JPH08225596A - Interleukin-1beta derivative and medicine - Google Patents

Abstract

PURPOSE: To provide interleukin-1β derivative having the amino acid sequence of interleukin-1β whose amino acid sequence is partially deleted or exchanged and is useful as a remedy of granulocytopenia, a prophylaxis or remedy for opportunistic infection, an antiinflammatory agent with side-effect reduced. CONSTITUTION: In the amino acid sequence of interleukin-1βrepresented by formula I, at least one of amino acids in the positions of 1, 3, 4, 5, 8, 11, 30, 71, 93, 97, 98, 99, 103, 120, 121 and 153 is deleted or exchanged, the amino acid sequence or at least one of amino acid residue is deleted in the positions of 1 to 9 and 103 to 153 where the deletion of the amino acids in the positions of 1, 3, 4, 5, 8, 103, 120, 121 and 153 is excluded) and Met or the amino acid sequence of formula II or its part are added to the N terminus. Thus, this novel interleukin-1β derivative is useful as a medicine with side-effect reduced.

Description

Detailed Description of the Invention

The present invention relates to new polypeptides, and more particularly to new derivatives of interleukin-1β (IL-1β), as well as the pharmaceutical use of IL-1β and its new derivatives.

In the 2nd International Lymphokine Work Shop, the Lymphocyte Activator (Lymphocyte Act) was once used.
ivating Factor; LAF), Mitogenic Protein, Helper Peak-1
(Helper peak-1), T lymphocyte replacement factor [T-cell
replacing factorIII (TRF-III), T-cell rep
lacing factor Mφ (TRFM)], B-cell activating facto
r), B lymphocyte differentiation factor (B-cell differationfacto
It has been decided that all the physiologically active substances that have been reported under the names such as r) are unified into the name interleukin-1 (IL-1) [Cellular Immunol., 4
8 , 433-436 (1979)]. This determination is based on the reason that each of the above-mentioned physiologically active substances cannot be distinguished as a substance and merely expresses the physiological activity from different angles.

The above-mentioned IL-1 further has an action of activating, for example, T lymphocytes and B lymphocytes to enhance interleukin 2 production and antibody production, and acts on hepatocytes to synthesize protein. It has also been reported to have an action of enhancing the activity, an action of enhancing the production of pustaglandin, and the like [Reviews of Infectious Disease, Vol. 6,
No. 1, 51-59 (1984), New England.
J. of Med., 311 , 1413 (1984), etc.].

However, although the body of IL-1 as a substance is still unknown, the existence of two different genes encoding a polypeptide having LAF activity or a precursor thereof has finally been reported. [P
roc. Natl. Acad. Sci., Vol. 81, 7907-7.
911 (1984), Nature. Vol. 315, 641
(1985), Nucleic Acid Research, Vol. 13
(16), 5869 (1985)]. These reports are 2
“IL-1α” having a 159 amino acid sequence deduced from the nucleotide sequence of the seed gene and “IL-1β” consisting of 153 amino acids are described.

However, the relationship between the above-mentioned physiological activity, which has been reported to have been conventionally conditioned medium or partially purified, and the polypeptide deduced from the above-mentioned nucleotide sequence has not yet been clarified. .

Further, I as the above-mentioned known physiologically active substance
L-1 is an endogenous pyrogen (endogeneous pyrogen):
EP) is the same substance and is known to exhibit exothermicity [Nature, 304 , 449 (198).
3); Cell. Immunol., 63 , 164 (1981);
J. Exp. Med., 150 , 709 (1979); I
mmunol., 130 , (6) 2708 (1983); ibid.
132 (3) 1311 (1984), etc.]. From this fact, it is extremely difficult to apply IL-1 as a physiological activity to the conventional use, and even if uniform IL-1 is provided as a substance, its application to medicinal use is extremely difficult.

The present invention is intended to provide a polypeptide which is a new useful IL-1β derivative which can be effectively used for pharmaceutical use.

The present invention is intended to provide a pharmaceutical use of a polypeptide which is a new IL-1β derivative.

The present invention relates to a gene encoding a novel IL-1β derivative and IL-by a genetic engineering method using the gene.
It is intended to provide a method for producing a polypeptide which is a 1β derivative.

The present invention also seeks to provide new pharmaceutical uses for homogeneous IL-1β itself.

The above and other objects of the present invention will be clarified by the following description.

The IL-1β derivative (polypeptide) of the present invention has the amino acid sequence of interleukin-1β represented by the following formula (A):

[0013]

[Chemical 6]

A) 1st Ala, 3rd Val, 4th Arg, 5th Ser, 8th Cys, 11th Arg, 30th His, 71st Cy
s, 93rd Lys, 97th Lys, 98th Arg, 99th Ph
e, 103rd Lys, 120th Trp, 121st Tyr and 1
At least one amino acid residue selected from Ser at position 53 has been deleted or substituted with another amino acid, b) the amino acid sequence from Ala at position 1 to Thr at position 9 or at least a small portion thereof Both have one amino acid residue deleted (provided that 1-position Ala, 3-position Val, 4-position A described in a above).
rg, unless at least one of the amino acid residues selected from the group consisting of Ser at position 5, and Cys at position 8 is deleted), c) Amino acid sequence from Lys at position 103 to Ser at position 153 or At least one amino acid residue therein has been deleted (however, Lys at position 103, 12
Unless at least one amino acid residue selected from the group consisting of 0-position Trp, 121-position Tyr, and 153-position Ser is deleted), d) Met or the following at the N-terminal of the formula (A): An amino acid sequence extending from Met at the 1'position to Asp at the 116 'position shown in formula (B) or a partial amino acid sequence on the C-terminal side thereof is added,

[0015]

[Chemical 7]

Is characterized by having a modified amino acid sequence which satisfies at least one of the conditions a) to d) (provided that at least the Cys at position 71 is substituted with another amino acid). except).

Amino acid and polypeptide designations herein above and below refer to IUPAC and IUAC-
Abbreviations in IUB nomenclature or rules or abbreviations commonly used in the art shall be followed.
The same applies to the display of nucleic acids in base sequences. The number or position of amino acids are indicated in accordance with the amino acid sequence of IL-1β, that is, the amino acid sequence of the above formula (A), even if there is a deletion or addition. However, among the numerical values indicating the amino acid positions, those with a dash attached follow the amino acid sequence of the formula (B).

The IL-1β derivative of the present invention is IL-1β
A novel polypeptide containing an amino acid sequence satisfying one or two or more of the requirements a) to d) in the amino acid sequence represented by the above formula A). Preferred derivatives are at least 1 of the above requirements a) to c).
Having an amino acid sequence satisfying the above conditions and a) to c)
Of the amino acid sequence satisfying at least one requirement and the requirement of d) at the same time.

Preferred specific examples of the IL-1β derivative polypeptide of the present invention are as follows.

1) A polypeptide in which at least position 1 Ala has been deleted or substituted with another amino acid.

2) A polypeptide in which at least Val at position 3 has been deleted or substituted with another amino acid.

3) A polypeptide having Arg at position 4 deleted or substituted with another amino acid.

4) A polypeptide having at least Ser at position 5 deleted or substituted with another amino acid.

5) A polypeptide in which at least Cys at position 8 has been deleted or substituted with another amino acid.

6) A polypeptide in which Arg at position 11 has been deleted or substituted with another amino acid.

7) A polypeptide in which at least His at position 30 has been deleted or substituted with another amino acid.

8) A polypeptide in which at least Cys at position 71 has been deleted or substituted with another amino acid.

9) A polypeptide in which at least Lys at position 93 has been deleted or substituted with another amino acid.

10) A polypeptide in which at least Lys at position 97 has been deleted or substituted with another amino acid.

11) A polypeptide in which Arg at position 98 has been deleted or substituted with another amino acid.

12) A polypeptide in which at least Phe in position 99 has been deleted or substituted with another amino acid.

13) A polypeptide in which at least Lys 103 is deleted or substituted with another amino acid.

14) A polypeptide in which at least Trp at position 120 has been deleted or substituted with another amino acid.

15) A polypeptide in which at least Tyr 121 is deleted or substituted with another amino acid.

16) A polypeptide in which at least Ser at position 153 has been deleted or substituted with another amino acid.

17) At least an amino acid sequence extending from Ala at position 1 to Val at position 3 from Ala at position 1 to Leu at position 6 or an amino acid sequence from Ala at position 1 to Thr at position 9 is at least absent. The missing polypeptide.

18) Amino acid sequence from 151-position Val to 153-position Ser, 149-position from Gln to 153-position Ser, amino acid sequence from 145-position Asp to 153-position Ser, 141-position from Gln-153 Ser A polypeptide in which the amino acid sequence, the amino acid sequence from Tyr 121 to Ser 153, or the amino acid sequence from Lys 103 to Ser 153 is deleted.

19) Met at the N-terminus of formula (A), the amino acid sequence represented by formula (B) from Met at position 77 'to Asp at 116' position, from Met at position 71 'to Asp at 116' position A polypeptide having at least an amino acid sequence, an amino acid sequence from Met at 32 'position to Ser at 116' position, or an amino acid sequence from Met at 1'position to Asp at 116 'position.

The above-mentioned IL-1β derivative of the present invention is IL-
It includes a polypeptide having an amino acid sequence in which a specific amino acid at a specific position in the 1β amino acid sequence is replaced with another amino acid. The other amino acid that can be substituted is an α-amino acid that constitutes a human body protein. , Any of them may be used, but a neutral amino acid is preferred. However, C
ys may form an intramolecular or intermolecular disulphide bond based on its SH group, and in consideration of this, the amino acid is preferably the above-mentioned amino acid other than Cys. Particularly preferred is, for example, G in the case of Arg at position 4.
ly, Ser or Ala for the 8-position Cys, Gln for the 11-position Arg, Tyr for the 30-position His, 71-position Cys
In the case of, Ser, Ala or Val, and L in the case of Lys 93
eu, Leu for 98th Arg, Gln for 103th Lys, Arg for 120th Trp, 121th Tyr
In this case, Gln can be exemplified as being preferable.

The IL-1β derivatives of the present invention as well as the homogeneous IL-1β obtained according to the method described herein are, for example, LAF activity, tumor cell growth inhibitory activity (GIF activity), ie specific for tumor cells. Colony stimulating fact (colony stimulating fact)
or: CSF), interferon (IF)
N), interleukin-2: IL-
2), Interleukin-3: IL-
3) etc. production-promoting activity of various cytokines, ie, activity that acts on, for example, human cells to remarkably promote the production of these cytokines, anti-inflammatory activity, especially arthritis by administration to, for example, arthritis model animals Activity that effectively suppresses the progression of
That is, it has an effect of preventing or preventing biological whole body irradiation at the time of bone marrow transplantation, irradiation at the time of cancer treatment, etc., and biological injury or serious side effects at the time of radiation accident. The derivative of the present invention is excellent in at least one of the above activities, or (and) is excellent in that it has lower toxicity and fewer side effects. Therefore, the derivative of the present invention and the above-mentioned homogeneous IL-1β are, for example, immune system stimulants such as antibody production promotion and vaccine effect enhancement, antitumor agents, for example, cytokine production promoters such as CSF, IL-2 and IL-3, It is useful as a medicine such as an anti-inflammatory agent and a radiation damage preventing agent.

In particular, the new finding according to the present invention that the above-mentioned homogeneous IL-1β itself is extremely effective for inflammation such as arthritis is as follows.
The fact that IL-1 was previously involved in mediating inflammation and in causing it is alarming. Further, the derivative of the present invention is superior in at least one of the above-mentioned activities, and / or is superior in that it has lower toxicity and fewer side effects.

In particular, the derivative of the present invention is effective as a CSF production promoter, and when it is administered to humans, it does not cause the risk of viral infection, antigen-antibody reaction, etc., and can be used after cancer chemotherapy or radiation therapy. Granulocytopenia due to bone marrow hypoplasia can be effectively restored (granulocytopenia therapeutic agent).
The above-mentioned CSF production promoter can be effectively used as a preventive and therapeutic agent for various diseases based on the action of CSF due to its original CSF production promoting action. For example, CSF has an action of promoting the functions of granulocytes and macrophages [Lopez et al. (AF et al.), J. Immuno
l., 131 , 2983 (1983), Handam et al. (Hand
am, E. et al.), ibid. 122 , 1134 (1979) and Vadas, MA et al., ibid. 130 , 79.
5 (1983)], clinical application is expected as a preventive and therapeutic agent for various infectious diseases, and the CSF production promoter is also expected to be clinically applied.

In particular, a so-called opportunistic infection or terminal in which a pathogen, which has been harmless until then, exerts its pathogenicity on an individual (compromised host) whose biological defense ability has been reduced or impaired in recent years infec
is a gram-negative bacillus such as Pseudomonas Serratia, which is a clinically problematic pathogen (Herpes simplex, HS).
V), Varicera zoster (VZ)
V), Cytomegalovirus (CM)
V) and other viruses, Candida albicans
) Fungi such as Aspergillus fumigatus and Nocardia asteroidea, Pneumocystis carinii, Toxoplasma
It is a protozoa such as lasma gondii), etc., and it is difficult for the currently used antibiotics to exert a sufficient effect against such pathogenic bacteria, and research and development of new drugs against the opportunistic infections have been earnestly desired. The derivative of the present invention is also useful as a prophylactic and therapeutic agent for such opportunistic infections. For example, it is useful as a prophylactic and therapeutic agent for complications such as ganglidosis, cryptococcosis, aspergillosis, zygomycosis, black fungal infection, viral infection, cytomegalovirus pneumonia, etc. Furthermore, the derivative of the present invention and the above-mentioned IL
In addition to the above-mentioned pharmaceutical use, -1β can be extremely effectively used based on its cytokine production promoting activity, for example, in the in vitro production of various useful cytokines from cell lines. The production of natural cytokines from such cell lines is particularly focused on cytokines, which are glycoproteins, and at least the 71-position Cys in the derivative of the present invention capable of obtaining useful cytokines efficiently and in large amounts. Substituted or deleted, especially Cys above
Substituted with other amino acids such as Ser, Ala, Val and the like shows high activity.

Further, the derivative of the present invention in which at least Arg at position 4 or Cys at least in position 8 is substituted or deleted, and the derivative of the present invention in which at least one amino acid after the 103rd position is deleted are all Prostaglandin E
The derivative of the present invention, which has a weak (PGE) production-promoting action and therefore has less side effects such as fever and less toxicity, and has at least Arg at position 4 substituted or deleted is G
Compared with IF and LAF activities, CSF production promoting activity and anti-inflammatory activity have stronger characteristics.

Further, among the derivatives of the present invention, those in which at least the above-mentioned specific amino acid or polypeptide is added to the N-terminal of the formula (A) have a C concentration higher than that of GIF activity and LAF activity.
It is more effective when used as a medicine, especially as an oral agent or suppository, because it has the characteristics of higher SF production promoting action and anti-inflammatory action, and has low toxicity and long-lasting action.

Furthermore, the derivative of the present invention, in particular at least the 8-position Cys and / or 71 Cys substituted or deleted,
In particular, the above Cys is replaced with another amino acid such as Ser, Ala or Val.
And the like are excellent in binding to the IL-1 receptor under various conditions.

Among the derivatives of the present invention, those containing less Cys in the molecule thereof than IL-1β or not containing IL-1β do not require the formation of intramolecular or intermolecular bonds based on the SH group of Cys. It is more preferable in consideration.

The polypeptide of the present invention can be produced, for example, by a genetic engineering technique. That is, it can be produced by utilizing a gene encoding the specific polypeptide according to the present invention, integrating the gene into a vector of a microorganism, and replicating, transcribing and translating in the cells of the microorganism. This method is particularly advantageous in that it can be mass-produced.

The gene used in the above method can also be totally synthesized by chemical synthesis of nucleic acid according to a conventional method, for example, a conventional method such as the phosphite triester method [Nature, 310 , 105 (1984)]. However, it is convenient to use a gene encoding IL-1β or a precursor thereof, and from the gene, a nucleic acid sequence encoding the specific amino acid sequence is modified according to a conventional method including the above-mentioned chemical synthesis means. Can be easily manufactured.

The gene encoding IL-1β or its precursor is publicly known (description), and as described in our earlier application (Japanese Patent Application No. 60-138281), IL-1β is known.
Was successfully obtained, and IL-1β was successfully obtained by a genetic engineering technique. Such a series of genetic engineering techniques will be clarified in Reference Examples described later.

The above-mentioned nucleic acid (base) sequence modification operation may be carried out according to known methods, and it is carried out according to the amino acid sequence of the desired polypeptide [as a genetic engineering technique, for example, Molecular Cloning Cold Spring Harbo
r Laboratory (1982)].

