JPH0771495B2 - Method for protein secretion production by Escherichia coli - Google Patents

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method utilizing gene recombination technology for secretory production of a useful substance by utilizing the expression and secretion system of Bacillus subtilis in Escherichia coli. The present invention relates to a method suitable for secretory production using a replacement technique.

[0002]

2. Description of the Related Art Escherichia coli is a bacterium whose safety evaluation was first certified as a host in gene recombination experiments. It is easier to transform than other bacteria and its effect is high. Many findings have been clarified for the purpose of improving the productivity in the production of a substance, and it is considered that the bacterium has a high practicability as a host.

However, when the foreign protein gene is expressed in Escherichia coli to produce the foreign protein inside the cell or secret it out of the cell, the resulting protein is often periplasm, and therefore its purification is performed. However, the number of steps increases and the work becomes complicated.

Also, for example, J. Bacteriol., 156 , 949.
(1983), Eurr. J. Appl. Microbiol., 18 , 339 (1983)
Although a method for secreting a foreign protein from Escherichia coli has been disclosed in E. coli, etc., the amount of secretion is small, and these methods are not necessarily practical methods.

[0005]

DISCLOSURE OF THE INVENTION An object of the present invention is to provide a recombinant expression / secretion plasmid capable of highly secretory production of a foreign useful protein in Escherichia coli by utilizing the expression / secretion system of Bacillus subtilis, and Escherichia coli having the plasmid. It is intended to provide a transformant and a method for highly secretory production of a useful protein using the E. coli transformant.

[0006]

The recombinant expression / secretion plasmid of the present invention comprises a) a base sequence containing a promoter, a ribosome binding site and a region encoding a secretory signal, and b) operably linked to the base sequence. A structural gene encoding a desired protein and c) a replication origin for replication in Escherichia coli, wherein the promoter, the ribosome binding site and the region encoding the secretory signal are neutral to Bacillus amyloliquefaciens. It is characterized by being a protease gene.

As the above-mentioned base sequence a, one containing a promoter derived from the neutral protease gene of Bacillus amyloliquefaciens, a ribosome binding site (Shine-Dalcano sequence; SD sequence) and a region encoding a secretory signal is used. .

[0008] The promoter refers to a region recognized and bound by RNA polymerase, and the ribosome binding site refers to a region encoding a portion where mRNA synthesized by RNA polymerase binds to ribosome. The secretory signal refers to a polypeptide at the N-terminal portion of a precursor of a protein (mature protein) secreted outside the cell, which is produced in the cell, and is a process in which the mature protein is secreted out of the cell. It is believed to be eliminated and play an important role in the passage of mature proteins through the cell membrane.

The base sequence (a) encodes, for example, a promoter, a ribosome binding site and a secretion signal derived from the neutral protease gene of Bacillus amyloliquefaciens contained in the plasmid pNPA225 (JP-A-1-273591). A portion including a region can be used.

As the origin of replication (c) for replication in Escherichia coli, the origin of replication possessed by various Escherichia coli-derived plasmids can be used. Examples of such replication origins include pBR322 and pUC1.
3 and the like of pUC19 can be used.

The recombinant expression / secretion plasmid of the present invention comprises, for example, a plasmid having a replication origin (c) functionally linked to the above-mentioned nucleotide sequence (a) and a structural gene (b) encoding a desired protein. It can be built by incorporating. Here, functionally linking the base sequence (a) and the structural gene (b) means that the expression / secretion of the protein encoded by the structural gene (c) is the base sequence (a).
As described above, the positional relationship is selected and these are ligated to each other. For example, if necessary, an appropriate linker is interposed so that the downstream of the region encoding the secretory signal in the base sequence (a) ( This can be achieved by connecting the structural gene (b) to the 3'end side.

The plasmids incorporating the nucleotide sequence (a) and the structural gene (b) include pBR322 and pU described above.
Plasmids such as C13 and pUC19 and various plasmids derived from them can be used. Commercially available plasmids can be used as these plasmids.

