted at (pH 6.8) and collect in fraction F
1 (1608 ml, protein concentration 2.13 mg / ml, total
A protein mass of 3426 mg) was obtained. Next, eluate 10m
750 mM N in M sodium phosphate (pH 6.8)
Change to a buffer containing aCl and 25% ethanol and elute.
The main elution fraction of hTPO163 F2 (651 m
1, protein concentration 1.67 mg / ml, total protein mass 108
7 mg) was collected. SP Sepharose Fas
200 out of TPO active fraction F2 of t Flow column
Take ml and add ethanol and purified water to the final ethanol.
A 300 ml solution having a concentration of 45% was prepared. Here
The insoluble matter resulting from the addition of tanol was removed by centrifugation.
After removal, developing solvent A (10 mM sodium acetate buffer
(PH 6.7)), developing solvent B (containing 90% ethanol)
10 mM sodium acetate buffer (pH 6.7))
By the way, SOURCE15 pre-equilibrated with 50% solution B
RPC column (Pharmacia Biotech, Catalo
No. 17-0727-02; diameter 2 cm, bed height 2
0 cm) at a flow rate of 2 ml / min. After injection,
Wash with 45% solution B until rum non-adsorbed substance is almost eluted
After that, set the flow rate to 1.5 ml / min, and first 5 minutes for 5 minutes.
0% B, then 50% B to 100% B in 140 minutes
After a linear concentration gradient, develop with 100% solution B for 35 minutes
Was. Elution fractions collected every 5 minutes (7.5 ml) during this time
Minutes were subjected to SDS-PAGE and Western analysis, h
When the elution range of TPO163 was examined, ethanol concentration
Apparent molecular weight in the range of 66% to 87% of about 20,000
To 26000 highly purified hTPO163
It turned out to have been issued. These hTPO163
The higher the molecular weight of the
As a result, hTPO16 with more sugar chains attached
It was suggested that the hydrophilicity was increased by about 3 molecules. SO
HTPO163 elution fraction of URCE 15RPC column
(Elution in the ethanol concentration range of 68% to 86.5%
out of 90 ml of hTPO163 fraction) to 88.8 ml
After adding CHAPS, ultrafiltration (YM, manufactured by Amicon)
-3 Concentrate and wash with ultrafiltration unit with membrane)
Finally, it contains about 5% ethanol and 4 mM CHAPS.
A 2.5 ml concentrated preparation was prepared. This standard is 10% in advance
10 mM sodium phosphate buffer containing ethanol (p
H6.8) equilibrated with Superdex 75 pg
Column (Pharmacia Biotech, catalog number
17-1070-01; diameter 2.6 cm, bed height 60
cm) at a flow rate of 1.5 ml / min. 6 after injection
After 0 minutes, the elution fraction was collected every 6 ml (4 minutes).
About SDS-PAGE
The fraction started to elute hTPO163, and at least 31
HTPO163 is eluting in a wide range up to
And confirmed. This is a standard molecular weight marker for gel filtration
(Gel Filtration manufactured by Bio-Rad)
Standard; Catalog No. 151-1901 and
Calbiochem Insulin; Catalog No.
A mixture of 407696) and a molecular weight of about 44,000.
To 6000. Moreover, these hTPs
O163 has a large molecular weight with more sugar added
It was considered that the compounds were eluted in this order. Test tube number 16-
In the elution range of 31 (elution volume 180-276 ml)
As a summary of all hTPO163 molecular species
Fraction FA was prepared. Separate from fraction FA, test tube number 1
6-18 (elution volume 180-198 ml), test tube number
19-24 (elution volume 198-234 ml), test tube number
No. 25-31 (elution volume 234-276 ml)
A portion was taken and made into fractions FH, FM, and FL, respectively. One
Mari Fraction FA is essentially a combination of Fractions FH, FM and FL.
It will be set. The above is shown in FIG. (2) Next, Superdex 75 pg described in (1)
 Column hTPO163 elution fractions FH, FM, FL and
And FA will be described in detail. Obtained in this way
The amino acid sequence on the N-terminal side of hTPO163 is shown in Example 1.
When examined in the same manner as described above, N-terminal serine
Most of the
It was strongly suggested that the O-linked sugar chain was added to
Was. Also, the sequence following the N-terminal serine is derived from the gene sequence.
It was confirmed that the amino acid sequence was expected. Ami
Acid composition analysis (AccQ.Tag method, Waters)
Results, hHPO163 protein of FH, FM, FL and FA
The quality (the peptide part that does not contain sugar chains) has a concentration of 1 each
0.2 ng / ml, 6.2 ng / ml, 0.84 ng /
ml was 3.2 ng / ml. These fractions 100
ng is multi gel 15/25 (Daiichi Pure Chemicals Co. 15-
25% precast polyacrylamide gel)
After reduction under non-reducing conditions or DTT, SDS-PAG
After carrying out E and dyeing with silver (manufactured by Daiichi Pure Chemicals Co., Ltd.),
Each is an extremely high purity hTPO163 standard product.
It could be confirmed. DPCIII molecular weight under reducing conditions
Calculated with a marker (Daiichi Pure Chemicals) as standard
The apparent appearance of hTPO163 in FH, FM, FL and FA
The molecular weight is 24000 to 21500 and 23000, respectively.
~ 21000, 23000-20500, 23500-
It was 20500 (see FIG. 20). See also Wester
Biotin-labeled SDS under reducing conditions
-PAGE standard (Bio-Rad, Bi
onylated SDS-PAGE Stand
ards, Broad Range; Catalog No. 16
1-0319) as a standard for FH, FM, F
The apparent molecular weights of hTPO163 of L and FA are respectively
26000-22000, 25500-22000,
26000-21000, 26000-21000
It was. Heterogeneity of molecular weight of FH, FM, FL and FA
Is probably due to the heterogeneity of the added O-linked sugar chain.
Can be set. Therefore, the FH, FM, FL and FA fractions
Neuraminidase (Naka)
Made by Litesque, catalog number 242-29 SP)
Enzymatically digested, reduced by DTT and analyzed by SDS-PAGE
Apparently, the apparent molecular weight of each fraction was 19000.
Since it was in the vicinity, it was added to the hTPO163 protein.
The same heterogeneity in the amount of sialic acid in the sugar chains was confirmed.
Sometimes, hTPO163 obtained here is used as a glycoprotein
It was revealed that it was expressed in CHO cells
Was. (3) Each of FH, FM, FL and FA obtained in (2)
Fractions were assayed for in vitro activity in the M-07e assay system.
When examined, the relative specific activity was 1 mg hTPO163 protein.
Per quality (weight of peptide part not including sugar chain weight),
511,000,000, 775,000,000, 1 respectively
It was 150,000,000 and 715,000,000. <Example 66> Human TP having Lys at position -1 and Met at position -2
O (amino acids 1-332) (hereinafter “hMKT (1-33
2) ")) construction and expression of expression vector for Escherichia coli.
The codons used from amino acid 164 to amino acid 332 are
It was changed to the E. coli preferred codon as described below. Table 20
21-40 synthetic oligonucleotides shown in
Was.