For example, conventional means such as restriction enzymes for the purpose of cutting, binding, phosphorylation of DNA, treatment of various enzymes such as DNA ligase, polynucleotide kinase, DNA polymerase and the like can be adopted, and these enzymes are commercially available products. As easily available. Isolation and purification of the gene or nucleic acid in each operation may be performed according to a conventional method such as agarose electrophoresis. In addition, replication of the obtained gene may be performed according to a method using an ordinary vector, as described later in part.
Further, a DNA fragment encoding a desired amino acid sequence and a synthetic linker can be easily produced by the above-mentioned chemical synthesis. In the above, the codon corresponding to the desired amino acid is known per se, and its selection may be arbitrary, and for example, it may be carried out according to a conventional method in consideration of the codon usage frequency of the host to be used [Nucl. Acids. Res., 9,43-74 (1
981)]. Moreover, in order to partially modify the codons of these nucleic acid sequences, for example, according to a conventional method, about 15 to 30 mer,
Site-specific mutagenesis [P] using a primer composed of a synthetic oligonucleotide encoding a desired modification
roc. Natl. Acad. Sci., 81 , 5662-5666 (1
984)] and the like can be adopted.

The desired gene obtained by the above method is
For example, the Maxam-Gilbert chemical modification method [Maxam-G
ilbert, Meth. Enzym., 65 , 499-560 (198).
0)] and the dideoxynucleotide chain termination method [Messing, J. et al. and Vieira, J., Gene, 1
9 , 269-276 (1982)] and the like, the base sequence thereof can be determined and confirmed.

Specific examples of the above operations and methods are described in Reference Examples and Examples below, but the methods are not particularly limited, and any of various methods well known in the art may be adopted.

Thus, according to the present invention, a novel gene encoding a polypeptide having the above-mentioned specific amino acid sequence is also provided (hereinafter this gene is referred to as "the gene of the present invention").

The polypeptide of the present invention can be produced by utilizing the above-mentioned specific gene (the gene of the present invention) according to a conventionally known general gene recombination technique. More specifically, a recombinant DN capable of expressing the above-mentioned gene of the present invention in a host cell.
A may be prepared, introduced into a host cell for transformation, and the transformant may be cultured.

As the host cell, either a eukaryote or a prokaryote can be used. The eukaryotic cells include cells such as vertebrates and yeast, and the vertebrate cells include, for example, Cos cells [Y.
Gluzman, Cell, 23 , 175-182 (1981)].
And Chinese hamster ovary cell dihydrofolate reductase-deficient strain [G. Urlaub and L.D. A. Chasin
, Proc. Natl. Acad. Sci., USA, 7 7 , 421.
6-4220 (1980)] and the like are often used, but the invention is not limited thereto. As an expression vector for vertebrate cells, a vector having a promoter located upstream of a gene to be expressed, an RNA splice site, a polyadenylation site, a transcription termination sequence, etc. can be used. May be owned. As an example of the expression vector, pSV2dhfr [S. Subrama
ni, R. Mulligan and P.M. Berg, Mol. Cell. Bio
l., 1 (9), 854-864] and the like can be exemplified, but the invention is not limited thereto.

Yeast is generally used as a eukaryotic microorganism, and among them, Saccharomyces yeast can be advantageously used. Examples of expression vectors for eukaryotic microorganisms such as yeast include pAM82 [A. Miyanohara et a
1, Proc. Natl. Acad. Sci., USA, 80 , 1-5
(1983)] can be preferably used.

As a prokaryotic host, Escherichia coli and Bacillus subtilis are commonly used. In the present invention, for example, a plasmid vector capable of replicating in the host bacterium is used, and a promoter and an SD (Shine and Dalgarno) nucleotide sequence are provided upstream of the gene so that the gene of the present invention can be expressed in the vector, and further, protein synthesis. Expression plasmids with the ATG required for initiation can be used. Escherichia coli as the host bacterium includes Escherichia coli.
coli) K12 strain and the like are often used, and pBR322 is generally often used as the vector, but the present invention is not limited to this, and various known strains and vectors can be used. Examples of the promoter include tryptophan
Promoter, PL promoter, lac promoter,
An lpp promoter or the like can be used, and in any case, the gene of the present invention can be expressed.

The case of using a tryptophan promoter will be described in detail. As an expression vector, a vector pT having a tryptophan promoter and an SD sequence will be described.
M1 [Now text Man, Metabolism, Vol. 22, 289 (198
5)] is used, and the restriction enzyme C existing downstream of the SD sequence is used.
A gene encoding a desired polypeptide with ATG added may be linked to the laI site, if necessary.

Not only the direct expression system but also a fusion protein expression system utilizing, for example, β-galactosidase or β-lactamase can be used.

The method of introducing the thus-obtained expression vector into a host cell and transforming it by this method are generally used, for example, cells mainly in the logarithmic growth phase are collected and treated with CaCl ₂ to spontaneously express DNA. It is possible to adopt a method in which the vector is incorporated so that it can be easily incorporated. In the above method, in order to further improve the efficiency of transformation, it is generally known that MgCl ₂
It is also possible to further coexist with RbCl. Alternatively, a method of transforming host cells into spheroplasts or protoplasts and then transforming them can also be used.

The desired transformant thus obtained can be cultured according to a conventional method, and the desired polypeptide is produced and accumulated by the culture. The medium used for the culture may be any of various media commonly used for ordinary cell culture, and specific examples thereof include L medium,
Examples of the medium include E medium, M9 medium and the like, and various types of medium generally known such as carbon sources, nitrogen sources, inorganic salts and vitamins. When the above tryptophan promoter is used, it can be cultivated using, for example, M9 minimal medium to which casamino acid is added in order to make the promoter work. A drug for enhancing the function of the tryptophan promoter such as indole acrylic acid may be added at the time.

Purification and isolation of the desired polypeptide, that is, the polypeptide of the present invention from the culture containing the thus obtained active substance can be carried out by a conventional method.
In extracting the polypeptide of the present invention from the host, it is preferable to use mild conditions such as the osmotic pressure shock method from the viewpoint of maintaining the higher order structure.

The above-mentioned purification and isolation can be carried out, for example, according to various treatment operations utilizing the physical and chemical properties of the polypeptide [for example, "Biochemical Data Book".
II ”pp1175-1259, 1st edition 1st printing, 1980
June 23, 2014, see Tokyo Kagaku Doujin Co., Ltd.] Specific examples of the method include treatment with an ordinary protein precipitation agent, ultrafiltration, molecular sieve chromatography (gel filtration), liquid chromatography, centrifugation, electrophoresis, affinity chromatography, dialysis. It is possible to adopt a combination of laws, rules, etc.

More specifically, the above operation can be carried out as follows, for example. That is, first, the polypeptide of interest is partially purified in advance from the culture supernatant. This partial purification is carried out, for example, with an organic solvent such as acetone, methanol, ethanol, propanol, dimethylformamide (DMF), acetic acid, perchloric acid (PCA), trichloroacetic acid (TC).
By treatment using an acid such as A) as a protein precipitant, treatment with a salting-out agent such as ammonium sulfate, sodium sulfate, sodium phosphate and / or ultrafiltration treatment using a dialysis membrane, flat plate membrane, hollow fiber membrane, etc. Done. The operations and conditions of each process may be the same as those of the ordinary method of this kind.

Then, the crudely purified product obtained above is subjected to gel filtration to obtain a fraction in which the activity of the target substance is recognized. The gel filtration agent used here is not particularly limited, and for example, any one made of dextran gel, polyacrylamide gel, agarose gel, polyacrylamide-agarose gel, cellulose or the like can be used. As a concrete example of the above, Sephadex G
Type, LH type, Cefalose type, Cefacryl type (above, Pharmacia), Cellulophane (Chitsuso Co., Ltd.), Biogel P type, A type (Bio-Rad Co.), Ultrogel (LKB company), TS
Commercial products such as K-G type (Toyo Soda Co., Ltd.) can be exemplified.

The polypeptide of interest is obtained by subjecting the active fraction obtained by the above gel filtration to ion exchange column chromatography such as affinity chromatography using a hydroxyapatite column, DEAE method, CM method, SP method and the like. Further, it can be further purified by subjecting it to chromatofocusing method, reverse phase high performance liquid chromatography or the like, or by a combination of various operations, and can be isolated as a homogeneous substance.

The chromatofocusing method can be carried out by various known methods. As the column, for example, P
BE94 (manufactured by Pharmacia), a starting buffer such as imidazole-hydrochloric acid, and an eluent such as Polybutafer 74 (manufactured by Pharmacia)-
Hydrochloric acid (pH 4.0) or the like can be used.

The above-mentioned reversed-phase high-performance liquid chromatography is
For example, using a C ₄ Hypoor reverse-phase HPLC column (Bio-Rad Laboratories) or the like, acetonitrile and trifluoroacetic acid (TF) as transfer agents are used.
It can be carried out using a mixed solvent of A), water and the like.

Thus, the IL-1β derivative (polypeptide) of the present invention can be isolated and obtained. IL-1β can be obtained from the gene encoding IL-1β by the same kind of gene recombination operation.

The resulting polypeptide of the invention or IL-1
Since β has excellent pharmacological activity as described above,
It can be made into a pharmaceutical preparation useful for the various pharmaceutical applications described above. Such pharmaceutical preparations include, for example, immunostimulants for enhancing antibody production and vaccine effect, and for treating immunodeficiency,
Antitumor agents, cytokine production accelerators, anti-inflammatory agents, radiation damage inhibitors, opportunistic infectious disease therapeutic agents and the like are included.
The pharmaceutical preparation usually comprises the polypeptide of the present invention or IL-1β.
It is prepared in the form of a pharmaceutical composition by mixing an appropriate pharmaceutical carrier with the pharmacologically effective amount of. As the drug carrier, a filler usually used for preparing a drug product according to the usage form,
Any excipient or diluent such as a filler, a binder, a moisturizer, a disintegrant, and a surfactant can be used. The form of the pharmaceutical composition is not particularly limited as long as it effectively contains the polypeptide of the present invention or IL-1β, and examples thereof include solid preparations such as tablets, powders, granules and pills. Good, but
Usually, it is preferable to use an injectable form such as a solution, suspension or emulsion. It can also be made into a dried product which can be made into a liquid by adding a suitable carrier before use. Each of these pharmaceutical compositions can be prepared according to a conventional method.

The obtained pharmaceutical preparation is administered by an appropriate administration route depending on the form of the pharmaceutical composition, for example, an injection preparation is administered intravenously, intramuscularly, subcutaneously, intracutaneously, intraperitoneally or the like. The solid dosage form pharmaceutical preparation can be administered orally or enterally. The amount of the active ingredient in the pharmaceutical preparation and the dose of the preparation are appropriately selected depending on the administration method of the preparation, the administration form, the purpose of use, the symptoms of the patient to which the preparation is applied, etc. It is prepared in a dosage form containing about 1 to 80% by weight of the active ingredient, and this preparation is administered in such a range that the amount of the active ingredient contained therein is about 0.1 μg to 10 mg per adult per day. Is desirable. The administration is 1 a day
It does not have to be once and can be divided into 3 to 4 times a day.

[0074]

The present invention will be described in more detail with reference to the following Reference Examples for producing IL-1β and Examples for producing the derivatives of the present invention.

In each of the following examples, the following abbreviations have been added to the derivatives of the present invention for the sake of simplicity.

In each of the following examples, various physiological activities were measured by the following methods.

[0077]

Embedded image

[0078]

[Chemical 9]

[0079]

[Chemical 10]

[0080]

[Chemical 11]

[0081]

[Chemical 12]

<Measurement of activity> (1) Measurement of IL-1 activity Method of Otsupenhain et al. (JJ Oppenhein et al) [J. Immunol., 116, 1466 (1976)], the LAF activity was measured using thymocytes of C3H / HeJ mice.

(2) Measurement of GIF activity 0.1 ml of the test solution diluted to various concentrations was placed in a 96-well microplate (Corning), and then 2 × 10 ⁴ human melanoma cells A375 / ml were placed in each well. 0.1 ml of Eagles MEM suspension containing 10% FCS contained in the above concentration was added to a carbon dioxide incubator (manufactured by Nafco).
Incubate for 4 days. After completion of the culture, 0.05 ml of 0.05% neutral red (manufactured by Wako Pure Chemical Industries, Ltd.) is added to each well, and the mixture is incubated at 37 ° C. for 2 hours. After removing the supernatant,
Wash the wells by gently adding 0.3 ml of phosphate buffered saline to each well. After removing the washing solution, 0.1 m of monosodium phosphate-ethanol equivalent mixture solution was added to each well.
1 and shaken for several minutes with a micromixer, and the amount of dye taken up in the cells was measured by measuring the absorbance using a photometer for 96-well microtitration plate (Titer Check Multiskin, manufactured by Flow Laboratories). 5
It is measured at 40 mμ to determine the growth inhibitory activity. The reciprocal of the dilution ratio of the test group showing 50% inhibition of cell growth in the control group (control group), that is, the test group showing the absorbance measurement value of 1/2 of the absorbance measurement value of the control group, was taken to obtain the GIF activity. Use as a unit. Thus, for example, if the GIF activity is 10 units, the test solution has an activity of inhibiting cell growth by 50% even after dilution 10-fold.

Reference Example 1 Production of plasmid pGIF-α (1) Preparation of human lymphocytes Human peripheral blood was collected and subjected to FICOL HYPERK density gradient centrifugation [Eur. J. Immunol. 4 , 808 (197
4)], 1.9 × 10 ¹⁰ peripheral blood lymphocytes were obtained.

The lymphocytes were suspended in RPMI1640 medium containing 5% of human serum at a cell concentration of 4 × 10 ⁸ / ml, dispensed in a dish having a diameter of 9 cm, and then in 5% carbon dioxide gas,
The cells were cultured at 37 ° C for 1 hour. After that, cells not attached to the bottom of the dish are removed, and fetal bovine serum 10% and TPA are used.
(Sigma) 0.5 ng / ml and LPS
RP containing 10 μg / ml (manufactured by Difco)
The cells were stimulated with MI1640 medium. After culturing in 5% carbon dioxide at 37 ° C for 4 hours, PBS and 0.02%
9 × 10 ⁸ adherent lymphocytes were obtained by EDTA.

(2) Preparation of mRNA Human adherent lymphocytes obtained in (1) above were treated with a 6M-guanidine thiocyanate solution (6M-guanidine isothiocyanate, 5 mM sodium citrate (pH 7.0),
After dissolving in 30 ml of 0.1 M 2-mercaptoethanol, 0.5% Sarkosyl, the DNA was sheared using a 50 ml syringe with a G18G needle.
To this solution was added 12 g of cesium chloride (Cs Cl),
After completely dissolving, 6.4 ml of each 5.7M
Cs Cl (5.7M Cs Cl-0.1 MEDTA) 4
Beckman SW (Beckman SW-
It was centrifuged for 20 hours at 31500 rpm at 25 ° C. in a 40 Ti rotor). After washing the pellet of the precipitated RNA with 70% ethanol, a TE solution (10 mM Tris-HCl, pH
7.5M, 1mM EDTA), 1/9 volume of 3M
Sodium acetate (pH 5.2) and 2.2 volumes of ethanol were added and left at -70 ° C for 1 hour. 15 at 4 ° C
RNA was recovered by centrifugation at 000 rpm for 20 minutes and dissolved in TE solution.

Thus, 250 μg of total RNA was obtained from about 9 × 10 ⁸ cells of adherent lymphocytes.

Next, in order to obtain mRNA from the RNA obtained above, oligo (dT) -cellulose (Collabo
rative Research Inc. ) Was used for column chromatography. Adsorption is 10 mM Tris HCl
(PH 7.5), 0.5 M NaCl, 1 mM EDTA
After washing the column with the same solution, RN with 10 mM Tris HCl (pH 7.5) and 1 mM EDTA.
A was eluted.

As a result, the amount of mRNA eluted was 1
It was 7.5 μg.

(3) Preparation of cDNA From the mRNA obtained in (2) above, cDNA was synthesized in vitro, and the Okayama-berg plasmid vector [O
kayama, H.M. and Berg, P., Mol. Cell.Biol., 2 ,
161 (1982)], and transformed into Escherichia coli.
A cDNA library was created. Each method is as follows.

(3) -1) Preparation of vector primer and linker DNA pBR322-SV40 (0.71 to 0.86) DNA
400 μg of KpnI (NEB) 700 units at 37 ° C.
Digested for 5 hours with 0.25M EDTA (pH 8.0)
After stopping the reaction with a mixture of 40 μl and 20 μl of 10% SDS, an equal volume of phenol-chloroform (1: 1) was used.
Extracted with ethanol, the DNA was precipitated with ethanol, and after centrifugation,
The DNA was recovered by washing with 70% ethanol. The obtained DNA is 140 mM sodium cacodylate, 30 mM
Tris HCl (pH 6.8), 1 mM CoCl ₂ , 0.
1 mM DTT and 0.25 mM dTTP (α- ³² P-d
200 μl of TTP (containing 0.5 μCi)
Terminal Transfer Errase (TTase, PL) 40
Allow the dT chain to elongate at 0 units for 30 minutes,
The reaction was stopped by adding 20 μl of M EDTA and 10 μl of 10% SDS, and phenol-chloroform extraction was repeated four times, and then DNA was recovered by ethanol precipitation. As a result, the dT chain was extended by about 70 bases.