As the structural gene (b), a gene encoding a protein to be secreted and produced in Escherichia coli is used. In the present invention, various proteins can be secreted and produced, and the recombinant expression / secretion plasmid of the present invention includes, for example, α1-antitrypsin, insulin-like growth factor, eglin, chicken egg white cystatin, cystatin C, cystatin. S, bovine growth hormone, human growth hormone, human pancreatic secretory trypsin inhibitor, human secretory leukocyte proteinase inhibitor, tumor necrosis factor,
It is convenient for secretory production of secretory proteins such as nerve cell growth factor in E. coli.

In the recombinant expression / secretion plasmid of the present invention, various genes such as a selectable marker gene, a terminator, a region for inducing expression, and a nucleotide sequence can be used in combination, if desired.

A transformant for secretory production of a desired protein can be obtained by transforming host Escherichia coli with the recombinant expression / secretion plasmid of the present invention having the above constitution.

The host is, for example, Escherichia coli MC106.
1 strain, HB101 strain, JM105 strain, JM109 strain, D
H5α strain and JE5505 strain can be used.

By culturing this transformant, the protein encoded by the structural gene incorporated into the recombinant expression / secretion plasmid of the transformant can be secreted and produced.

The Escherichia coli transformant into which the recombinant expression / secretion plasmid of the present invention has been introduced can be easily and satisfactorily cultivated under the same conditions as the host Escherichia coli.

Culturing of the transformant is carried out, for example, with 1 × LB.
(1% bactotryptone, 0.5% bacto yeast extract,
A liquid medium such as 0.5% NaCl) can be used, and the concentration of each component can be appropriately selected as necessary. In addition, substances such as glucose that are used for the growth and maintenance of bacterial cells, and substances that are used for screening transformants and selected with a selection marker (antibiotics, etc.) are added to the medium as necessary. can do.

The culture temperature is not particularly limited, but usually 3
7 ° C is convenient.

The protein secreted in the culture supernatant by the culture of the transformant is subjected to gel filtration, ion exchange column chromatography, high performance liquid chromatography (HP
It can be recovered with a desired degree of purification by various separation and purification methods using, for example, LC).

[0022]

【Example】

Example 1 Preparation of StuI-HindIII DNA fragment containing 22-kilodalton human growth hormone ( 22K hGH) structural gene (see FIG. 2) Known DNA nucleotide sequence encoding mature protein of hGH (hereinafter simply referred to as hGH gene)
5'end side (side encoding the N-terminus of the protein)
At the EcoRI and StuI cleavage sites, and at the 3'end side (the side encoding the C-terminal of the protein) Bam
Escherichia coli HB10 was constructed with a plasmid pHGH10 constructed by incorporating a synthetic DNA fragment provided with a HI cleavage site into a pBR322 vector digested with EcoRI and BamHI.
One strain was transformed by a conventional method to obtain a transformant, which was then transformed into 1 × LB medium (1% bactotryptone, 0.5% bacto yeast extract, 0.5% NaCl, pH 7.0, 50).
The cells were inoculated into 500 ml (containing ampicillin at a concentration of μg / ml) and cultured at 37 ° C. overnight.

The cultured cells were collected and washed, and the plasmid DNA was recovered from the cells by the alkaline method.

Next, the recovered plasmid DNA (about 20
0 xg), 10x high buffer [1M NaCl, 0.5M
Tris-Cl (pH 7.5), 0.1M MgCl
₂ , 10 mM DTT] 12 μl and restriction enzyme EcoR
7 units each of I and HindIII (both manufactured by Takara Shuzo Co., Ltd.) were added, and water was added thereto to make a total volume of 120 μl, and the mixture was reacted at 37 ° C. overnight.

After the reaction is completed, the reaction solution is made to contain 5% urea-free.
EcoRI-Hin containing the target hGH gene by polyacrylamide gel electrophoresis (PAGE)
Cut off the gel containing the dIII fragment (small fragment),
DNA recovery solution [0.5M sodium acetate, 10m
1.5 ml of M magnesium acetate, 0.1% sodium dodecyl sulfate (SDS), 1 mM disodium ethylenediaminetetraacetate (EDTA), pH 7.5] was added, and the mixture was slowly shaken and mixed overnight at room temperature, and then a DNA recovery solution was prepared. A DNA fragment was recovered from the inside using Cellulose DE-52 (manufactured by Whatman), 45 μl of water was added to the obtained recovered product, and after phenol and chloroform extraction, ethanol precipitation was carried out to obtain the target hGH gene. Including EcoR
The I-HindIII fragment was obtained as a precipitate.