[Table 20] 21 and 22; 23 and 24; 25 and 26; 27 and 28; 29 and 30; 31 and 32; 33 and 34; 3
5 and 36; 37 and 38; 39 and 40 synthetic oligonucleotides in the same tube using T4 kinase (Pharmacia) 0.1 mM ATP, 10 mM
Tris-acetate, 10 mM Mg-aceta
It was phosphorylated in a solution of te, 50 mM K-acetate. Further 1/10 amount of 100 mM Tris /
HCl (pH 7.5), 100 mM MgCl ₂ , 50
A solution of 0 mM NaCl was added, and the mixture was boiled in a water bath for 3 minutes and left to stand to give a double-stranded DNA. Then 2
1 and 22; 23 and 24 (combination A), 25 and 2
6; 27 and 28; 29 and 30 (combination B), 31
And 32; 33 and 34 (combination C), 35 and 3
6; 37 and 38; 39 and 40 (combination D) four sets of double-stranded DNA were ligated using a DNA ligation kit (Takara Shuzo), and then (combination A) and (combination B), (Combination C) and (Combination D) were similarly linked, and the resulting reaction solutions were designated as Connection 1 and Connection 2. Using these reaction solutions as templates, 41 and 42 for ligation 1 and 43 and 44 for ligation 2
PCR was performed using the synthetic oligonucleotide of 1. as a primer. The PCR product obtained by the PCR reaction of ligation 1 was SacI, EcoRV, and the PCR product obtained by the PCR reaction of ligation 2 was EcoRV, Hind.
After digestion with III, electrophoresis was performed on a 2% agarose gel, and fragments of about 240 bp and 250 bp were respectively prepared by prep-A-.
It was recovered by the Gene DNA Purification Kit. These two fragments were digested with SacI and HindIII to obtain pBlu.
escript II KS + (manufactured by Stratagene)
Subcloned into E. coli DH5
It was used). Among the obtained clones, those having the nucleotide sequences shown in Table 21 were selected by sequencing, and the clones obtained here were designated as pBL (SH) (174).
332).

[Table 21] Next, pBL (XH) h6T (1-
163) as a template, the following 45 and 46 synthetic oligonucleotides were used as primers for PCR reaction, and the PCR products obtained here were BamHI and Sac.
After digestion with I, electrophoresis was performed on a 6% polyacrylamide gel, and a fragment of about 160 bp was recovered from the gel. Also, pBL (S
H) (174-332) was digested with SacI and HindIII to obtain a fragment of about 480 bp, which was Prepoo A-
These two fragments were recovered with the Gene DNA Purification Kit and pBlue was digested with BamHI and HindIII.
script II KS + (manufactured by Stratagene)
Subcloned into E. coli DH5
It was used). Among the obtained clones, those having the nucleotide sequences shown in Table 22 were selected by sequencing, and the clone obtained here was designated as pBL (BH) (123.332).