Next, the DNA obtained above was replaced with HpaI (NE
B) 17 units were used for digestion at 37 ° C. for 6 hours, and a DNA fragment of about 2.7 kb was recovered by agarose (low melting point agarose, BRL, 1%) electrophoresis.

After electrophoresis, ethidium bromide 0.5
DNA is stained with μg / ml and is about 2.7 under UV irradiation.
Agarose containing kb fragment was cut out and 5 volumes of 20m
After adding M Tris HCl (pH 8.0) -1 mM EDTA and dissolving agarose at 65 ° C. for 5 minutes, phenol extraction, phenol-chloroform (1: 1) extraction and chloroform extraction were sequentially performed, and ethanol precipitation was performed to DN.
A was collected. Next, the vector primer DNA was purified by oligo (dA) cellulose column chromatography. The above DNA was added to 10 mM Tris HCl (pH
7.3) -1 mM EDTA-1M NaCl buffer 1
Dissolve in 1 ml, cool with ice, load on a column equilibrated with the same buffer, wash with 1 ml of the same buffer, return to room temperature, and
0 mM Tris HCl (pH 7.3) -1 mM EDTA
Then, the DNA was eluted. The elution peak fractions were collected and the DNA was recovered by ethanol precipitation.
It was dissolved in 100 μl of (pH 7.3) -1 mM EDTA and stored at 4 ° C.

Linker DNA was prepared as follows. That is, pBR322-SV40 (0.19 to 0.32)
100 μg of DNA in 120 units of PstI (NEB)
After digesting at 37 ° C for 1.5 hours, the reaction was stopped, and phenol-chloroform extraction and ethanol precipitation were performed.
DNA was collected, 140 mM sodium cacodylate, 3
0 mM Tris HCl (pH 6.8), 1 mM CoC
l ₂ , 0.1 mM DTT, 0.25 mM dGTP (1
50 μl of μCi (containing α- ³² P-dGTP) and 60 units of TTase were allowed to act for 20 minutes. As a result, a dG chain of 18 residues was added. After stopping the reaction, DN
A is collected and digested with 50 units of Hind III (Takara Shuzo),
As described above, a DNA fragment of about 0.28 kb was recovered by agarose (1.8%) electrophoresis, and 2.3 μg of linker DNA was obtained.

(3) -2) Synthesis of cDNA and preparation of cDNA library After 5 μg of RNA was dried under reduced pressure, 5 mM Tris-HCl was added.
(PH 8.3) Dissolved in 10 μl and heated at 65 ° C. for 5 minutes. Immediately transfer to 37 ° C., and add 20 μl of reaction mixture (50
mM Tris HCl (pH 8.3), 8 mM MgC
l ₂ , 30 mM KCl, 0.3 mM DTT, 2 mM
dNTP, 10 μCi α- ³² P-dCTP),
It was kept warm at 37 ° C. for 5 minutes.

After adding 10 units of RTase (reverse transcriptase, manufactured by Seikagaku Corporation) and reacting at 37 ° C. for 15 minutes, 10 units of RTase were added again, and further 1 unit was added.
Incubated for 5 minutes. 0.25 mM EDTA (p8.0)
After stopping the reaction by adding 2 μl and 1% 10% SDS, phenol-chloroform extraction was performed, 20 μl of 4M ammonium acetate and 80 μl of ethanol were added, and the mixture was frozen at −70 ° C. for 15 minutes and then thawed at room temperature, 1
It was precipitated by centrifugation at 5000 rpm for 10 minutes at 4 ° C. The precipitate was dissolved in 20 μl of 10 mM Tris HCl (pH 7.3), 19 μl of 4M ammonium acetate and 80% ethanol.
.mu.l was added for reprecipitation.

The precipitate was recovered and washed with 70% ethanol, and then 140 mM sodium cacodylate, 30 mM Tris HCl (pH 6.8), 1 mM CoCl ₂ , 0.1 m was added.
MDTT, 0.2 μg poly A and 66 μM [α- ³² P]
It was dissolved in 15 μl of dCTP (10 μCi). TTase
(PL) 18 units was added, and the mixture was reacted at 37 ° C for 5 minutes, then rapidly cooled to 0 ° C, and 0.25M EDTA 1.3 µl.
The reaction was stopped with 0.65 μl of 10% SDS and phenol-chloroform extraction and ethanol precipitation were performed.

After collecting the precipitate by centrifugation, it was digested with 4 units of Hind III (Takara Shuzo) at 37 ° C. for 2 hours, and after the reaction was stopped, it was extracted with phenol-chloroform and precipitated with ethanol. After recovering the precipitate, 10 mM Tris HCl (pH 7.
3) and 1 mM of EDTA were dissolved in 10 μl, ethanol 3 μl was added, and the mixture was stored at −20 ° C.

1 μl of the sample obtained above was added to the linker DNA5
ng with 10 mM Tris HCl (pH 7.5) -1 m
6 in 10 μl of M EDTA-0.1 M NaCl
Incubate for 2 minutes at 5 ° C, then for 30 minutes at 42 ° C, then
Cooled to ° C. 20 mM Tris HCl (pH 7.
5) 4 mM MgCl ₂ , 10 mM (NH ₄ ) ₂ SO ₄ ,
0.1 M KCl, 0.1 mM β-NAD, 50 μg
/ Ml BSA and 6 units / ml Escherichia coli DN
Add 90 μl of the mixed solution of A ligase and bring the total volume to 100
μl and stored overnight at 12 ° C.

Then, 10 mM dNTP 0.5 μ
1, 10 mM NAD 0.56 μl, Escherichia coli DNA polymerase I (manufactured by Boehringer Mannheim) 0.5 μl and RNase H (PL) 0.2 μl were added, followed by incubation at 12 ° C. and 25 ° C. for 1 hour each,
It was stored frozen at -20 ° C.

Escherichia coli HB101 strain was transformed into LB
Medium (Bacto - tryptone 10 g, Bacto - yeast extract 5g and NaCl 10 g / l) at, OD ₅₅₀ =
Incubate to 0.45, cool on ice for 5 minutes, then 8000rp at 4 ℃
The cells were collected by centrifugation at m for 5 minutes. 30 mM potassium acetate, 100 mM RbC obtained by ice-cooling a pellet of cells.
1, 10 mM CaCl ₂ , 50 mM MnCl, 15%
Suspend in glycerin, keep at 0 ° C for 5 minutes, 4 ° C, 80
Centrifuge at 00 rpm for 5 minutes, and collect the resulting cells at 10 mM.
MOPS (morpholino propane sulfonate acid), 75 mM CaCl ₂ , 10 mM RbCl, 1
The cells were resuspended in 5% glycerin and incubated at 0 ° C for 15 minutes to prepare competent cells. The competent cells thus obtained were then stored at -70 ° C.

The frozen bacterial solution was thawed at room temperature, 20 μl of the above DNA sample was added to 400 μl of the bacterial solution, and the mixture was kept for 0 minutes for 30 minutes.
After leaving it at ℃, give a heat shock at 42 ℃ for 90 seconds,
It was left still again at 0 ° C for 1 to 2 minutes. 2 ml of LB medium
, Incubate at 37 ° C for 30 minutes, inoculate into 50 volumes of LB medium, incubate at 37 ° C for 6 hours, add ampicillin to 50 μg / ml, and incubate overnight.
An NA library was created. This cDNA library was stored in 50% glycerin at -20 ° C.

(3) -3) Preparation of synthetic probe As a probe for selecting a transformant having a cDNA encoding IL-1β, a nucleotide sequence complementary to the following nucleic acid sequence (shown at the bottom) was It was synthesized by the following method.

[0104]

[Chemical 13]

That is, a solid phase phosphite triester method [Nature, 310 , 105] using an N, N-dialkylmethyl phosphoramidite derivative as a condensation unit.
(1984)], an automatic synthesizer (380A DNA
Synthesizer, Applied Biosystems Inc., Foster
(City, California 94404, USA) was used to synthesize the desired fully protected DNA. Subsequently, the completely protected DNA was treated with 28% ammonia water at 55 ° C. for 10 hours to give a protective group (A, DMTr (dimethoxytrityl) group other than the DMTr (dimethoxytrityl) group bonded to the OH group at the 5 ′ end. The acyl groups of the amino groups of G and C are deprotected to obtain a partially protected DNA (DMTr body). Then, this DMTr form was purified by reverse phase HPLC using C ₁₈ as a carrier, and then treated with 80% acetic acid at room temperature for 10 minutes to give the above D.
The MTr group is eliminated, and the resulting base is purified by 10% polyacrylamide gel electrophoresis containing 7M urea and Bio-gel P-30 (manufactured by Bio-Rad) to obtain the target DNA (60mer). Got

6 μg of the DNA obtained above was added to 50 μl of a reaction solution (50 mM Tris HCl (pH 7.6), 10 m).
M MgCl ₂ , 10 mM 2-mercaptoethanol, 0.2 mg / ml calf thymus DNA, 50 μCi [γ
- In ²¹ P] -ATP) in, T4 polynucleotide kinase (Takara Shuzo) 12 units, it reacted for 1 hour at 37 ° C.,
The 5'end of the DNA was labeled. In order to separate labeled DNA and unreacted ³² P, Biogel P-30
Column chromatography was performed by (Bio-Rad). The labeled DNA fraction was precipitated with 1/9 volume of 3M sodium acetate and 2.5 volume of ethanol, centrifuged, and recovered, then 10 mM Tris-HCl (pH 8.0) was added.
It was dissolved in 400 μl of -1 mM EDTA and stored at -20 ° C.

The specific activity of the obtained probe was 10 ⁷ cpm /
It was more than μg DNA.

(3) -4) Screening of cDNA library On a LB agar medium containing 50 μg / ml of ampicillin, a nitrocellulose filter (Millipore HAI) having a diameter of 80 mm was prepared.
F08250) and place 500 per filter on it.
The cDNA library bacterial solution diluted so as to have 0 colonies was sowed and cultured overnight at 37 ° C. A total of 24 filters were produced.

A replica filter was prepared by placing a new nitrocellulose filter on the filter where colonies appeared.

Original filter (master filter)
Was stored at 4 ° C., the replica filter was cultured on the agar medium described above for 6 hours at 37 ° C., transferred to an LB agar medium containing 200 μg / ml of chloramphenicol, and cultured overnight at 37 ° C. .

The filter was replaced with 0.5N NaOH, 1M.
Tris HCl (pH 8.0) and 1M Tris HCl (p
H8.0) -1.5M NaCl was sequentially processed, air-dried, and then baked at 80 ° C. under vacuum for 2 hours.

Baking the filter with 1.2M
NaCl, 0.12M trisodium citrate, 10m
g / ml Ficoll, 10 mg / ml polyvinylpyrrolidine, 10 mg / ml BSA, 0.1%
SDS and 0.1 mg / ml Salmon Sperum (Sal
mon Sperm) in 20 ml of DNA with gentle shaking,
It was kept warm at 68 ° C overnight. The solution is 1.2M NaCl,
0.12 M trisodium citrate, 10 mg / ml Ficoll, 10 mg / ml polyvinylpyrrolidine, 10 mg / ml BSA, 0.1% SDS and 1
The probe was replaced with a 0 ⁶ cpm / ml probe and shaken lightly at 42 ° C for one day to carry out hybridization.

The filter after hybridization was taken out, washed with 1.2 M NaCl, 0.12 M sodium citrate and 0.1% SDS three times at room temperature, and then with the same solution at 60 ° C. Back ground count of 200 cp with GM survey meter
Washed to m.

After air-drying the filter, an X-ray film (Fuji RX) was subjected to autoradiogram at -70 ° C for 2 days using an intensifying screen.

After developing the film, the colonies existing in the signal region were scraped off from the master filter, and the above method was repeated to isolate colonies having a positive signal to isolate clone I-2 having a strong signal. .

(3) -5) Analysis of clone cD of plasmid pGIF-α carried by clone I-2
A restriction enzyme map of NA was prepared.

The results are shown in FIG.

From FIG. 1, in the cDNA, there is one site each cleaved by NcoI (Nippon Gene), Hind III (Nippon Gene), PvuII (Nippon Gene) and AccI (Nippon Gene), and 5 '. From the end, it was confirmed that there were cleavage sites with the same restriction enzymes in that order. The length of the cDNA was about 1.5 kb, and it was found that IL-1 having a molecular weight of about 18 kd can be sufficiently encoded.

Next, the base sequence of the pGIF-α cDNA was determined by the Maxam-Gilbert chemical modification method and the dideoxynucleotide chain termination method using M13 phage. The result is shown in the following equation.

[0120]

Embedded image

[0121]

[Chemical 15]

[0122]

Embedded image

[0123]

[Chemical 17]

From the above figure, there is a region complementary to the synthetic probe at the 312th to 371st positions from the 5'end (underlined in the figure), and the nucleotide sequence derived from the human codon usage frequency is 75%. It showed homology.

In addition, when the longest reading frame in the cDNA of pGIF-α was searched, it was the region from the 57 ′ to the 771th region from the 5 ′ end.

The plasmid pGIF-α having the cDNA encoding the above-mentioned human IL-1 precursor protein was constructed in Escherichia coli χ1776.
The strain was held in the strain, and the strain was transferred to the Institute of Microbial Science and Technology (AIST) of the Institute of Industrial Science and Technology (Microtechnology Research Institute)
IF-α ”, and is referred to as Micro Engineering Research Article No. 948 (FER
Reference Example 2 deposited as MBP-948) Production of Polypeptide I The plasmid pGIF-α obtained in Reference Example 1 above was cleaved with restriction enzymes AccI and ClaI, and then about 1.2 kilobase pairs (kbp The DNA fragment (1) was isolated and purified by agarose gel electrophoresis. This DNA fragment was digested with DNA polymerase I (Klenow fragment) to form the restriction enzyme AccI.
And the ClaI digestion site was made a blunt end.

On the other hand, BamHI linker (5'HOCGGAT
The 5'end of CCGOH 3 ') was phosphorylated by T4 polynucleotide kinase, and this was used as the blunt end of DN.
After ligation to the A fragment using T4 DNA ligase, it was digested with restriction enzyme BamHI and further digested with restriction enzyme MspI, and the resulting reaction product was subjected to agarose gel electrophoresis.
About 540 base pairs (bp) of MspI-BamHI DNA
The fragment was isolated and purified, and then the following oligodeoxynucleotides (I) and (II) were synthesized as follows.

5'HOCGATAATGGCTCCGTGTACGTTTCTCTGAACTGC ACACTCOH 3 '(I) 5'HOCGGAGAGTGCAGTTCAGAGAACGTTACAGGAGCCATCATOH 3' (II) That is, 5'-O-dimethoxytriquene bio-deoxyaculidene and a 5'-O-dimethoxytridecane system bound to macroporous silica. As a starting material,
From 3'to 5'side using 5'-O-dimethoxytrityl and N-protected deoxymononucleoside-3'-phosphoamidite as a condensation unit, using an automatic synthesizer (380A DNA synthesizer manufactured by Applied Biosystems). The nucleotide chain was extended in sequence. Subsequent demethylation by treatment with thiofenool and 2
The nucleotide was eliminated from the silica by treatment with 8% ammonia at room temperature to obtain a completely protected oligonucleotide. All of the above operations were performed using an automatic synthesizer [Hunkapiller et al., Nature, 310 , 105 (1
984)].

Then, the completely protected oligonucleotide thus obtained was treated with 2 ml of 28% ammonia water at 55 ° C. for 10 hours to eliminate the N-protecting group to obtain a 5′-O-dimethoxytrityl oligonucleotide. Using 1/5 of this amount, 80% acetic acid 1 after purification by reverse phase high performance liquid chromatography using ODS (Yamamura Chemical Laboratory Co., Ltd.) as a carrier
Treatment with 50 μl for 20 minutes at room temperature gave the crude oligonucleotide. This was further purified by reverse phase high performance liquid chromatography using ODS as a carrier to obtain the desired oligonucleotide.

Each of the 5'ends of the synthetic oligodeoxynucleotides (I) and (II) synthesized above was phosphorylated with T4 polynucleotide kinase to obtain MspI obtained above.
-BamHI DNA fragment was ligated with T4 DNA ligase, digested with restriction enzymes BamHI and ClaI, and the resulting reaction product was subjected to agarose gel electrophoresis to give about 58
A 0 bp ClaI-BamHI DNA fragment was isolated and purified.

On the other hand, the plasmid pTMI [Nakamoto, O., Metabolism, Vol. 22, 289 (1985)] was digested with the restriction enzyme B.
About 4.4 kbp DNA containing trp promoter region by agarose gel electrophoresis after digestion with amHI and ClaI
The fragment was isolated and purified. This DNA fragment and the approximately 580 bp ClaI-BamHI DNA fragment prepared above were treated with T4D.
Ligation with NA ligase gave the desired polypeptide I expression plasmid p trp GIF-α.