Subsequently, StuI was added to 5 μl of 10 × high buffer solution.
8 units (manufactured by Takara Shuzo Co., Ltd.) and water were added to make a total volume of 50 μl, and the mixture was reacted overnight at 37 ° C. After extraction with phenol and chloroform, ethanol precipitation is performed to obtain the target StuI.
-HindIII DNA fragment was obtained.

Example 2 Preparation of vector DNA fragment (see FIGS. 1 and 2) Bacillus subtilis transformant MT430 (pNPA225) (JP-A-1-273591, FERM BP-107)
9) 500 of 2 × LB medium (2% bactotryptone, 1% bacto yeast extract, 1% NaCl, pH 7.0) supplemented with kanamycin to a final concentration of 5 μg / ml.
The cells were inoculated in ml and cultured at 30 ° C. for 20 hours with gentle shaking.

After the completion of the culture, the culture solution was stirred at 8000 rpm for 4
The cells were centrifuged at 10 ° C for 10 minutes to separate the cells from the culture supernatant, and the separated cells were separated by a conventional method [HC Brinboim and J. Poly: N
Plasmid DNA (pNPA225) was recovered according to Nucleic Acid Res., 7 , 15131 (1979)].

Next, this plasmid DNA (about 100 μm)
6 g of 10 × high buffer solution, 10 units of StuI (manufactured by Takara Shuzo), 10 units of HindIII (manufactured by Takara Shuzo) were added to g), and water was further added to bring the total volume to 60 μl, and the temperature was 37 ° C.
Allowed to react overnight. Subsequently, 10 units of microbial alkaline phosphatase (BAP, manufactured by Takara Shuzo), 1M Tr
10 μl of isCl (pH 8.0) was added, and finally water was added to make the total amount 200 μl, and the reaction was carried out at 37 ° C. for 2 hours to carry out a dephosphorylation reaction by a conventional method.

After completion of the reaction, the reaction solution was extracted with phenol and chloroform and precipitated with ethanol to obtain vector DA.
The N fragment was obtained as a precipitate. Add this to T ₁₀ E ₁ buffer [1
0 mM Tris · Cl (pH 7.5), 1 mM ED
TA] was dissolved in 1000 μl to prepare a vector DNA fragment solution, which was used in the following operation.

This vector DNA fragment corresponds to part a of pNPA225 shown in FIG. 1, and contains the promoter (Pm), ribosome binding site (SD) and secretion signal of the neutral protease gene of Bacillus amyloliquefaciens. It has a nucleotide sequence containing the coding region (I).

Example 3 Construction of plasmid pNPG5 (see FIG. 2) StuI-Hind containing the hGH gene obtained in Example 1
To the mixture obtained by adding 2 μl of the vector DNA fragment solution obtained in Example 2 to the III fragment precipitate, a DNA solution [100 mM Tris · Cl (pH 7.5), 5 mM was added.
1 μl of MgCl ₂ ], 24 μl of solution A of DNA ligation kit (Takara Shuzo, No. 6021) and 3 μl of solution B were added and reacted at 16 ° C. for 3 hours.

Next, using the obtained reaction solution, Bacillus subtilis M
The T430 strain was subjected to the protoplast method of Chang et al. [Chang,
S. and Cohen, SN: Mol. Gen. Genet., 168 , 111
(1978)]. The regeneration medium for protoplasts contained kanamycin at a final concentration of 150 μg /
It was added so as to become ml. Plasmid DNA was prepared from the obtained transformant by a conventional method.