[Table 22] PBL (XH) h6T (1-16 prepared in Example 42
3) was digested with BamHI and HindIII to give pBL
Digest (BH) (123-332) with the same restriction enzymes
The resulting fragment of about 640 bp was ligated to clone pBL
(XH) h6T (1-334) was prepared. Further implementation
PCFM536 / hMKT (1-16 created in Example 52
About 270 obtained by digesting 3) with XbaI and SfiI
pBL (XH) obtained by digesting the bp fragment with the same restriction enzymes
The clone pBL (X was ligated to h6T (1-334).
H) hMKT (1-334) was created. pBL (X
H) hMKT (1 to 334) was added to XbaI, HindII
After digestion with I, mutated human TPO amino acids 1-332
The fragment of about 1040 bp in size is encoded.
After collecting and purifying, p digested with XbaI and HindIII
Cloni on CFM536 (Sho 60-501988)
(The host was pMW1 (ATCC No. 3993).
3), which was previously transformed in E. coli JM109
used). The clone obtained here was designated as pCFM536.
/ HMKT (1-332) and the expression vector
Mutated hMKT (1-332) tamper strain
It was used as a transformant for expression. This expression plasmid
Including the DNA sequence shown in the sequence listing (SEQ ID NO: 14)
I have. The transformant obtained here was treated with ampicillin 50
μg / ml, tetracycline 12.5 μg / ml
Culture in 60 ml of LB medium with shaking at 30 ° C overnight.
LB containing 25 ml of nutrient solution containing 50 μg / ml of ampicillin
In addition to 1000 ml of medium, OD is A ₆₀₀ Is 1.0-
Shaking culture was performed at 30 ° C. until reaching 1.2. Then the final temperature
Approximately 330 ml LB culture at 65 ° C so that the temperature is 42 ° C
Add the soil and cultivate with shaking at 42 ° C for 3 hours
Of human TPO and hMKT (1-332) protein
Was induced. Using these cultured cells directly as a sample
SDS-PAGE was performed. First for SDS-PAGE
Using a multi gel 15/25 manufactured by Kagaku Co.
When sea blue staining was performed, hMKT (1-332)
For those that induce protein expression, the molecular weight is about
A protein specific for induction of expression was detected at 35 kD.
Was issued. On the other hand, after SDS-PAGE, the tamper on the gel
Electro-Plotting of Quenched Material to Nitrocellulose Membrane
And reacted with the anti-HT1 peptide antibody prepared in Example 45.
When it was made to develop color, it was found to have a molecular weight of about 35 kD.
Of the hMKT (1–332) was detected.
Expression was confirmed. <Example 67> Preparation of human TPO-substituted derivative and expression in COS7 cells-
Confirmation of activity A derivative of human TPO with some amino acids replaced
Whether or not it has was examined as follows. For this example
The animal cell expression vector pSMT201 was as follows.
It was made. First, the mouse erythropoietin receptor
Expression plasmid pXM-mEPORn containing cDNA
(Dana Farber Cancer Institute D'-Andre
Obtained from Dr. a, Cell: Volume 57, 277-285.
(1989)) with the restriction enzymes KpnI and EcoRI.
After treatment, perform agarose gel electrophoresis and
PXM vector excluding the poetin receptor cDNA part
-The fragments were collected. Next, in the recovered pXM expression vector
2 for introducing various restriction enzyme sites for cloning
A synthetic DNA oligonucleotide synthesizer from ABI
Was manufactured using. Base of synthesized oligonucleotide
The sequence is shown below. The two oligonucleotides are mixed and annealed.
After making into a double-stranded oligonucleotide,
PXM vector fragment and T4 DNA ligase (Takara Shuzo
(Manufactured by K.K.) to obtain expression vector pDMT201.
Next, the mouse contained in this expression vector pDMT201
PDMT201 vector was used to remove the DHFR cDNA.
And pEF18S vector with restriction enzyme Not I
Agarose gel electrophoresis after treatment with Hpa I,
with the larger fragment derived from pDMT201 vector DNA
The smaller fragment derived from pEF18S vector DNA was cloned
Collect and bind with T4 DNA ligase (Takara Shuzo)
Thus, the expression vector pSMT201 was obtained. This one
As shown in Figure 21,
Region and enhancer sequences, adenovirus major late
Romano array, adenovirus tripartite reader
Sequence, splice signal sequence, SV40 early polyadenylation
Site sequence, adenovirus VA RNA gene sequence,
Replication origin region of pUC 18, β-lactamase gene
(Amp ^r ), To connect the gene of interest
Restriction enzyme sequences of BgI II, Pst I, K
pnI, Xho I, EcoRI, Sma I, Spe
I, and Not I sites. Shown in Example 30
PHTP1 containing isolated full-length human TPO cDNA
Can be enzymatically digested with the restriction enzymes EcoRI and speI
The resulting full-length human TPO cDNA fragment was similarly restricted
Subclonin in the vector pSMT201 digested with enzyme
Plasmid pSMT201-hTPO
I got The plasmid pSMT20 obtained as described above
First, using 1-hTPO as a template,
The plasmid βGL-TPO / pBlue is
It was made like this. In βGL-TPO / pBlue, human T
On the 5'untranslated side of PO, the method of Annweiler et al.
Therefore, we tried to add a rabbit β-globin leader sequence.
(Annweiler et al., Nucleic Acids
Research, vol. 19, p. 3750). First of all
The two chemically synthesized DNA chains shown in and the vector B
Restricts Rubyscript IISK (made by Toyobo Co., Ltd.)
Ligated with the fragments digested with the enzymes EcoRI and SmaI
The leader sequence was inserted by
Ter βGL / pBlue was prepared. The sequences of the primers used for PCR are as follows. PCR is the plasmid pSMT201-hTPO DNA
1 ng was used as a template and the synthesized primers were
It carried out using 10 micromol each. TaKaRa PCR A
For use with mpification Kit (manufactured by Takara Shuzo)
And Programmable Thermal C
on the controller (MJ Research)
PCR in a volume of 100 μl (94 ° C for 1 minute, 55 ° C
2 minutes, 72 ° C 2 minutes 3 cycles, followed by 94 ° C 45
Seconds, 55 ℃ 1 minute, 72 ℃ 1 minute 20 cycles)
went. Chloroform extraction of PCR product, ethanol
Precipitate twice and dissolve in 100 μl TE buffer
did. Digest this with restriction enzymes smaI and HindIII
After that, phenol / chloroform extraction, ethanol precipitation
went. Dissolve the obtained precipitate in 10 μl of TE buffer.
After solving, the vector βGL / pBl similarly digested with restriction enzymes
sub-cloned into ue (host strain is Toyobo Co.
Mptent high E. E. coli JM109).
20 clones were selected from the obtained transformants and
Mid DNA was prepared. The method is essentially Molecul
ar Cloning [Sambook et al., Cold
Spring Harbor Laboratory P
[ress (1989)].
gave. TaqD for purified plasmid DNA
ye Deoxy ^TM Terminator Cycle
e Sequencing Kit (Applied Bio
Applied Biosystems
The nucleotide sequence was confirmed by using a 373A DNA sequencer manufactured by the company.
I confirmed. encodes βGL-TPO / pBlue
There is no substitution of the nucleotide sequence over the entire length of the plasmid
It was confirmed that the clone had the above TPO cDNA sequence. further
βGL-TPO / pBlue is a restriction enzyme BglII, S
After digestion with peI, phenol / chloroform extraction, etha
Noll precipitation was performed. The precipitate obtained was mixed with 10 μl of TE solution.
Vector p, which was dissolved in a cuffer and similarly digested with restriction enzymes
Subcloned into SMT201 (host strain Toyobo
Kokisha Competent High E. coli JM109
use). Essentially Molecular Cloning
[Sambook et al., Cold Spring Ha
rbor Laboratory Press (198
9)] and transform the transformant into
Rasmid DNA was prepared. The obtained expression vector pS
MT / βGL-TPO is pSMT20 shown in FIG.
Restriction enzyme downstream of splice signal sequence of 1 vector
Sequence β-globinly at Bgl II / Spe I site
It has a structure in which the DNA sequencer and human TPO cDNA are connected.
are doing. This pSMT / βGL-TPO vector CO
It was used for transfection experiments into S7 cells. Human
PCR was used to prepare the TPO-substituted derivative, and Ito et al.
(Ito et al., Gene, Vol. 102, 6).
7-70, 1991). Here, 2 of human TPO
A derivative in which the Arg residue at position 5 is replaced with an Asn residue,
Of the derivative in which the His residue at position 33 was replaced with a Thr residue
Tried to make. The sequences of the primers used for PCR are as follows
Street. The first-stage PCR was performed using the plasmid βGL-TPO / pBl.
Using 1 ng of ue DNA as a template,
Immersion was performed using 10 μM each (primer
The combination of [1] ΔBglII and end, [2] T
7 and N3, [3] T7 and 09). TaKaRa PCR
Amplification Kit (manufactured by Takara Shuzo)
Using the Programmable Thermal C
on the controller (MJ Research)
PCR in a volume of 100 μl (94 ° C for 1 minute, 55 ° C
2 minutes, 72 ° C 2 minutes 3 cycles, followed by 94 ° C 45
Seconds, 55 ° C for 1 minute, 72 ° C for 1 minute for 17 cycles)
went. Chloroform extraction of each PCR product,
100 μl TE buffer after ethanol precipitation twice
Dissolved in Use 2 kinds of this PCR product 1 μl each
Then, the second stage PCR was performed. The combination of molds
PCR products of [1] and [2], PCR of [1] and [3]
It is a product. All primers used were T7 and end
It is a combination. Incubate at 94 ° C for 10 minutes
After that, TaKaRa Taq is added, and the mixture is heated at 94 ° C for 1 minute,
℃ 2 minutes, 72 ℃ 2 minutes 3 cycles, followed by 94 ℃ 4
9 cycles of 5 seconds, 55 ° C for 1 minute, 72 ° C for 1 minute
It was 5 mg / ml prote for each PCR product
1 μl of inase K and 2 μ of 0.5M EDTA
1, 2% of 20% SDS was added and kept warm at 37 ° C for 30 minutes.
After deactivating Taq, extract phenol / chloroform.
The precipitate was precipitated with ethanol and dissolved in 20 μl of sterilized water. This
After digesting this with the restriction enzymes BglIII and SpeI, pheno
/ Chloroform extraction and ethanol precipitation were performed. Profit
Dissolve the obtained precipitate in 10 μl of TE buffer, and then
Restriction enzyme digested with alkaline phosphatase (calf intestine,
Boehringer Mannheim) treated expression vector
Subcloned into pSMT201 (host strain: Toyo
Spinning Company Competent High E. coli JM109
use). Of the resulting transformants, 2 clones each
Each plasmid was selected to prepare plasmid DNA. The way is
Essentially Molecular Cloning [Sa
mbook et al., Cold Spring Harbor
Laboratory Press (1989)]
