JPH0770196A - Insulin-like growth factor-i - Google Patents

Abstract

PURPOSE:To obtain an insulin-like growth factor-I derived from fishes of Paralichthys of Pleuronectiformes. CONSTITUTION:An insulin-like growth factor-I derived from liver of flat fish is elucidated and the m-RNA is separated and purified and cDNA coding an amino acid sequence of the growth factor using the mRNA as a template is collected and the gene is cloned using a gene recombinant technique to manifest the gene. The insulin-like growth factor-I obtained by using the gene recombinant technique is effective in promoting growth of animals, especially fishes.

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a novel insulin-like growth factor (IGF) -I for fish, and more specifically, an insulin-like growth factor for flounder flounder.
I, gene encoding the amino acid sequence, recombinant vector incorporating the gene, transformant transformed with the recombinant vector, novel insulin-like growth of fish produced by using the transformant The present invention relates to Factor-I and a method for producing the same. The present invention also relates to a method for promoting animal growth, including a method for culturing fish using the novel insulin-like growth factor-I.

[0002]

2. Description of the Related Art At present, a large number of growth hormones and the like from fishes to mammals have been isolated, and most of them have been elucidated to have the gene structure. This is because these growth hormones have a growth-promoting effect, and in the aquaculture and livestock industries, applications such as promotion of growth of fish and livestock or increase of edible sites can be expected. Furthermore, it has been shown to be effective in treating dwarfism in humans. On the other hand, by the cells of the liver, which is one of the target organs of growth hormone,
Insulin-like growth factor-I, a protein whose expression is regulated via growth hormone receptors and the like based on growth hormone commands, is already known to exist in vertebrates including mammals such as tetrapods. ing. Insulin-like growth factor-I is mainly expressed in the liver and almost all is released into the blood, and its presence in the liver and organs other than blood is extremely small. Its physiological action is, for example, an insulin-like action such as promotion of glucose uptake and oxidation in adipose tissue and muscle. Further, as a growth-promoting factor, activation of cell turnover, promotion of DNA synthesis in fibroblasts and the like, and promotion of glucosaminoglycan synthesis in chondrocytes are observed. Further, since insulin-like growth factor-I is a factor induced by growth hormone, it may be an effective therapeutic means for dwarfism in humans, especially for patients with defective growth hormone receptors. Further, since it has an insulin-like action, it may be a therapeutic drug for various diseases caused by abnormal blood glucose level such as diabetes. In fish, various growth promotion using growth hormone is carried out in aquaculture and the like, and its effect can be indirectly confirmed by examining the expression level of insulin-like growth factor-I. Insulin-like growth factor-I
It is considered that itself can be used to promote growth and metabolic activity. However, few genes have been isolated in fish. Therefore, the present inventors obtained a new insulin-like growth factor gene-I of marine fish and, as a result of intensive research to utilize this, as a result, cloning of a gene encoding a novel insulin-like growth factor-I from the flounder liver. And succeeded in developing a method to mass-produce it. Further, they have found that the insulin-like growth factor-I obtained as described above is effective for the growth of fish.

[0003]

The present invention provides a novel insulin-like growth factor for flatfish, especially flatfish, of the order flounder.
In addition to finding I, purifying mRNA, and further obtaining a gene encoding the amino acid sequence of the growth factor, then cloning the gene using gene recombination techniques,
It has succeeded in expressing the gene.

The present invention further shows that the insulin-like growth factor-I obtained from the Japanese flounder by means of gene recombination technology exhibits good growth-promoting activity and metabolic control activity in animals, especially fish. It was confirmed and done. The insulin-like growth factor gene of the present invention can be obtained by various methods shown below. For example, a tissue or cell containing and expressing the above-mentioned insulin-like growth factor-I, for example, the liver of flounder, which is a flatfish of the order flatfish, can be used as a starting material and applied by a method known as a method for separating and purifying various mRNAs be able to.

More specifically, for example, poly (A) ⁺ mRNA is prepared from the liver of flounder, which is a flatfish of the order flatfish, which is the above-mentioned producing cell, and cDNA is prepared using this as a template.
, Which was then ligated to an appropriate vector and propagated in a host cell to synthesize an appropriate DNA probe with a primer, which was used as a probe to search a cDNA gene library for the desired insulin-like growth. A clone containing a cDNA encoding the amino acid sequence of factor-I can be selected and isolated from the vector possessed by the clone.