As a result of using a part of this plasmid DNA, analysis of decomposition pattern on PAGE with various restriction enzymes and analysis of DNA sequence of DNA fragment obtained by treatment with various restriction enzymes The obtained plasmid DNA is StNP shown in FIG. 1 of pNPA225.
It was confirmed that the region between uI and HindIII was the recombinant plasmid pNPG5 in which the StuI-HindIII fragment containing the hGH gene was replaced.

Example 4 Construction of Expression Plasmid pHGE195 (see FIG. 3) About 200 μg of the plasmid DNA (recombinant plasmid pNPG5) obtained in Example 3 was added to 12 μ of 10 × high buffer solution.
1, and 7 units of AvaI (Takara Shuzo) were added, and finally water was added to adjust the total amount to 120 μl, and the reaction was carried out at 37 ° C. overnight.

Next, the obtained reaction solution has a NaCl concentration of 1
After adding a 100 mM NaCl solution to 50 mM, 6 units of SphI (manufactured by Takara Shuzo Co., Ltd.) was added and further reacted overnight.

After completion of the reaction, the reaction solution was adjusted to 5% without urea.
The gel of the band portion containing the target DNA fragment (small fragment) was cut out by PAGE and treated in the same manner as in Example 1 to obtain the promoter, ribosome binding site and secretion signal of the neutral protease gene of Bacillus amyloliquefaciens. An AvaI-SphI DNA fragment having a structure in which the StuI-HindIII fragment containing the hGH gene was ligated to the downstream (3 ′ end side) of the DNA fragment containing the base sequence containing the coding region was obtained.

On the other hand, pCU19 (Takara Shuzo) DNA about 1
00 μg was treated with AvaI and SphI in the same manner as above, followed by dephosphorylation enzyme (BAP) treatment according to a conventional method, followed by extraction with phenol and chloroform, followed by ethanol precipitation to obtain a vector DNA fragment as a precipitate. This precipitate was dissolved in 100 μl of T ₁₀ E ₁ buffer to obtain a vector DNA fragment solution.

Then, 2 of this vector DNA fragment solution
μl was mixed with the total amount of the previously obtained AvaI-SphI DNA fragment, and a ligation reaction was carried out using a DNA ligation kit in the same manner as in Example 3, and then the obtained reaction solution was directly used in E. coli JM109 competent cell ( Takara Shuzo, No. 9052) (200 μl) was added and the mixture was kept in ice water for 30 minutes.

Next, after heating this mixed solution at 45 ° C. for 45 seconds, 1 ml of 1 × LB medium was further added thereto, and the mixture was incubated at 37 ° C.
Hold for 1 hour, apply appropriate amount to several 1 × LB agar plates containing 40 μg / ml concentration of ampicillin,
It was kept at 37 ° C overnight.

Six transformants appearing on the agar plate were inoculated into 20 ml of 1 × LB medium and cultured at 37 ° C. overnight, and then plasmid DNA was prepared in the same manner as in Example 1.

Using a part of the obtained plasmid DNA,
The degradation pattern on PAGE after digestion with various restriction enzymes was analyzed. Furthermore, when a protein was obtained from the culture medium by a conventional method and analyzed by SDS-PAGE, a band matching the migration rate of the standard product was confirmed. From the above analysis results, it was confirmed that the obtained plasmid DNA was the plasmid pHGE195 having the constitution shown in FIG.

Escherichia coli JM105, HB101 and MC1061 were each transformed with the obtained pHGE195 by a conventional method to obtain three kinds of transformants.

Example 5 Cultivation of a transformant obtained by transforming Escherichia coli HB101 with the plasmid pHGE195 The Escherichia coli HB101 obtained in Example 4 was transformed with the plasmid pHGE.
Transformant HB101 (pH
The GE195) strain was inoculated into 20 ml of 1 × LB medium, and 3
The culture was carried out at 7 ° C. with shaking at 150 rpm overnight with shaking. After the completion of the culture, the culture solution was centrifuged to collect 90 μl of the culture supernatant. Trichloroacetic acid (TC
10 μl of A) (final concentration 10%) was added, and the mixture was allowed to stand at 4 ° C. for 30 minutes and then centrifuged, and the obtained precipitate was washed with a small amount of acetone and dried.