The plasmid was transformed into Escherichia coli H
B101 was transformed, and the target transformant was selected by restriction enzyme analysis of plasmid DNA obtained by the boiling method [T. Maniatis, E .; F. Fritsch and J. Sambr
ook, Molecular Cloning, pp366, Cold Sprin
g Harfor Laboratory, (1982)].

The above outline is shown in FIG.

The plasmid p trp GIF-α incorporated into the above transformant was transformed into Escherichia coli χ1776, and the transformant was transformed into "Escherichia coli χ1776 / p trp GIF."
-Α "on December 12, 1985 at the Institute of Microbiology, National Institute of Advanced Industrial Science and Technology
P-949).

(2) Cultivation of transformant The above transformant (Escherichia coli HB101 / p tr
p GIF-α) with 50 μg / ml ampicillin and L
LB medium containing 20 μg / ml tryptophan (1%
Tryptone, 0.5% yeast extract and 0.5% Na C
l) Incubate in 10 ml at 37 ° C with shaking overnight,
1 of M9 minimal medium (0.6% Na ₂ HPO ₄ , 0.3% K) containing 50 μg / ml ampicillin and 1% casamino acid.
H ₂ PO ₄ , 0.05% NaCl, 0.1% NH ₄ Cl,
2 mM MgSO ₄ , 0.2% glucose and 0.1 m
M CaCl ₂ ) inoculated into 50 ml and cultured at 37 ° C. with shaking, and when the absorbance (OD) at 550 nm reached 1.0, the cells were collected, and 15% sucrose-50 mM Tris HCl (pH 8) was added. .0) -50 mM EDTA (pH
8.0) of the solution was suspended in 5 ml, and 500 mg of 10 mg / ml lysozyme [solution dissolved in 10 mM Tris-HCl (pH 8.0)] was added, and 0.3% Triton X1 was further added.
00-187.5 mM EDTA (pH 8.0) -15
5 ml of a solution of 0 mM Tris HCl (pH 8.0) was added, and the mixture was allowed to stand at room temperature for 15 minutes, further suspended, and centrifuged to obtain a supernatant of a cell extract having GIF activity.

(3) Purification of Polypeptide I Ion exchange chromatography (CM-HPLC) The supernatant of the bacterial cell extract obtained above was dialyzed against 50 mM sodium acetate buffer (pH 5.5), and then Gilson Hyper Performance. It was subjected to ion exchange chromatography (CM-HPLC) using a Liquid Chromatography system (manufactured by Gilson). The conditions are as follows. Column: IEX-535CM (6.0 x 1
50 mm, manufactured by Toyo Soda Co., Ltd. Eluent: A solution = 50 mM sodium acetate (pH 5.5, B solution = 0.5 mM NaCl-containing 50 mM sodium acetate (pH 5.5) Flow rate: 0.5
ml / min Fraction volume: Retention time 0 to 60 minutes ... 2 ml / 4 minutes / tube 60 to 120 minutes ... 0.5 ml / minute / tube 120 to 180 minutes ... 2 ml / 4 minutes / tube Reverse phase high performance liquid chromatography over the retentivity Chillon time obtained by CM-HPLC from 90 to 9
The 1 minute fraction was then subjected to reverse phase high performance liquid chromatography. The conditions are as follows.

Column: C ₄ hypopore reverse phase column (RP
304) Bio-Rad, diameter 4.6 x 250 mm Eluent: solution A = 0.1% TFA, solution B = acetonitrile: 1
% TFA (9: 1) Flow rate: 1 ml / min Chart speed: Retention time 0 to 50 minutes ... 5 minutes / cm 50 to 80 minutes ... 2 minutes / cm Fraction volume: 2 ml / 2 minutes / Cube retention time 63.9 to 65.3 minutes, GIF
Polypeptide I of interest was obtained which showed a single protein absorbance peak consistent with activity.

The obtained polypeptide I has IL-1 activity and its specific activity is 2.7 × 10 6 as GIF activity.
^{It was 7} units / mg protein.

(4) Identification of Polypeptide I SDS polyacrylamide gel electrophoresis (SDS-PA
GE) Laemmli, U .; K. Method [Nature, 277 , 680
(1970)], SDS-PAGE of the polypeptide I obtained in (3) above was performed. The conditions are as follows.

Samples: After the polypeptide I fraction in the above-mentioned reversed-phase high performance liquid chromatography was dried to dryness, a sample buffer of Laemery [containing 1/20 volume of 2-mercaptoethanol (2ME ⁺ ) or not) (2ME ⁻ )] and treated at 100 ° C. for 4 minutes.

Gel: A 15% polyacrylamide gel having a thickness of 1.5 mm was used.

Electrophoresis device: Bio-Rad (Bio-Ra
d) Protean manufactured by the company was used.

Electrophoresis conditions: Electrophoresis was performed for 2 hours at a constant current of 40 mA.

The gel after the migration was stained with Silver Stain Kit (manufactured by Bio-Rad). As a result, polypeptide I was located at about 17K under 2ME ^{+ and} about 17.K under 2ME ⁻ .
It was run as a single band at the 5K position.

Isoelectric Focusing Method (IEF) Isoelectric focusing of Polypeptide I was carried out in the pH range 3.5-3.5.
9.5 Ampholine PAG plate (made by LKB)
And Model 1415 (manufactured by Bio-Rad). The conditions are as follows.

Reagent: Polypeptide I obtained in (3) above
0.037 μg, 0.074 μg, and 0.74 μg of each of the above, and a total of 4 lanes of the following marker protein (pI marker protein) were used.

<Marker protein> Amyloglucosidase (3.50), soybean trypsin inhibitor (4.
55), β-lactoglobulin A (5.20), bovine
Carbonic anhydrase
drase) B (5.85), human carbonic anhydrase B (6.5)
5), horse myoglobin-acidic band (hors
e myoglobin-acidic band) (6.85) horse myoglobin-basic ba
nd) (7.35), lentil lectin-acidic band (8.15),
Lentillectin-mid
dle band) (8.45), lentil lectin-basic band (8.65)
And trypsinogen (9.30).

Electrode solution: Anolyte solution = 1MH ₃ PO ₄ Catholyte solution = 1M NaOH Electrophoresis conditions: Electrophoresis was performed at a constant power of 1 W / cm gel width for 90 minutes under cooling (10 ° C).

Dyeing: Dyeing was done with a Silver Stein kit.

After the electrophoresis, the gel was sliced at 1 cm intervals, extracted with shaking with 1 ml of distilled water (2 days), the pH was measured, and the isoelectric point was calculated.

As a result, the isoelectric point (p
I) was 6.8 ± 0.1 and was run as a single band at this position.

Amino acid composition ratio 30 μl of the polypeptide I fraction obtained by reverse phase high performance liquid chromatography of (3) above was added to 12 mm × 1
It was carefully placed in the bottom of a 20 mm thick hard test tube made of Pyrex and dried under reduced pressure with a desiccator containing sodium hydroxide particles. To a test tube containing a dried sample, 50 .mu.l of 4N-methanesulfonic acid [containing 0.2% 3- (2-aminoethyl) indole, manufactured by Pierce] was added, and 1 was added at 0.1 to 0.2 mmHg. After degassing for a minute, the tube was vacuum sealed. The hydrolysis was performed in a heater at 118 ° C. for 24 hours. After opening the tube, 4N-sodium hydroxide 46μ
It was neutralized with 1 and made up to 450 μl with citrate buffer for dilution.

The amino acid analysis was carried out by injecting 250 μl of the above sample solution using an amino acid analyzer (Hitachi 835-type analyzer). The separated amino acids were detected by the orthophthalaldehyde method. The quantification was performed using a calibration curve prepared with standard amino acids analyzed before and after the sample.

The results are shown in Table 1 below in terms of the molar ratio of each amino acid based on Phe (9 mol). still,
Under the above analysis conditions, Pro and Cys cannot be measured. For Ser, Thr and Met, the recovery rate under the above analysis conditions is shown in parentheses.

[0155] Table 1 A Mi Roh acid molar ratio Asp and / or Asn 17.1 Ser 10.9 (80%) Thr 5.4 (90%) Glu and / or Gln 23.8 Gly 8.3 Ala 5.0 Val 10.8 Met 5.5 (90%) Ile 4.9 Leu 15.1 Tyr 3.9 Phe (9) Lys 14.9 His 0.9 Trp 0.8 Arg 3.0 Amino Acid Sequence Above 150 μl of the polypeptide I fraction obtained by reverse phase high speed chromatography in (3) was analyzed with a protein sequencer manufactured by Applied Biosystems. The generated PTH-amino acid was added to a 33% acetonitrile aqueous solution 1
The mixture was appropriately diluted with 00 to 50 μl, and 5 μl thereof was injected using a Waters 710B type autosampler. The chromatograph system operated two Beckman 112 type pumps with a 421 type controller. The column is 2m filled with ultra air ODS-5μm.
m × 250 mm was used and the temperature was kept at 55 ° C. by a column heater. The flow rate was 0.3 ml / min, and the mixture was separated by the gradient elution method using a mixed solution of 20 mM sodium acetate and acetonitrile and monitored at 269 nm. Analysis is 45
Minutes

As a result of 20 cycles of analysis, the amino acid sequence of the N-terminal 20 amino acids of the polypeptide I obtained in (3) above was
It was recognized that:

Ala-Pro-Val-Arg-Ser-Leu-A
sn-Cys-Thr-Leu-Arg-Asp-Ser-Gln-Gln
-Lys-Ser-Leu-Val-Met- Incidentally, Ser was confirmed as one of the by-products, and further confirmed as a dehydro form showing absorption at 322 nm. Cycle 8
Then, it was presumed to be Cys from the peak of the by-product, and further confirmed to be Cys by the analysis after carboxamide methylation of the original sample.

Further, the amino acid composition of the peptide fragment obtained by digesting polypeptide I with trypsin was analyzed, and it was confirmed that the C-terminal peptide was also accurately contained without deletion.

That is, 60 μg of polypeptide I was dissolved in 600 μl of 1% ammonium hydrogencarbonate, and 20 μl of a solution of trypsin (0.2 mg / ml, Cooper) previously dissolved in 1% ammonium hydrogencarbonate was dissolved in the solution.
Was added and the mixture was allowed to stand at 37 ° C. for 24 hours to obtain a tryptic peptide. This peptide mixture was analyzed by reverse phase HPLC [C
-18,300 Angstrom, 4.6 × 150m
m; 0.1% TFA is A solution and acetonitrile containing 1/10 volume of 1% TFA is B solution, and the B solution is eluted by a program increasing 1% / 3 minutes]. All components were isolated up to 40%. These peptides were subjected to amino acid analysis. All the peptide fragments expected from this amino acid composition could be identified. Particularly, the C-terminal peptide did not contain a basic amino acid, and the result of the amino acid composition correctly contained the expected amino acid. Thus, it was confirmed that the C-terminal of the polypeptide I obtained in the above (3) was accurate as expected.

The amino acid sequences of each peptide fragment were analyzed in the same manner as above. As a result, the confirmed sequences were all in agreement with IL-1β. The confirmed peptide fragments are shown below by the amino acid number of IL-1β.

<Confirmed peptide fragment (amino acid number)> 1-4, 5-11, 12-16, 17-27, 2
8-63, 64-65, 66-74, 75-88, 89
~ 92, 95-98, 99-103, 104-109,
110-138, 139-153 From the above results, the polypeptide I obtained in (3) above was
It was confirmed to be the polypeptide I specified by the sequence defined above. The calculated value of the molecular weight of polypeptide I is 17376.59.

Example 1 Production of IL-1β Derivative of the Present Invention (1) Production of Polypeptide VI Using p trp GIF-α obtained in Reference Example 2 above, site-specific fusion protein generation (Site- Spe
cific Mutagenesis) [Proc. Nat. Acad. Sci., 8
1 , 5665-2566 (1984)],
Polypeptide VI in which Cys at position 71 from the amino terminus of IL-1β (polypeptide I) was changed to Ser was produced as follows.

That is, the M13mp11 charge vector was
Used as a single-stranded (ss) DNA template. First, an EcoRI / BamHI DNA fragment was excised from the plasmid p trp GIF-α, and M13mp11 phage (RF) was excised.
Was cloned into the restriction enzyme sites of EcoRI and BamHI, and single-stranded (ss) DNA (M13-GIF-
α) was obtained, and this was used as a template for miutagenesis.

Synthetic oligonucleotide [5'-CTGT
CCTCAGGTTG-3 ′ (primer)]
Phosphorylation by 4 polynucleotide kinase
After hybridization with 13-GIF-α DNA and annealing, DNA polymerase I was added in the presence of dNTPs.
(Klenow fragment) and T4 DNA ligase, respectively, and incubated at 15 ° C. for 18 hours.

The obtained DNA was transformed into JM105 competent cells, and the resulting colonies were inoculated on 50 agar plates and cultured at 37 ° C. for 18 hours. The filter containing the grown colonies was alkali-denatured by a usual method, dried and then baked at 80 ° C. for 2 hours. After prehybridizing this filter, this and the 5'end of the above primer were
A ³² P- Purobe labeled with ³² P-r -ATP, and hybridized at room temperature. The hybridized filter was washed with a 6 × ssc buffer for 10 minutes at room temperature and then for 10 minutes at 37 ° C., dried, and then autoradiographed at −70 ° C. for 18 hours.

Of the 5 mutated clones, M was used as a representative.
13-GIF-71s was selected, and this was infected with JM105 and cultured to prepare ssDNA and RF DNA.

The mutation of the target gene was confirmed by M13 dideoxy chain termination sequencing of the ssDNA obtained above.

In addition, in the above RF DNA, a newly created restriction enzyme DdeI site was also confirmed.

An EcoRI / BamHI fragment was prepared from RF DNA grown in JM105, and this was incorporated into an expression plasmid in the same manner as in (1) above, and the desired polypeptide VI expression plasmid (ptrp GIF-α) was prepared.
-71S) was obtained.

The plasmid was carried in Escherichia coli HB101, and the strain was designated as "Esherichi".
a coli HB101 / p trp GIF-α-71S ”under the name of Microtechnology Research Institute No. 1296 (FERM BP 129).
Deposited as 6).

Using this plasmid, Reference Example 2-
In the same manner as in (2), a bacterial cell extract supernatant was obtained and G
IF activity was measured. As a result, G per ml of culture solution
The IF activity (unit / ml culture solution) was 2.4 × 10 ⁶ using Escherichia coli HB101 as a host.

From this, the desired polypeptide VI was isolated and purified by the same means as in Reference Example 2- (3).

(2) Production of Polypeptide IV Polypeptide IV was produced using plasmid p trp GIF-α in the same manner as in (1) above.

That is, the M13mp11 charge vector was
Used as a single-stranded (ss) DNA template. First the plasmid
An EcoRI / BamHI DNA fragment was excised from p trp GIF-α and cloned into the restriction enzyme sites of EcoRI and BamHI of M13mp11 phage (RF) to obtain single-stranded (ss) DNA (M13-GIF-
α) was obtained and used as a template for mutagenesis.

Synthetic oligonucleotide [5′-CTGA
ACTGACACTCTC-3 ′ (primer)]
Phosphorylation by 4 polynucleotide kinase
After hybridizing with 13-GIF-α DNA and annealing, in the presence of dNTPs, DNA polymerase I
(Klenow fragment) and T4 DNA ligase, respectively, and incubated at 15 ° C. for 18 hours.

The obtained DNA was transformed into JM105 competent cells, and 100 colonies of the resulting colonies were inoculated on an agar plate and cultured at 37 ° C. for 18 hours. The filter containing the grown colonies was alkali-denatured by a usual method, dried and then baked at 80 ° C. for 2 hours. After the filter was prehybridized, and this one, the 5 'end of the primer, a ³² P- Purobe labeled with ³² P-r-ATP, were hybridized at room temperature. The hybridized filter was washed with a 6 × ssc buffer at room temperature for 10 minutes and then at 37 ° C. for 10 minutes, dried and then -7
Autoradiography was performed at 0 ° C. for 18 hours.

Of the 4 mutated clones, M was used as a representative.
13-GIF-8S was selected and infected with JM105 and cultured to prepare ssDNA and RF DNA.

The mutation of the desired gene was confirmed by M13 dideoxy chain termination sequencing of the ssDNA obtained above.

In addition, a newly created restriction enzyme Hinf I site was confirmed in the RF DNA.

An EcoRI / BamHI fragment was prepared from RF DNA grown in JM105, and this was incorporated into an expression plasmid in the same manner as in Reference Example 2- (1) to obtain the desired polypeptide IV expression plasmid (ptrp GI).
F-α-8S) was obtained.