Performed as described. Purified plasm
About TaqDye Deoxy ^TM T
erminatorCycle Sequencing
Using Kit (manufactured by Applied Biosystems),
Applied Biosystems 373A DNA seek
The nucleotide sequence was confirmed with an enterr. [1] and
Intended for a plasmid derived from the PCR product of [3]
Amino acid substitution [HiS33 (CAC) → Thr (AC
C)] and at the C-terminus (Gly332):
TPO substitution inducement with a peptide consisting of a mino acid sequence
Includes cDNA encoding conductor (09 / TPO)
Was confirmed. On the other hand, PCR of [1] and [2]
The plasmid derived from the product has the intended amino acid substitution [A
rg25 (AGA) → Asn (AAC)] and 1 more
Amino acid substitution at some place [Glu231 (GAA) → Lys
(AAA)] and has the following at the C-terminus (Gly332)
TPO device to which a peptide consisting of the amino acid sequence of
Includes a cDNA encoding a modified derivative (N3 / TPO)
It turned out. Peptide: TSIGYPYDVPDYAGVHHHHHH Trans of each obtained clone into COS7 cells
Sfection was chloroquine treated according to Example 35.
The DEAE-Dextran method was used. Ie plastic
Transfection using 40 μg of Sumid DNA
The culture supernatant was recovered after 5 days. The collected culture supernatant is
Concentrated 20 times with Tricon-30 (manufactured by Amicon) to give M-
It was evaluated by the 07e assay system. As a result, the human TPO device
A plastic encoding N3 / TPO, 09 / TPO
In COS7 cell culture supernatant transfected with Sumid
In each case, TPO activity was detected in a dose-dependent manner (Fig.
22). <Example 68> Preparation of human TPO insertion / deletion derivative and its use in COS7 cells
Expression-Activity Confirmation Derivative or hT in which amino acid is inserted into hTPO163
Derivatives lacking amino acids from PO163 are active
I examined whether or not. The prepared derivative is SEQ ID NO: 13.
His33 deletion (dH33), Gly116 deletion
(DG116), Arg117 deletion form (dR117),
Thr insert between His33 and Pro34 (T3
3 '), Ala insert (A33'), Gly insert (G
33 ') and A between Gly116 and Arg117
sn insert (N116 ′), Ala insert (A11
6 '), a Gly insert (G116'). these
Of these, T33 'and N116' are mucin-type sugar chains, A
It is a derivative intended to introduce a sn-linked sugar chain. Derivative
PCR was used for the preparation of
(Ito et al., Gene, 102, 67-70, 19
91). The sequences of the primers used for PCR are as follows.
Ri. The first-stage PCR is the plasmid β prepared in Example 67.
Using 1 ng of GL-TPO / pBlue DNA as a template
Use and synthesize each primer with 10 μM
Carried out. The primer combination is [1] dRI and e
ndNotI, [2] T7 and mutagenesis primer (dH
33, A33 ', G33', T33 ', dG116, d
R117, A116 ', G116', N116 ')
It TaKaRa PCR Amplification
Program using n Kit (Takara Shuzo)
ble Thermal Controller (MJ
PCR in a volume of 10 μl by Research)
went. The reaction of [1] is 94 ° C for 1 minute, 45 ° C for 2 minutes
72 ° C for 2 minutes for 3 cycles, followed by 94 ° C for 45 seconds
17 cycles of 45 ° C for 1 minute and 72 ° C for 1 minute.
The reaction of [2] is 94 ° C for 1 minute, 55 ° C for 2 minutes, 72 ° C.
3 cycles of 2 minutes, followed by 94 ° C for 45 seconds, 55 ° C 1
17 cycles of 1 minute at 72 ° C. PCR of each
The product is extracted with chloroform and ethanol precipitation is performed twice.
And then dissolved in 100 μl of TE buffer. next,
Use 1 μl each of the PCR products of [1] and [2]
The second stage PCR was performed. All the primers used are
Is a combination of T7 and endNotI. At 94 ° C
After incubating for 10 minutes, TaKaRa Taq was added.
In addition, 94 ℃ 1 minute, 55 ℃ 2 minutes, 72 ℃ 2 minutes 3
Cycle, continued at 94 ° C for 45 seconds, 55 ° C for 1 minute, 72
Nine cycles of 1 minute at ℃ were performed. For each PCR product
1 μl of 5 mg / ml proteinase K,
Add 2 μl of 0.5 M EDTA and 2 μl of 20% SDS.
After incubating at 37 ℃ for 30 minutes to inactivate Taq,
20 μl after extraction with nol / chloroform and ethanol precipitation
Dissolved in sterile water. Restriction enzyme EcoRI, No
After digestion with tI, phenol / chloroform extraction, ethanol
Precipitation. The precipitate obtained was mixed with 10 μl of TE bag.
After dissolving in fur, digest with restriction enzyme in the same manner and
Aatase (calf intestine, Boehringer Mannheim)
Subcloning into treated expression vector pEF18S
(The host bacterium was Competent High E.c manufactured by Toyobo Co., Ltd.
oli JM109 is used). From the obtained transformant
Plasmid DNA was prepared. The method is essentially Mole
circular Cloning [Sambrook et al., c
old Spring Harbor Laboratory
Press (1989)].
It was carried out. Ta for purified plasmid DNA
q Dye Deoxy ^TM Terminator C
Cycle Sequencing Kit (Applied
Applied Systems
Base distribution by Thames 373A DNA sequencer
Checked the rows. As a result, dH33, A33 ', T
33 ', dG116, dR117, A116', G11
Plasmids encoding 6'and N116 'span the entire length
As expected, there is no substitution of the base sequence other than the intended site
It was confirmed to have the TPO cDNA sequence. Also, G3
In 3 ', not only the intended site but also 1 amino acid substitution
Tarasu base substitution [Pro38 (CCT) → Ser (TC
T)] was recognized. C of each clone obtained
Transfection of OS7 cells is described in Example 11.
Therefore it went. That is, use 10 μg of plasmid DNA.
DEAE-Dextran method including chloroquine treatment
Transfection was performed and the culture was performed 4-5 days later.
The nutrient supernatant was collected. The collected culture supernatant was added to M-07e
It was evaluated by a sei system. As a result, amino acid insertion / deletion induction
CO transfected with a plasmid encoding the body
In the S7 cell culture supernatant, TPO activity was observed in a dose-dependent manner.
The sex was detected (see FIG. 23). Code TPO derivative
Expression plasmid pEF18S containing no cDNA
There is no activity in the transfected COS7 cell culture supernatant.
The sex was not recognized. <Example 69> Platelet-increasing action of TPO Blood was collected in advance from the orbital vein and the microcell counter was used.
-(Toa Medical Electronics, F-800)
Randomized 20 normal 8-week-old ICR male mice
It was divided into 4 groups. One group of them (control-iv
Group) 100 μl PBS once a day for 5 consecutive days
It was administered intravascularly, and the other 1 group (TPO-iv group) was used as an example.
SP Sepharose Fast obtained in 56
The concentrated solution of human TPO active fraction F2 of Flow was NAP-
25 columns (Pharmacia Biotech, catalog
No. 17-0852-02) and replaced with PBS, and
100 μl of diluted with PBS (M-07e
(Including relative activity of 211,900 in essay system) for 1 day
It was intravenously administered once for 5 consecutive days. Also, another group
(Control-sc group) 1 μl of 100 μl PBS
Administered subcutaneously once a day for 5 consecutive days, then administered to another group (TPO-
sc group) 100 μl for 1 day as in TPO-iv group
It was subcutaneously administered once for 5 consecutive days. 6, 8 after the start of administration
Orbital vein of each mouse on days 10, 13 and 15
Blood is collected daily, and a microcell counter (Toa Medical
The number of platelets was measured by F-800 manufactured by Denshi. platelet
The transition of the numbers is shown in FIG. That is, control-
In the iv group, the number of platelets increased even on the 6th day when the number increased.
44% increase compared to before, control-s
47% increase was observed on day 8 with the highest increase in group c
It was only done. On the other hand, in the TPO-iv group
Shows an increase of 177% on day 6 compared to before administration.
And continued to increase thereafter, and reached the highest level of 469% on the 10th day.
A large increase was observed. Also, 6 days for TPO-sc group
Already a 347% increase in the eyes and the biggest increase after 8 days
A 493% increase was observed. From the above results, human T
PO increases platelets regardless of species and administration route
It was confirmed to have. <Example 70> Platelet-increasing action of TPO Blood was collected in advance from the orbital vein, and the microcell counter was used.
-(Toa Medical Electronics, F-800)
Normal 11-week-old C3H / HeJ male mice 16
The animals were randomly divided into 4 groups. One group (contro
100 μl PBS once a day for 5 consecutive days
Was subcutaneously administered. Conducted to the other 1 group (TPO-1 group)
Sephacryl S-200HR obtained in Example 56
The human TPO active fraction F1 of the above was placed in PBS with NAP-25.
100 μl of the solution that had been replaced and diluted with PBS
(Relative activity of 83,000 in M-07e assay system
(Including) was subcutaneously administered once a day for 5 consecutive days. Another one
Group (TPO-2 group) was administered with TPO-1 group
One of the two-fold diluted active fractions with PBS
00 μl (relative activity in the M-07e assay system 41,
(Including 500) subcutaneously once a day for 5 consecutive days
It was The last one group (TPO-3 group) is the TPO-2 group.
The TPO active fraction administered in 1. was further diluted 2-fold with PBS.
100 μl of the sample (in the M-07e assay system)
Relative activity of 20,750 is included) once a day for 5 consecutive days
Was subcutaneously administered. 6, 8, 10 and 12 days after the start of administration
Blood was collected daily from the orbital vein of each mouse and
Icrocel Counter (Toa Medical Electronics, F-800)
The number of platelets was measured at. Fig. 25 shows the change in platelet count
did. That is, in the control group, the platelet count was almost
No fluctuation was seen. In the TPO administration group, whichever
Platelets that maximize in group 8 days after the start of administration
An increase in number was observed. Also, the dose-dependent
The existence was confirmed. That is, in the TPO-1 group, 6 days
Already an increase of about 200% on the eyes and about 27 on the 8th day
It increased to 0%. It decreased after that, but on the 12th day
Even if it is, there is an increase of about 65.
Intention (p <0.01: Dunnett's multiple comparison test: Dun
net multiple comparison t
est) was recognized. Similarly in the TPO-2 group
Although the increase was seen, the increase effect did not reach the TPO-1 group.