Subsequently, a part of this precipitate was added to a small amount of SD.
S-PAGE buffer (0.25M Tris.Cl, 4%
SDS, 10% mercaptoethanol, 20% glycerin, pH 6.8) was dissolved in 18% SDS-P.
As a result of analysis by AGE (manufactured by Tefco), the presence of a protein having a transfer rate identical to that of the hGH preparation was observed. When the hGH activity of the precipitate obtained earlier was measured, it was found to have the same hGH activity as the hGH standard preparation. Therefore, from these analyzes, the target h
It was confirmed that GH was secreted.

Example 6 Synthesis of Linker DNA Fragment and Its Purification Single-stranded DNA fragments L ₄₃ and L ₄₄ having the following nucleotide sequences were synthesized by a phosphoramidide method using a fully automatic synthesizer (Applied Biosystems). did. L ₄₃ 5'CCTCTTCTCCGGGCAAACCGCCGCGTTTAGTTGGCG 3 '(SEQ ID NO: 1) L ₄₄ 5'GGCCGCCAACTAAACGCGGCGGTTTGCCCGGAGAAGAGG 3' (SEQ ID NO: 2) Each single-stranded DNA fragment was purified by the following procedure.

After completion of the synthesis, the reaction product was transferred to a container, 1.5 ml of concentrated aqueous ammonia was added, and the reaction mixture was sealed and allowed to react at room temperature for 1 hour and further at 55 ° C. overnight, and then the reaction product was concentrated to dryness. . Dissolve this in water and add 7M urea containing 20% PAG
Then, the gel portion containing the target single-stranded DNA fragment is cut out by E, 1.5 ml of the DNA recovery solution is added thereto, and the mixture is slowly shaken and mixed overnight at room temperature. Then, the single-stranded DNA fragment is removed from the DNA recovery solution. Was separated and purified using Cellulose DE-52 (manufactured by Whatman).

Example 7 Preparation of double-stranded linker (see FIG. 4) 1 μ of single-stranded DNA fragments L ₄₃ and L ₄₄ obtained in Example 6
G ₄ g each, and then add 7 units of T ₄ polynucleotide kinase (Takara Shuzo) 10 mM ATP 5 μl, 10 ×
Phosphorylated solution (500 mM Tris.Cl, pH 7.
5), 100 mM MgCl ₂ , 5 mM dithiothreitol (DTT), 0.1 mM EDTA) 5 μl was added water to make the total volume 50 μl, reacted at 37 ° C. for 15 hours, and then the reaction solution was heated to 95 ° C. for 3 minutes. After slowly cooling to room temperature, the reaction mixture was concentrated to dryness to obtain a double-stranded linker (StuI-Cfrl3I DNA fragment).

Example 8 Preparation of DNA Fragment Containing Cystatin C Gene (see FIG. 4) E. coli transformant HB101 (pTPI-201) (Japanese Patent Laid-Open No. 64-74988) was treated with ampicillin at a final concentration of 4
The cells were inoculated into 20 ml of 1 × LB medium added so that the concentration became μg / ml, and cultured with shaking at 37 ° C. overnight.

Bacteria were collected from the obtained culture broth, and plasmid DNA was recovered by a conventional method.
Reaction solution (500 mM NaCl, 100 m
MTrisCl, pH 7.5, 100 mM MgCl
₂ , 10 mM DTT) 12 μl, EcoRI and H
7 units each of indIII (both manufactured by Takara Shuzo Co., Ltd.) were added, and finally water was added to make a total volume of 120 μl, and the reaction was carried out at 37 ° C. overnight.

The reaction mixture obtained was treated with urea-free 5%
The gel portion containing the desired DNA fragment was cut out by PAGE, treated in the same manner as in Example 1, and subjected to cellulose DE.
To the recovered product at -52, add 45 μl of water, add phenol,
Chloroform extraction followed by ethanol precipitation, cystatin C gene (structural gene encoding mature protein)
A DNA fragment containing

Then, 5 μl of the reaction solution having the above composition
Dissolved in water, added 7 units of Cfr3I (Takara Shuzo Co., Ltd.), and further added water to a total volume of 50 μl, reacted at 37 ° C. for 1.5 hours, and then subjected to urea-free 5% PAGE and the same treatment as described above. By carrying out Cfrl3I-HIndII containing the purified cystatin C gene of interest.
An IDNA fragment was obtained.