The amino acid composition of the insulin-like growth factor-I gene of the present invention thus obtained is as shown in SEQ ID NO: 1 in the sequence listing. As can be seen from this sequence listing, the insulin-like growth factor-I of the present invention has 6 cysteines, and the precursor has a signal peptide at the N-terminus,
It has a C-terminal prosequence and exhibits insulin-like growth factor-I-like properties known in animals.

Among the amino acid sequence molecules shown in SEQ ID NO: 1 of the sequence listing, a polypeptide containing the amino acid sequence of insulin-like growth factor-I is shown in SEQ ID NO: 3, and this amino acid sequence molecule has a methionine at its N-terminal. A polypeptide containing the added insulin-like growth factor-I amino acid sequence is shown in SEQ ID NO: 4.

[0008]

EXAMPLES The present invention will be described in detail by describing specific experimental examples below.

Example 1 Experiment 1 Preparation of flounder pituitary cDNA library 0.6 g of flounder liver was treated with 2% sodium dodecyl sulfate (S
DS), 50 mM Tris-HCl (pH 9.0), 2
5 mM ETDA, 200 mM naCl, 0.1% mercaptoethanol solution, TE (pH 9.0) saturated phenol solution, and 1/10 volume of chloroform mixture were crushed, and phenol extraction, chloroform extraction, and ethanol precipitation were performed. Was purified. Total nucleic acid obtained is 8m
It was g. Next, total RNA was selectively precipitated in 2.5M LiCl, 2M urea aqueous solution, and then total RNA was purified by ethanol precipitation. The total RNA obtained was 5.4 mg. Next, this was purified to poly (A) ⁺ mRNA by a commercially available oligotex (manufactured by TAKARA). Poly (A) ⁺ obtained from 1 mg of total RNA
The total amount of mRNA was 15 μg. Further, 3 μg of cDNA was synthesized from 5 μg of this poly (A) ⁺ RNA by reverse transcriptase, DNA polymerase and ribonuclease, and then this cDNA was incorporated into λgt10 to obtain a flounder liver cDNA library. This flounder cd
NA library is 7.5 × 10 ⁶ pfu / μgcDN
It had the efficiency of A.

Experiment. 2 Selection of Japanese flounder insulin-like growth factor-I cDNA For the selection of the growth factor cDNA from the library,
5'-GGGGATCCCAGTTTGTGTGTGG
AGAGAGAGG-3 ', and 5'-CCCTGCA
GTGGCATGTCTGTGTGGCGCTGT-
Experiment using 3 '. A cDNA fragment was amplified by the PCR method using the cDNA synthesized in 1 as a template. The thus obtained cDNA fragment was inserted into the PUC at the previously added restriction enzyme site.
After increasing the number of plasmids incorporated into 18 plasmids, the cDNA was excised and labeled with digoxigenin and used as a probe. Experimented on E. coli NM514 cultured for 16 hours after preculture overnight. After amplifying the cDNA library prepared in 1 above, the plate was infected so that 1.0 × 10 ⁵ plaques were obtained per plate, layered on an LB plate, and cultured for 16 hours. The DNA of the obtained plaque was immobilized on a nylon filter, and the plaque corresponding to the one strongly associated with the labeled probe at 68 ° C. was selected to obtain a phage having the cDNA of the growth factor.

Experiment. 3 Determination of nucleotide sequence of the glycoprotein cDNA Next, the obtained cDNA was digested with various restriction enzymes to prepare a restriction enzyme map (Fig. 1), and the entire nucleotide sequence was converted to a DNA sequencer (370A manufactured by Applied Biosystems).
/ 373A). The determined sequence is shown in SEQ ID NO: 2 in the sequence listing. In SEQ ID NO: 2, the number of bases 1-132 encodes a signal peptide, and 133-558 encodes a protein of the growth factor. The sequence of this cDNA has already been elucidated. Insulin-like growth factor-I from other animals.
Has high homology with the amino acid sequence and cDNA sequence of
It was confirmed that the CDNA encodes flounder insulin-like growth factor-I.

This nucleotide sequence has significant homology with insulin-like growth factor-I, insulin, etc. discovered in the past, and particularly in fish salmon, high homology with insulin-like growth factor-I was observed. It was Therefore, it can be inferred that the growth factor has an action similar to that of insulin-like growth factor-I.