Using this plasmid, Reference Example 2-
A cell extract supernatant was obtained in the same manner as in (2). The GIF activity of the supernatant was determined by using Escherichia coli HB101 as a host.
When using Escherichia coli W3110, it is 1.2 × 10 ⁵ units / ml culture solution, and when using Escherichia coli W3110.
The culture medium was 2 × 10 ⁵ units / ml.

The desired polypeptide VI was isolated and purified from the above supernatant by the same means as in Reference Example 2- (3).

(3) Production of Polypeptide V The plasmid p trp GIF-α-7 obtained in (1) and (2) above.
1S and p trp GIF-α-8S were treated with restriction enzyme E
After cutting with coRI and HindIII, p trp GIF-α-8
A DNA fragment of about 400 bp from S
Approximately 4600 bp DNA fragment was extracted from GIF-α-71S and ligated to each other,
Plasmid ptrp GIF-α-8S for expression of desired polypeptide V in which Cys at positions 8 and 71 from the N-terminal of IL-1β (polypeptide I) are both changed to Ser
71S was obtained.

Using this plasmid, Reference Example 2-
As in (2), the bacterial cell extract supernatant (Escherichia.
When using Escherichia coli HB101 as a host, the GIF activity is 1.4 × 10 ⁴ units / ml culture solution, and Escherichia coli
When E. coli W3110 is used as a host, GIF activity is 5
(× 10 ⁵ units / ml culture solution) was obtained, from which Reference Example 2-
The target polypeptide V was isolated and purified by the same means as in (3).

(4) Production of Polypeptide II 5′-GCTCCTGTTAGG was prepared in the same manner as in (1) above.
By using TTCTCTG-3 ′ as a primer, a plasmid for expressing polypeptide II, p trpGIF-
α-4G was obtained.

This plasmid was carried in Escherichia coli HB101, and the strain was designated as "Esherichi".
a coli HB101 / p trp GIF-α-4G ”under the name of Microindustry Research Institute No. 1297 (FERM BP 129
It has been deposited as 7).

Using this plasmid, Reference Example 2- (2)
Cell extract supernatant (Escherichia coli HB
101 as a host and GIF activity of 2.8 × 10 ⁵
(Unit / ml culture solution) was obtained, from which the target polypeptide II was isolated and purified by the same means as in Reference Example 2- (3).

In this purification operation, the polypeptide XXXXXVIII was obtained as a purified product by rechromatography of the first half of the main peak of CM-HPLC. The polypeptide XXXXXVIII has a CSF production promoting activity similar to that of the polypeptide II, and similarly has a characteristic that the GIF activity, LAF activity and PGE production promoting activity are all low.

(5) Production of Polypeptide III 5′-GCACTCTCCAG was prepared in the same manner as in (1) above.
By using GACTCACA-3 ′ as a primer, a plasmid p trp GI for expressing polypeptide III can be obtained.
F-α-11Q was obtained.

Using the plasmid, Reference Example 2- (2)
Cell extract supernatant (Escherichia coli HB
101 as a host and GIF activity of 2.8 × 10 ⁶
(Unit / ml culture solution) was obtained, and from this, the target polypeptide III was isolated and purified by the same means as in Reference Example 2- (3).

(6) Production of Polypeptide VII 5′-TCTTCAACTAG was prepared in the same manner as in (1) above.
By using ATAGAA-3 ′ as a primer, a plasmid p trpGIF-α for expressing the polypeptide VII is obtained.
-102 CT was obtained.

Using the plasmid, Reference Example 2- (2)
Cell extract supernatant (Escherichia coli HB
101 as a host and GIF activity of 7.4 × 10 ⁴
(Unit / ml culture solution) was obtained, from which the target polypeptide VII was isolated and purified by the same means as in Reference Example 2- (3).

(7) Production of Polypeptide VIII In the same manner as in (1) above, 5′-AAAGGCGGGCTA was prepared.
By using GGATATAA-3 'as a primer, a plasmid for expressing polypeptide VIII ptrp GI
F-α-140CT was obtained.

Using the plasmid, Reference Example 2- (2)
Similarly, using Escherichia coli W3110 as a host, a bacterial cell extract supernatant (5.8 × 10 ³ units / ml culture solution as GIF activity) was obtained. From this, Reference Example 2- (3) The target polypeptide VIII was isolated and purified by the same means as described above.

The above plasmid p trp GIF-α-
By expressing 140 CT using Escherichia coli HB101 as a host, the bacterial cell extract supernatant was similarly obtained (1.3 × 10 ⁶ units / ml culture solution as GIF activity).
Was obtained, from which Polypeptide I was isolated and purified in the same manner as above.

Incidentally, in the above, Escherichia coli H
When B 101 is used as a host, SupE acts as a nonsense suppressor, the termination codon of UAG is read as Gln (read through), and polypeptide I is expressed. On the other hand, the host is Escherichia coli W3110
In this case, since the SupE gene is not encoded, the UAG functions as a stop codon and polypeptide VIII consisting of a 140 amino acid sequence is expressed.

(8) Identification of Polypeptides I to VIII The IL-1β derivatives (polypeptides I to VIII) of the present invention obtained in (1) to (7) above are the same as in Reference Example 2- (4). Then, SDS-PAGE (18% polyacrylamide gel, 2ME ⁺ ) was performed. As a result, polypeptide I to polypeptide VII were all electrophoresed as a single band at a position of about 17.5 kd, and polypeptide VIII was electrophoresed at a position of about 16 kd as a single band.

Further, a neutralizing antiserum against the GIF activity of Polypeptide I (Polypeptide I obtained in Reference Example 2- (3))
According to the usual method, antiserum prepared by immunizing rabbits,
The same shall apply hereafter) Western blotting [Weste
rn blotting, Proc. Natl. Acad. Sci., USA, 76 ,
1420 (1979)], each of polypeptide I to polypeptide VIII was confirmed as a single band at the corresponding position.

Example 2 (1) The transformant (Escherichia coli HB101 / ptrp GIF-α) obtained in Reference Example 2- (1) was treated with ampicillin 50 μg / ml and L-tryptophan 20 μg / ml.
It was cultured overnight at 37 ° C. in 400 ml of LB medium containing 400 ml, and 400 ml of this was inoculated into 20 l of M9 minimal medium containing 1% casamino acid and cultured at 37 ° C. for 8.5 hours.

[0200] The cells were collected by centrifugation and the resulting cells were
After suspending in M Na ₂ HPO ₄ and leaving it in a cold room overnight,
2 for 10 mM Tris-HCl buffer (pH 8.0)
He dialyzed for a day.

The obtained dialysate was centrifuged (10000rp).
m, 30 minutes) to obtain a supernatant.

The above supernatant corresponding to 300 liters of E. coli culture was collected and adjusted to pH 5.0 with 100 mM acetic acid, and then SP-Zetaprep 250 Cartridge [LK].
Manufactured by Company B] and started at a flow rate of 30 ml / min for 100 minutes with 10 mM sodium acetate (pH 5.3), and then 0.1
50 mM sodium acetate containing M NaCl (pH 5.
It was eluted with 5) for 220 minutes and further with 50 mM sodium acetate (pH 5.5) containing 1 M NaCl. Each fraction was checked by HPLC, and the fraction containing the desired product, that is, 50 m containing 0.1 M NaCl
Fractions of M sodium acetate (pH 5.5) (fraction No. 8 to 10) were collected.

After adjusting the pH to 4.5 with 100 mM acetic acid, HPLC [Toyo Soda Co., Ltd., TSK gel SP-
5 PW, 5.5 × 20 cm] and eluted under the following conditions to collect fractions with a retention time (rt) of 65 to 72 minutes.

Eluent A: 50 mM sodium acetate (pH 5.5) Eluent B: 50 mM sodium acetate containing 0.5 M NaCl (pH 5.5) Flow rate: 30 ml / min Thus, a purified product of polypeptide I was obtained.

This was subjected to ultrafiltration (YM-5 membrane).
20 mM sodium phosphate buffer (pH 7.
Concentration (20 mg / ml) was performed while exchanging the buffer solution so that the solution composition of 0) was obtained.

Further, the above concentrated solution was supplied to a filtration device equipped with Positaine Filter NFZ (manufactured by Nippon Pall Ltd.) and sterilized by filtration to obtain a purified product having a pyrodiene of 100 pg / mg protein or less.

According to the above purification method, 300 l of E. coli culture solution
Thus, about 3 g of polypeptide I was obtained.

(2) HPLC of the above (1) (SP-5PW)
In the elution of (1), the first half of the main peak (rt 64 to 65 minutes) was collected and subjected to chromatography again to obtain polypeptide X.
2.7 × 10 ⁶ GIF units / mg protein.

Similarly, polypeptide XI was obtained from the latter half of the main peak (rt 72 to 76 minutes). 2.8 × 10 ⁷ GIF units / mg protein.

(3) The amino acid analysis of the polypeptides I, X and XI obtained in the above (1) and (2) was carried out according to Reference Example 2-
It carried out like (4). The results are shown in Table 2 below.

Regarding polypeptides X and XI,
The N-terminal sequences were confirmed and identified in the same manner as the amino acid sequence analysis in Reference Example 2- (4).

[0212]

Embedded image

(4) Polypeptide I has two Cys (positions 8 and 71) in the molecule. The existence state of the side chain SH group of Cys was examined by the following method.

A. 100 μm of a solution of polypeptide I obtained in Reference Example 2- (3) corresponding to about 5 nmole (50 mM sodium acetate (pH 5.5) solution containing 0.1 M NaCl)
l) was divided into three test tubes A, B, and C, and 0.1 M Tris HCl (pH 8.45) was added to each test tube.
300 μl each of a 6 M guanidine-hydrochloric acid solution containing the above was added.

Next, to test tubes A and B, 25 μl of a 6 M guanidine hydrochloric acid solution was added as a blank, and to test tube C, 25 μl of a 6 M guanidine hydrochloric acid solution containing 2 μmol of dithiothreitol as a reducing agent was added to each test. The tube was blown with nitrogen gas for 1 minute and then left at 50 ° C. for 2 hours.

Then, in the test tube A, as a blank,
25 μl of 6M guanidine hydrochloric acid solution was added to test tubes B and C, and 25 μmol of 6M guanidine hydrochloric acid solution containing 4 μmol of iodoacetamide was added to each test tube, and nitrogen gas was blown into each test tube for 1 minute. It was left for 30 minutes.

Test tubes A, B and C treated as described above
5% of 10% TFA was added to each and reverse phase HPLC
The protein was purified by (C ₃ ).

About 1/10 of the purified protein was placed in a test tube, dried and hydrolyzed with 4N-methanesulfonic acid.
The amino acid composition was investigated.

As a result, almost the same amount of carboxymethyl cysteine was detected in the test tubes B and C. From this, it can be confirmed that the polypeptide I was in the state as it was in the test tube A, whereas it was changed to the S-carboxamide methylated-polypeptide I in the test tubes B and C (the test tube B was reduced). Cys contained in Polypeptide I, since it has not been exposed to the agent), is disulfide (S-
S) It was found that the bond did not form.

Further, after drying the remaining amount (%) of the product in each of the test tubes A, B and C, 600 μl of 1% ammonium bicarbonate solution was added to each of them and dissolved to obtain 1 each.
The concentration was adjusted to μg / 5 μl. 7.5 μl of a trypsin solution was added to each of these solutions, and enzyme digestion was performed at 37 ° C. for 20 hours. Thereafter, 10 μl of 10% TFA was added to each solution to stop the enzymatic reaction, and the peptide fragments were separated by reverse phase HPLC (C ₁₈ ).

As a result, the test tubes B and C showed almost the same pattern, and the test tube A showed a different pattern.

The amino acid composition of each peptide isolated above was determined in the same manner as described above. As a result, it was confirmed from the peptide fragment in test tube A that there was a peptide that would not occur unless it contained one Cys.

From the above results, it was confirmed that the Cys residue of Polypeptide I does not form a disulfide bond either within the molecule or between the molecules.

B. Elman method [Ellman method, Arch.Bio
chem. Biophys., 82 , 70 (1959)], the SH group of polypeptide I was quantified as follows.

That is, 200 μg (11.5 μmol) of the polypeptide I obtained in Reference Example 2- (3) was added to 0.1 M Tris H containing 6 M guanidine hydrochloride and 1-mM EDTA.
It was dissolved in 1 ml of Cl buffer (pH 8.0). on the other hand,
0.05 containing fresh 0.01M DTNB [5,5'-dithiobis (2-nitrobenzoic acid)]
An M phosphate buffer solution (pH 7.0) (hereinafter referred to as "Ellman's reagent") was prepared.

6N guanidine hydrochloride and 10 m in a control cell
0.1 M Tris-HCl buffer containing M EDTA (pH
8.0 ml) and 1 ml of the above-mentioned solution containing polypeptide I were introduced into the sample cell, 40 μl of each Ellman's reagent was added to each of them and mixed, and the absorbance at 412 nm was immediately measured. After reaching the maximum absorbance, DTN
Correct the decrease in absorbance due to the decomposition of B to "0" and
As a result of determining the concentration of the group, 412 nm actually obtained
The absorbance at was 0.328.

On the other hand, the ε ₄₁₂ of 3-carboxylate-4-nitrothio-phenolate ion in an aqueous solution containing 6 M guanidine hydrochloride is 13880 M ^-1 cm ^-1 . Yes [Eur. J.
Biochem., 30 , 32 (1972)], which indicates that the SH group of the polypeptide I solution is 0.000024.
It was 5 (M / e), and it was found that 24.5 μmoles of SH groups were present in 11.5 μmoles of polypeptide I.

From the above, Cys contained in polypeptide I
Was confirmed to have a free SH group.

The polypeptide I was added to water or PBS (-).
Even when the solution was dissolved in lysate and lyophilized repeatedly 3 to 4 times, almost no change was observed in the GIF activity and the quantitative value of SH group by the Ellman's method.

(5) When a large amount of a heterologous protein is expressed in Escherichia coli or the like according to a gene recombination technique, the protein is often accumulated as an insoluble substance in E. coli cells. In this case, in order to collect the target protein from the bacterial cells, it is necessary to perform treatment under extreme conditions using a denaturing agent such as 7M guanidine hydrochloride, 8M urea or 0.1% SDS. However, according to such a treatment, the target protein, including its higher-order structure, is likely to be irreversibly damaged. Therefore, as much as possible without using the above modifiers,
The ability to isolate and extract the target protein under mild conditions is an important concern in the above gene recombination technology. Therefore, according to the method described in (1) above, the target protein can be extracted and isolated by employing a very mild condition of osmotic shock, and this method is extremely preferable in this respect. In addition, the target protein obtained according to the method retains a higher-order structure that is more natural, and is also desirable in this respect.

(6) Plasmid according to Example 1- (1)
By site-specific mutagenesis using p trp GIF-α, each polypeptide shown in Table 3 below (IL-1β derivative of the present invention) was obtained. The expression of each polypeptide, the measurement and purification of GIF activity are according to the above (1), and SDS-PAGE is shown in Reference Example 2- (4).
According to the method shown in. The same applies to each of the following examples unless otherwise specified.

[0232]

[Chemical 19]

[0233]

Embedded image

(7) The plasmid p tr obtained in Example 1- (6)
Escherichia coli W3110 was used as the host and the same expression and purification were performed using pGIF-α-102CT to obtain the polypeptide XXX which is the IL-β derivative of the present invention.
Approximately 11.4 kd (by SDS-PAGE, the same applies hereinafter).

(8) Plasmid p trp GIF-α-4G
5'-GCACTCTCC as a primer using
The plasmid p trp GIF for expressing the polypeptide XIV was prepared using AGGACTCACA-3 ′ in the same manner as in (6) above.
-Α-4G11Q was obtained. Using this plasmid, Escherichia coli HB101 as a host was similarly expressed (2.7 × 10 ⁵ GIF unit / ml culture medium) and purified to obtain polypeptide XIV which is the IL-1β derivative of the present invention. .

About 17.5 kd.

(9) Plasmid according to Example 1- (3)
p trp GIF-α-4G and p trp GIF-α-98L
Using the plasmid p trp G for expressing the polypeptide XV.
IF-α-4G98L was obtained.

That is, both of the above plasmids were treated with the restriction enzyme EcoR.
After digestion with I and HindIII, a DNA fragment of about 400 bp was obtained from p trpGIF-α-4G and p trp GI.
A DNA fragment of about 4.6 kbp was extracted from F-α-98L and ligated with each other.

Plasmid p trp GIF-α-4G98L
Was similarly expressed and purified using Escherichia coli W3110 as a host to obtain the polypeptide XV which is the IL-1β derivative of the present invention. About 17.5kd.

[10] In the above (9), the plasmid p
Plasmid p trp GI instead of trp GIF-α-4G
A plasmid p trp GIF-α-11Q98L for expressing the polypeptide XVI was similarly obtained using F-α-11Q (using a DNA fragment of about 400 bp). Similarly, using the plasmid, a polypeptide XVI which is an IL-1β derivative of the present invention was obtained. About 17.5kd.