Example 9 Cfrl containing the Cystatin C gene, a double-stranded linker
Ligation to 3I-HIndIII DNA fragment (see FIG. 4) Cfrl3I-HIndIII containing the cystatin C gene obtained in Example 8 in the double-stranded linker obtained in Example 7.
The DNA fragments were combined and DNA solution 3 was prepared in the same manner as in Example 3.
μl, DNA ligation kit (Takara Shuzo, N
o. 6021) Add 24 μl of Solution A and 3 μl of Solution B, and add 16
The reaction was carried out at ℃ for 3 hours. After extraction with phenol and chloroform, ethanol precipitation was performed to obtain a target DNA fragment (StuI-HindIII).

Example 10 Construction of plasmid pNPC2 (see FIG. 4) To the total amount of the DNA fragment obtained in Example 9, 2 μl of the DNA fragment solution prepared in Example 2 was added, and DN was added in the same manner as in Example 3.
After ligation was performed using the A ligation kit, the Bacillus subtilis MT430 strain was transformed according to the protoplast method of Chang et al.

Kanamycin was added to the protoplast regeneration medium at a final concentration of 150 μg / ml. Plasmid DNA was prepared from the obtained transformant by a conventional method.

As a result of using a part of this plasmid DNA, analysis of decomposition pattern on PAGE with various restriction enzymes and analysis of DNA sequence of DNA fragment obtained by treatment with various restriction enzymes The obtained plasmid DNA is StNP shown in FIG. 1 of pNPA225.
It was confirmed that the region between uI and HindIII is the recombinant plasmid pNPC2 in which the DNA fragment containing the cystatin C gene was replaced.

Example 11 Construction of Expression Plasmid pCCE192 (See FIG. 5) The MT430 (pNPC2) strain obtained in Example 10 was added with kanamycin to a final concentration of 5 μg / ml.
20 mL of LB medium was inoculated and gently shaken at 30 ° C. overnight.

The cells were collected from the culture broth and the plasmid DNA (pNPC2) was recovered by a conventional method. About 200 μg thereof was added with 12 μl of 10 × high buffer solution and 7 units of AvaI (Takara Shuzo), and water was added to make the whole amount. 120 μl, 37
The reaction was carried out at 0 ° C overnight. Then, after adding 100 mM NaCl solution so that the final concentration of NaCl would be 150 mM, 6 units of SphI (Takara Shuzo) was added and reacted overnight.

The reaction mixture obtained was mixed with urea-free 5%
PAGE and treat as in Example 1 with Bacillus
An AvaI-SphI DNA fragment having a structure in which the cystatin C gene was linked to the downstream of the base sequence containing the promoter of the neutral protease gene of amyloliquefaciens, the ribosome binding site, and the region encoding the secretory signal was obtained.

On the other hand, pCU19 (Takara Shuzo) DNA about 1
00 μg was treated with AvaI and SphI in the same manner as above, followed by dephosphorylation enzyme (BAP) treatment according to a conventional method, followed by extraction with phenol and chloroform, followed by ethanol precipitation to obtain a vector DNA fragment as a precipitate. This precipitate was dissolved in 100 μl of T ₁₀ E ₁ buffer to obtain a vector DNA fragment solution.

Subsequently, 2 parts of this vector DNA fragment solution
μl was mixed with the total amount of the previously obtained AvaI-SphI DNA fragment, and a ligation reaction was carried out using a DNA ligation kit in the same manner as in Example 3, and then the obtained reaction solution was directly used in E. coli JM109 competent cell ( Takara Shuzo, No. 9052) (200 μl) was added and the mixture was kept in ice water for 30 minutes.

Next, after heating this mixed solution at 45 ° C. for 45 seconds, 1 ml of 1 × LB medium was further added thereto, and the mixture was incubated at 37 ° C.
Hold for 1 hour, apply appropriate amount to several 1 × LB agar plates containing 40 μg / ml concentration of ampicillin,
It was kept at 37 ° C overnight.