Experiment. 4 Expression of Recombinant Protein In order to express the recombinant protein, primers for constructing an expression unit were synthesized from the findings obtained in SEQ ID NO: 1 and SEQ ID NO: 2. A synthetic DNA corresponding to the 1st to 8th amino acid sequences from the N-terminus of the mature form of the growth factor, to which a restriction enzyme site and a start codon have been added, that is, 5 '
-GGGAATTCATGGGGACCGGAGACCC
TGTGCGGGGGC-3 'or a synthetic DNA corresponding to the 1st-10th amino acid sequence with a restriction enzyme site and a start codon added to form an AT-rich sequence according to the frequency of use of the codon, that is, 5'-GGGAATTCAT.
GGGACCAGAAAACATTGTGCGGAGCT
GAACTG-3 ', and synthetic DN corresponding to the amino acid sequences 61-68 from the N-terminal of the mature form in a complementary manner
A with a complementary sequence added to the restriction enzyme site and stop codon, that is, 5'-GGGAATTCCTAAGCTG
Using CCTTGCTAGTCTTGGCAC-3 ',
Experiment. The expression unit was amplified using the cDNA obtained in 2 as a template. The cDNA fragment thus obtained was added to the expression vector pKP15 at the restriction enzyme site to which it was added in advance.
00 (an improved version of pKK223-3, the main improvement being the origin of replication exchanged from pBR origin to pUC9 origin) (Fig. 2) and transformed into E. coli JM109 strain to obtain an expression strain. After culturing the cells overnight with shaking, the cells were collected and solubilized, and then a band that appeared to be insulin-like growth factor-I was identified by SDS-polyacrylamide gel electrophoresis, and its expression was confirmed.

Experiment. 5 Large scale preparation experiment of recombinant protein. 50 ml of 2YT medium (1.6% bactotryptone, 1.0% yeast extract, 0.5% NaC).
1, 45 ppm ampicillin, pH 7.6) and then precultured (23 ° C., 16 hours), and then cultured in a similar 2YT medium 201 for 16 hours with a fermenter (Maruhishi Bioengine, MSJ-U3-301). did. 2 to 3 hours after the start of culture, expression was induced by IPTG. Continuous fungus body (Tomy Seiko Co., Ltd., centrifuge CX-
250, rotor no. 16 N) and the resulting cells were 500 ml of 20 mM Tris-HCl, 50 m
Suspended in M NaCl, pH 7.5, and homogenized (15MR-8TA, manufactured by APV GAURIN, 8,
Crushed 3 times at 000 psi). Next, this suspension was centrifuged at 16,000 g for 10 minutes at 4 ° C. with a centrifuge (Tomy Seiko Co., Ltd.), and the precipitate was suspended in 200 ml of distilled water and then centrifuged again under the above conditions to precipitate the precipitate. Obtained. This precipitate was added to 100 ml of 20 mM Tris-HCl, 5 mM.
Suspended in EDTA, 0.02% lysozyme, pH 8.0 and added 25 ml of 10% deoxycholic acid, 23 ° C, 1
Stir for hours. Next, this solution was centrifuged at 16,000 g for 10 minutes at 4 ° C., the precipitate was suspended in 90 ml of distilled water and then centrifuged again under the above conditions to obtain an inclusion body as a precipitate.
400 ml of 6 M guanidine hydrochloride per 1 g of inclusion body,
Suspend in 50 mM Tris-HCl, pH 8.0,
Solubilized at room temperature for 0 hours. Guanidine hydrochloride was removed from the solution by dialysis. For dialysis, a 10-fold volume of external dialysis solution (0.
25% sodium bicarbonate, 0.2% α-lactose,
0.2% mannitol, pH 5.0) was used for 4 days, and the external solution was replaced every other day. The desalted extract solution was concentrated by freeze-drying, which was then added to Wakosil 5C18.
It was purified by reverse phase HPLC using a column (manufactured by Wako Pure Chemical Industries, Ltd.). HPLC elution conditions were 0.1% trifluoroacetic acid, acetonitrile 20-60% linear concentration gradient, column temperature 40 ° C, flow rate 1 ml / min, protein content was measured by absorbance at 220 nm, and flounder insulin-like growth factor was fractionated, Lyophilized to obtain 20 mg of regenerated recombinant flounder insulin-like growth factor-I.