[11] In the above (9), the plasmid p
Plasmid p trp GI instead of trp GIF-α-4G
Approximately 4 from the plasmid using F-α-4G11Q
A DNA fragment of 00 bp was used in the same manner as the plasmid p trp GIF-α-for expressing polypeptide XIII.
4G11Q98L was obtained. Similarly, using the plasmid, the polypeptide XIII which is an IL-1β derivative of the present invention was obtained. About 17.5kd.

[12] The plasmids p trp GIF-α-8A and p trp GIF-α- were prepared according to Example 1- (3).
71S was used to obtain the plasmid p trpGIF-α-8A71S for expressing the polypeptide XXXVI.

That is, both of the above plasmids were digested with the restriction enzyme EcoR.
After digestion with I and Hind III, a DNA fragment of about 400 bp was obtained from p trpGIF-α-8A and p trp GIF.
A DNA fragment of about 4.6 kbp was extracted from -α-71S and ligated with each other.

Plasmid p trp GIF-α-8A71S
Was similarly expressed using Escherichia coli HB101 as a host (8.7 × 10 ⁵ GIF unit / ml culture solution) and purified to obtain the polypeptide XXXVI which is the IL-1β derivative of the present invention. About 17.5kd.

[13] In the above [12], the plasmid p trp is replaced by the plasmid p trp instead of GIF-α-71S.
Polypeptide XX was similarly prepared using pGIF-α-71A (using a DNA fragment of about 4.6 kbp thereof).
XVII expression plasmid p trpGIF-α-8A71A
I got Escherichia coli H carrying the plasmid
B101 was sent to the Institute of Microtechnology as "Escherihia coli HB101 /
ptrp GIF-α-8A71A "has been deposited as Microindustrial Research Institute No. 1298 (FERM BP 1298). Similarly expressed using the plasmid (1.6
(× 10 ⁶ GIF unit / ml culture solution) and purified to obtain the polypeptide XXXVII which is the IL-1β derivative of the present invention. About 17.5kd.

[14] In the above [12], the plasmid p trp is replaced with the plasmid p trp instead of the GIF-α-71S.
Using pGIF-α-71V, a DNA fragment of about 4.6 kbp from the plasmid was used, and the plasmid p trp GI for expressing the polypeptide XXXVIII was similarly prepared.
F-α-8A71V was obtained. Expression (2.1 × 10 ⁶ GIF units / ml culture solution) and purification using the plasmid were carried out in the same manner, and the polypeptide X which is the IL-1β derivative of the present invention
XXVIII was obtained. About 17.5kd.

[15] Using the transformants obtained in each of Examples 1- (1) to (7) and Examples 3- (6) to (9) described below, according to the method of (1) above, Invention IL-1β derivatives Polypeptides II-VIII and XXXI-XXXIV were prepared.

All of them were run as a single band by SDS-PAGE. Polypeptides II-VIII
Is migrated to the same position as above, and the polypeptide XXX
I to XXXIV were as follows.

Polypeptide XXXI About 22 kd Polypeptide XXXII About 23 kd Polypeptide XXXIII About 27 kd Polypeptide XXXIV About 31 kd Example 3 (1) Culture of U937 cells Human lymphohistiocytoma U937 cells (Ascenso, J.L.
et al., Blood, Vol. 57, p 170 (1981)]
1.4 × 10 ⁹ pieces of 12-O-tetradecanoylphorbol-13-acetate (TPA) (manufactured by Pharmacia) 25 ng / ml, concanavalin A (ConA) (manufactured by Sigma) 10 μg / ml and 10% Fetal bovine serum (FC
S) in RPMI-1640 medium containing 4 x 10
A cell suspension having a concentration of ⁵ cells / ml was prepared.

10 ml each of this cell suspension was used to measure a diameter of 9 cm.
Of Ciale (Falcon 3003), cultivated in 5% carbon dioxide gas at 37 ° C for 3 days, the culture supernatant was removed by an aspirator, and 10% FCS, bacterial lipopolysaccharide (LPS) (Daifuco) Manufactured by Wako Pure Chemical Industries, Ltd.) 10 μg / ml, Muramil dipeptide (MDP) 1 μg / m
10 ml of RPMI-1640 medium containing 1 and 1 ng / ml of TPA was dispensed into each shearle. 5 in this medium
U937 cells were cultured at 37 ° C. for 18 hours in a% carbon dioxide gas, and U937 cells attached to the bottom of the shearle were used as a material for preparing mRNA.

(2) Preparation of mRNA RNA was extracted using guanidinium / heat phenol (guanine).
idium / hot phenol) method [Feramisco, J. R, et a
l., J. Biol. Chem., Vol. 257, p 11024.
(1982)] and the guanidinium / cesium chloride method [Glisin, V.
et al., Biochemistry, Vol. 13, p 2633 (1)
974)].

In order to wash the U937 cells cultured in (1) above, after removing the culture supernatant, 5 ml of each dish was added.
Rinse with PBS (-) solution of 4M-guanidine isothiocyanate mixed solution [4M-guanidine isothiocyanate (Fluka), 50 mM Tris-HCl (pH 7.6), 10 mM for each dish.
EDTA, 2% sodium lauroyl sarcosinate]
Was added to lyse the cells. Collect the lysate with a rubber policeman and a Pasteur pipette,
0 ml was obtained. This lysate was kept at 60 ° C and passed through an 18G injection needle to shear the chromosomal DNA,
Then add an equal amount of phenol kept at 60 ℃
The solution was further mixed with an injection needle and sheared. Then, to this mixed solution, 0.1 M sodium acetate-10 mM Tris HC was added.
1 (pH 7.4) -1 mM EDTA solution 210 ml and chloroform-isoamyl alcohol (24: 1 volume ratio)
Add 420 ml of the mixed solution, and while keeping the temperature at 60 ° C,
Stir vigorously for a minute. After cooling the mixture on ice, 3000 rpm,
After centrifugation at 4 ° C. for 20 minutes, the aqueous layer was collected. After adding 2 volumes of ethanol to the aqueous layer and leaving it at -70 ° C overnight, the crude RNA was added.
A precipitate was obtained. The crude RNA was treated with 6 M guanidine isothiocyanate-5 mM sodium citrate (pH 7.0).
-0.1 M β-mercaptoethanol-dissolved in 0.5% sodium lauroyl sarcosinate solution 48 ml,
19.2 g of cesium chloride was added and dissolved. Then, 7 ml each of this mixed solution was added to 5.7 M cesium chloride-0.1.
Overlay with 4 ml of M EDTA (pH 7.5) and use Beckman SW40Ti rotor at 25 ° C, 31500 rp.
RNA was collected by centrifugation at m 2 for 20 hours.

The amount of RNA thus obtained was 9.7 mg.

Next, in order to obtain mRNA from the RNA obtained above, oligo (dT) -cellulose (Collaborative Research, Inc.
Column chromatography. Adsorption was performed with 10 mM Tris HCl (pH 7.5) -0.
Performed with 5 M NaCl-1 mM EDTA, elution is 1
0 mM Tris HCl (pH 7.5) -1 mM EDTA
I went there.

As a result, the obtained mRNA was 400 μm.
It was g.

(3) Preparation of cDNA library The preparation of the cDNA library was performed as follows.
Can be expressed in animal cells (Oka-berg
yama-Berg) method. That is, the vector primer to which the dT chain was added used for cDNA cloning was obtained from the plasmid pCDV1 and the linker DNA to which the dG chain was added was obtained from the plasmid pL1 by the method of Okayama et al. [Okayama, H. and P. et al. Berg., Molecul
ar and Cellular Biology, Vol. 3, p 280 (19
83)].

Next, 15 μg of the mRNA obtained in (2) above was
5 mM Tris HCl (pH 7.5) -0.5 mM ED
After dissolving in 20 μl of TA (pH 7.5) aqueous solution and incubating at 65 ° C. for 5 minutes and then at 37 ° C. for 5 minutes,
The reaction solution (total volume 40 μl) was added to 50 mM Tris HCl (p
H8.3), 8 mM MgCl ₂ , 30 mM KCl,
0.3 mM dithiothreitol, 2 mM each dATP,
dGTP, dCTP and dTTP, vector primer DNA 2.8 μg, RNase inhibitor (Prome
ga Biotech) 60 units, reverse transcriptase (Bio-Rad) 40 units, 37 units
Incubate at ℃ for 1 hour, 0.5M EDTA (pH
7.5) The reaction was stopped by adding 2 μl and 2 μl of 10% SDS. Then, phenol-chloroform extraction and chloroform extraction were performed, and the vector primer cDNA: mRNA was recovered by ethanol precipitation. Recovered vector primer cDNA: mRNA
40 mM sodium cacodylate, 30 mM Tris HCl
(PH 6.8), 1 mM CaCl ₂ , 0.1 mM dithiothreitol, 0.3 μg poly (A), 66 μM d
After incubating at 37 ° C. for 5 minutes in 30 μl of a reaction solution consisting of CTP and 38 units of terminal deoxynucleotidyl transferase (manufactured by Pharmacia), 0.5 μM EDTA (pH 7.5) 1.5 μl and 10% SDS 1. The reaction was stopped by adding 5 μl, phenol / chloroform extraction and chloroform extraction were performed, and oligo dC chain-added cDN was added as an ethanol precipitate.
A: mRNA-vector primer was recovered.

This recovered nucleic acid was treated with 7 mM Tris HC.
1 (pH 7.5), 7 mM MgCl ₂ , 60 mM Na
Cl, 100 μg / ml bovine serum albumin and 12 units of a restriction enzyme Hind III (manufactured by Nippon Gene Co., Ltd.) were incubated in a reaction solution of 20 μl at 37 ° C. for 90 minutes, and then 0.5 M EDTA (pH 7.5) 1 μl and 10 The reaction was stopped by adding 1 μl of SDS. Then, phenol-chloroform extraction and chloroform extraction were performed, and the HindIII-degraded oligo dC chain-added cDNA: mRNA-vector primer was recovered as an ethanol precipitate. Add this to 10 mM Tris HCl (p
H7.5) -1 mM EDTA (pH 7.5) (TE
It was dissolved in 10 μl (pH 7.5). 1μ of this
TE (pH 7.5), 0.1M Na
Linker DNA14 with Cl and oligo dC chains added
Incubation was carried out at 65 ° C. for 2 minutes in 10 μl of a reaction solution containing ng, then at 42 ° C. for 30 minutes and then cooled to 0 ° C.

The above reaction solution was further added with 20 mM Tris HCl.
(PH 7.5), 4 mM MgCl ₂ , 10 mM (N
H ₄ ) ₂ SO ₄ , 0.1 M KCl, 50 μg / ml bovine serum albumin, 0.1 mM β-NAD (nicotinamide adenine dinucleotide, manufactured by Pharmacia), and 0.6 μg of Escherichia coli DNA ligase (Farmacia). (Manufactured by the company) was adjusted to 100 μl, and incubated at 12 ° C. overnight. To this reaction solution, each of dATP, dGTP, dCTP, and dTTP was adjusted to 40 μM, and β-NAD was added to 0.15.
Each of them was added to be mM, and 0.4 μg of Escherichia coli DNA ligase and Escherichia coli D were added.
NA polymerase I (Boehringer Mannheim)
4.6 unit and Escherichia coli RNase H
Add 1 unit (made by Pharmacia), and add 1 unit at 12 ℃.
Incubate for 1 hour at 25 ° C., then 25 ° C.

The reaction solution obtained above was used to transform Escherichia coli HB101 strain. As a competent cell of Escherichia coli HB101 strain,
Bethesda Research Laboratories
The above transformation was carried out using a product of esearch Laboratories (BRL) according to the manual of the BRL.

Thus, approximately 21,000 cDNs
A library was obtained.

(4) Transfection of monkey Cos-1 cells The cDNA library obtained in (3) above was divided into groups with an average of 70 clones per group, and plasmid DNA was prepared from each group.

The plasmid DNA was prepared by the alkaline lysis method (M
olecular Cloning-A Laboratory Manual, Cold
Spring Harbor Laboratory, 1982, p 368).
Was prepared according to.

The plasmid DNA thus prepared from each group was used to prepare Cos-1 cells of monkey culture cells [Gluzman, Y., Cell, Vol. 23, p 175 (19).
81)]. The transfection was by the DEAE-dextran method [Yok
ota, T.M. et al., Proc. Natl. Acad. Sci. USA., V
81, p 1070 (1984)]. That is, Cos-1
Cells were trypsinized to contain 10% FCS R
The cells were suspended in PMI-1640 medium and the number of cells was 1 × 10 ^6.
RPMI-16 containing 10% FCS after adjusting to
40 medium in a 6-well plate containing 2 ml / well,
500 μl of each was dispensed. After culturing overnight at 37 ° C, remove the supernatant, wash the cells with serum-free medium, and
g / ml plasmid DNA, 0.4 mg / ml DEAE
RPMI containing dextran (Pharmacia), 50 mM Tris HCl (pH 7.4) and 10% FCS
Add 1ml / well of -1640 medium for 4.5 hours 3
The cells were cultured at 7 ° C. Thereafter, the supernatant was removed, the cells were washed with a serum-free medium, 2 ml / well of RPMI-1640 medium containing 150 μM chloroquine (manufactured by Sigma) and 10% FCS was added, and the mixture was further cultured at 37 ° C. for 3 hours. .
After removing the supernatant and washing the cells with serum-free medium, 10
RPMI-1640 medium containing 3% FCS was added at 3 ml / well and cultured at 37 ° C. for 72 hours. After collecting the supernatant, the RPMI-1640 medium containing 10% FCS was added to 2 m.
1 / well was added and freeze-thawing was repeated twice to recover the cell extract. Regarding this culture supernatant and cell extract, GI
F activity was measured.

The group showing GIF activity was divided into 24 groups of 10 clones / group, the same operation as above was carried out, and the GIF activity was measured. For the group showing activity, and for each clone in the group, A clone showing GIF activity was identified by performing the same operation as in.

Thus, pcD-GIF-16 and pcD-
Two clones of GIF-207 were obtained.

The GIF activity (GIF units / ml) of these clones is shown in Table 4.

Table 4 Clone culture supernatant cell extract pcD-GIF-16 48.3 120.7 pcD-GIF-207 62.6 196.9 pcDV1 (control) 0 0 (5) Analysis of clones PcD-GIF showing a constant GIF activity in order to clarify the difference in GIF activity from both clones as a substance
-16 or pcD-GIF-207 culture supernatant and cell extract, respectively, serial dilutions of neutralizing antiserum against GIF activity of polypeptide I were added to the above supernatant and cell extract. The effect was tested.

The results are shown in FIG. 3-a (pcD-GI).
F-16 culture supernatant), Fig. 3-b (pcD-GIF).
-16 cell extract), Figure 3-c of Figure 3 (pcD-GIF).
-207 culture supernatant) and Fig. 3-d in Fig. 3 (pcD-GI).
F-207 cell extract). In each figure, the horizontal axis represents the serum dilution factor and the vertical axis represents the GIF activity (%). Further, in each figure, (1) shows anti-polypeptide I serum and (2) shows normal serum.

As shown in FIGS. 3-a and 3-b, pc
The GIF activity derived from D-GIF-16 was completely neutralized in a concentration-dependent manner by the addition of anti-polypeptide I serum, but as shown in FIGS. 3-c and 3-d, pcD- GI
GIF activity from F-207 was unaffected by anti-Polypeptide I serum. Therefore, pcD-GIF-2
The GIF activity derived from 07 is polypeptide I and pcD-
It was found to be immunologically different from the GIF activity derived from GIF-16.

In addition, the plasmids pcD-GIF-16 and
The restriction enzyme map of pcD-GIF-207 cDNA is shown in FIG.
Shown in Furthermore, the nucleotide sequence of these cDNAs was modified by a base-specific chemical modification method [Methods in Enzymology, Vol.
99 (1980)] and Phage M13 vector [Gen
e, Vol. 19, p 269 (1982)] using dideoxy chain termination [Proc. Natl. A.
cad.Sci., USA, Vol. 74, p 5463 (197)
7)].

As a result, pcD-GIF-16 has c
DNA is a translation region of IL-1β c reported by March et al.
It was confirmed that the cDNA sequence was identical to that of pcD-GIF-207, and the cDNA sequence of the translation region of IL-1α was also identical [Carl J. et al. March e
t al., Nature, Vol. 315, p 641 (198
5)].

(6) Production of Polypeptide XXXIV I close to the full length obtained in (5) above
The L-1β cDNA clone pcD-GIF-16 was digested with a restriction enzyme PvuII and further partially digested with a restriction enzyme NcoI, and a 380 bp NcoI-PvuII DNA fragment was isolated and purified by allose gel electrophoresis.

[0274] The DNA fragment was treated with mung bean nuclease to give
The sticky end generated by the restriction enzyme NcoI digestion was used as a blunt end.