The transformant appeared on the agar plate [J
M109 (pCCE192), FERM BP-316
7] was cultured in the same manner as in Example 4 to obtain plasmid DNA.
Was prepared. Using a part of the obtained plasmid DNA,
As a result of analyzing the decomposition pattern on PAGE with various restriction enzymes and measuring the activity, the obtained plasmid D was obtained.
It was confirmed that NA was the plasmid pCCE192 having the structure shown in FIG.

Example 12 Construction of Expression Strain T10 of plasmid pCCE192 obtained in Example 11
A transformant was obtained in the same manner as in Example 11 using 2 μl of the E1 buffer solution and 200 μl of Escherichia coli JM105 competent cell (Takara Shuzo).

Furthermore, Escherichia coli HB101, MC1061
200 μl of each competent cell (both made by Takara Shuzo)
Using each of the above, a transformant was obtained by the same operation.

Example 13 Culture of E. coli transformant containing plasmid pCCE192 and purification of secreted cystatin C E. coli transformant HB101 (pCC obtained in Example 12
The E192) strain was inoculated into 20 ml of 1 × LB medium (containing ampicillin at a concentration of 50 μg / ml), and cultured at 37 ° C. overnight.

After completion of the culturing, the whole amount of the culture broth was washed with fresh 1 × LB
5 of medium (containing ampicillin at a concentration of 50 μg / ml)
It was mixed with 00 ml and further shake-cultured overnight at 37 ° C with shaking at 150 rpm, and then the culture supernatant (450 ml)
Was collected by centrifugation.

Next, ammonium sulphate was added to this culture supernatant to a final concentration of 80.
The mixture was added so as to be saturated at%, and stirred at 4 ° C. for 3 hours. The obtained precipitate was collected by centrifugation at 12000 rpm for 20 minutes, and this was collected in 50 mM Tris.Cl (pH 8.
5) Dowe dissolved in 50 ml and equilibrated with the same buffer
Apply 100 ml to the x.1-X2 column (2.8 cmφ, 5 cm) and the combined fractions passed through and washed with the same buffer.
Was obtained as a cystatin C-containing fraction.

Next, 80% of the cystatin C-containing fraction was
Ammonium sulfate was added to achieve saturation, and the mixture was stirred at 4 ° C for 3 hours. After centrifugation at 12000 rpm for 20 minutes, the precipitate is washed with water 3
Dissolve in 50 ml of 50 mM phosphate buffer solution (pH 6.8)
Sephadex G-50 column (1.4c
mφ, 82 cm) and eluted with the same buffer.

Each fraction was confirmed by SDS-PAGE and measurement of enzyme activity (see Example 14), and the desired cystatin C-containing fraction No. 34 to 37 were collected to obtain a single band target product by SDS-PAGE with a recovery rate of about 70%.

This fraction was added to a formate buffer solution (pH 2.
As a result of dialysis in 5), freeze-drying and amino acid analysis (Model 470A, Applied Biosystems), it was confirmed that this was the desired product.

Example 14 Method for measuring activity 20 μl of papain aqueous solution (manufactured by Sigma) prepared at a concentration of 6 μg / ml, 40 μl of 0.2 M cysteine aqueous solution and 50 mM phosphate buffer solution (pH 6.8) 1870
20 μl of the sample solution was added to this, reacted at room temperature for 30 minutes, and then added with 50 μl of an aqueous solution of a substrate for measuring cystatin C activity (Z-Phe-Arg-MCA Peptide Laboratories) adjusted to 20 μM and rapidly fluorescent. It was measured with a photometer (JASCO SP-770 type). EX370
nm, EM 440 nm. The amount of cystatin C was calculated from the actual measurement value, assuming that activated papain and cystatin C are bound one-to-one.

Example 15 Culture of HB101 (pCCE192) Strain in Liquid Medium Containing Glucose E. coli transformant HB101 (pCCE obtained in Example 9
192) strain 2 × LBG medium (2% bactotryptone, 1% bacto yeast extract, 1% NaCl, 0.2% glucose, ampicillin at a final concentration of 50 mg / ml) 20
The cells were inoculated in ml and cultured overnight at 37 ° C.