Approximately 140% and 160 on the 6th and 8th days, respectively
% Increase was recognized. Also, control group on day 12
And reduced to almost the same level. To TPO-3 group
The increasing effect on swelling was even weaker than that of the TPO-2 group,
On the 8th day when it reached the maximum value, an increase of about 110% was seen
And a significant difference from the control group (p <0.01)
Was also recognized. From the above results, human TPO is
To increase the number of platelets regardless of
It was confirmed that the effect was dose-dependent. <Example 71> Thrombocytopenia inhibitory effect of administration of an anticancer agent by TPO 5-FU to 200 m for 30 8-week-old ICR male mice
After intravenous administration at a rate of g / kg body weight, randomly
Divided into 2 groups of 15 animals, one from the next day (Day 1)
Group (control group) with 100 μl PBS for 1 day
It was subcutaneously administered once for 5 consecutive days. The other group
(TPO group) includes the human TPO activity used in Example 69.
Fraction F2 100 μl (relative in M-07e assay system
(Including active amount 211,900) once a day for 5 consecutive days
It was administered subcutaneously. After the start of administration, it will be on Days 4, 6, and 8 respectively.
Randomly extract 5 mice from each group and
Blood is collected from the pulse, and a micro cell counter (Toa Medical Electronics
Manufactured by E-2500). Platelet count
The transition of is shown in FIG. That is, in the control group
The number of platelets decreased daily after administration of 5-FU.
6 reached the lowest value (about 28% of the value before 5-FU administration)
However, it increased to about 1.3 times in response to the decrease in Day 8.
did. Even in the TPO group, the platelet count after 5-FU administration was
It decreases daily, and the lowest value for Day 6 (before 5-FU administration)
(About 52% of the value) but reached the platelet count of Day 4 and 6
There is almost no difference, and in Day 6
Statistically significant (p <0.05: Dunnett's multiple ratio)
The high level was maintained in the comparison test). 5 in Day 8
-It increased to about 200% of the value before FU administration. The above conclusion
As a result, human TPO has anti-cancer drug
It was confirmed to have an effect of blocking. <Example 72> The therapeutic effect of thrombocytopenia by TPO To 36 7-week-old ICR male mice, nimustine hydrochloride (A
CNU) was intravenously administered at a rate of 50 mg / kg body weight.
After that, they were randomly divided into two groups of 18 animals each, and the next day (Da
200 μ in one group (control group) from y 1)
l of PBS was administered subcutaneously twice daily for one day, and the other
In the group (TPO group), the TPO active fraction used in Example 70 was used.
Twe at a rate of 0.04% without diluting PBS with F1
200 μl with en-80 added (M-07e
2 days a day including relative activity of 360,000
Subcutaneous administration was performed every day. No mice were left in each group after the start of administration.
It was divided into 3 groups, and blood was drawn on Day 5 and 12, respectively.
Group that collects blood, Group that collects blood on Day 8 and 14, and Day 1
The blood was collected at 0. Blood is collected from the orbital vein and
Cross cell counter (Toa Medical Electronics, F-800)
The number of platelets was measured by using Fig. 27 shows the change in platelet count
It was That is, in the control group, blood was administered after ACNU administration.
The number of plaques decreases daily and is the lowest at Day 8-10 (each
About 29% of the value before ACNU administration)
It just recovered to 49% and about 74% on Day 14.
It was On the other hand, in the TPO group, Day 5 was administered before ACNU administration.
It decreased to about 38% of the value. After that, it started to increase, and
Up to about 63% in Day 8 compared to the value before CNU administration
Recovered, and blood levels above the ACNU pre-administration level after Day 10
Shows the number of plates. Day 12 is about 300%, Day 14 is
Has increased to about 400%. As mentioned above,
In Day 8-10, which is in the process of decreasing
It has already started to increase in the TPO group, and already in Day 10.
Increased platelet count above the ACNU pre-administration level
Shows that human TPO is a thrombocytopenic agent-induced thrombocytopenic agent.
Confirmed to have the effect of promoting recovery from low
It was In addition, even if the results of Example 71 are combined,
Efficacy to prevent a decrease in platelet count regardless of the type of cancer drug
Has the effect of promoting recovery from fruit and thrombocytopenia
It is expected. <Example 73> The therapeutic effect of thrombocytopenia after BMT by TPO 10G was applied to 48 7-week-old C3H / HeN male mice.
Bone marrow cells of syngeneic mice after whole body irradiation with y radiation
1 x 10 ⁶ Individuals were immediately administered intravenously. There randomly
Divided into two groups, one group (control) from the next day (Day 1)
PBS for the roll group) and actual for the other group (TPO group)
The TPO active fraction F1 (M-07e
(Including relative activity amount of 44,000 in sei system)
100 μl was subcutaneously administered once a day for 20 consecutive days.
After the start of administration, each of days 5, 10, 14 and 21
Six mice were randomly selected from each group and
Blood collection, micro cell counter (made by Toa Medical Electronics,
E-2500) was used to measure the platelet count. Platelet count estimation
The transfer is shown in FIG. That is, in any group
Platelet count decreased daily after BMT,
It became the lowest (about 3% before BMT enforcement). Then Xu
It recovered to each day, and about 11 in the control group on Day14.
%, About 13% in the TPO group. Day 21 is
In the troll group, the recovery was only 37%,
The PO group recovered to about 65% and had a significant recovery-promoting effect.
Admitted. From the above results, it was purified in Example 56.
Human TPO promotes recovery of platelet count after BMT
It was confirmed that there is an effect. <Example 74> Effect of TPO on thrombocytopenia after irradiation Irradiation of 36 male 8-week-old ICR mice with 5 Gy X-rays
After total body irradiation, it was randomly divided into 2 groups and the next day (Day
From 1) PBS to one group (control group), the other
One group (TPO group) had the TPO activity used in Example 70.
Fraction F1 (relative activity in M-07e assay system 1,4
(Including 40,000) once a day for 3 consecutive days
Subcutaneous administration, and from the next day, relative activity in the M-07e assay system
A sex dose of 360,000 was administered subcutaneously once a day for 7 consecutive days.
It was After the start of administration, the mice were randomly divided into 3 groups in each group.
And a group that collects blood on Day 4, 11, and 21, respectively.
Day 7, 13, blood collection group and Day 9, 15
The group was used for blood collection. Blood is collected from the orbital vein and micro
Blood on a cell counter (F-800 manufactured by Toa Medical Electronics)
The number of platelets was measured. FIG. 29 shows the change in platelet count.
That is, in the control group, the platelet count after X-ray irradiation was
It decreases daily, and is the lowest at Day 9 (about 2 times the value before X-ray irradiation).
4%), about 38% for Day 11 and about 13 for Day 13.
Recovered to 67%, recovered to the value before X-ray irradiation on Day 15
did. On the other hand, in the TPO group, the value before X-ray irradiation was set for Day 7.
To about 24%. After that, it started to increase and X-ray
Compared to the pre-irradiation value, Day 9 recovered to about 82%
However, after Day 11, the number of platelets above the pre-X-ray irradiation value is shown.
However, the tendency was maintained until Day 21. As above
In the control group, Day 9 is in the process of decreasing.
In the TPO group, it has already started to increase.
Already increased to the number of platelets above the value before X-ray irradiation, and then
Also maintained high prices. On the other hand, in the control group, X-ray irradiation
It takes 15 days to recover the platelet count above the previous level
I have. From this result, human TP purified in Example 56
O shortens the recovery period from thrombocytopenia after irradiation
And the therapeutic effect on thrombocytopenia after irradiation.
The fruit was recognized. <Example 75> Platelet-increasing action of hTPO163 Blood was collected in advance from an orbital vein, and a microcell counter was used.
-(Toa Medical Electronics, F-800)
Randomized 15 normal C3H / HeN male mice
Were divided into 4 groups (control group, A, B, C group). 1
Group (control group) contains 0.1% mouse serum
PBS was subcutaneously administered once a day for 5 consecutive days. To group A
Is the SP Sepharose obtained in Example 65.
FastFlow TPO active fraction F2 was added to 0.1%
HTPO163 was diluted with PBS containing mouse serum for 1 day.
Or about 4 as the relative activity amount in the M-07e assay system.
0,000,000 / kg body weight, M-0 for group B
Approximately 8,000,0 as relative activity in 7e assay system
00 / kg body weight, and similarly for group C, M-07e
Approximately 1,600,000 as relative activity as a sei system
/ Kg body weight was subcutaneously administered for 5 consecutive days. Administration
Eyes of each mouse 6, 8, 10, 12 days after the start
Blood is collected daily from the fossa vein and microcell counter is used.
(Toa Medical Electronics, F-800)
It was The change in platelet count is shown in FIG. That is,
Little change in platelet count in the troll group
It was Start administration in any of the TPO administration groups
A maximal increase in platelet count was observed on the 8th day
It was In addition, a dose dependence was observed between the administration groups.
That is, in Group A, about 88% on the 6th day and about 1% on the 8th day.
00% increase was seen, and even on the 10th day, about 97%
The increase was maintained and both were significantly different from the control group
(P <0.01: Dunnett's multiple comparison test)