Experiment. 9 Measurement of physiological activity Individual identification of 10 group 1 flounder 1 group 4 months old (10-15 g) after townization, and recombination into the respective abdominal cavity of the relevant growth factor,
For comparison, physiological saline was administered every 4 days at 0.01 μg and 0.1 μg per fish weight. Rearing was carried out at 20 ° C., and a feed of 1.5% of the body weight of flounder juveniles was fed twice a day in the morning and in the evening. The weight gain rate on the 35th day from the first administration is shown below. As is clear from the results below, the growth factor of the present invention was found to be effective in promoting the growth of fish such as flounder.

[Sequence list]

[Brief description of drawings]

FIG. 1 is a cDNA obtained by digesting cDNA with various restriction enzymes.
The restriction enzyme map of is shown.

FIG. 2 schematically shows a method for constructing a vector for expressing a DNA encoding the amino acid sequence of flounder insulin-like growth factor-I.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C12N 1/21 7236-4B 15/09 ZNA C12P 21/02 H 9282-4B // (C12N 1 / 21 C12R 1:19) (C12P 21/02 C12R 1:19)

Claims (21)

[Claims] 1. Insulin-like growth factor-I of flounder flounder. 2. The insulin-like growth factor-I according to claim 1, which has the amino acid sequence and the cDNA sequence shown in SEQ ID NOS: 1 and 2. 3. Insulin-like growth factor-I according to claim 1, which is a polypeptide obtained by a gene recombination method and containing the amino acid sequence shown in SEQ ID NO: 1 in the molecule. 4. The insulin-like growth factor-I according to claim 1, which is a polypeptide having the amino acid sequence shown in SEQ ID NO: I. 5. The insulin-like growth factor-I according to claim 1, which is a polypeptide containing the amino acid sequence of SEQ ID NO: 3 among the amino acid sequence molecules shown in SEQ ID NO: 1. 6. Insulin-like growth factor-I according to claim 1, which is a polypeptide comprising the amino acid sequence of SEQ ID NO: 3 and having the amino acid sequence of SEQ ID NO: 4 with methionine added to its N-terminal. 7. The gene shown in SEQ ID NO: 2 which encodes the amino acid sequence of insulin-like growth factor-I according to claim 1, which is derived from a flatfish of the order flounder. 8. The gene according to claim 7, which is a DNA encoding an amino acid sequence of polypeptide containing the amino acid sequence shown in SEQ ID NO: 3. 9. The gene according to claim 7, which is a DNA encoding the amino acid sequence of a polypeptide containing the amino acid sequence shown in SEQ ID NO: 4. 10. The method according to claim 7, which encodes the amino acid sequence of insulin-like growth factor-I derived from the flounder flounder.
A recombinant vector incorporating the described gene. 11. The recombinant vector according to claim 10, which incorporates the gene according to claim 8 or 9. 12. A transformant comprising a recombinant vector incorporating a gene encoding an amino acid sequence of insulin-like growth factor-I derived from flatfish of the order flounder. 13. The transformant according to claim 12, wherein the transformant contains the recombinant vector according to claim 11. 14. The transformant is a microorganism.
2 or the transformant according to claim 13. 15. The transformant according to claim 14, wherein the transformant belongs to Escherichia coli. 16. A flatfish flounder produced by proliferating a transformant transformed with a recombinant vector incorporating a gene encoding an amino acid sequence of insulin-like growth factor-I derived from a flatfish flounder family. Insulin-like growth factor-I derived from fish, which is characterized by collecting insulin-like growth factor-I derived from fish
Manufacturing method. 17. The growth factor-I according to any one of claims 2, 3, 4, 6 and 8 which is an insulin-like growth factor-I of the flounder flounder. A method for promoting animal growth, which comprises administering to the animal to promote animal growth. 18. The method of claim 17, wherein the protein is vertebrate insulin-like growth factor-I. 19. The method of claim 17, wherein said protein is mammalian insulin-like growth factor-I. 20. Insulin-like growth factor-I of the flounder flounder fish, wherein the growth factor according to any one of claims 2, 3, 4, 6 and 8 is administered to fish. A method for breeding fish, which comprises controlling the growth of fish. 21. An animal feed containing the insulin-like growth factor-I of flatfish flounder.