Next, the synthetic oligonucleotide [5'-G
ATAATG-3 'and 5'-CATTAT-3'] are each phosphorylated at the 5'end with T4 polynucleotide kinase, and ligated to the above DNA fragment using T4 DNA ligase, and then the restriction enzymes ClaI and HindIII.
Cleave with agarose gel electrophoresis and
A ClaI-HibdIII DNA fragment <A> of bp was isolated and purified.

On the other hand, the expression plasmid p trp G obtained above was used.
IF-α was cleaved with restriction enzymes ClaI and HindIII,
The larger DNA fragment <B> was isolated and purified by agarose gel electrophoresis.

The above fragments <A> and <B> are replaced by T4.
Ligation was carried out using DNA ligase and the ligation was transformed into Escherichia coli HB101. By the boiling method, the obtained transformant plasmid DNA was extracted, and the restriction enzyme digestion map was analyzed to select the desired transformant.

The thus-isolated target transformant (Escherichia coli HB101 / p trp GIF-
α-V) was shake-cultured in 10 ml of LB medium containing 50 μg / ml L-tryptophan at 37 ° C. overnight, and 1 ml of this was inoculated into 50 ml of M9 minimal medium containing 50 μg / ml ampicillin and 1% casamino acid. The cells were cultivated with shaking at 37 ° C, and when the absorbance at 550 nm reached about 1.0, the cells were collected, and 15% sucrose-50 mM Tris H was added.
5 ml of a solution of Cl-50 mM EDTA (pH 8.0)
10 mg / ml lysozyme [10 m
Dissolved in M Tris HCl (pH 8.0)] Solution 500 μl
Was added, and 0.3% Triton X100-187.5M was added.
EDTA (pH 7.0) -150 mM Tris HCl
After adding 5 ml of a solution of (pH 8.0) and leaving it at room temperature for 15 minutes, ultrasonic treatment was performed and centrifugation was performed to obtain a bacterial cell extract supernatant.

About the obtained bacterial cell extract supernatant, GIF
When the activity was measured, it was 112 units per ml of the culture solution.

(7) Production of Polypeptide XXXII The plasmid pGIF-α obtained above was digested with the restriction enzyme NcoI.
And digested with AccI to obtain about 0.7 kb of NcoI-AccI
The DNA fragment was isolated and purified by agarose gel electrophoresis. This DNA fragment is
By treatment with polymerase I (Klenow fragment),
Both ends thereof were made blunt ends.

On the other hand, the plasmid pTM1 was digested with the restriction enzyme H
After cleaving with ind III, the cleavage site was made blunt end using DNA polymerase I (Klenow fragment).

The two DNA fragments obtained above were ligated with T4 DNA ligase, and the ligation product was transformed into Escherichia coli HB101.
Plasmid DNA was extracted from the transformants by the boiling method, and the target transformants were selected from the map cut with restriction enzymes.

The transformant thus isolated (Escherichia coli HB101 / p trp GIF-α-
III) is the Escherichia coli HB101 shown in (6) above.
After culturing in the same manner as in / ptrp GIF-α-V, a cell extract supernatant was obtained. The GIF activity of this culture supernatant was 190 units per ml of the culture solution.

(8) Production of Polypeptide XXXIII This polypeptide expression plasmid was constructed by removing unnecessary nucleotide sequence sites according to the method of site-specific mytagenesis as described in detail below.

Specifically, pGIF-α was cleaved with restriction enzymes PstI and AccI, and then a PstI-AccI DNA fragment of about 0.9 kb was isolated and purified by agarose gel electrophoresis, and both ends thereof were digested with T4 DNA polymerase. Blunt ends.

This fragment was cloned separately into plasmid p
After cleaving TM1 with the restriction enzyme HindIII, the DNA fragment prepared as a blunt end with DNA polymerase I (Klenow fragment) was ligated with T4 DNA ligase, and the ligation product was transformed into Escherichia coli HB101 to obtain the objective. Transformants were selected by restriction enzyme maps of plasmid DNA extracted by the boiling method. The DNA base sequence of the obtained plasmid was also confirmed. This plasmid is referred to as "pTM1-
I-2 ".

Then, the plasmid pTM1-I-2 was
Approximately 740b by cutting with restriction enzymes EcoRI and HindIII
The EcoRI-HindIII DNA fragment of p was isolated and purified by agarose gel electrophoresis. this,
Eco RI and Hind III of M13mp11 FUAGE (RF)
Was ligated to the restriction enzyme site of T4 using a T4 DNA ligase. From now on, single-stranded (ss) DNA (mp11-trp-I2
(E / M)) was obtained and used as a template for mudogenesis.

Synthetic oligonucleotide [5′-CACG
TAAAAAAGGGTATCGATAATGAAGTG
CTCCT-3 ′ (primer)] was phosphorylated with T4 polynucleotide kinase, and this was ss mp 11-trp
-I-2 (E / M), and after annealing, treated with DNA polymerase I (Klenow fragment) and T4 DNA ligase in the presence of dNTPs, respectively, 15
Incubated at C for 2 nights.

The obtained DNA was transformed into JM105 competent cells, and 200 colonies of the resulting colonies were inoculated on an agar plate and cultured at 37 ° C. for 18 hours. The filter containing the grown colonies was denatured with an alkali by a usual method, dried, and then baked at 80 ° C. for 2 hours. After hybridizing this filter, the 5'end of this primer and the above primer was 32P-
32 P-probe labeled with γ-ATP was hybridized at room temperature. The hybridized filter was washed with 6 × SSC buffer at room temperature for 10 minutes, then with 0.25 × SSC buffer at 60 ° C. for 5 minutes, dried, and then autoradiographed at −70 ° C. for 18 hours. It was

Of the mutated clones, mp
Select 11-trp GIF-α-IV (E / M) and
Infected with M105 and cultured, ssDNA and RF DN
A was prepared.

Deletion of the target gene was confirmed by M13 dideoxy chain termination sequencing of the ssDNA obtained above.

Also, RF DN grown in JM105
An EcoRI-HindIII DNA fragment of about 630 bp from A was isolated and purified by agarose gel electrophoresis.

On the other hand, from the plasmid pTM1-I-2,
Similarly, an about 4.2 kb EcoRI-HindIII DNA fragment was isolated and purified.
coRI-Hind III DNA fragment was added to T4DN
A ligase was used for ligation, and the ligation product was Escherichia.
E. coli HB101 was transformed.

The target transformant was selected by extracting the brasmid from the transformant according to the boiling method and analyzing the restriction enzyme map.

The transformant thus isolated (Escherichia coli HB101 / p trp GIF-α-
IV) is the Escherichia coli HB101 shown in (6) above.
/ P trp After culturing in the same manner as in the case of GIF-α-V, a bacterial cell extract supernatant was obtained. The GIF activity of this culture supernatant was 336 units per ml of the culture solution.

(9) Production of polypeptide XXXI In the same manner as in (8) above, a transformant carrying the desired polypeptide expression plasmid p trp GIF-α-II was prepared.

As the template, the single-stranded DNAmp11-
trp-I-2 (E / M) was used. As a primer, a synthetic oligonucleotide [5'-CACGTAA
AAAGGGTATCGATAATGCTGGTTCC
CT-3 '] was used.

A transformant carrying the above plasmid (Escherichia coli HB101 / p trp GIF
After culturing -α-II in the same manner, a bacterial cell extract supernatant was obtained.
The GIF activity of this culture supernatant was 112 units per ml of the culture solution.

IL-1β of the Present Invention (Polypeptide I)
The GIF activity of the derivative of the present invention and the derivative of the present invention have already been described, and the following test was additionally performed.

The LAF activity (U) per polypeptide I-converted protein amount (mg) measured by the RIA method using the above-described antiserum against polypeptide I was 5
As shown in the table.

Table 5 Polypeptide LAF activity (U / mg) Polypeptide I 4.5 × 10 ⁶ Polypeptide II 1.6 × 10 ⁵ Polypeptide III 6.2 × 10 ⁶ Polypeptide IV 2.6 × 10 ⁵ Polypeptide V 2.1 × 10 ⁵ Polypeptide VI 1.3 × 10 ⁷ Polypeptide VIII 8.0 × 10 ³ Pharmacological test Example 1: CSF production promoting effect test of Polypeptide I (1) Human lung cell CSF production Effect test CS for
As an F-producing strain, a human lung cell-derived strain HFL-1 (Human
The following tests were performed using Embroniconic lung Fibroblasts, ATCC registered cell line No. CCL-153).

[0302] First, the HFL-1 cells such that the cell concentration of 2 × 10 ⁵ cells / ml, 10% fetal bovine serum pressurized hamster 12K culture [Ham, R. G., Proc. Natl.
Acad. Sci., 53 , 288 (1965)]. Then, the polypeptide I obtained in the above-mentioned Reference Example prepared at various concentrations was added to the above-mentioned cell suspension, and the mixture was cultured at 37 ° C. for 24 hours, 48 hours, and 72 hours in a carbon dioxide incubator, and each culture was performed. The supernatant was collected, and the amount of CSF produced and accumulated in the culture supernatant was measured using mouse bone marrow cells [Lewis, I. et al. C. et al., J. Immunol, 128 , 1
68 (1982)].

The results at each culture time (hr) obtained using the polypeptide I are shown in FIG. In the figure, the horizontal axis represents the concentration of polypeptide I (GIF unit / ml), and the vertical axis represents CS.
F activity (unit / ml) is shown.

From the above results, it is clear that the addition of polypeptide I enhances the CSF production of HFL-1 cell line by several hundreds of times as compared with the case without addition of the polypeptide. .

(2) Test for promoting effect of polypeptide I on CSF production of human skin-derived cells As a human normal skin-derived cell line, CRL-1445 (AT
CC. No.) was used to perform the following tests.

[0306] The cells 2 × 10 ⁵ cells / ml 10% fetal bovine serum pressurized Dulbecco's MEM medium so that the cell concentration of [Dulbeco, R. and Freman, G., Virology,
8 , 396 (1959)]. Polypeptide I obtained in Reference Example at various concentrations was added to the above cell suspension and cultured at 37 ° C. for 24, 48 and 72 hours in a carbon dioxide incubator, and then the culture supernatant was collected to produce the CSF produced. The amount was measured in the same manner as in the above test (1) using mouse bone marrow cells.

The obtained results are shown in FIG. 6 in the same manner as in FIG.

From FIG. 6, 1 unit / ml as GIF activity
It is clear that by adding the above-mentioned polypeptide I to the fibrillogenic cells derived from normal human skin, the CSF-producing ability of the cells is remarkably promoted.

(3) Test for promoting effect on CSF production in vivo When polypeptide I was administered in vivo, C in vivo was examined.
The fact that the SF production promoting action is exerted 2 was tested by the following animal experiments.

That is, in normal mice (BALB / C mice, purchased from Shizuoka Experimental Animal Cooperative Association), various amounts of polypeptide I (10 ⁵ as GIF activity) obtained in Reference Example were obtained.
The 10 ⁵ units / individual) were intravenously administered. Blood was collected from each experimental animal at 2, 4, 8, 12 and 24 hours after the above administration, and the CSF concentration in serum was measured using mouse bone marrow cells.

The results are shown in FIG. In the figure, the horizontal axis represents the time (hr) after administration of polypeptide I at various concentrations (GIF unit / individual), and the vertical axis represents the CSF activity (unit / ml serum). In addition, (1) in the figure shows 100,000 GI of polypeptide I.
F unit / individual administration group, (2) same 10,000 GIF unit / individual administration group, (3) same 1000 GIF unit / individual administration group, and (4) control group (HSA 10 μg / individual administration group) Are shown respectively.

From FIG. 7, it was revealed that when the polypeptide I was given to the animal, the CSF concentration in the animal serum was remarkably high. That is, it was confirmed that Polypeptide I had an effect of remarkably enhancing CSF production in vivo in proportion to the injected amount. Pharmacological Test Example 2: Polypeptide I Anti-arthritic Test (1) Parson [Pearson, C. M., Proc. Soc. Exp.
Biol. Med., 91 , 95 (1956)] and Ward and Jones [Ward, JR, Jones, R. et al. S., Arthrit
is Rheumatism, 5 , 557 (1962)], and an adjuvant arthritis rat was prepared. That is, female S. D. 0.05 ml of an adjuvant in which killed Mycobacterium butyricum was suspended in flowing paraffin was injected into the ridge skin of the rat strain. Grouped based on foot swelling on day 14 (n =
6) The polypeptide I obtained in Reference Example or a solvent thereof (physiological saline; control group) was intradermally administered for 5 days from the next day. The effect on arthritis was evaluated by measuring paw volume daily.

The results are shown in FIG. In the figure, the horizontal axis represents the number of days (day) after administration of adjuvant, and the vertical axis represents the foot volume (x0.0).
1 ml) is shown. In addition, (1) in the figure is polypeptide I
100,000 GIF units / individual administration group, (2)
IF unit / individual administration group, (3) same 1000 GIF unit / individual administration group, (4) same 100 GIF unit / individual administration group, (5) control group (saline administration group), (6) shows the normal rat group, respectively.

From FIG. 8, the paw swelling in the control group (graph (5)) was exacerbated up to the 23rd day, whereas polypeptide I
In the administration groups (graphs (1) to (4)), the inhibitory effect on paw swelling was observed from the 4th day of administration (18 days after administration of Ajyuband), and 4 days after the final administration (23 days after administration of Ajyuband) It was also confirmed that the progression of arthritis can be prevented in the eye).

Pharmacological test example 3: CSF production promoting effect test of the derivative of the present invention Cell line U-373MG [ATCC HTB17, Gliob
lastoma, Astrocytoma, Human] was used to perform the following tests.

The above cells were adjusted to a cell concentration of 2 × 10 ⁵ cells / ml with 10% FCS (GIBCO), MEM.
Suspended in Eagle's MEM medium (Nissui Co.) supplemented with non-essential amino acids (Flow Co.) and MEM sodium pyruvate (Flow Co.), added the test substance to various concentrations, and carbon dioxide culture Incubation was carried out at 37 ° C. for 24 hours in the container.

Each culture supernatant was collected, and the amount of CSF produced and accumulated in the culture supernatant was measured using mouse bone marrow cells [Lewis, I. et al. C. et al., J. Immunol, 12
8 , 168 (1982)].

The results are shown in FIG. In the figure, the horizontal axis represents the concentration of the test substance (ng / ml), and the vertical axis represents the CSF activity (U
/ Ml). Also, in the figure, the curves (1) to (7) are
The results when the following polypeptides were used as test substances are shown.

Curve (1) ... Polypeptide VI curve (2) ... Polypeptide II curve (3) ... Polypeptide VIII curve (4) ... Polypeptide V curve (5) ... Polypeptide IV curve (6) ... Polypeptide III curve (7) ... Polypeptide XXX Pharmacological test example 4: Anti-inflammatory test of derivative of the present invention Method of Winter et al. [Proc. Soc. Expt
l. Biol. Med., 111 , 544-547 (196).
This test was performed according to 2)].

That is, 6 to 8 week old male rats (Spraque
Dawley strains (Charles River Laboratories Japan, Inc.) were used in groups of 6 to 8 per group based on the body weight on the day before the experiment. Carrageenin (manufactured by Marine Colloid) was used as an inflammatory agent, suspended in physiological saline so as to be 1%,
0.1 ml was subcutaneously injected into the foot pad of the right hind leg of the rat to induce paw edema. In order to evaluate paw edema, the paw volume of the right hind paw was measured at a certain time before and after the injection of the inflammatory agent using a plethysmometer (manufactured by Ugo-Vasile). The rate of volume increase after injection of the inflammatory agent with respect to the previous value was expressed as the edema rate (swelling%).

The test substance was dissolved and diluted in Dulbeco's phosphate buffered saline and injected into the dorsal skin of the rat at 0.1 ml, 1 hour before the injection of the inflammatory agent. A solvent administration group was prepared as a control group and subjected to the same experiment.

The results are shown in FIG.

In the figure, the horizontal axis represents the time (h
r), and the vertical axis represents the edema rate (%). In the figure, curve (1) represents the control group, and curve (2) represents the polypeptide VI of 0.
1 μg administration group, curve (3) is 1 μg of polypeptide VI
The administration group and the curve (4) show the administration group of polypeptide VI at 10 μg.

Pharmacological Test Example 5: Radiation Damage Prevention Action Test of Derivatives of the Present Invention BALB / c mice (9 weeks old) were exposed to a lethal dose of X-rays 20 hours before 1 μg / mouse or 0 of polypeptide VI. 0.3 μg / mouse was injected intraperitoneally. Using an X-ray irradiation device (MBR-1505R, Hitachi Medical Co.), 8
The mouse was whole-body irradiated with 50 X-rays of X-ray, and thereafter, its survival was confirmed every day. As a control, a PBS administration group was set.

The results are shown in FIG. In the figure, the horizontal axis is X
The number of days (rays) after irradiation with radiation is shown, and the vertical axis shows the survival rate (%) of the test animals. Curve (1) shows the group administered with 1 μg of polypeptide VI, and curve (2) shows the value of 0. The 3 μg administration group and the curve (3) show the control group.