The culture supernatant was collected from the culture solution by centrifugation,
The sample solution was diluted with 50 mM phosphate buffer (pH 6.8) to an appropriate concentration.

As a result of measuring the activity by the method described in Example 14, it was confirmed that about 120 g / l of cystatin C in terms of activity was secreted and accumulated in this culture supernatant.

In addition, 20 ml of 2 × LBG medium at 37 ° C.
The whole amount of the culture solution obtained by overnight culture is mixed with 250 ml or 500 ml of a fresh 2 × LBG medium, and 100 rpm
After culturing with shaking under the condition (1), the activity of the obtained culture supernatant was measured, and it was confirmed that about 30 to 50 mg / l of cystatin C in terms of activity was secreted.

[0077]

INDUSTRIAL APPLICABILITY According to the present invention, a recombinant expression / secretion plasmid that enables highly secreted production of a foreign useful protein in Escherichia coli by using the expression / secretion system of Bacillus subtilis, an Escherichia coli transformant having the plasmid, and It is possible to provide a method for highly secretory production of a useful protein using an Escherichia coli transformant.

[0078]

[Sequence list]

SEQ ID NO: 1 Sequence length: 36 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence characteristics: Double-stranded linker (StuI-Cfrl3I DNA fragment) Preparative Sequence CCTCTTCTCC GGGCAAACCG CCGCGTTTAG TTGGCG 36 SEQ ID NO: 2 Sequence Length: 39 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acids Synthetic DNA Sequence Features: Two Sequence for preparation of chain linker (StuI-Cfrl3I DNA fragment) GGCCGCCAAC TAAACGCGGC GGTTTGCCCG GAGAAGAGG 39

[Brief description of drawings]

FIG. 1 shows the structure of plasmid pNPA225.

FIG. 2 is a diagram showing a construction process of a plasmid pNPG5.

FIG. 3 is a diagram showing a construction process of a plasmid pHGE195.

FIG. 4 is a diagram showing a construction process of a plasmid pNPC2.

FIG. 5 is a diagram showing a construction process of a plasmid pPCCE192.

FIG. 6 is a graph showing a chromatogram in Sephadex G-50 column chromatography for purification of cystatin C in Example 13.

[Explanation of symbols]

 Pm promoter CD Ribosome binding site I Secretory signal coding region II Binding region III α-amylase mature protein structural gene

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Office reference number FI technical display location C12R 1:19) (C12P 21/02 C12R 1:19) (72) Inventor Izumi Mita Shimobara, Chiba Prefecture 1144 Togo, Ichi, Mitsui Toatsu Chemical Co., Ltd. (72) Inventor Nobuhiro Kawashima 1144, Togo, Mobara-shi, Chiba Mitsui Toatsu Chemical Co., Ltd. (56) Reference JP-A-3-83590 (JP, A) Flat 1-273591 (JP, A)

Claims (5)

[Claims] 1. A base sequence comprising a promoter, a ribosome binding site and a region encoding a secretory signal, a structural gene encoding a desired protein operably linked to the base sequence, and for replication in Escherichia coli. A recombinant expression / secretion plasmid having a replication origin, wherein the region encoding the promoter, the ribosome binding site and the secretion signal is derived from the neutral protease gene of Bacillus amyloliquefaciens. 2. The base sequence is plasmid pNPA22.
The recombinant expression / secretion plasmid according to claim 1, which is obtained from step 5. 3. An Escherichia coli transformant obtained by transforming Escherichia coli with the recombinant expression / secretion plasmid according to claim 1. 4. The Escherichia coli transformant according to claim 3 is cultured,
A method for secretory production of a protein in Escherichia coli, which comprises a step of secreting a desired protein into a culture supernatant and a step of recovering the desired protein from the obtained culture supernatant. 5. The method for secretory production of a protein according to claim 4, wherein the Escherichia coli transformant is cultured in a liquid medium containing glucose.