It was An increase was also seen in group B, but there was an increasing effect.
Are less than group A, but about 6 and 8 days each
5%, about 84% increase between the control group
Significant difference (p <0.01 or p <0.05: Dunnett
Multiple comparison test) was accepted. Increasing effect in group C
Was even weaker than group B, but reached the maximum on day 8
The increase was about 31%. Based on the above results
The hTPO163 purified in Example 65 had an increased platelet count.
Addition, and its effect is dose-dependent
Was confirmed. <Example 76> The therapeutic effect of thrombocytopenia by hTPO163 Nim hydrochloride was added to 100 8-week-old C3H / HeN male mice.
Sutin (ACNU) intravenously at a rate of 50 mg / kg body weight
After oral administration, 4 groups of 25 animals each (control
Le, A, B, C group) and the next day (Day 1)
5 ml / kg body weight of PBS for control group
Subcutaneous administration was carried out once daily for 1 day.
Of the SP Sepharose Fast Flow
The TPO active fraction F2 was diluted with PBS, and hTPO163
Is about 1 as a relative activity amount in the M-07e assay system.
6,000,000 / kg body weight once a day for consecutive days
It was administered below. Similarly, for group B, the M-07e assay system was used.
As a relative activity of about 48,000,000 / kg body
In the M-07e assay system for group C
Relative activity of about 160,000,000 / kg body weight
Was subcutaneously administered once a day for consecutive days. After the start of administration
Randomly divide the mice into 5 groups, and
Blood was collected at 5, 8, 10, 12, and 14. Blood sampling
Perform from the vein, micro cell counter (Toa Medical Electronics
Manufactured by E-2500). Platelet count
The transition of is shown in FIG. That is, in the control group
Showed that platelet count decreased daily after ACNU administration.
8-10 lowest (ACNU pre-administration value about 15-16
%), About 28% for Day 12 and about 5 for Day 14.
Only recovered to 1%. On the other hand, in group A, Day
8 decreased to about 25% of ACNU pre-treatment value
However, after that, it started to increase, and it was about 34% on Day 10.
Approximately 89% for Day 12 and AC for Day 14.
The value recovered to a level higher than that before NU administration. In group B, Day
In 8 it decreased to about 23% of the ACNU pre-treatment value,
After that, it started to increase, and it was already about 64% on Day 10.
Up to the pre-ACNU dose level on Day 14.
Recovered. In addition, in the group C as well, Day 10 or later
It started to increase, and after Day 12 after ACNU administration
I recovered to the top. As mentioned above, in which group
The lowest platelet count was observed in Day 8, but in humans
The decrease in the TPO administration group is slower than that in the control group
That is, the lowest price was seen rising. Also, the controller
The recovery of the platelet count in Day 10 was almost
Although it was not seen, Day10 in the human TPO administration group
The recovery of platelet counts was observed in all groups, although
And in the 50 μg / kg dose group,
It recovered to more than the ACNU administration pre-position. Control group
Then, in Day14, about 51% of the ACNU administration front
Compared with the fact that it just recovered to No. 2
, HTPO163 produced in, recovers from thrombocytopenia
It was revealed that it has the effect of promoting that's all,
HTPO163 purified in Example 65 was treated with an anti-cancer agent.
Has a therapeutic effect on thrombocytopenia caused by
It was Example 77 Preparation of human TPO derivative in E. coli Biological activity, stability, and stability of TPO expressed in E. coli, and
Designed and produced TPO derivatives in an attempt to improve solubility
It was The prepared derivative is the Leu129 of SEQ ID NO: 11.
Arg substitution (L129R), Arg position of His133
Substitute (H133R), Arg substitution of Met143 (M
143R), a Leu substitution product of Gly82 (G82L),
Leu substitution product of Gly146 (G146L), Ser1
Pro substitution of 48 (S148P), Ar of Lys59
g-substitution (K59R) and Arg substitution of Gln115
It is the body (Q115R). Casting for making TPO derivative
As a mold, h6T (1-163) described in Example 42 is used.
To synthesize the following oligo DNA for mutation introduction
did. The mutant plasmids shown below are all Sculptor
Nvitro Mutagenesis Kit (Amersham
Manufactured by the company). The plasmid described in Example 42.
Obtained from pCFM536 / h6T (1-163)
The Xba I-Hind III fragment was bluescript.
pt II SK- (Toyobo Co., Ltd.) Xba I-H
The plasmid pS was inserted between the ind III cleavage sites.
KTPO was prepared. The plasmid pSKTPO is E. coli
It was held on JM109. Helper phage M13K0
Single-stranded DN from pSKTPO using 7 (Takara Shuzo)
A was prepared, and using the above synthetic oligo DNA for mutation,
According to the protocol attached to the kit,
It was made. About the obtained candidate plasmid
Determine the nucleotide sequence and confirm that the target site has been mutated.
And confirmed. Of all pSKTPO made above
Extraction of Xba I-Hind III fragment from derivative
Xba I-Hind of plasmid pCFM536
E. coli 261 after insertion between the III cleavage sites
Transformation to express the desired TPO derivative
Completed the body. Encode the desired TPO derivative
Cultivation of the transformant containing the gene was carried out according to Example 43.
Carried out. Of the obtained h6T (1-163) producing recombinant
Frozen cells (about 3 g), 10 mM EDTA, 10 mM
20 mM Tris buffer containing DTT, 1 mM PMSF
About 30 mL of liquid (pH 8.5) was added and suspended, and then ice-cooled
1 minute sonication with an interval of 1 minute below
Wave crusher was used) 5 times. Centrifuge the crushed cells
Transfer to a tube and spin at 15,000 rpm for 10 minutes at 4 ° C.
Keep in mind and collect the pellets. Add 8M Guani to this pellet.
Zinc hydrochloride, 5 mM EDTA, 1 mM PMSF
Add about 30 mL of 10 mM Tris buffer (pH 8.7).
And add about 50 mg of DTT to room temperature.
And stirred for 1-2 hours to reduce the protein sample. After the reduction,
Adjust the pH of the sample to 5 using a 2M hydrochloric acid solution and adjust to 4 ° C.
I left it. Reduced protein sample is treated with 30% glycero
3M urea, 3mM cystamine, 1mM L-system
In containing 10 mM CAPS buffer (pH 10.5,
Diluted to about 1.5 L). Dilution at room temperature overnight
It carried out. Stir the diluted sample solution at room temperature for 2 days
At 8000 rpm after fully oxidizing the sample protein
Insoluble matter was removed by centrifugation for 45 minutes. The supernatant after centrifugation
The pH was adjusted to 6.8 with 6M phosphoric acid and deionized water was added.
After doubling the dilution with the
Filter using 2 sheets of Western filter paper, # 2, diameter 90mm)
It was The filtrate is used as an ion exchange resin (CM-Sepharose
Fast flow, from Pharmacia)
15% glyceride
Roll, 10 mM phosphate buffer containing 1 M urea (pH
6.8) After washing with about 400 mL, 15% glycerol
Containing 10 mM phosphate buffer (pH 7.2) about 300 m
The column was equilibrated with L. 15% for elution of target sample
0.5M from 10 mM phosphate buffer containing glycerol
Using a linear concentration gradient up to the same buffer containing salt, flow rate 1
It was performed at mL / min. Elute proteins from the column
Followed by UV absorption at 280 nm, containing the target protein
The collected fractions (about 30-40 mL) were collected. This
Centriprep 1
0, manufactured by Amicon) was concentrated to about 2 mL.
Then, it was purified using reverse phase HPLC (Waters).
It was At this time, the column has Waters μBonda.
Using sphere C4 (3.9x150mm),
For elution of white matter, eluent A which is a 0.05% TFA solution
70% 2-Propanol, 30% CH3CN
And eluent B containing 0.02% TFA, B eluent
Change the concentration of from 1% to 100% in 40 minutes,
The target protein was eluted. TPO derivative is
Were eluted at the position of about 30 minutes. Purified
To measure the activity of the TPO derivative, the eluted derivative
Collect body for 2 days against 2 L of 10 mM phosphate buffer
After dialysis, centrifuge concentrator (Centriprep 1
0, manufactured by Amicon) and concentrated with M-07e
I used it for essay. Each of the prepared TPO derivatives is
Organism similar to h6T (1-163) used as a control
The activity was shown (see FIGS. 32 and 33). The following are formulation examples
Show. Formulation Example 1 Human TPO fraction obtained in Example 56
Frozen product frozen at -20 ° C after concentrated and aseptic treatment
Was used as an injection. Formulation Example 2 Human TPO fraction obtained in Example 56
Was concentrated in a 10 ml vial bottle by aseptic operation.
1 liter, freeze-dried at -20 ° C, and frozen with a rubber stopper.
The dried product was used as an injection. <Formulation Example 3> Human TPO fraction obtained in Example 56
Was concentrated and sterile filtered, then placed in a 10 ml vial.
It was filled into an injection. <Formulation Example 4> hTPO163 obtained in Example 65
The fractions were concentrated, sterilized, and frozen at -20 ° C.
The frozen product obtained was used as an injection. <Formulation Example 5> hTPO163 obtained in Example 56
Concentrate the fractions and sterilize them into 10 ml vials.
Fill 5 ml, freeze-dry at -20 ° C, and plug into a rubber stopper.
The lyophilized product was used as an injection. Formulation Example 6 hTPO163 obtained in Example 65
After concentrating the fractions and aseptically filtering this, 10ml vials
It was filled in a bottle to give an injection. <Formulation Example 7> Reference Example Human TP obtained in Example 57
The O fraction was concentrated, aseptically processed, and frozen at -20 ° C.
The frozen product thus obtained was used as an injection. <Formulation Example 8> Human TPO fraction obtained in Example 57
Was concentrated in a 10 ml vial bottle by aseptic operation.
1 liter, freeze-dried at -20 ° C, and frozen with a rubber stopper.
The dried product was used as an injection. <Formulation Example 9> Human TPO fraction obtained in Example 57
Was concentrated and sterile filtered, then placed in a 10 ml vial.
It was filled into an injection.