From FIG. 11, in the control group, all cases died on the 18th day after X-ray irradiation, whereas the polypeptide VI
In the administration group, the radiation-damage-preventing action was observed depending on the dose, and in the 1 μg-administered group, it was confirmed that about 80% were avoided from death due to radiation injury and survived.

Pharmacological Test Example 6: Opportunistic Infection Protective Effect Test of Derivatives of the Present Invention The following tests were carried out using easily infected model mice.

Male ICR mice (6 weeks old) were used as test animals (7 mice per group), and 5-fluorouracil (5-Fu, manufactured by Kyowa Fermentation Co., Ltd.) 100 mg / kg was intravenously administered on the first day. did. On day 2, 4, and 6, 1 μg / mouse of polypeptide VI was subcutaneously administered, and on day 7,
A predetermined amount of Pseudomonas aeruginosa E-2 was intraperitoneally administered for infection. On the 10th day, the number of surviving test animals was counted to determine the survival rate (%).

The results are shown in FIGS. 12 (1) to 12 (3).

FIG. 12 (1) shows the result of the above experimental group, the same (2) shows the result of the control group not administered with polypeptide VI (only 5-Fu was administered), and the same (3) shows 5-F
The results of the control group to which neither u nor polypeptide VI was administered are shown.

In FIG. 12, the vertical axis represents the survival rate (%), and the horizontal axis represents groups A to E in which the following doses of Pseudomonas aeruginosa were adopted.

Group A: 19000 bacteria / mouse administration group B: 3800 bacteria / mouse administration group C: 750 bacteria / mouse administration group D group: 150 bacteria / mouse administration group E group: 30 bacteria / Mouse administration group F group: 6 bacteria / mouse administration group Formulation example 1 Polypeptide V with 1 × 10 ⁷ units / ml as GIF activity
Human saline albumin (HSA) in saline solution I
Was added to 0.5% and filtered (0.22 μm
After a membrane filter), 1 ml of this was aseptically dispensed into vials and freeze-dried to prepare a preparation for injection.

The thus-obtained preparation is used by dissolving it in 1 ml of distilled water for injection before use.

<Method for Producing Cytokine from Animal Cell> (1) Polypeptides XXXVII and 0.0 at Various Concentrations
In the presence of 1% PHA-P, HBS-2C5B2 cells [J. Immunol., 131 , 1682-1689 (198).
5)] was cultured in 2 × 10 ⁵ cells / well. Culture 2
The supernatant after 4 hours was collected, and its IL-2 activity was measured using IL-2-dependent mouse T cells (CTLL2) according to the method of KA Smith (J. Imm
unol., 120 , 2027 (1978))].

The results are shown in Table 6 below.

[0336] (2) U-373MG cells were added to RPMI containing 10% FCS.
Cultivated to -1640 medium until confluent and further 20 ng / m
Incubated for 18 hours in the above medium with or without 1 polypeptide XXXVII (control).

After removing the medium, RNA was extracted by the guanidinium / cesium chloride method and poly (A) ⁺ RNA (mRNA was analyzed by oligo (dT) -cellulose chromatography according to Example 3- (2) above. )
Was obtained. Northern blotting method
otting), 10 μg of the above poly (A) ⁺ RNA was subjected to agarose gel (1.2%) electrophoresis, fractionated, and transferred to a nitrocellulose filter. 80 under reduced pressure
Baking at 20 ° C., 20 mM Tris HCl (pH 8.
0) in 100 ° C. for 5 minutes, 50% formamide, 5 × ssc, 50 mM sodium phosphate (p
H6.5), 4 × Denhardt's solutio
n) and 200 μg / ml denatured salmon Sperum D
Prehybridization was performed at 42 ° C. in NA.

After 5 hours, GM-CSF cDNA [Science, 22 ] radiolabeled by nick translation was used.
8 , 810 (1985)] or PstI-NcoI DNA fragment or BSF-2 cDNA [Nature, 324 , 73 (1).
986)] and the KpnI-BamHI DNA fragment were hybridized at 42 ° C. for 20 hours. The filter was washed with 2 × ssc containing 0.1% SDS at room temperature for 15 minutes, and further with 0.1 × ssc containing 0.1% SDS at 50 ° C. for 1 hour. The autoradiogram was performed overnight at -70 ° C using an intensifying screen.

The results obtained using the GM-CSF DNA fragment are shown in FIG. Lane A shows the result using the polypeptide of the present invention, and Lane B shows the result of a control without using the polypeptide of the present invention.

The results of using the BSF-2 DNA fragment are shown in FIG. 14 according to FIG.

From the results shown above, it can be seen that the use of the polypeptide of the present invention enables efficient production of natural cytokines from animal cells.

In applying the polypeptide of the present invention to such a method, an extremely small amount, usually 10 ng / ml, is used.
The use of a degree is sufficient and also facilitates the purification process of the induced cytokines.

(3) When a cytokine is produced from animal cells, the polypeptide of the present invention used for attracting production is structurally stable under the conditions, and IL on the cell surface is
Binding to the -1 receptor is essential. That is, it is important that the polypeptide of the present invention binds to the IL-1 receptor and transmits a signal required for cytokine production into cells.

Therefore, the following test was conducted for the binding to the IL-1 receptor on fibroblasts.

Balb / 3T3 cells (clone A31: A) which were almost uniformly grown on one surface of a 6-well plate.
TCC, CCL-163, 1 × 10 ⁶ cells / well),
50 of polypeptide I (IL-1β) labeled with ¹²⁵ I
000 cpm / well and D-MEM with 10% FCS in advance
Incubated 20 ng / ml of Polypeptide I was added at 37 ° C. in the reaction mixture and reacted at 4 ° C. Remove the reaction solution with a Pasteur pipette and add D-MEM with 10% FCS.
1 ml was added and the mixture was washed gently and the supernatant was discarded. After repeating this washing operation twice, 1 ml of 1% SDS, 0.2N N
The cells were solubilized with aOH, and the radioactivity (bound radioactivity) in the solubilized solution and the solubilized solution obtained by washing the wells was measured with a γ-counter.

The above ¹²⁵ I-labeled polypeptide I was prepared by the method of Bolton and Hunter [Bi
Ochem. J., 133 , 529 (1973)] and purified (specific activity; 250 μCi / μg protein or more).

The results obtained are shown in Table 7 below.

[0348] Stopping power (%) = (A−C) / (A−B) × 100 A: radioactivity bound in the absence of unlabeled polypeptide I B: radioactivity non-specifically adsorbed on the plate C: binding Measured value of radioactivity performed This index represents the binding power of the coexisting polypeptide I to the IL-1 receptor.

From Table 7 above, polypeptide I, namely I
It was revealed that L-1β itself has a decreased binding power to the IL-1 receptor with the passage of time under the condition of cytokine induction.

Therefore, in the above, the same test was carried out using the polypeptide I, the polypeptide VI or the polypeptide XXXVII which had been pre-incubated for 24 hours.

The results are shown in Table 8 below.

[0352] From the above results, it is found that it is more preferable to employ the polypeptide of the present invention than IL-1β itself when producing cytokines from animal cells.

[0353]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 153 Sequence type: Amino acid Number of chains: 1 strand Topology: Linear Sequence type: Peptide Sequence: Ala Pro Val Arg Ser Leu Asn Cys Thr Leu Arg Asp Ser Gln Gln Lys 5 10 15 Ser Leu Val Met Ser Gly Pro Tyr Glu Leu Lys Ala Leu His Leu Gln 20 25 30 Gly Gln Asp Met Glu Gln Gln Val Val Phe Ser Met Ser Phe Val Gln 35 40 45 Gly Glu Glu Ser Asn Asp Lys Ile Pro Val Ala Leu Gly Leu Lys Glu 50 55 60 Lys Asn Leu Tyr Leu Ser Cys Val Leu Lys Asp Asp Lys Pro Thr Leu 65 70 75 80 Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys Met Glu 85 90 95 Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu Glu Phe 100 105 110 Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln Ala Glu 115 120 125 Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly Gln Asp Ile Thr 130 135 140 Asp Phe Thr Met Gln Phe Val Ser Ser 145 150 153 SEQ ID NO: 2 Sequence Length: 116 Sequence Type: Amino Acid Number of Chains: Single Chain Topology: Type of linear sequence: Peptide Sequence: Met Ala Glu Val Pro Glu Leu Ala Ser Glu Met Met Ala Tyr Tyr Ser 5 10 15 Gly Asn Glu Asp Asp Leu Phe Phe Glu Ala Asp Gly Pro Lys Gln Met 20 25 30 Lys Cys Ser Phe Gln Asp Leu Asp Leu Cys Pro Leu Asp Gly Gly Ile 35 40 45 Gln Leu Arg Ile Ser Asp His His Tyr Ser Lys Gly Phe Arg Gln Ala 50 55 60 Ala Ser Val Val Val Ala Met Asp Lys Leu Arg Lys Met Leu Val Pro 65 70 75 80 Cys Pro Gln Thr Phe Gln Glu Asn Asp Leu Ser Thr Phe Phe Pro Phe 85 90 95 Ile Phe Glu Glu Glu Pro Ile Phe Phe Asp Thr Trp Asp Asn Glu Ala 100 105 110 Tyr Val His Asp 115 116 SEQ ID NO: 3 Sequence Length: 153 Sequence Type: Amino Acid Number of Chains: Single Strand Topology: Linear Sequence Type: Peptide Sequence: Ala Pro Val Arg Ser Leu Asn Cys Thr Leu Arg Asp Ser Gln Gln Lys 5 10 15 Ser Leu Val Met Ser Gly Pro Tyr Glu Leu Lys Ala Leu His Leu Gln 20 25 30 Gly Gln Asp Met Glu Gln Gln Val Val Phe Ser Met Ser Phe Val Gln 35 40 45 Gly Glu Glu Ser Asn As p Lys Ile Pro Val Ala Leu Gly Leu Lys Glu 50 55 60 Lys Asn Leu Tyr Leu Ser Ser Val Leu Lys Asp Asp Lys Pro Thr Leu 65 70 75 80 Gln Leu Glu Ser Val Asp Pro Lys Asn Tyr Pro Lys Lys Lys Met Glu 85 90 95 Lys Arg Phe Val Phe Asn Lys Ile Glu Ile Asn Asn Lys Leu Glu Phe 100 105 110 Glu Ser Ala Gln Phe Pro Asn Trp Tyr Ile Ser Thr Ser Gln Ala Glu 115 120 125 Asn Met Pro Val Phe Leu Gly Gly Thr Lys Gly Gly Gln Asp Ile Thr 130 135 140 Asp Phe Thr Met Gln Phe Val Ser Ser 145 150 153

[Brief description of drawings]

FIG. 1 shows a restriction map of cDNA of plasmid pGIF-α.

FIG. 2 shows plasmid pGIF-α and plasmid p.
A schematic diagram for constructing a plasmid ptrpGIF-α from TMI is shown.

FIG. 3A to FIG. 3D show the plasmid pcD-GI.
F-16-derived GIF activity and plasmid pcD-GI
It is a graph which shows the influence of the anti-polypeptide I serum (neutralizing antibody) with respect to each of GIF active substances derived from F-207.

FIG. 4 shows restriction enzyme maps of cDNA of plasmid pcD-GIF-16 and plasmid pcD-GIF-207.

FIG. 5 is a graph showing the results of a test for promoting effect of polypeptide I on CSF production.

FIG. 6 is a graph showing the results of a test for promoting effect of polypeptide I on CSF production.

FIG. 7 is a graph showing the results of a test for promoting effect of polypeptide I on CSF production.

FIG. 8 is a graph showing the results of polypeptide I anti-arthritic test.

FIG. 9 is a graph showing the results of a CSF production promotion test of the IL-1β derivative of the present invention.

FIG. 10 is a graph showing the results of an anti-inflammatory test for the IL-1β derivative of the present invention.

FIG. 11 is a graph showing the results of a radiation damage prevention action test of the IL-1β derivative of the present invention.

FIG. 12 is a graph showing the results of an opportunistic infection protective effect test of the IL-1β derivative of the present invention.

FIG. 13 is a diagram showing a derivative of IL-1 of the present invention, GM-C.
It is drawing which shows the result of SF induction production effect test.

FIG. 14 shows BSF- of the IL-1β derivative of the present invention.
It is drawing which shows the result of 2 induction production effect test.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C12P 21/02 9162-4B C12N 15/00 ZNAA // A61K 38/00 ABE A61K 37/02 ABE ( (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1:91) (31) Priority claim number Japanese Patent Application No. Sho 61-200324 (32) Priority Date Sho 61 ( 1986 August 27 (33) Priority claiming Japan (JP) (72) Inventor Hidemitsu Hong 129-4 Miyanonishi, Kitahama, Senyo-cho, Naruto City Sun Lounge House No. 105 (72) Inventor Kazuyoshi Kawai Tokushima Prefecture 130-2 Masuho, Matsuho-cho, Itano-gun Character development of Mitsuho Soleil No. 503 (72) Inventor Setoko Sezuko 1090-18 Kagasuno, Kawauchi-cho, Tokushima City (72) Inventor Kiyoshi Ishii 39 Sumiyoshi Sumiyoshi, Sumiyoshi-cho, Aizumi-cho, Itano-gun, Tokushima Prefecture −46 (72) Inventor Yasuo Yanagihara Tokushima City Kawauchi-cho, Omatsu 891-6 (72) inventor Yoshikatsu Hirai Tokushima Prefecture Itano-gun, Kitajima-cho, Shinkirai Jie Furukawa 5-49

Claims (8)

[Claims] 1. The following formula (A) of interleukin-1β:
In the amino acid sequence represented by, a) 1st is Ala, 3rd Val, 4th Arg, 5th Ser, 8th Cys, 11th Arg, 30th His, 71st Cys, 93rd L
ys, 97th Lys, 98th Arg, 99th Phe, 103th L
at least one amino acid residue selected from ys, Trp at position 120, Tyr at position 121, Tyr at position 153 and Ser at position 153 is deleted or substituted with another amino acid, b) position 1 from position 9 to position Ala The amino acid sequence up to Thr or at least one amino acid residue in it has been deleted (provided that it consists of 1-position Ala, 3-position Val, 4-position Arg, 5-position Ser and 8-position Cys described in a above). Except that at least one amino acid residue selected from the group is deleted), c) an amino acid sequence from Lys at position 103 to Ser at position 153, or at least one amino acid residue therein is deleted (However, 103-position Lys, 1 described in a above)
Except that at least one of the amino acid residues selected from the group consisting of Trp at position 20, Tyr at position 121, Ser at position 153, and Ser at position 153 is deleted), d) Met or the formula (B) below at the N-terminus. The amino acid sequence from Met at the 1'position to Asp at the 116 'position or a part of the amino acid sequence at the C-terminal side thereof is added, the formula (B): A polypeptide characterized by having a modified amino acid sequence satisfying at least one of the conditions a) to d) (excluding a polypeptide in which Cys at position 71 is replaced with another amino acid). . 2. The polypeptide according to claim 1, wherein at least Arg at position 4 is modified. 3. The polypeptide according to claim 2, wherein Arg at position 4 is replaced with Gly. 4. The polypeptide according to claim 1, which has the following sequence: Embedded image 5. The polypeptide according to claim 1, wherein Cys at position 8 is modified. 6. The polypeptide according to claim 1, which has at least the amino acid at position 103 and subsequent amino acids deleted. 7. Cys at least at position 8 and Cy at position 71
The polypeptide according to claim 1, wherein s is modified. 8. The following formula (A) of interleukin-1β.
In the amino acid sequence represented by: a) 1st is Ala, 3rd Val, 4th Arg, 5th Ser, 8th Cys, 11th Arg, 30th His, 71st Cys, 93rd L
ys, 97th Lys, 98th Arg, 99th Phe, 103th L
at least one amino acid residue selected from ys, Trp at position 120, Tyr at position 121, Tyr at position 153 and Ser at position 153 is deleted or substituted with another amino acid, b) position 1 from position 9 to position Ala The amino acid sequence up to Thr or at least one amino acid residue in it has been deleted (provided that it consists of 1-position Ala, 3-position Val, 4-position Arg, 5-position Ser and 8-position Cys described in a above). Except that at least one amino acid residue selected from the group is deleted), c) an amino acid sequence from Lys at position 103 to Ser at position 153, or at least one amino acid residue therein is deleted (However, 103-position Lys, 1 described in a above)
Except that at least one of the amino acid residues selected from the group consisting of Trp at position 20, Tyr at position 121, Ser at position 153, and Ser at position 153 is deleted), d) Met or the formula (B) below at the N-terminus. That the amino acid sequence from Met at the 1'position to Asp at the 116 'position or a part of the amino acid sequence at the C-terminal side thereof is added, the formula (B): A polypeptide characterized by having a modified amino acid sequence satisfying at least one of the conditions a) to d) (excluding a polypeptide in which Cys at position 71 is replaced with another amino acid). Gene that encodes.