[Sequence list]

[Brief description of drawings]

FIG. 1 Gel filtration chromatography (sephacryl S-2) in rat TPO purification from XRP.
00HR column) and rat CFU-
The graph which shows TPO activity in a MK assay.

FIG. 2: Reversed phase chromatography (Capcell Pak) for purification of rat small molecule TPO preparation derived from XRP.
Cl 300A column) chromatogram and TPO activity in rat CFU-MK assay.

FIG. 3: Reversed phase chromatography (Capcell Pak) for purification of rat small molecule TPO preparation derived from XRP.
Cl 300A column) TPO active fraction FA (tube number 36 to 42), a photograph showing separation by SDS-polyacrylamide gel electrophoresis, and rat CFU-
The graph which shows TPO activity in a MK assay.

FIG. 4: Reversed phase chromatography (Capcell Pak) for purification of rat small molecule TPO preparation derived from XRP.
Cl 300A column) TPO active fraction FA 3
The graph which shows the peptide map by step digestion.

FIG. 5 is a graph showing rat plasma-derived TPO activity in the rat CFU-MK assay.

FIG. 6 is a conceptual diagram showing the construction of the expression vector pEF18S.

FIG. 7. pEF1 in rat CFU-MK assay.
8 is a graph showing TPO activity in the culture supernatant of COS1 cells into which 8S-A2α has been introduced and expressed.

FIG. 8. pEF1 in rat CFU-MK assay.
8 is a graph showing TPO activity in the culture supernatant of COS1 cells into which 8S-HL34 has been introduced and expressed.

FIG. 9: pHT1 in rat CFU-MK assay
6 is a graph showing TPO activity in the culture supernatant of COS1 cells in which -231 was introduced and expressed.

Figure 10a: pH in the rat CFU-MK assay.
3 is a graph showing TPO activity in the culture supernatant of COS1 cells into which TF1 has been introduced and expressed.

FIG. 10b is a graph showing TPO activity in the culture supernatant of COS1 cells into which pHTF1 was introduced and expressed in the M-07e assay.

FIG. 11: Outline of restriction enzyme map of phage clone λHGT1. (In the figure, E: EcoRI, H: HindII
I, S: sal I is shown. )

Figure 12a: pE in rat CFU-MK assay.
The graph which shows TPO activity in the COS1 cell culture supernatant which introduced and expressed FHGTE.

Figure 12b: pEFHGT in M-07e assay.
TPO in COS1 cell culture supernatant in which E was introduced and expressed
A graph showing activity.

FIG. 13a: pHT1-211 # 1, and pHT1-291 # in rat CFU-MK assay.
1 and C into which pHT1-171 # 2 was introduced and expressed
The graph which shows the TPO activity in the OS1 cell culture supernatant.

Figure 13b: pH in the rat CFU-MK assay.
The graph which shows the TPO activity in the COS1 cell culture supernatant which introduce | transduced / expressed T1-163 # 2.

Figure 14: pHT1-21 in M-07e assay.
1 # 1, pHT1-191 # 1, pHT1-171 #
2 and C introduced with pHT1-163 # 2
The graph which shows the TPO activity in the OS1 cell culture supernatant.

FIG. 15 is a chromatogram of reverse phase chromatography (Vydac C4 column) in the purification of human TPO from the culture supernatant of CHO cells into which pDEF202-hTPO-P1 was introduced and expressed.

FIG. 16: Human TP purified from the culture supernatant of CHO cells into which pDEF202-hTPO-P1 was introduced and expressed.
A photograph showing separation of O by SDS-polyacrylamide gel electrophoresis.

FIG. 17 is a chromatogram of reverse phase chromatography in the purification of human TPO from Escherichia coli into which pCFM536 / h6T (1-163) has been introduced and expressed.

FIG. 18 is a photograph showing separation by SOS-polyacrylamide gel electrophoresis of h6T (1-163), a mutant human TPO separated and purified from Escherichia coli into which pCFM536 / h6T (1-163) had been introduced and expressed.

FIG. 19: Human TPO expression plasmid pDEF202-
CHO cells were transfected with hTPO163, and the culture supernatant obtained as a starting material was used to purify hTPO163.
Elution of TPO163. Protein was measured by UV absorption at 220 nm.

FIG. 20: Human TPO expression plasmid pDEF202-
SDS-polyacrylamide gel electrophoretic photograph of hTPO163 preparation obtained by Superdex 75 pg column in the purification of hTPO163 using culture supernatant obtained by transfecting hTPO163 into CHO cells as a starting material. Each hTPO163 was silver stained.

FIG. 21 shows the structure of the expression vector pSMT201.

FIG. 22: βGL-TP in the M-07e assay.
C introduced and expressed O, N3 / TPO, O9 / TPO
The graph which shows TPO activity in OS7 cell culture supernatant.

FIG. 23 is a graph showing TPO activity in COS7 cell culture supernatants into which the human TPO insertion / deletion derivative was introduced / expressed in the M-07e assay.

FIG. 24 is a graph showing changes in the platelet count when human TPO was intravenously or subcutaneously administered to normal mice.

FIG. 25 is a graph showing changes in platelet count when human TPO was subcutaneously administered to normal mice at different doses.

FIG. 26 is a graph showing changes in the number of platelets when human TPO is administered after the anticancer drug (5-FU) has been administered to mice.

FIG. 27 is a graph showing changes in the number of platelets when human TPO was administered after the anticancer drug (ACNU) was administered to mice.

FIG. 28 is a graph showing changes in the platelet count when human TPO was administered after BMT (bone marrow transplantation) was performed on mice.

FIG. 29 is a graph showing changes in platelet count when human TPO was administered to mice after irradiation.

FIG. 30 is a graph showing the change in platelet count when hTPO163 was subcutaneously administered to normal mice.

FIG. 31 is a graph showing changes in platelet count when hTPO163 was administered to mice after the administration of an anticancer drug (ACNU).

FIG. 32: Human TPO derivative expressed in E. coli (H1
33R, S148P, Q115R) is a graph showing the TPO activity in the M-07e assay.

FIG. 33. Human TPO derivative expressed in E. coli (M1
43R, L129R, G82L, G146L, K59
R) is a graph showing TPO activity in the M-07e assay.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] May 22, 1995

[Procedure Amendment 1]

[Document name to be corrected] Drawing

[Name of item to be corrected] Figure 3

[Correction method] Change

[Correction content]

[Figure 3]

[Procedure Amendment 2]

[Document name to be corrected] Drawing

[Correction target item name] Fig. 16

[Correction method] Change

[Correction content]

FIG. 16

[Procedure 3]

[Document name to be corrected] Drawing

[Name of item to be corrected] Fig. 18

[Correction method] Change

[Correction content]

FIG. 18

[Procedure amendment 4]

[Document name to be corrected] Drawing

[Name of item to be corrected] Fig. 20

[Correction method] Change

[Correction content]

FIG. 20 ─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] May 23, 1995

[Procedure Amendment 1]

[Document name to be corrected] Drawing

[Name of item to be corrected] Figure 3

[Correction method] Change

[Correction content]

[Figure 3]

[Procedure Amendment 2]

[Document name to be corrected] Drawing

[Correction target item name] Fig. 16

[Correction method] Change

[Correction content]

FIG. 16

[Procedure 3]

[Document name to be corrected] Drawing

[Name of item to be corrected] Fig. 18

[Correction method] Change

[Correction content]

FIG. 18

[Procedure amendment 4]

[Document name to be corrected] Drawing

[Name of item to be corrected] Fig. 20

[Correction method] Change

[Correction content]

FIG. 20 ─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] November 17, 1995

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be amended] Claims

[Correction method] Change

[Correction content]

[Claims]

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI technical display location (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1:91) (31) Priority Claim number Japanese Patent Application No. Hei 6-167328 (32) Priority Date Hei 6 (1994) June 15 (33) Country of priority claim Japan (JP) (31) No. of Japanese Patent Application No. Hei 6-227159 (32) Priority Hihei 6 (1994) August 17 (33) Priority claiming country Japan (JP) (31) Priority claim number Japanese Patent Application 6-193169 (32) Priority Day Hei 6 (1994) August 17 (33) ) Japan claiming priority (JP) (31) Claim number of priority Japan Patent Application No. 6-304167 (32) Priority date Hei 6 (1994) November 1 (33) Country claiming priority Japan (JP) (31) Priority claim number Japanese Patent Application No. 6-298669 (32) Priority date Hei 6 (1994) December 1 (33) Country of priority claim Japan (JP) (31) Priority claim number Japanese Patent Application No. Hei 6-34 1200 (32) Priority Day Hei 6 (1994) December 28 (33) Priority claiming country Japan (JP) (72) Inventor Akihiko Iwamatsu 1-13-5 Fukuura, Kanazawa-ku, Yokohama-shi, Kanagawa Kirin Brewery Co., Ltd., Fundamental Technology Laboratory (72) Inventor Hironori Akahori, 3 Miyahara-cho, Takasaki City, Gunma Prefecture Kirin Brewery Co., Ltd., Pharmaceutical Research Laboratories (72) Inventor, Ryota Kuroki 1-13-5, Fukuura, Kanazawa-ku, Yokohama, Kanagawa Prefecture Kirin Brewery Co., Ltd., Fundamental Technology Research Institute (72) Inventor Toshiyuki Shimizu 1-13-5, Fukuura, Kanazawa-ku, Yokohama-shi, Kanagawa Kirin Brewery Co., Ltd., Fundamental Technology Research Center (72) Inventor, Takanori Muto, Kanazawa-ku, Yokohama-shi, Kanagawa 1-13-5 Fukuura Kirin Brewery Co., Ltd. Basic Technology Research Institute

Claims (17)

[Claims] 1. Having TPO activity, substantially SEQ ID NO: 1.
A protein having the amino acid sequence shown in 6. 2. The protein according to claim 1, which has TPO activity and has the amino acid sequence shown in SEQ ID NO: 16. 3. The amino acid sequence shown in SEQ ID NO: 16,
Alternatively, the amino acid sequence has a substitution, deletion, insertion, and / or addition in a part of the amino acid sequence, and TPO
A protein having activity. 4. The protein according to claim 3, which comprises the amino acid sequence of positions 7 to 151 in the amino acid sequence shown in SEQ ID NO: 16. 5. The protein according to claim 4, which comprises the amino acid sequence of positions 1 to 151 of the amino acid sequence shown in SEQ ID NO: 16. 6. The protein according to claim 4, which comprises the amino acid sequence of positions 7 to 163 of the amino acid sequence shown in SEQ ID NO: 16. 7. The amino acid sequence shown in SEQ ID NO: 16 including the amino acid sequence from 1st position to 163rd position.
The protein according to. 8. The protein according to claim 3, which has at least one of the amino acid mutations shown in (a) to (v) below in the amino acid sequence shown in SEQ ID NO: 16; A serine residue is replaced with an alanine residue, and an alanine residue at position 3 is replaced with a valine residue. (B) An arginine residue at position 25 is replaced with an asparagine residue. (C) Histidine at position 33. The residue is substituted with a threonine residue. (D) The arginine residue at the 25th position becomes an asparagine residue,
And the glutamic acid residue at position 231 is replaced with a lysine residue (e) the histidine residue at position 33 is deleted (f) The glycine residue at position 116 is deleted (g) 117 The arginine residue at position 33 is deleted (h) The threonine residue is inserted between the histidine residue at position 33 and the proline residue at position 34 (i) The histidine residue at position 33 and position 34 An alanine residue is inserted between the proline residues of (j) a histidine residue at position 33 and a glycine residue between the proline residues at position 34 (k) a histidine residue at position 33 A glycine residue is inserted between the group and the proline residue at the 34th position, and the proline residue at the 38th position is replaced with a serine residue. (L) Glycine residue at the 116th position and arginine residue at the 117th position An asparagine residue is inserted between (M) an alanine residue is inserted between the glycine residue at position 116 and the arginine residue at position 117 (n) a glycine residue between the glycine residue at position 116 and the arginine residue at position 117 (O) the leucine residue at position 129 is replaced with an arginine residue (p) the histidine residue at position 133 is replaced with an arginine residue (q) a methionine residue at position 143 Is substituted with an arginine residue (r) The glycine residue at position 82 is replaced with a leucine residue (s) The glycine residue at position 146 is replaced with a leucine residue (t) 148 (U) The lysine residue at position 59 is replaced with an arginine residue (v) The glutamine residue at position 115 is replaced with an arginine residue. 9. ThrSerIleGly is further added to the C terminus.
TyrProTyrAspValProAspTyrA
laGlyValHisHisHisHisHisHi
9. The protein according to any one of claims 3 to 8, wherein the s polypeptide is added. 10. A methionine residue at the -2 position and a lysine residue at the -1 position are further added.
The protein according to any one of claims 3 to 8. 11. The protein according to claim 3, wherein a methionine residue is further added at the -1 position. 12. The protein according to claim 3, wherein a glycine residue is further added at the -1 position. 13. A pharmaceutical composition comprising the protein according to any one of claims 1 to 12 and a pharmaceutically acceptable carrier. 14. A platelet increasing agent containing the protein according to any one of claims 1 to 12 as an active ingredient. 15. A therapeutic agent for platelet disorders, which comprises the protein according to any one of claims 1 to 12 as an active ingredient. 16. A therapeutic agent for thrombocytopenia containing the protein according to any one of claims 1 to 12 as an active ingredient. 17. The therapeutic agent for thrombocytopenia according to claim 16, wherein the thrombocytopenia is caused by chemotherapy, radiation therapy or bone marrow transplantation.